Gene-deleted variant strain of porcine pseudorabies virus, vaccine composition, method of making the same and use thereof
10548972 ยท 2020-02-04
Assignee
Inventors
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2710/16721
CHEMISTRY; METALLURGY
A61K45/06
HUMAN NECESSITIES
C12N2710/16734
CHEMISTRY; METALLURGY
C12N7/04
CHEMISTRY; METALLURGY
C12N2710/16634
CHEMISTRY; METALLURGY
International classification
C12N7/00
CHEMISTRY; METALLURGY
C12N7/04
CHEMISTRY; METALLURGY
A61K39/00
HUMAN NECESSITIES
Abstract
The present invention provides an attenuated strain of porcine pseudorabies virus (PRV), in which said attenuated strain of PRV is a variant strain of PRV with inactivation of gI/gE/11K/28K proteins. In addition, the present invention also provides a vaccine composition comprising the attenuated strain of PRV as an antigen, a preparation method and use thereof. Proved by immunogenicity and pathogenicity testing of the live vaccine, said live PRV vaccine can provide a good protection for pigs with no clinical signs observed, indicating excellent immune protection.
Claims
1. An attenuated strain of porcine pseudorabies virus comprising: a first attenuated porcine pseudorabies virus strain, wherein the first attenuated porcine pseudorabies virus strain comprises a porcine pseudorabies virus strain characterized by inactivation of gI/gE/11K/28K protein, wherein the first attenuated porcine pseudorabies virus strain is a variant strain of pseudorabies virus, wherein the gE protein has 95% or greater homology with SEQ ID NO: 5, and wherein the first attenuated strain of porcine pseudorabies virus strain comprises a gene variation resulting in inactivation of TK protein, wherein at least a portion of a TK gene is deleted from a first nucleotide sequence to generate a second nucleotide sequence, and wherein the second nucleotide sequence encodes for SEQ ID NO: 4.
2. The attenuated strain of porcine pseudorabies virus of claim 1, wherein the whole ORF of gI/gE/11K/28K gene is deleted from the first attenuated porcine pseudorabies virus strain.
3. The attenuated strain of porcine pseudorabies virus of claim 1, wherein the first attenuated porcine pseudorabies virus strain is an HN1201 strain.
4. A vaccine composition, comprising: an immunizing amount of an antigen of an attenuated, variant strain of porcine pseudorabies virus; and a carrier, wherein the attenuated, variant strain of porcine pseudorabies virus comprises: a first attenuated porcine pseudorabies virus strain, wherein the first attenuated porcine pseudorabies virus strain comprises a porcine pseudorabies virus strain characterized by inactivation of gI/gE/11K/28K protein, wherein the first attenuated porcine pseudorabies virus strain is a variant strain of pseudorabies virus, wherein the gE protein has 95% or greater homology with SEQ ID NO: 5, and wherein the first attenuated strain of porcine pseudorabies virus strain comprises a gene variation resulting in inactivation of TK protein, wherein at least a portion of a TK gene is deleted from a first nucleotide sequence to generate a second nucleotide sequence, and wherein the second nucleotide sequence encodes for SEQ ID NO: 4.
5. The vaccine composition of claim 4, wherein the immunizing amount comprises at least 10.sup.6.0TCID.sub.50/ml of the attenuated, variant strain of porcine pseudorabies virus.
6. The vaccine composition of claim 4, wherein the antigen comprises a live attenuated, variant strain of porcine pseudorabies virus, and wherein the vaccine composition further comprises a cryoprotectant.
7. The vaccine composition of claim 4, further comprising an inactivated pathogen or antigen.
8. The vaccine composition of claim 7, wherein the inactivated pathogen or antigen is selected from the group consisting classical swine fever virus, antigen of porcine reproductive and respiratory syndrome virus, antigen of porcine circovirus, antigen of haemophilus parasuis, and antigen of mycoplasma.
9. A method of treating and preventing pseudorabies infection, comprising immunizing a pig with an attenuated strain of porcine pseudorabies virus, wherein the attenuated strain of porcine pseudorabies virus comprises: a first attenuated porcine pseudorabies virus strain, wherein the first attenuated porcine pseudorabies virus strain comprises a porcine pseudorabies virus strain characterized by inactivation of gI/gE/11K/28K protein, wherein the first attenuated porcine pseudorabies virus strain is a variant strain of pseudorabies virus, wherein the gE protein has 95% or greater homology with SEQ ID NO: 5, and wherein the first attenuated strain of porcine pseudorabies virus strain comprises a gene variation resulting in inactivation of TK protein, wherein at least a portion of a TK gene is deleted from a first nucleotide sequence to generate a second nucleotide sequence, and wherein the second nucleotide sequence encodes for SEQ ID NO: 4.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
SEQUENCE LISTING
(6) SEQ ID NO:1 is the nucleotide sequence of gI/gE/11K/28K genes in the PRV HN1201 strain.
(7) SEQ ID NO:2 is the nucleotide sequence of TK gene in the PRV HN1201 strain.
(8) SEQ ID NO:3 is the nucleotide sequence of location for deletion of TK gene in the PRV HN1201 strain.
(9) SEQ ID NO:4 is the amino acid sequence of location for deletion of TK gene in the PRV HN1201 strain.
(10) SEQ ID NO:5 is the amino acid sequence of gE in the PRV HN1201 strain.
DETAILED DESCRIPTION
(11) The description of the present invention is further provided as follows with reference to the specific embodiments, and features and advantages of the present invention will become more apparent from the following description. However, these embodiments are only exemplary, but not forming any limitation to the scope of the present invention. It should be understood by a person skilled in the art that modifications or alternatives to details and forms of the technical solution of the present invention without deviation from the spirit and scope of the present invention will be allowed, while those modification and alternatives should all fall within the scope of the present invention.
(12) In the invention, the term per pig refers to the amount of vaccine each pig injected.
(13) In the invention, the term TCID.sub.50 refers to 50% tissue culture infective dose, a way to represent viral infectivity.
(14) Minimum Essential Medium (MEM) liquid medium is prepared with MEM dry powdered medium purchased from Life Technologies, Corp. according to the instruction.
(15) Dulbecco's Modified Eagle's Medium (DMEM) in the present invention is prepared with reference to the preparation method from Appendix A of GB/T18641-2002 Diagnostic Techniques for Aujeszk's Disease.
(16) In the present invention, the term PBS is the abbreviation for Phosphate Buffer Saline, and 0.01 mM pH 7.4 PBS as used in the present invention is prepared as described in Molecular cloning: Laboratory manuals, 3rd edition.
