Malaria vaccines based on pre-erythrocytic antigens from P. falciparum

Abstract

The present invention relates to polypeptides or fragments thereof for use as malaria vaccines. It also relates to nucleic acid molecules coding for the polypeptides of the invention. It further relates to compositions comprising such polypeptides or fragments thereof or the nucleic acid molecules, in particular combinations of such polypeptides or fragments thereof, and the use of such compositions as malaria vaccines.

Claims

1. A multicomponent composition, which is immunogenic, comprising at least two polypeptides and an adjuvant, wherein each of said at least two polypeptides has a length in the range of 5 to 50 amino acids, wherein at least one of the two polypeptides comprises an amino acid sequence TABLE-US-00014 SLICGLYLL, (SEQIDNO:26) and at least one of the two polypeptides comprises an amino acid sequence TABLE-US-00015 LLFINEINKL. (SEQIDNO:33)

2. The multicomponent composition, according to claim 1, wherein the composition further comprises a mixture of polypeptides comprising the sequences of SEQ ID NOs: 27, 28, 31 and 32, wherein each of these further polypeptides has a length in the range of 5 to 50 amino acids.

3. The multicomponent composition, according to claim 1, wherein the composition further comprises a polypeptide comprising an amino acid sequence selected from: TABLE-US-00016 VLLEKINVI, (SEQIDNO:29) YLSPNFINKI, (SEQIDNO:30) SLISLYIYYV, (SEQIDNO:34) FLLLMLVSI, (SEQIDNO:35) FLTLMARKL, (SEQIDNO:36) NLLDPLVVV, (SEQIDNO:37) LLLEGNFYL, (SEQIDNO:38) KLIPVNYEL, (SEQIDNO:39) or ILIPSLPLI, (SEQIDNO:40) wherein the polypeptide has a length in the range of 5 to 50 amino acids.

4. The multicomponent composition, according to claim 1, wherein the composition further comprises polypeptides selected from the following polypeptides: a mixture of SEQ ID NOs: 29 and 30; a mixture of SEQ ID NOs: 34 and 35; SEQ ID NO: 36; and a mixture of SEQ ID NOs: 37 to 40, wherein each of these further polypeptides has a length in the range of 5 to 50 amino acids.

5. The multicomponent composition, according to claim 1, wherein the polypeptides comprise one or more labels, N- and/or C-terminal modifications, or a drug.

6. The multicomponent composition, according to claim 1, wherein the adjuvant triggers a CD8 T cell response.

7. A method for activating an immune response, wherein said method comprises administering, to a subject in need of such activation, the multicomponent composition according to claim 1.

8. The multicomponent composition, according to claim 1, wherein each of at least two polypeptides has a length of 8 to 25 amino acids.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the experimental setup of the modified suppression subtractive hybridisation (SSII) assay for comparing the transcripts of P. falciparum WT and RAS parasites after mid-liver stage development.

(2) FIGS. 2A-2D show the predicted primary structure of the indicated P. falciparum proteins, as predicted by the SMART algorithm (www.smart.embl-heidelberg.de, version 7.0, November 2011), Pfam, EMBL and PlasmoDB.org.

(3) FIG. 3 shows Validation of upregulation of RAS-specific antigens by quantitative RT-PCR. Total RNA has been isolated from P. falciparum liver stages (2 days post infection) of Wildtype and RAS followed by first strand cDNA synthesis. cDNA was then subjected for gene-specific qRT-PCR. Statistical analysis was performed by t-test.

(4) FIG. 4A-4D show Cultured ELISpot analysis for detecting antigen-specific CD8+ T cells in malaria-exposed Kenyan adults. Freshly isolated PBMCs from the blood of malaria-exposed (13 blood samples) and non-exposed (nave) individuals (8 blood samples) were stimulated with peptide pools of antigen (4A) MALS_A (Mal13P1.13) (SLICGLYLL (SEQ ID NO:26), ILYSLMINSL (SEQ ID NO:27), LICGLYLLTL (SEQ ID NO:33)),

(5) (4B) MALS_B (PF14_0480) (VLLEKINVI (SEQ ID NO:26), YLSPNFINKI (SEQ ID NO:30)),

(6) (4C) MALS_C (Mal13P1.258) (ILHGGVYRL (SEQ ID NO:31), ILFLFILSI (SEQ ID NO:32), LLFINEINKL (SEQ ID NO:33)),

(7) (4D) MALS_F (PF14_0435) (FLLLMLVSI (SEQ ID NO:34), SLISLYIYYV (SEQ ID NO:35)).

