Compositions and methods for the treatment of inflammation in urological pathology
11559536 · 2023-01-24
Assignee
Inventors
Cpc classification
A61K31/198
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K31/198
HUMAN NECESSITIES
A61K31/64
HUMAN NECESSITIES
International classification
A61K31/64
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
Abstract
The present disclosure provides compositions and methods for the treatment of inflammation in urological pathologies.
Claims
1. A method of treating diabetic bladder dysfunction (DBD) in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a NLRP3 inflammasome inhibitor, wherein the NLRP3 inflammasome inhibitor is a TXNIP inhibitor, ASC inhibitor, NEK7 inhibitor, Gasdermin D inhibitor, capspase-11 inhibitor, capsase-1 inhibitor, IL-1β inhibitor, IL-18 inhibitor, or combinations thereof.
2. The method of claim 1, wherein the DBD is acute or chronic.
3. The method of claim 1, further comprising repeating the administering of the therapeutically effective amount of the NLRP3 inflammasome inhibitor to the subject.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The foregoing aspects and other features of the disclosure are explained in the following description, taken in connection with the accompanying drawings, wherein:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
DETAILED DESCRIPTION OF THE DISCLOSURE
(25) For the purposes of promoting an understanding of the principles of the present disclosure, reference will now be made to embodiments and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the disclosure is thereby intended, such alteration and further modifications of the disclosure as illustrated herein, being contemplated as would normally occur to one skilled in the art to which the disclosure relates.
(26) Definitions
(27) Articles “a” and “an” are used herein to refer to one or to more than one (i.e. at least one) of the grammatical object of the article. By way of example, “an element” means at least one element and can include more than one element.
(28) “About” is used to provide flexibility to a numerical range endpoint by providing that a given value may be “slightly above” or “slightly below” the endpoint without affecting the desired result.
(29) The use herein of the terms “including,” “comprising,” or “having,” and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof as well as additional elements. Embodiments recited as “including,” “comprising,” or “having” certain elements are also contemplated as “consisting essentially of” and “consisting of” those certain elements. As used herein, “and/or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations where interpreted in the alternative (“or”).
(30) As used herein, the transitional phrase “consisting essentially of” (and grammatical variants) is to be interpreted as encompassing the recited materials or steps “and those that do not materially affect the basic and novel characteristic(s)” of the claimed invention. Thus, the term “consisting essentially of” as used herein should not be interpreted as equivalent to “comprising.”
(31) Moreover, the present disclosure also contemplates that in some embodiments, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a complex comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.
(32) Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise-Indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the lowest value and the highest value enumerated are to be considered to be expressly stated in this disclosure.
(33) As used herein, “treatment,” “therapy” and/or “therapy regimen” refer to the clinical intervention made in response to a disease, disorder or physiological condition manifested by a patient or to which a patient may be susceptible. The aim of treatment includes the alleviation or prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and/or the remission of the disease, disorder or condition.
(34) The term “effective amount” or “therapeutically effective amount” refers to an amount sufficient to effect beneficial or desirable biological and/or clinical results.
(35) As used herein, the term “subject” and “patient” are used interchangeably herein and refer to both human and nonhuman animals. The term “nonhuman animals” of the disclosure includes all vertebrates, e.g., mammals and non-mammals, such as nonhuman primates, sheep, dog, cat, horse, cow, chickens, amphibians, reptiles, and the like. In some embodiments, the subject comprises a human. In certain embodiments, the subject comprises a human having a DAMP-induced or PAMP-induced inflammation of the bladder.
(36) “Administration” as it applies to a human, primate, mammal, mammalian subject, animal, veterinary subject, placebo subject, research subject, experimental subject, cell, tissue, organ, or biological fluid, refers without limitation to contact of an exogenous ligand, reagent, placebo, small molecule, pharmaceutical agent, therapeutic agent, diagnostic agent, or composition to the subject, cell, tissue, organ, or biological fluid, and the like. “Administration” can refer, e.g., to therapeutic, pharmacokinetic, diagnostic, research, placebo, and experimental methods. Treatment of a cell encompasses contact of a reagent to the cell, as well as contact of a reagent to a fluid, where the fluid is in contact with the cell. “Administration” also encompasses in vitro and ex vivo treatments, e.g., of a cell, by a reagent, diagnostic, binding composition, or by another cell.
(37) Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
(38) Inhibition of Inflammasomes for the Treatment and Prevention of Inflammation to the Bladder and Central Nervous System
(39) The inventors have surprisingly discovered that inflammasomes may serve as therapeutic targets in the treatment of inflammation in urological pathologies. The inventors have discovered inflammasomes are activated early in the development of diabetic bladder dysfunction and can contribute to the onset of voiding dysfunction. Furthermore, the inventors have demonstrated that NLRP3 inflammasome inhibitors can prevent or treat DBD and possibly other diabetic complications. The inventors have also created a new murine model of diabetic mice lacking the NLRP3 inflammasome (NLRP3.sup.−/− diab).