(17) The PRV HN1201 strain (pseudorabies virus, strain HN1201) used in the embodiments is deposited in the China Center for Type Culture Collection on May 20, 2013, of which the accession number is CCTCC NO. V 201311 and the address is Wuhan University, Wuhan, China.
(18) The PRV HN1202 strain (pseudorabies virus, strain HN1202) used in the embodiments is deposited in the China Center for Type Culture Collection on Aug. 26, 2013, of which the accession number is CCTCC NO. V 201335 and the address is Wuhan University, Wuhan, China.
(19) PRV is the abbreviation for the term Pseudorabies virus.
(20) In the following specific embodiments, the description of the present invention is further provided with examples of PRV HN1201 strain, NVDC-PRV-BJ strain, NVDCPRV-HEB strain, NVDC-PRV-SD strain and HN1202 strain.
Example 1
(21) Preparation of PRV HN1201 Strain with Deletion of gI/gE/11K/28K
(22) 1.1 Construction of a Transfer Vector for Recombinant PRV HN1201GFP Virus
(23) According to the sequence of US segment (gI/gE/11K/28K) to be deleted, the homologous arms were designed at its two ends, called USA and USB, respectively. USA and USB were cloned into pUC19 vector and named pUCUSAB. Then GFP gene was cloned into pUCUSAB, to obtain a transfer vector for recombinant virus which was called pUCUSA-GFP-B. The homologous arms in the transfer vector are sequences of two sides of US, therefore the recombinant virus obtained after recombination, was US segment deleted, which comprised gI/gE/11K/28K.
(24) 1.1.1 Amplification and Cloning of the Homologous Recombinant Arms
(25) 1.1.1.1 Design of Primers and Preparation of Templates
(26) Two pairs of primers were designed for amplifying the homologous arms at two sides of segment to be deleted according to the gene sequence of HN1201 virus:
(27) The upstream and downstream primers for the homologous arm USA at the left side are, respectively:
(28) TABLE-US-00001 SEQ ID NO: 6 USAF:CCGGAATTCTCGTCGTGGGCATCGTCATCAT(theunder- lineportionreferstotheEcoRIcuttingsite), SEQIDNO:7 USAR:CTATCTAGAataacttcgtataatgtatgctatacgaagttatC GGTACTGCGGAGGCTACGGAC(theunderlineportion referstotheXbaIcuttingsite,lowercase lettersrefertotheloxpsite,
(29) The upstream and downstream primers for the homologous arm USB at the right side are, respectively:
(30) TABLE-US-00002 SEQ ID NO: 8 USBF:ACATGCATGCataacttcgtatagcatacattatacgaagttat ACGGCAGGATCTCTCCGCGTCCC(theunderlineportion referstotheSphIcuttingsite,lowercaseletters refertotheloxpsite), SEQIDNO:9 USBR:CCCAAGCTTAGGAGGGGGCGGGGAGCGCGAGC(theunder- lineportionreferstotheHindIIIcuttingsite),
(31) Vero cells were transfected with PRV HN1201, and part of supernatant was harvested when the cytopathic effect of cells reached to 80%, for extracting genomic DNA of virus by using Geneaid Viral Nucleic Acid Extraction kit as the template for amplification of the homologous arms.
(32) 1.1.1.2 Amplification and Cloning of the Homologous Arms, USA and USB
(33) USA and USB were amplified through PCR method by using TAKARA PrimeSTAR, of which the system and condition is as follows:
(34) TABLE-US-00003 PRV HN1201 DNA 1 L PrimeSTAR 0.5 L 2*primeSTAR GC buffer 25 L dNTP(25 mM) 4 L Upstream primer 0.5 L downstream primer 0.5 L Water Used for adjusting to a final volume of 50 L
(35) TABLE-US-00004 98 C. 2 min 98 C. 10 s 68 C. 1 min 15 s } 30 cycles 68 C. 5 min
(36) USA and USB fragments amplified by PCR were separated by electrophoresis on agarose gel, and the target fragments were recovered with TIANGEN Gel Recovery Kit. USA fragment and pUC19 vector was digested by both of EcoR I and XbaI, and the target fragments were recovered, connected by T4 DNA ligase, and the product was transformed into DH5. The transformation mix was spread onto plates containing ampicillin, and incubated at 37 C. overnight. A single colony was picked to extract the plasmid and the plasmid was identified using enzyme digestion, and the correct plasmid after identification was named pUCUSA. pUCUSA and USB was digested by both of SalI and HindIII, and the target fragments were recovered, linked by T4 DNA ligase, and the product was transformed into DH5. The transformation mix was spread onto plates containing ampicillin, and incubated at 37 C. overnight. A single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion, and the correct plasmid after identification was named pUCUSAB.
(37) 1.1.3 Amplification of Label Gene GFP
(38) 1.1.2.1 Removal of Multiple Cloning Site (MCS) of GFP Vector pAcGFP-C1
(39) The pAcGFP-C1 plasmid (purchased from Clontech, Catalog No. 632470) was digested by Bgl II and Sma I, and the linearized vector was recovered, linked by T4 DNA Ligase after filling-in with DNA Polymerase I Large (Klenow) Fragment, and transformed into the competent cell DH5 to obtain MCS deleted GFP plasmid, named pAcGFPMCS.
(40) 1.1.2.2 Amplification of GFP Gene
(41) The primers for amplifying GFP were designed according to the sequence of pAcGFP-C1 vector.
(42) Upstream Primer
(43) TABLE-US-00005 SEQ ID NO: 10 CMVU:ACGCGTCGACTAGTTATTAATAGTAATCAATTACG(the underlineportionreferstotheSalIcutting site.),
(44) Downstream Primer
(45) TABLE-US-00006 SEQ ID NO: 11 SV40R:ACATGCATGCCTAGAATGCAGTGAAAAAAATGC(the underlineportionreferstotheSphIcutting site.),
(46) GFP gene was amplified with pAcGFPMCS plasmid as the template, of which the system and condition is as follows:
(47) TABLE-US-00007 pAcGFPMCS 1 L primeSTAR 0.5 L 2*primeSTAR GC buffer 25 L dNTP(25 mM) 4 L Upstream primer CMVU 0.5 L Downstream primer SV40R 0.5 L Water Used for adjusting to a final volume of 50 L
(48) TABLE-US-00008 94 C. 2 min 94 C. 30 s 60 C. 30 s 30 cycles {close oversize brace} 72 C. 2 min 72 C. 5 min
(49) A target band was recovered by electrophoresis on agarose gel for further linking.