(8) For statistical analysis we performed a Mann-Whitney U-Test.

(9) FIGS. 5A-5D show Cultured ELISpot analysis for detecting antigen-specific CD830 T cells in malaria-exposed Ghanian adults.

(10) Freshly isolated PBMCs from the blood of malaria-exposed (26 blood samples) and non-exposed (nave) individuals (8 blood samples) were stimulated with peptide pools of antigen

(11) (5A) MALS_A (Mal13P1.13) (SLICGLYLL (SEQ ID NO:26), ILYSLMINSL (SEQ ID NO:27), LICGLYLLTL (SEQ ID NO:38)),

(12) (5B) MALS_B (PF14_0480) (VLLEKINVI (SEQ ID NO:29), YLSPNFINKI (SEQ ID NO:30)),

(13) (5C) MALS_Cal (PF14_0323) (FLTLMARKL (SEQ ID NO:36)) as well as peptides derived from the described blood-stage antigen MSPI (5D) (merozoite surface protein 1) (YLIDGYEEI (SEQ ID NO:87), KLLDKINEI (SEQ ID NO:88), KLKEFIPKV (SEQ ID NO:89)).

(14) The secretion of IFN-gamma has been analysed by cultured ELISpot assay. For statistical analysis we performed a Mann-Whitney U-Test.

(15) FIG. 6A-6E show Cultured ELISpot analysis for detecting antigen-specific CD8+ T cells in malaria-exposed Ghanian adults.

(16) Freshly isolated PBMCs from the blood of malaria-exposed (26 blood samples) and non-exposed (nave) individuals were stimulated with peptide pools of antigen

(17) (6A) MALS _C (Mal13P1.258) (ILHGGVYRL (SEQ ID NO:31), ILFLFILSI (SEQ ID NO:32), LLFINEINKL (SEQ ID NO:33)),

(18) (6B) MALS_F (PF14_0435) (SLISLYIYYV (SEQ ID NO:34)),

(19) (6C) MALS_E (NLLDPLVVV (SEQ ID NO:37), LLLEGNFYL (SEQ ID NO:38), KLIPVNYEL (SEQ ID NO:39), ILIPSLPLI (SEQ ID NO:40)),

(20) (6D) Antigen mixture (MALS_A: SLICGLYLL (SEQ ID NO:26), ILYSLMINSL (SEQ ID NO:27), LICGLYLLTL (SEQ ID NO:28); MALS_B: VLLEKINVI (SEQ ID NO:29), YLSPNFINKI (SEQ ID NO:30); MALS_C: ILHGGVYRL (SEQ ID NO:31), ILFLFILSI (SEQ ID NO:32), LLFINEINKL (SEQ ID NO:33); MALS_E: NLLDPLVVV (SEQ ID NO:37), LLLEGNFYL (SEQ ID NO:38), KLIPVNYEL (SEQ ID NO:39), ILIPSLPLI (SEQ ID NO:40); MALS_F: SLISLYIYYV (SEQ ID NO:34); MALS_Cal: FLTLMARKL (SEQ ID NO:36)) as well as peptides derived from

(21) (6E) MSPI (merozoite surface protein 1) a described blood-stage antigen (YLIDGYEEI (SEQ ID NO:87), KLLDKINEI (SEQ ID NO:88), KLKEFIPKV (SEQ ID NO:89)).

(22) The secretion of IFN-gamma has been analysed by a cultured ELISpot assay. For statistical analysis we performed a Mann-Whitney U-Test.

EXAMPLES

Example 1

Identification of Potentially Immunogenic Antigens in the Liver Stages Of P. falciparum by a SSH Screen

(23) It has been shown that immunisation with attenuated parasites confer sterile protection in mice (RAS and GAP) and also in humans (RAS). By applying the SSH (suppressive subtractive hybridisation) technology in order to analyse differentially expressed genes the inventors identified critical/potential targets of protective liver-stage immunity. For that purpose, they compared the transcriptional profile of liver stages from wildtype and attenuated (RAS) parasites, i.e. the cDNA populations of the protected RAS forms and the unprotected WT forms. Their modified suppressive subtractive hybridisation (SSH) screening (FIG. 1) allowed selective enrichment of differentially regulated cDNAs of high and low abundance that are exclusively present in one population. A combination of hybridisation and PCR amplification steps allowed simultaneous normalisation and subtraction of the cDNA populations. Since protective antigens are expressed very early, malaria infected hepatocytes were harvested at early time points after host cell invasion. SMART PCR cDNA Synthesis and PCR-Select cDNA subtraction kits were used to identify differentially expressed genes between the two populations.