(50) 1.1.3 Linking of GFP Label Gene and pUCUSAB
(51) GFP was digested with both of Sal and Sph I, and the target fragments were recovered, linked to pUCUSB plasmid which had been through the same double enzyme digestion, and the product was transformed into the competent cell DH5. The transformation mix was spread onto plates containing ampicillin, and incubated at 37 C. overnight. A single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion, and the correct plasmid after identification was named pUCUSA-GFP-B.
(52) 1.2 Acquisition of Recombinant Virus Containing GFP
(53) 1.2.1 Acquisition of Recombinant Virus Through Co-Transfection of Vero Cells with the Transfer Vector and HN1201 DNA
(54) Co-transfection of vero cells was conducted by using lipofectin technique, wherein 3 g PRV-HN1201 viral genomic DNA and 5 g the transfer vector pUCUSA-GFP-B was transfected, in accordance with procedures of Lipofectamine 2000 Protocol (Invitrogen, Catalog No. 11668030). Cells were incubated at 37 C. in an incubator containing 5% CO.sub.2. The supernatant of cell culture, i.e. P0 recombinant virus, named rPRV-GFP-US-, was collected 36-48 h after transfection, or until the cytopathic effect was visible and infected cells exhibited fluorescence.
(55) 1.2.2 Plaque Purification of Recombinant Viruses
(56) When infected with the obtained P0 recombinant virus rPRV-GFP-US-, vero cells infected were covered with 2% agarose with low melting point. After 48 h when the cytopathic effect became apparent and infected cells exhibited obvious fluorescence, a plaque with a green fluorescence was picked and freeze-thawed 3 times in 70 C., inoculated at 10-fold serial dilutions into vero cells previously laid in six-well plates. Such plaque with a green fluorescence was continued to be picked for purification. After 8 rounds of plaques purification, a purified recombinant virus rPRV-GFP-US- which was free of wild-type virus HN1201 and with deletion of gI/gE/US9/US2 (i.e. gI/gE/11K/28K) was obtained.
(57) 1.3 Deletion of GFP Label Gene in the gI/gE/US9/US2 (i.e. gI/gE/11K/28K) Segment-Deleted Recombinant Virus
(58) pBS185 plasmid expressing Cre enzyme (purchased from addgene, Cre enzyme recognizes loxP sites at downstream of USA and upstream of USB, wherein USA and USB are homology arms, and deletes sequence between two loxp sites) and genomic DNA of recombinant virus rPRV-GFP-US- was co-transfected into vero cells, with the results showing relatively obvious cytopathic effect and more single fluorescence 24 h after transfection. After serial dilution, P0 virus harvested was inoculated for plaque screening; fluorescence-negative plaque was picked for the next round of purification. After 2 rounds of screening and purification, a fluorescence-negative virus was obtained, and named vPRV-US-. PCR identification result after extraction and purification of viral genomic DNA, showed deletion of gI/gE/US9/US2 (i.e. gI/gE/11K/28K) segment, and indicated that GFP label gene had been deleted. The result showed a successful purification of gI/gE/US9/US2 (i.e. gI/gE/11K/28K) segment-deleted virus containing no GFP label gene.
(59) 1.4 Confirmation of PRV HN1201 Strain with Deletion of US Segment
(60) The viral genome of gI/gE/US9/US2 (i.e. gI/gE/11K/28K) segment-deleted virus and wild-type virus, was extracted and identified by PCR, with the following primers:
(61) TABLE-US-00009 SEQ ID NO: 12 USDCF:TACATCGTCGTGCTCGTCTTTGGC, SEQIDNO:13 USDCR:AGCTCGTGCGTCTCGGTGGTG,
(62) The size of PCR amplification product of the wild-type virus was 6286 bp, the size of PCR amplification fragment of gI/gE/US9/US2 (i.e. gI/gE/11K/28K) segment-deleted virus was 1960 bp.
(63) PCR assay result confirmed that ORF of gI/gE/US9/US2 (i.e. gI/gE/11K/28K) segment had been completely missing.
Example 2
(64) Preparation of PRV HN1201 Strain with Deletion of gI/gE/11K/28K/TK
(65) 2.1 Construction of a Transfer Vector for Recombinant PRV HN1201GFP Virus
(66) According to the sequence of TK gene to be deleted, the homologous arms at its two ends were designed, called TKA and TKB, respectively. TKA and TKB were cloned into pUC19 vector and named pUCTKAB. Then GFP gene was cloned into pUCTKAB, to obtain a transfer vector for recombinant virus which was called pUCTKA-GFP-B. The homologous arms in the transfer vector are sequences of two sides of TK, therefore the recombinant virus obtained after recombination, was TK gene deleted.
(67) 2.1.1 Amplification and Cloning of the Homologous Recombinant Arms
(68) 2.1.1.1 Design of Primers and Preparation of Template
(69) Two pairs of primers were designed for amplifying the homologous arms at two sides of TK gene according to the gene sequence of HN1201 virus:
(70) The upstream and downstream primers for the homologous arm TKA at the left side are, respectively:
(71) TABLE-US-00010 SEQ ID NO: 14 TKAF:CCGGAATTCGTAGTGCCGGTTGCCCACGTACA(theunder- lineportionreferstotheEcoRIcuttingsite), SEQIDNO:15 TKAR:CTAGTCTAGAataacttcgtatagtacacattatacgaagttat CGCTCAGGCTGCCGTTCTGC(theunderlineportionrefers totheXbaIcuttingsite,lowercaselettersrefer totheloxpsite),
(72) The upstream and downstream primers for the homologous arm TKB at the right side are, respectively:
(73) TABLE-US-00011 SEQ ID NO: 16 TKBF:ACATGCATGCataacttcgtataatgtgtactatacgaagttat AACGACGACGGCGTGGGAGG(theunderlineportionrefers totheSphIcuttingsite,lowercaselettersrefer totheloxpsite), SEQIDNO:17 TKBR:CCCAAGCTTAGGGCGACGGCGAAGAAGAGC(theunder- lineportionreferstotheHindIIIcuttingsite),
(74) Vero cells were transfected with PRV HN1201, and part of supernatant was harvested when the cytopathic effect of cells reached to 80%, for extracting genomic DNA of virus by using Geneaid Viral Nucleic Acid Extraction kit as the template for amplification of the homologous arms.