(24) Sequencing of the identified differentially expressed genes was conducted by a sequencing company GATC, Konstanz and the data obtained were evaluated with BLAST algorithms (PlasmoDB version: 8.1, Oct. 8, 2011, NCBI, Sanger/GeneDB as of November, 2010, SMART). After sequencing and bioinformatical analysis of 672 RAS-specific clones the inventors were able to describe the 24 most abundantly transcribed antigens as listed in Table 1.

(25) Their predicted primary structures are shown in FIGS. 2A-2D.

Example 2

Validation of Upregulation of RAS-Specific Antigens by Quantitative RT-PCR

(26) The results obtained from the differential expression analyses (Suppression Subtractive Hybridisation screening) have been validated by performing quantitative Real-time PCR (qRT-PCR) for selected antigens. Total RNA isolated from P. falciparum wildtype and radiation-attenuated (RAS) liver stage parasites have been used to quantify the respective transcripts in both populations. Plasmodium liver stages were obtained by infecting cultured primary human hepatocytes with P. falciparum salivary gland sporozoites (strain NF54, Prof. Robert Sauerwein, Nijmegen, Netherlands; Delemarre BJM & Van der Kaay HJ, Ned. T. Geneesk 123 (1979).

(27) Infection of host cells was conducted in close collaboration with the laboratory of Prof. D. Mazier at INSERM, Paris (Semblat et al., 2002). Purified human hepatocytes were plated on collagen I-coated wells (2.510.sup.6 cells/well in a 6-well plate) and maintained until infection with salivary gland sporozoites. Cells have been infected with 1.510.sup.6 sporozoites per well. To obtain liver stages from radiation-attenuated parasites, sporozoites were irradiated at 150 Gray prior infection of liver cells. Two days post infection cells were harvested and total RNA has been purified using TRIzol Reagent (a monophasic solution including phenol, and guanidine isothiocyanate which facilitate the isolation of a variety of RNA species of large or small molecular size). First strand cDNA synthesis (Superscript III 1st strand synthesis Kit, Invitrogen) was performed with gene-specific primers (Invitrogen) in a nested first-strand reaction.

(28) Subsequently, cDNA was used to amplify the corresponding transcripts. SYBR Green has been used for quantification (Power SYBR Green Mastermix, Applied Biosystems). For normalisation, parasite specific GAPDH has been used. We also included as a positive control in this analysis the candidate antigens Pf Ferlin (PF14_0530; MALS_E) and Pf Ferlin-like protein (Mal8P1.134; MALS_G) (as described and disclosed in WO 2011/066995).

(29) The following oligonucleotides have been used for the nested first strand cDNA synthesis:

(30) TABLE-US-00012 PfGAPDHnestedrev [SEQIDNO:66] 5 CAGTGGATGCATGAACGGTGG, MALS_B(PF140840)nestedrev [SEQIDNO:67] 5 CCTAACTTGGAACATGGGAGTC, MALS_A(Mal13P1.13)nestedrev [SEQIDNO:68] 5 TGCACTCTTCCAAAGCCATG, MALS_C(Mal13P1.258)nestedrev [SEQIDNO:69] 5 ACCATCGTCTTTACCGTGTGAC, MALS_F(PF14_0435)nestedrev [SEQIDNO:70] 5 CTCACGACATTCGAAATGTAATCTC, MALS_E(PF14_0530)nestedrev [SEQIDNO:71] 5 GATCATCATGTTGTTTGAATGATTATACC, MALSG(Mal8P1.134)nestedrev [SEQIDNO:72] 5 CATAATCGAAGCCGTTGCAGC.

(31) The following oligonucleotides have been used for amplification of the corresponding transcripts:

(32) TABLE-US-00013 PfGAPDHfor [SEQIDNO:73] 5 GCAGCCTTTGGAAGGAAAGA and PfGAPDHrev [SEQIDNO:74] 5 GGCTCCTCCCTTAAGGTGAC, MALS_B(PF14_0840)for [SEQIDNO:75] 5 CGTGCAGCTCTTTAGTAGAAGTGG and MALS_Brev [SEQIDNO:76] 5 AGCATTAACAGCAGGGTAACTG, MALS_A(Mal13P1.13)for [SEQIDNO:77] 5 ATCGTGCACATATGACCATCT and MALS_Arev [SEQIDNO:78] 5 CATCTCCCTTGTCCATTTGCAAC, MALS_C(Mal13P1.258)for [SEQIDNO:79] 5 GGTCTCAGGTATGGACAGGG and MALS_Crev [SEQIDNO:80] 5 TCATGATCAGGATGGGGAGATG, MALS_F(PF14_0435)for [SEQIDNO:81] 5 CGACAAATACATAAAGATGGACGAG and MALS_Frev [SEQIDNO:82] 5 CATGGCTTGTTGGTATAAAACATACG, MALS_E(PF14_0530)for [SEQIDNO:83] 5 GCAGCTCTCGTCATATCAGCA and MALS_Erev [SEQIDNO:84] 5 TCCAAGCTTCGTCATCATCGT, MALS_G(Mal8P1.134)for [SEQIDNO:85] 5 GAGCCTATAGGTGAGGCAACC and MALS_Grev [SEQIDNO:86] 5 CCAACTGGGTCAAGTTCAGCC.

(33) The quantification of the transcript copies clearly shows a 1.2 to 6.5-fold up-regulation of the tested antigens in liver stages of radiation-attenuated parasites compared to wildtype liver stages (see FIG. 3).

Example 3

Presence of Antigen-Specific T Cells Recognising Peptides Derived from Selected Antigen Candidates in Malaria-Exposed Kenyan Adults

(34) In order to investigate the presence of antigen-specific T cells in malaria-exposed individuals, T-cell responses to peptides from a first selection of antigens MAL13P1.13 (SLICGLYLL (SEQ ID NO:26), ILYSLMINSL (SEQ ID NO:27), LICGLYLLTL (SEQ ID NO:28)), PF14_0480 (VLLEKINVI (SEQ ID NO:29), YLSPNFINKI (SEQ ID NO:30)), MAL13P1.258 (ILHGGVYRL (SEQ ID NO:31), ILFLFILSI (SEQ ID NO:32), LLFINEINKL (SEQ ID NO:33)), and PF14_0435 (FLLLMLVSI (SEQ ID NO:35), SLISLYIYYV (SEQ ID NO:34)) were tested in semi-immune Kenyan adults in collaboration with Dr. Britta Urban at the Kenyan Medical Research Institute-Wellcome Trust Research Programme (KEMRI). All adults are resident in Junju District, about 60 km north of Mombasa at the Kenyan coast. The area has two high transmission seasons but low-level transmission occurs all year round (infectious bites per year: 23-53) (Mwangi et al., 2005).

(35) In order to determine the production of antigen-specific IFN-gamma by activated peripheral blood mononuclear cells (PBMC), cultured ELISpot analysis was carried out over a period of 10 days. Peripheral blood mononuclear cells (PBMCs) were purified from fresh blood samples by gradient centrifugation using Lymphoprep and resuspended in RPMI 1640 medium containing 10% heat-inactivated FCS, 2 mM L-Glutamine and Penicillin (100 U/ml)/Streptomycin (100 g/ml). 110.sup.6 cells were cultured with 10 g/ml of peptides in a volume of 500 l. On day 3 and day 7, 250 l culture medium was removed and replaced with fresh medium containing human IL2 (final concentration 20 U/ml). On day 9, cells were washed three times, resuspended in 500 l medium and rested overnight before proceeding to an IFN-gamma ELISpot assay (IFN-gamma ELISpot kit, Mabtech). Cells (100.000 cells/well) were transferred to MultiScreen filter plates coated with 10 g/ml anti-human IFN-gamma antibody and incubated with indicated peptide pools or medium (non stimulated control) overnight (in each case in triplicates). After removing the cells and several washing steps, secreted IFN-gamma was detected by using a second antibody against human IFN-gamma coupled with biotin (1 g/ml) and subsequent addition of streptavidin-ALP followed by substrate solution.

(36) The detected IFN-gamma response is shown as counted spots per million cells. FIGS. 4A-4D summarize the specific T-cell responses to individual peptide pools from antigens Mal13P1.13, PF14_0840, Mal13P1.258 (high responder) as well as PF14_0435 (mediate responder), which therefore can be considered as valuable candidate antigens for a potential subunit vaccine against malaria.

Example 4

Presence of Antigen-Specific T Cells Recognizing Peptides Derived from Selected Antigen Candidates in Semi-Immune Ghanaian Adults

(37) We have been able to expand our investigations on testing reactivity of T cells to our critical target antigens in a malaria holo-endemic region in Ghana.