(75) 2.1.1.2 Amplification and Cloning of the Homologous Arms, TKA and TKB
(76) TKA and TKB were amplified through PCR method by using TAKARA PrimeSTAR, of which the system and condition is as follows:
(77) TABLE-US-00012 PRV HN1201 DNA 1 L PrimeSTAR 0.5 L 2*primeSTAR GC buffer 25 L dNTP(25 mM) 4 L Upstream primer 0.5 L downstream primer 0.5 L Water Used for adjusting to a final volume of 50 L
(78) TABLE-US-00013 98 C. 2 min 98 C. 10 s 68 C. 1 min 15 s } 30 cycles 68 C. 5 min
(79) TKA and TKB fragments amplified by PCR were separated by electrophoresis on agarose gel, and the target fragments were recovered with TIANGEN Gel Recovery Kit. TKA fragment and pUC19 vector was digested with both of EcoR I and XbaI, and the target fragments were recovered, linked by T4 DNA ligase, and the product transformed into DH5. The transformation mix was spread onto plates containing ampicillin, and incubated at 37 C. overnight. A single colony was picked to extract the plasmid and the plasmid was identified after enzyme digestion, and the correct plasmid after identification was named pUCTKA. pUCTKA and TKB was digested with both of SalI and HindIII, and the target fragments were recovered, linked by T4 DNA ligase, and the product transformed into DH5. The transformation mix was spread onto plates containing ampicillin, and incubated at 37 C. overnight. A single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion, and the correct plasmid after identification was named pUCTKAB.
(80) 2.1.2 Amplification of Label Gene GFP
(81) 2.1.2.1 Removal of Multiple Cloning Site (MCS) of GFP Vector pAcGFP-C1
(82) The pAcGFP-C1 plasmid (purchased from Clontech, Catalog No. 632470) was digested with Bgl II and Sma I, and the linearized vector was recovered, linked by T4 DNA Ligase after filling-in with DNA Polymerase I Large (Klenow) Fragment, and the product was transformed into the competent cell DH5 to obtain MCS deleted GFP plasmid, named pAcGFPMCS.
(83) 2.1.2.2 Amplification of GFP Gene
(84) The primers for amplifying GFP were designed according to the sequence of pAcGFP-C1 vector.
(85) Upstream Primer
(86) TABLE-US-00014 SEQ ID NO: 18 CMVU:ACGCGTCGACTAGTTATTAATAGTAATCAATTACG(the underlineportionreferstotheSalIcutting site.),
Downstream Primer
(87) TABLE-US-00015 SEQ ID NO: 19 SV40R:ACATGCATGCCTAGAATGCAGTGAAAAAAATGC((the underlineportionreferstotheSphI cuttingsite.),
(88) GFP gene was amplified with the template of pAcGFPMCS plasmid, of which the system and condition is as follows:
(89) TABLE-US-00016 pAcGFPMCS 1 L PrimeSTAR 0.5 L 2*primeSTAR GC buffer 25 L dNTP(25 mM) 4 L Upstream primer CMVU 0.5 L Downstream primer SV40R 0.5 L Water Used for adjusting to a final volume of 50 L
(90) TABLE-US-00017 94 C. 2 min 94 C. 30 s 60 C. 30 s 30 cycles {close oversize brace} 72 C. 2 min 72 C. 5 min
(91) A target band was recovered by electrophoresis on agarose gel for further linking.
(92) 2.1.3 Linking of GFP Label Gene and pUCTKAB
(93) GFP was digested with both of Sal and Sph I, and the target fragments were recovered, linked to pUCTKAB plasmid which had been through the same double enzyme digestion, and the linked product was transformed into the competent cell DH5. The transformation mix was spread onto plates containing ampicillin, and incubated at 37 C. overnight. A single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion, and the correct plasmid after identification was named pUCTKA-GFP-B.
(94) 2.2 Acquisition of Recombinant Virus Containing GFP
(95) 2.2.1 Acquisition of Recombinant Virus Through Co-Transfection of Vero Cells with the Transfer Vector and vPRV-gI-gE-11K-28K-DNA
(96) Co-transfection of vero cells was conducted by using lipofectin technique, wherein 3 g vPRV-gI-gE-11K-28K- viral genomic DNA and 5 g the transfer vector pUCTKA-GFP-B was transfected, in accordance with procedures of Lipofectamine 2000 Protocol (Invitrogen, Catalog No. 11668030). Cells were incubated at 37 C. in an incubator containing 5% CO.sub.2. The supernatant of cell culture, i.e. P0 recombinant virus, named rPRV-GFP-gI-gE-11K-28K-TK-, was collected 36-48 h after transfection, or until the cytopathic effect was visible and infected cells exhibited fluorescence.
(97) 2.2.2 Plaque Purification of Recombinant Virus rPRV-GFP-gI-gE-11K-28K-TK-
(98) When infected with the obtained P0 recombinant virus rPRV-GFP-gI-gE-11K-28K-TK-, vero cells infected were covered with 2% agarose with low melting point. After 48 h when the cytopathic effect became apparent and infected cells exhibited obvious fluorescence, a plaque with a green fluorescence was picked and freeze-thawed 3 times in 70 C., inoculated at 10-fold serial dilutions into vero cells previously laid in six-well plates. Such plaque with a green fluorescence was continued to be picked for purification. After 11 rounds of plaques purification, a purified recombinant virus rPRV-GFP-gI-gE-11K-28K-TK- which was free of PRV-gI-gE-11K-28K-TK- and with deletion of five genes was obtained.
(99) 2.3 Deletion of GFP Label Gene in gI/gE/11K/28K/TK Deleted Recombinant Virus
(100) The pBS185 plasmid expressing Cre enzyme (purchased from addgene, Cre enzyme recognizes mutated loxP sites at downstream of TKA and upstream of TKB, wherein TKA and TKB are homology arms, and deletes sequence between two loxp sites) and genomic DNA of recombinant virus rPRV-GFP-gI-gE-11K-28K-TK- was co-transfected into vero cells, with the results showing relatively obvious cytopathic effect and more single fluorescence 24 h after transfection. After serial dilution, P0 virus harvested was inoculated for plaque screening; fluorescence-negative plaque was picked for the next round of purification. After 2 rounds of screening and purification, a fluorescence-negative virus was obtained, and named PRV-gI-gE-11K-28K-TK-. PCR identification result after extraction and purification of viral genomic DNA, showed deletion of TK gene, and also indicated that GFP label gene had been deleted. The result showed a successful purification of gI-gE-11K-28K-TK- deleted virus containing no GFP label gene.
(101) 2.4 Confirmation of PRV HN1201 Strain with Deletion of gI/gE/11K/28K/TK
(102) The primers used for identifying deletion of gI/gE/11K/28K were the same as above.