(38) In close collaboration with Prof Dr. Achim Hoerauf (University of Bonn, Germany) and the Kumasi Center for Collaborative Research, Kumasi, Ghana (KCCR), we investigated the presence of antigen-specific T cells recognising peptides derived from selected antigen candidates in semi-immune Ghanaian adults. Most of the analysed peptides have already been tested in studies in Kilifi, Kenya as described as part of this invention. Within this study the following antigen candidates and corresponding peptides were used: MALS_A=Mal13P1.13 (SLICGLYLL (SEQ ID NO:26), ILYSLMINSL (SEQ ID NO:27), LICGLYLLTL (SEQ ID NO:28)), MALS_B=PF14_0840 (VLLEKINVI (SEQ ID NO:29), YLSPNFINKI (SEQ ID NO:30)), MALS_C =Mal13P1.258 (ILHGGVYRL (SEQ ID NO:31), ILFLFILSI (SEQ ID NO:32), LLFINEINKL (SEQ ID NO:33)), MALS_F=PF14_0435 (SLISLYIYYV (SEQ ID NO:34)) and MALS_Cal=PF14_0323 (FLTLMARKL (SEQ ID NO:36)). In addition to that we included peptides derived from the candidate antigen Pf Ferlin (PF14_0530) as described below (and disclosed in WO 2011/066995).

(39) In order to determine the production of antigen-specific IFN-gamma by activated peripheral blood mononuclear cells (PBMC), cultured ELISpot analyses were carried out over a period of 10 days. Briefly, Peripheral Blood Mononuclear Cells (PBMCs) were purified from fresh blood samples by gradient centrifugation using Lymphoprep and resuspended in RPMI 1640 medium containing 10% heat-inactivated FBS, 2 mM L-Glutamine and Penicillin (100 U/ml)/Streptomycin (100 g/ml). 110.sup.6 cells were cultured with 10 g/ml (except for the tested antigen mixture, described below) of peptides in a volume of 800 l. On day 3 and day 7, 400 l culture medium was removed and replaced with fresh medium containing human IL2 (final concentration 20 U/ml), On day 9 cells were washed three times, resuspended in 500 l medium and rested overnight before proceeding with an IFN-gamma ELISpot assay (IFN-gamma ELISpot kit, Mabtech). Cells (100,000 cells/well) were transferred to MultiScreen filter plates coated with 10 g/ml anti-human IFN-gamma antibody and incubated with indicated peptide pools or medium (non stimulated control) overnight (in each case in triplicates). After removing the cells and several washing steps, secreted IFN-gamma was detected by using a secondary antibody against human IFN-gamma coupled with biotin (1 g/ml) and subsequent addition of Streptavidin-ALP followed by substrate solution. The detected IFN-gamma response is shown as counted spots per million cells. In addition to analysing peptide pools from individual antigens, we investigated T cell activation in response to a mixture of antigens (peptide pool). In this experimental set-up, peptides derived from antigen candidates Mal13P1.13 (SLICGLYLL (SEQ ID NO:26), ILYSLMINSL (SEQ ID NO:27), LICGLYLLTL (SEQ ID NO:28)), PF14_0840 (VLLEKINVI(SEQ ID NO:29), YLSPNFINKI (SEQ ID NO:30)), Mal13P1.258 (ILHGGVYRL (SEQ ID NO:31), ILFLFILSI (SEQ ID NO:32), LLFINEINKL (SEQ ID NO:33)), PF14_0435 (SLISLYIYYV (SEQ ID NO:34)), PF14_0323 (FLTLMARKL (SEQ ID NO:36)) and PF14_0530 (NLLDPLVVV (SEQ ID NO:37), LLLEGNFYL (SEQ ID NO:38), KLIPVNYEL (SEQ ID NO:39), ILIPSLPLI (SEQ ID NO:40)) were combined at a concentration of 1.25 g/ml per peptide (considered as peptide pool).

(40) Two different sets of experiments have been carried out using 26 blood samples of malaria-exposed individuals (semi-immune adults) each (FIGS. 5A-5D and FIGS. 6A-6E, respectively). In parallel CD8+ T cell responses to peptides derived from a known blood-stage vaccine candidate MSP-1 (Merozoite Surface Protein 1) have been determined (Goodman et al., 2010). In good agreement with our hypothesis that parasite transcripts isolated from the protection-mediated attenuated parasite line may serve as critical targets of anti-liver stage immunity we could nicely confirm a significant interaction of these candidate antigens with the host's immune system. Cultured ELISpot analysis hence revealed significant T cell activation as measured by IFN-gamma secretion for the target antigens MALS_A (Mal13P1.13), MALS_C (Mal13P1.258), MALS_E (PF14_0530) and MALS_F (PF14_0435).

(41) With respect to the results shown in FIGS. 5A-5D: Contrary to what was expected we measured IFN-gamma responses against MALS_A in a few individuals from the non-exposed group. We excluded specific restimulation of PBMCs from non-exposed individuals by MALS_A derived peptides after BLAST searches of the specific peptide sequence against human and other apicomplexan parasites (including Toxoplasma) sequences. Evidence from the literature suggests that Plasmodium antigens are thought to mimic antigens from other microbes thereby soliciting the reactivation of cross-reactively primed memory T cells rapid (Riley et al, 1999).

(42) The features disclosed in the foregoing description, in the claims and/or in the accompanying drawings may, both separately and in any combination thereof, be material for realizing the invention in diverse forms thereof.

REFERENCES

(43) Alonso, P. L., Sacarlal, J., Aponte, J. J., Leach, A., Macete, E., Milman, J., Mandomando, I., Spiessens, B., Guinovart, C., Espasa, M., Bassat, Q., Aide, P., Ofori-Anyinam, O., Navia, M. M., Corachan, S., Ceuppens, M., Dubois, M. C., Demoitie, M. A., Dubovsky, F., Menendez, C., Tornieporth, N., Ballou, W. R., Thompson, R., Cohen, J. (2004) Efficacy of the RTS,S/AS02A vaccine against Plasmodium falciparum infection and disease in young African children: randomised controlled trial. Lancet 364, 1411-20.

(44) Alonso, P. L., Sacarlal, J., Aponte, J. J., Leach, A., Macete, E., Aide, P., Sigauque, B., Milman, J., Mandomando, I., Bassat, Q., Guinovart, C., Espasa, M., Corachan, S., Lievens, M., Navia, M. M., Dubois, M. C., Menendez, C., Dubovsky, F., Cohen, J., Thompson, R., Ballou, W. R. (2005) Duration of protection with RTS,S/AS02A malaria vaccine in prevention of Plasmodium falciparum disease in Mozambican children: single-blind extended follow-up of a randomised controlled trial. Lancet 366, 2012-8.

(45) Aly, A. S., Mikolajczak, S. A., Rivera, H. S., Camargo, N., Jacobs-Lorena, V., Labaied, M., Coppens, I., Kappe, S. H. (2008) Targeted deletion of SAP1 abolishes the expression of infectivity factors necessary for successful malaria parasite liver infection. Mol Microbiol. 69, 152-63.

(46) Bejon, P., Lusingu, J., Olotu, A., Leach, A., Lievens, M., Vekemans, J., Mshamu, S., Lang, T., Gould, J., Dubois, M. C., Demoitie, M. A., Stallaert, J. F., Vansadia, P., Carter, T., Njuguna, P., Awuondo, K. O., Malabeja, A., Abdul, O., Gesase, S., Mturi, N., Drakeley, C. J., Savarese, B., Villafana, T., Ballou, W. R., Cohen, J., Riley, E. M., Lemnge, M. M., Marsh, K., von Seidlein, L. (2008) Efficacy of RTS,S/AS01E vaccine against malaria in children 5 to 17 months of age. N Engl J Med 359, 2521-32.

(47) Bongfen, S. E., Torgler, R., Romero, J. F., Renia, L., Corradin, G. (2007) Plasmodium berghei infected primary hepatocytes process and present the circumsporozoite protein to specific CD8+ T cells in vitro. J Immunol 178,7054-7063.

(48) Carvalho, L. H., Sano, G., Hafalla, J. C., Morrot, A., Curotto de Lafaille, M. A., Zavala, F. (2002) IL-4 secreting CD4+ T cells are crucial to the development of CD8+ T-cell-responses against malaria liver stages. Nat Med 8,166-170.

(49) Epstein J E, Tewari K, Lyke K E, Sim B K, Billingsley P F, Laurens M B, Gunasekera A, Chakravarty S, James E R, Sedegah M, Richman A, Velmurugan S, Reyes S, Li M, Tucker K, Ahumada A, Ruben A J, Li T, Stafford R, Eappen A G, Tamminga C, Bennett J W, Ockenhouse C F, Murphy J R, Komisar J, Thomas N, Loyevsky M, Birkett A, Plowe C V, Loucq C, Edelman R, Richie T L, Seder R A, Hoffman S L (2011) Live attenuated malaria vaccine designed to protect through CD8+ T cell immunity. Science. October 28; 334(6055):475-80. Epub 2011 September 8.