(103) The viral genome of gI/gE/11K/28K/TK-deleted virus and wild-type virus, was extracted and identified by PCR, with the following primers:
(104) TABLE-US-00018 SEQ ID NO: 20 TKDCF:cctacggcaccggcaagagca, SEQIDNO:21 TKDCR:cgcccagcgtcacgttgaagac,
(105) The size of PCR amplification product of the wild-type virus was 1566 bp, the size of PCR amplification fragment of TK deleted virus was 742 bp (refer to
Example 3
(106) Preparation of PRV HN1201 Strain with Deletion of gI/gE
(107) PRV HN1201 strain with deletion of gI/gE was prepared by reference to the method in Example 1 of CN103756977A.
Example 4
(108) Pathogenicity Test of Gene-Deleted PRV Strain
(109) 25 7-day-old piglets which were negative for pseudorabies antibodies and pseudorabies antigen were randomly divided into 5 groups (A, B, C, D and blank control group), each with 5 piglets. Grouping conditions and challenge conditions are shown in Table 1.
(110) TABLE-US-00019 TABLE 1 Grouping of animals in the pathogenicity test Group Strain used for inoculation Dose A PRV HN1201 strain with inoculated with 1 ml deletion of gI/gE/11K/28K (10.sup.7.0TCID.sub.50/ml)/piglet by prepared in Example 1 intranasal instillation B PRV HN1201 strain with inoculated with 1 ml deletion of (10.sup.7.0TCID.sub.50/ml)/piglet by gI/gE/11K/28K/TK prepared intranasal instillation in Example 2 C PRV HN1201 strain with inoculated with 1 ml deletion of gI/gE prepared in (10.sup.7.0TCID.sub.50/ml)/piglet by Example 3 intranasal instillation D PRV HN1201 strain inoculated with 1 ml (10.sup.7.0TCID.sub.50/ml)/piglet by intranasal instillation Blank DMEM medium inoculated with l ml/piglet by control intranasal instillation
(111) After inoculation of virus, the temperature of piglets was determined daily, and clinical signs and death status were observed. The results are shown in Table 2.
(112) TABLE-US-00020 TABLE 2 Pathogenicity of different genes-deleted PRV HN1201 strains in 7-day-old piglets Death Group Number Clinical signs status A A1 Normal body temperature, no clinical Survived signs A2 Body temperature increased for 1 day, Survived no clinical signs A3 Normal body temperature, no clinical Survived signs A4 Normal body temperature, no clinical Survived signs A5 Body temperature increased for 1 day, Survived no clinical signs B B1 Normal body temperature, no clinical Survived signs B2 Normal body temperature, no clinical Survived signs B3 Normal body temperature, no clinical Survived signs B4 Normal body temperature, no clinical Survived signs B5 Normal body temperature, no clinical Survived signs C C1 Body temperature increased for 1 day, Survived slightly depression, loss of appetite C2 Body temperature increased for 1 day, Survived slightly depression, loss of appetite C3 Body temperature increased for 1 day, Survived slightly depression, loss of appetite C4 Body temperature increased for 1 day, Survived slightly depression, loss of appetite C5 Body temperature increased for 1 day, Survived slightly depression, loss of appetite D D1 Body temperature increased for 3 days, Died on depression, completely loss of appetite, day 3 neurological signs such as staying lying, after dyspnea, trembling, convulsions, turning challenge around, and making strokes with their arms D2 Body temperature increased for 4 days, Died on depression, completely loss of appetite, day 4 staying lying, dyspnea, trembling and after convulsions. challenge D3 Body temperature increased for 4 days, Died on depression, completely loss of appetite, day 4 neurological signs such as staying lying, after dyspnea, trembling, convulsions, turning challenge around, and making strokes with their arms D4 Body temperature increased for 4 days, Died on depression, completely loss of appetite, day 4 neurological signs such as staying lying, after dyspnea, trembling, convulsions, turning challenge around, and making strokes with their arms D5 Body temperature increased for 4 days, Died on depression, completely loss of appetite, day 4 neurological signs such as staying lying, after dyspnea, trembling, convulsions, and challenge making strokes with their arms Blank K1 Normal Survived control K2 Normal Survived K3 Normal Survived K4 Normal Survived K5 Normal Survived
(113) It showed in the results that inoculation with PRV HN1201 strain in 7-day-old piglets could lead to 100% death (5/5) of inoculated piglets, while the virulence of PRV HN1201 strain with deletion of gI/gE/11K/28K was significantly decreased, which could only make the temperature of 2 piglets increased, without any clinical signs. Inoculation with PRV HN1201 strain with deletion of gI/gE in 7-day-old piglets could still lead to common clinical signs such as increased body temperature and depression etc., indicating remaining virulence; while PRV HN1201 strain with deletion of gI/gE/11K/28K/TK gene had completely lost its virulence.
Example 5
(114) Preparation of the Live Gene-Deleted PRV Vaccines
(115) 5.1 Proliferation of Vaccine Virus
(116) The virus seed of PRV HN1201 strain with deletion of gI/gE/11K/28K prepared in Example 1, PRV HN1201 strain with deletion of gI/gE/11K/28K/TK prepared in Example 2 and PRV HN1201 strain with deletion of gI/gE prepared in Example 3 was diluted at 510.sup.4 fold, and then inoculated into a monolayer of ST cell. After 1 h adhesion, 1000 ml of DMEM medium containing 2% fetal calf serum was added into ST cell, which was then placed at 37 C. in a roller bottle with a rotation speed of 6 rph. The cell medium containing viruses was harvested when the cytopathic effect of cells reached to 80%; the viruses were harvested after 2 times of freezing-thawing the medium and the virus titer was assessed. The virus solution was preserved at low temperature.
(117) 5.2 Preparation of a Protective Agent
(118) 40 g of sucrose and 8 g of gelatin was added into every 100 ml of deionized water, and the solution was autoclaved (under 121 C. for 30 min) after fully melted.
(119) 5.3 Preparation of Vaccine Virus Suspension
(120) The virus solution prepared and preserved in Example 5.1 was mixed with the protective agent prepared and preserved in Example 5.2 at a volume ratio of 1:1, distributed into sterilized bottles, each of which containing 2.6 ml and the mixed virus solution was freeze-dried. The vaccine was tested and determined to be free of contamination of bacterium and exogenous viruses and the content of virus was consistent with that before freeze-drying. The batch number of PRV HN1201 strain with deletion of gI/gE/11K/28K prepared in Example 1, PRV HN1201 strain with deletion of gI/gE/11K/28K/TK prepared in Example 2 and PRV HN1201 strain with deletion of gI/gE prepared in Example 3 were 20140501, 20140502 and 20140503, respectively.
Example 6
(121) Immunogenicity Assay of the Live Gene-Deleted PRV Vaccines
(122) 12 9-day-old piglets which were negative for PRV antibodies and PRV antigens were randomly divided into 5 groups, each with 5 piglets, and the piglets were injected with the vaccines prepared in Example 5 according to Table 3. The vaccine control group was inoculated with the live PRV vaccine, Bartha K-61 strain purchased from HIPRA, Spain, Batch No. 42RH, at the dosage from the protocol. The blank control group was inoculated with 1 mL/piglet of DMEM medium. The piglets were challenged with 110.sup.7.0TCID.sub.50/piglet of PRV HN1201 strain on day 28 after immunization. After challenge, the body temperature of piglets was determined daily, and in the meanwhile clinical signs and death status were observed (The results are shown in Table 3), the blood of piglets in all the experimental groups and control groups was collected respectively before challenge.
(123) TABLE-US-00021 TABLE 3 Grouping of animals in the pathogenicity test Group Vaccines injected Dose Group I Batch No. 20140501 inoculated with 1 ml 10.sup.6.0TCID.sub.50/piglet by intramuscular injection Group II Batch No. 20140502 inoculated with 1 ml 10.sup.6.0TCID.sub.50/piglet by intramuscular injection Group III Batch No. 20140503 inoculated with 1 ml 10.sup.6.0TCID.sub.50/piglet by intramuscular injection Vaccine control Live PRV vaccine inoculated with 2 ml group 2 10.sup.6.0TCID.sub.50/piglet by intramuscular injection Blank control group DMEM medium inoculated with 1 mL/piglet by intramuscular injection
(124) The piglets were challenged with 110.sup.7.0TCID.sub.50/piglet (1 ml/piglet) of PRV HN1201 strain on day 28 after immunization. After challenge, the body temperature of piglets was determined daily, and in the meanwhile clinical signs and death status were observed (The results are shown in Table 5).
(125) TABLE-US-00022 TABLE 5 clinical status and challenge status for piglets challenged after immunization with live PRV vaccines Group clinical signs and death status Rate of protection Group I Normal body temperature, 100% (5/5) normal appetite, no abnormal clinical signs, survived Group II Normal body temperature, 100% (5/5) normal appetite, no abnormal clinical signs, survived Group III After immunization, body 100% (5/5) temperature increased, slightly depression and loss of appetite. After challenge, normal body temperature, normal appetite, no abnormal clinical signs, survived Vaccine control group Body temperature of three 80% (4/5) piglets increased for 7-10 days, depression, loss of appetite, one died. Blank control group Body temperature of three 0% (0/5) piglets increased for 7-10 days, depression in all piglets, partially or completely loss of appetite, significant clinical signs, two piglets died on day 4 after challenge, and all died within 5 days after challenge.
(126) The result from Table 5 indicated that immunizing piglets with the gene-deleted PRV vaccines prepared in example 5 can blocked virus infection (i.e. displaying clinical signs), and provide 100% (5/5) protection rate for piglets, while all the piglets in the blank control group died by day 5 after challenge, therefore the PRV vaccines in three experimental groups can provide excellent protection, showing excellent immune protection and safety; meanwhile it indicated that either deletion of gI/gE/11K/28K or deletion of gI/gE/11K/28K/TK for PRV strain would not affect the immunogenicity. For the vaccine group with only deletion of gI/gE, the clinical signs such as increased body temperature could not be avoided, while the vaccine still possessed good immunogenicity. Whereas the commercial vaccines in the prior art cannot provide a full protection to pigs.
Example 7
(127) Construction of Gene-Deleted Variant Strains of NVDC-PRV-BJ Strain, NVDCPRV-HEB Strain and NVDC-PRV-SD Strain, HN1202 PRV Variant Strain
(128) gI/gE/11K/28K genes and gI/gE/11K/28K/TK genes were deleted from the parent strains, NVDC-PRV-BJ strain, NVDC-PRV-HEB strain and NVDC-PRV-SD strain (Xiuling Yu, Zhi Zhou, Dongmei Hu, et al. Pathogenic Pseudorabies Virus, China, 2012 Emerging Infectious Diseases, No. 1, January 2014) (the applicant promises to open it to public for 20 year from the patent application date according to provisions of Guidelines for Patent Examination), HN1202 strain (deposited in the China Center for Type Culture Collection on Aug. 26, 2013, of which the accession number is CCTCC NO. V 201335 and the address is Wuhan University, Wuhan, China), according to methods in Example 1 and 2. The names of the attenuated strains obtained were NVDC-PRV-BJ with deletion of gI/gE/11K/28K/TK, NVDCPRV-HEB with deletion of gI/gE/11K/28K/TK, NVDC-PRV-SD with deletion of gI/gE/11K/28K/TK, and PRVHN1202 with deletion of gI/gE/11K/28K/TK. The deletion of genes was verified through comparison of PCR results with that of parent strains respectively.
Example 8
(129) Preparation of Vaccine Compositions of the Attenuated Variant Strains of NVDC-PRV-BJ Strain, NVDC-PRV-HEB Strain and NVDC-PRV-SD Strain, HN1202 PRV Strain
(130) Each attenuated vaccine strains prepared in Example 7 was proliferated according to the method from Example 5.1, mixed with the protective agent (prepared by adding 40 g of sucrose and 8 g of gelatin into every 100 ml of deionized water, and autoclaved (under 121 C. for 30 min) after fully melted) at a volume ratio of 1:1 and the mixed vaccine compositions were freeze-dried. The batch numbers of NVDC-PRV-BJ strain with deletion of gI/gE/11K/28K/TK, NVDCPRV-HEB strain with deletion of gI/gE/11K/28K/TK, NVDC-PRV-SD strain with deletion of gI/gE/11K/28K/TK and PRV HN1201 strain with deletion of gI/gE/11K/28K/TK were Q01, Q02, Q03 and Q04, respectively.
Example 9
(131) Pathogenicity Test of the Virus Strains Prepared in Example 7
(132) Pathogenicity test was conducted according to the method in Example 4, in which the piglets were randomly divided into 5 groups, each with 5 piglets, inoculated with 1 ml (10.sup.7.0TCID.sub.50/ml) of NVDC-PRV-BJ strain with deletion of gI/gE/11K/28K/TK, NVDC-PRV-HEB strain with deletion of gI/gE/11K/28K/TK, NVDC-PRV-SD strain with deletion of gI/gE/11K/28K/TK, and PRV HN1202 strain with deletion of gI/gE/11K/28K/TK by intranasal instillation, respectively. The results showed that all the piglets were alive in each group, with normal body temperature and no clinical signs. It proved that the virulence of mutated PRV strain was reduced through deletion of gI/gE/11K/28K/TK genes.