(50) Goodman A L, Epp C, Moss D, Holder A A, Wilson J M, Gao G P, Long C A, Remarque E J, Thomas A W, Ammendola V, Colloca S, Dicks M D, Biswas S, Seibel D, van Duivenvoorde L M, Gilbert S C, Hill A V, Draper S J. (2010) New candidate vaccines against blood-stage Plasmodium falciparum malaria: prime-boost immunization regimens incorporating human and simian adenoviral vectors and poxviral vectors expressing an optimized antigen based on merozoite surface protein 1. Infect Immun. 78(11):4601-4612.

(51) Gruner, A. C., Mauduit, M., Tewari, R., Romero, J. F., Depinay N., Kayibanda, M., Lallemand, E., Chavatte, J. M., Crisanti, A., Sinnis, P., Mazier, D., Corradin, G., Snounou, G., Renia, L. (2007) Sterile protection against malaria is independent of immune responses to the circumsporozoite protein. PLoS One 2, e1371.

(52) Haldar, K., Murphy, S. C., Milner, D. A. Jr, Taylor, T. E. (2007) Malaria: mechanisms of erythrocytic infection and pathologic correlates of severe disease. Annu Rev Pathol Mech Dis 2, 217-249.

(53) Hoffman, S. L., Goh, L. M. L., Luke, T. C., Schneider, I., Le, T. P., Doolan, D. L., Sacci, J., de la Vega, P., Dowler, M., Paul, C., Gordon, D. M., Stoute, J. A., Church, L. W., Sedegah, M., Heppner, D. G., Ballou, W. R., Richie, T. L. (2002) Protection of humans against malaria with radiation-attenuated Plasmodium falciparum sporozoites. J Infect Dis 185,1155-64.

(54) Jobe, O., Lumsden, J., Mueller, A. K., Williams, J., Silva-Rivera, H., Kappe, S. H., Schwenk, R. J., Matuschewski, K., Krzych, U. (2007) Genetically attenuated Plasmodium berghei liver stages induce sterile protracted protection that is mediated by major histocompatibility complex Class I-dependent interferon-gamma-producing CD8+ T cells. J Infect Dis. 196, 599-607.

(55) Klotz, F. W., Scheller, L. F., Seguin, M. C., Kumar, M. A., Marietta, A., Green, S. J., Azad, A. F. (1995) Co-localization of inducible nitric oxide synthase and Plasmodium berghei in hepatocytes from rats immunized with irradiated sporozoites. J Immunol. 154, 3391-3395.

(56) Leiriao, P., Mota, M. M., Rodriguez, A. (2005) Apoptoptic Plasmodium-infected hepatocytes provide antigens to liver dendritic cells. J Infect Dis. 191,1576-1581.

(57) Mauduit, M., Tewari, R., Depinay, N., Kayibanda, M., Lallemand, E., Chavatte, J. M., Snounou, G., Renia, L., Grner, A. C. (2010) Minimal role for the circumsporozoite protein in the induction of sterile immunity by vaccination with live rodent malaria sporozoites. Infect Immun. 78, 2182-8.

(58) Mueller, A. K., Labaied, M., Kappe, S. H. & Matuschewski, K. (2005 a) Genetically modified Plasmodium parasites as a protective experimental malaria vaccine. Nature 433, 164-7.

(59) Mueller, A. K., Camargo, N., Kaiser, K., Andorfer, C., Frevert, U., Matuschewski, K., Kappe, S. H. (2005 b) Plasmodium liver stage developmental arrest by depletion of a protein at the parasite-host interface. Proc Natl Acad Sci USA 102, 3022-7.

(60) Mueller, A. K., Deckert, M., Heiss, K., Goetz, K., Matuschewski, K., Schluter, D. (2007) Genetically attenuated Plasmodium berghei liver stages persist and elicit sterile protection primarily via CD8 T cells. Am J Pathol 171, 107-115.

(61) Mwangi, T. W., Ross, A., Snow, R. W., Marsh, K. (2005) Case definitions of clinical malaria under different transmission conditions in Kilifi District, Kenya. J Infect Dis 191, 1932-9.

(62) Nussenzweig, R. S., Vanderberg, J., Most, H. & Orton, C. (1967) Protective immunity produced by the injection of -irradiated sporozoites of Plasmodium berghei. Nature 216, 160-2.