Example 10
(133) Immunogenicity Assay of the Vaccines Prepared in Example 8
(134) Immunogenicity assay of the vaccines prepared in Example 8 was conducted according to the method and dose in Example 6, in the meanwhile the piglets in the vaccine control group were inoculated with the live PRV vaccine, HB-98 strain Batch No. 1308011-1 (purchased from China Animal Husbandry Industry Co., Ltd. Chengdu Medical Equipments Factory). The piglets were challenged with 110.sup.7.0TCID.sub.50/piglet of PRV HN1201 strain on day 28 after immunization. After challenge, the body temperature of piglets was determined daily, and in the meanwhile clinical signs and death status were observed (the results are shown in Table 6).
(135) TABLE-US-00023 TABLE 6 clinical status and challenge status for piglets challenged after immunization with live PRV vaccines clinical signs and death Rate of Group Vaccines status protection Group IV Q01 Normal body temperature, 100% (5/5) normal appetite, no abnormal clinical signs, survived Group V Q02 Normal body temperature, 100% (5/5) normal appetite, no abnormal clinical signs, survived Group VI Q03 Normal body temperature, 100% (5/5) normal appetite, no abnormal clinical signs, survived Group VII Q04 Normal body temperature, 100% (5/5) normal appetite, no abnormal clinical signs, survived Vaccine the live PRV Body temperature of five 80% (4/5) control vaccine, HB- piglets increased for 7-10 group 98 strain days, loss of appetite, one Batch No. piglet died and four 1308011-1 survived. Blank DMEM Body temperature of all 0% (0/5) control medium piglets increased, group depression in all piglets, partially or completely loss of appetite, significant clinical signs, two piglets died on day 4 after challenge, and all died within 5 days after challenge.
(136) The result from Table 6 indicated that immunizing piglets with the PRV vaccines prepared in Example 8 can block virus infection (i.e. displaying clinical signs), and provide 100% (5/5) protection rate for piglets, while the vaccine control group can only provide 80% (4/5) protection rate for piglets, and all the piglets in the blank control group died by day 5 after challenge, therefore the PRV vaccines of the present invention can provide excellent protection. In addition, the piglets exhibited substantially no clinical signs, indicating excellent immune protection of the PRV vaccines relative to live vaccines in the prior art.
Example 11
(137) Monitoring of gB antibodies after immunization with different strain vaccines 15 piglets at the age of around 13 days which were negative for PRV antigens and PRV antibodies were randomly divided into 5 groups, each with 5 piglets. Groups 1-3 were injected with the vaccine prepared in Example 5, which is PRV HN1201 strain with deletion of gI/gE/11K/28K/TK, with Batch No. 20140502, the live PRV vaccine Bartha K-61 strain, with Batch No. 66KR, purchased from HIPRA, Spain, and the live PRV vaccine, K-61, with Batch No. 195-B59B purchased from Boehringer Ingelheim (US) respectively. All the dose for immunization is 1 ml/piglet (for commercial vaccine, 1 piglet dosage/piglet, according to protocols; the PRV HN1201 with deletion of gI/gE/11K/28K/TK vaccine, 10.sup.6.0TCID.sub.50/piglet). The blank control group was inoculated with 1 mL/piglet of DMEM medium. The blood of piglets was collected on day 8, 10, 12, 14 and 21 after immunization, and gB antibody was determined according to the protocol of gB ELISA antibody detection kit (purchased from Biochek, Batch No. FS5763, Expiry Date: 2015 Jan. 7) after the serum was separated. The detailed results of detection are shown in Table 7 below.
(138) TABLE-US-00024 TABLE 7 Results of detection of gB antibodies of piglets after immunization. Before Day 8 after Day 10 after No. of immunization immunization immunization Group piglet OD405 nm S/P OD405 nm S/P OD405 nm S/P PRV HN1201 1# 0.184 0.025 0.398 0.469 0.439 0.555 strain with 2# 0.170 0.004 0.369 0.409 0.453 0.584 deletion of 3# 0.172 0.000 0.263 0.189 0.360 0.390 gI/gE/11K/28K/TK 4# 0.181 0.019 0.320 0.307 0.494 0.669 vaccine with 5# 0.182 0.021 0.339 0.347 0.400 0.474 Batch No. 20140502 Bartha K-61 6# 0.177 0.010 0.223 0.106 0.243 0.147 7# 0.176 0.008 0.256 0.174 0.286 0.237 8# 0.167 0.010 0.224 0.108 0.246 0.154 9# 0.186 0.029 0.221 0.102 0.219 0.098 10# 0.175 0.006 0.242 0.145 0.277 0.218 K-61 11# 0.162 0.019 0.195 0.059 0.185 0.035 12# 0.16 0.023 0.174 0.009 0.192 0.052 13# 0.167 0.007 0.182 0.028 0.218 0.113 14# 0.16 0.023 0.199 0.068 0.201 0.073 15# 0.17 0.000 0.219 0.115 0.225 0.129 Day 12 after Day 14 after Day 21 after No. of immunization immunization immunization Group piglet OD405 nm S/P OD405 nm S/P OD405 nm S/P PRV HN1201 1# 0.471 0.621 0.678 1.051 1.069 1.863 strain with 2# 0.510 0.702 0.631 0.953 0.984 1.686 deletion of 3# 0.453 0.584 0.496 0.673 0.619 0.928 gI/gE/11K/28K/TK 4# 0.596 0.881 0.687 1.070 0.844 1.396 vaccine, Batch 5# 0.602 0.893 0.547 0.779 0.690 1.076 No. 20140502 Bartha K-61 6# 0.275 0.214 0.290 0.245 0.570 0.827 7# 0.302 0.270 0.317 0.301 0.418 0.511 8# 0.283 0.231 0.309 0.285 0.315 0.297 9# 0.211 0.081 0.223 0.106 0.316 0.299 10# 0.272 0.208 0.299 0.264 0.486 0.652 K-61 11# 0.239 0.162 0.274 0.244 0.314 0.338 12# 0.205 0.082 0.211 0.096 0.277 0.251 13# 0.248 0.183 0.25 0.188 0.449 0.655 14# 0.256 0.202 0.285 0.27 0.321 0.354 15# 0.28 0.258 0.3 0.305 0.385 0.505 Note: evaluation criteria: negative, S/P value 0.499; positive, S/P value 0.500.
Note: evaluation criteria: negative, S/P value 0.499; positive, S/P value 0.500.
(139) In conclusion, the antibody test results showed that, all gB antibodies turned positive on day 12 after immunization with PRV HN1201 strain with deletion of gI/gE/11K/28K/TK, while not all the gB antibodies had turned positive on day 21 after immunization with the two control vaccine. It showed that PRV HN1201 strain with deletion of gI/gE/11K/28K/TK could provide earlier immune protection.
Example 12
(140) Monitoring of gE Antibodies after Immunization with Four Genes Deleted Strain Vaccine and Challenge.
(141) 15 piglets at the age of around 13 days which were negative for PRV antigens and PRV antibodies were randomly divided into 3 groups, each with 5 piglets. Groups 1-3 were injected with the vaccine prepared in Example 5, which is PRV HN1201 strain with deletion of gI/gE/11K/28K/TK, with Batch No. 20140502, the live PRV vaccine, Bartha K-61 strain, with Batch No. 66KR, purchased from HIPRA, Spain, and the live PRV vaccine, K-61, with Batch No. 195-B59B purchased from Boehringer Ingelheim (US). All the dose for immunization is 1 ml/piglet (for commercial vaccine, 1 piglet dosage/piglet, according to protocols; the PRV HN1201 with deletion of gI/gE/11K/28K/TK vaccine, 10.sup.6.0TCID.sub.50/piglet). The piglets were challenged with 10.sup.7.0TCID.sub.50/piglet, 1 ml/piglet of PRV HN1201 strain on day 21 after immunization. The blood of piglets was collected daily continuously from day 7 to day 14 after challenge, and gE antibody was determined according to the protocol of gE ELISA antibody detection kit (purchased from IDEXX Co., Batch No. AK650, Expiry Date: 2015 Jun. 13) after the serum was separated. The results showed that gE antibody was still negative (If the value of S/N is less or equal to 0.60, the sample should be determined as PRV gE antibody positive) on Day 14 after challenge when the piglets were immunized with the vaccine prepared in Example 5, PRV HN1201 with deletion of gI/gE/11K/28K/TK with Batch No. 20140502, while gE antibody became positive at different level when the piglets were immunized with the two commercial vaccines. The detailed results of deletion are shown in Table 8 below.
(142) TABLE-US-00025 TABLE 8 Results of detection of gE antibody of piglets after immunization. Before Day 7 after Day 8 after Day 9 after Dayb10 after No of challenge challenge challenge challenge challenge Group piglet OD650 nm S/N OD650 nm S/N OD650 nm S/N OD650 nm S/N OD650 nm S/N PRV HN1201 1# 1.024 1.041 0.917 0.932 0.956 0.972 0.860 0.874 0.863 0.877 with deletion of 2# 1.006 1.008 0.979 0.980 0.931 0.932 0.889 0.890 0.780 0.781 gI/gE/11K/28K/TK, 3# 1.070 1.072 0.990 0.991 1.007 1.009 0.970 0.971 0.929 0.930 vaccine with 4# 1.052 1.054 0.795 0.796 0.899 0.872 0.972 0.943 1.000 0.970 Batch No. 5# 0.969 0.970 0.912 0.913 0.915 0.916 0.922 0.923 0.683 0.684 20140502 Bartha K-61 6# 1.045 1.078 0.634 0.654 0.684 0.706 0.587 0.606 0.518 0.535 7# 1.063 1.097 0.788 0.813 0.758 0.782 0.664 0.685 0.612 0.632 8# 1.008 1.040 0.897 0.926 0.857 0.884 0.784 0.809 0.783 0.808 9# 1.017 1.050 0.720 0.743 0.637 0.657 0.599 0.618 0.467 0.482 10# 0.987 1.019 0.871 0.899 0.701 0.723 0.656 0.677 0.655 0.676 K-61 11# 0.905 0.934 0.946 0.976 0.698 0.720 0.643 0.664 0.618 0.638 12# 1.024 1.057 0.898 0.927 0.773 0.798 0.688 0.710 0.760 0.784 13# 1.030 1.063 0.957 0.928 0.965 0.936 0.913 0.886 0.732 0.710 14# 0.963 0.934 0.757 0.734 0.899 0.872 0.972 0.943 1.000 0.970 15# 0.944 0.916 0.747 0.725 0.591 0.573 0.543 0.527 0.531 0.515 Day 11 after Day 12 after Day 13 after Day 14 after No of challenge challenge challenge challenge Group piglet OD650 nm S/N OD650 nm S/N OD650 nm S/N OD650 nm S/N PRV HN1201 1# 0.884 0.898 0.877 0.891 0.871 0.885 0.880 0.894 with deletion of 2# 0.854 0.855 0.780 0.781 0.793 0.794 0.732 0.733 gI/gE/11K/28K/TK 3# 0.907 0.908 0.905 0.906 0.904 0.905 1.067 1.069 vaccine, with 4# 0.965 0.936 0.864 0.838 0.997 0.967 0.929 0.901 Batch No. 5# 0.623 0.624 0.718 0.719 0.784 0.785 0.718 0.719 20140502 Bartha K-61 6# 0.552 0.570 0.482 0.497 0.463 0.478 0.456 0.471 7# 0.664 0.685 0.533 0.550 0.499 0.515 0.478 0.493 8# 0.749 0.773 0.647 0.668 0.700 0.722 0.753 0.777 9# 0.450 0.464 0.410 0.423 0.432 0.446 0.433 0.447 10# 0.633 0.653 0.699 0.721 0.684 0.706 0.676 0.698 K-61 11# 0.568 0.586 0.472 0.487 0.472 0.487 0.449 0.463 12# 0.745 0.769 0.659 0.680 0.659 0.680 0.714 0.737 13# 0.785 0.761 0.678 0.658 0.505 0.490 0.425 0.412 14# 0.965 0.936 0.864 0.838 0.997 0.967 0.929 0.901 15# 0.578 0.561 0.528 0.512 0.457 0.443 0.398 0.386
(143) The above results indicated that the vaccine strains in the present invention has a better immunogenicity than commercial vaccine in the prior art, and after immunization therewith a faster generation of the antibody can be achieved, and the effective amplification of virus in the body of pigs can be blocked, and gE antibody is negative.
(144) Those are only preferred embodiments of the present invention as described above, which cannot be used to limit the present invention. Any change, substitution or modification etc., which are within the spirit and principle of the invention, should be included within the scope of protection of the present invention.