(63) Oliveira, G. A., Kumar, K. A., Calvo-Calle J. M., Othoro, C., Altszuler, D., Nussenzweig, V., Nardin, E. H. (2008) Class II restricted immunity induced by malaria sporozoites. Infect Immun. 76, 200-1206.

(64) Prudenco, M., Rodriguez, A., Mota, M. M. (2006) The silent path to thousands of merozoites: the Plasmodium liver stage. Nat Rev Microbiol 4, 849-856.

(65) Putrianti, E. D., Silvie, 0., Kordes M., Borrmann, S., Matuschewski K. (2009) Vaccine-like immunity against malaria by repeated causal-prophylactic treatment of liver-stage Plasmodium parasites. J Infect Dis 199, 899-903.

(66) Riley E. M. (1999) Is T-cell priming required for initiation of pathology in malaria infections? Immunol Today. 20:228-33.

(67) Roestenberg, M., McCall, M., Hopman, J., Wiersma, J., Luty, A. J., van Gemert, G. J., van de Vegte-Bolmer, M., van Schaijk, B., Teelen, K., Arens, T., Spaarman, L., de Mast, Q., Roeffen, W., Snounou, G., Renia, L., van der Ven, A., Heimsen, C. C., Sauerwein, R. (2009) Protection against a malaria challenge by sporozoite inoculation. N Engl J Med 361, 468-77.

(68) Semblat J P, Silvie O, Franetich J F, Mazier D. (2005) Laser capture microdissection of hepatic stages of the human parasite Plasmodium falciparum for molecular analysis. Methods Mol Biol. 293:301-7.

(69) Silvie, O., Semblat, J. P., Franetich, J. F., Hannoun, L., Eling, W., Mazier, D. (2002) Effects of irradiation on Plasmodium falciparum sporozoite hepatic development: implications for the design of pre-erythrocytic malaria vaccines. Parasite Immunol. 24, 221-3.

(70) Silvie, O., Goetz, K., Matuschewski, K. (2008) A sporozoite asparagine-rich protein controls initiation of Plasmodium liver stage development. PLoS Pathog. 4(6), e1000086.

(71) Sturm, A., Amino, R., van de Sand, C., Regen, T., Retzlaff, S., Rennenberg, A., Krueger, A., Pollok, J. M., Menard, R., Heussler, V. T. (2006) Manipulation of host hepatocytes by the malaria parasite for delivery into liver sinusoids. Science 313, 1287-1290.

(72) Tarun, A. S., Dumpit, R. F., Camargo, N., Labaied, M., Liu, P., Takagi, A., Wang, R., Kappe, S. H. (2007) Protracted sterile protection with Plasmodium yoelii pre-erythrocytic genetically attenuated parasite malaria vaccines is independent of significant liver stage persistence and is mediated by CD8+ T cells. J Infect Dis 196, 608-16.

(73) van Dijk, M. R., Douradinha, B., Franke-Fayard, B., Heussler, V., van Dooren, M. W., van Schaijk, B., van Gemert, G. J., Sauerwein, R. W., Mota, M. M., Waters, A. P., Janse, C. J. (2005) Genetically attenuated, P36p-deficient malarial sporozoites induce protective immunity and apoptosis of infected liver cells. Proc Natl Acad Sci USA. 102, 12194-9.

(74) van Schaijk, B. C., Janse, C. J., van Gemert, G. J., van Dijk, M. R., Gego, A., Franetich, J. F., van de Vegte-Bolmer, M., Yalaoui, S., Silvie, O., Hoffman, S. L., Waters, A. P., Mazier, D., Sauerwein, R. W., Khan, S. M. (2008) Gene disruption of Plasmodium falciparum p52 results in attenuation of malaria liver stage development in cultured primary hepatocytes. PLoS ONE. 3:e3549.

(75) VanBuskirk, K. M., O'Neill, M. T., De La Vega, P., Maier, A. G., Krzych, U., Williams, J., Dowler, M. G., Sacci, J. B. Jr., Kangwanrangsan, N., Tsuboi, T., Kneteman, N. M., Heppner, D. G. Jr., Murdock, B. A., Mikolajczak, S. A., Aly, S. A., Cowman, A. F., Kappe, S. H. (2009) Preerythrocytic, live-attenuated Plasmodium falciparum vaccine candidates by design. Proc Natl Acad Sci USA. 106, 13004-9.

(76) White, K. L., Synder, H. L., Krzych, U. (1996) MHC class-I dependent presentation of exoerythrocytic antigens to CD8+ T lymphocytes is required for protective immunity against Plasmodium berghei. J Immunol. 156, 3374-3381.