(40) Furthermore, the inventors have discovered that the stone components calcium pyrophosphate (CPPD) and monosodium urate (MSU) activate NLRP3 in a reactive oxygen species (ROS) and thioredoxin-interacting protein (TXNIP)-dependent manner in bladder urothelium. These findings demonstrate the importance of ROS and TXNIP, and suggest that targeting either can decrease stone-dependent NLRP3 inflammation within the bladder.
(41) Accordingly, one aspect the present disclosure provides a method of treating or preventing inflammation in the bladder (e.g., cystitis) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an inflammasome inhibitor. In another aspect, the present disclosure provides a method of treating or preventing a condition that is associated with or causes inflammation in the bladder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an inflammasome inhibitor.
(42) In another aspect, the present disclosure provides a method of treating or preventing diabetic bladder dysfunction (DBD) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an inflammasome inhibitor.
(43) Inflammation in the bladder is also known and referred to herein as cystitis. Cystitis can be acute or chronic. Acute cystitis can involve calor, dolor, tumor, rubor (heat, pain, swelling, and redness). Chronic can involve low-level meta-inflammation, does not typically involve calor, dolor, tumor, or rubor, and can contribute to heart disease, cancer, diabetes, stroke, Alzheimer's disease, respiratory disease, among others. Symptoms of cystitis can include a strong, persistent urge to urinate, a burning sensation when urinating, passing frequent, small amounts of urine, passing cloudy urine, passing strong-smelling urine, hematuria (blood in the urine), pelvic discomfort, pressure in the lower abdomen, and/or a low-grade fever.
(44) Inflammation in the bladder (both acute and chronic) can be caused by a variety of different factors and conditions. Inflammation in the bladder can be caused by, for example, bacteria (e.g., a urinary tract infection caused by E. coli), chemotherapy agents (e.g., cyclophosphamide and ifosfamide), exposure to radiation (e.g., radiation treatment to the pelvic area), foreign-bodies (e.g., use of a catheter or a urinary stent), or chemical agents (e.g., chemicals contained in feminine hygiene products, bubble bath, or other chemical that could cause an allergic reaction within the bladder).
(45) Inflammation in the bladder can be caused by benign bladder disorders. The term benign bladder disorder refers to non-cancerous conditions that affect the bladder. Examples of benign bladder disorders include, but are not limited to, infectious cystitis, noninfectious cystitis, reactive proliferative processes, and benign processes that secondarily involve the bladder.
(46) Inflammation in the bladder (both acute and chronic) can also be caused by an inflammatory bladder disorder. The term “inflammatory bladder disorder” refers to a condition that can result in inflammation in the bladder. Examples of “inflammatory bladder disorders” include, but are not limited to, diabetes, kidney stones, urinary stones, enlarged prostate, bladder outlet obstructions (BOO), interstitial cystitis (IC), benign prostatic hyperplasia (BPH), cyclophosphamide-induced hemorrhagic cystitis, diabetic uropathy (e.g., diabetic bladder dysfunction [DBD]), fibrosis, denervation, or pressure activation.
(47) In some embodiments, inflammation in the bladder can be caused by other disorders and diseases including gout, benign prostatic hyperplasia (BPH), gynecological cancers (e.g., cervical cancer, ovarian cancer, uterine cancer, etc.), diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, bladder cancer, pelvic inflammatory disease, endometriosis, Crohn's disease, diverticulitis, lupus, and/or tuberculosis.
(48) Accordingly, the methods of the present disclosure provide for treating and/or preventing conditions associated with inflammation in the bladder, including benign bladder disorders and inflammatory bladder disorders, in a subject by administering to the subject one or more inflammasome inhibitors.
(49) In some embodiments, the inflammation in the bladder is caused by diabetic uropathy. Diabetic uropathy refers to a number of debilitating urologic complications. Types of diabetic uropathy include, but are not limited to, DBD, urinary incontinence, urinary tract infection and sexual dysfunction.
(50) DBD is the most common complication seen in diabetic patients. DBD is a progressive complication. DBD can be either acute of chronic. Symptoms of acute DBD (or early stage) can include irritative voiding symptoms, including urgency (e.g., overactive bladder), frequency, nocturia, precipitancy, and urge incontinence. Symptoms of chronic (or late stage) DBD can include decompensated bladder (e.g., insensate bladder, poor compliance, and overflow incontinence) and detrusor underactivity (DU) (also known as underactive bladder).
(51) In some embodiments of the above aspects, the inflammation in the bladder comprises urothelial cell damage. In certain embodiments of the above aspects, the inflammation in the bladder comprises urothelial cell inflammation. In other embodiments, bladder damage from a condition associated with inflammation in the bladder (e.g., diabetes) can cause neuropathy, smooth muscle dysfunction, and urothelial (barrier) dysfunction.
(52) Inflammation in the bladder can be caused by activation of an inflammasome. In some embodiments of the above aspects, the inflammasome can be activated by danger associated molecule patterns (DAMPs) or pathogen associated molecular patterns (PAMPs).
(53) DAMPs are endogenous danger molecules that are released from damaged or dying cells and activate the innate immune system by interacting with pattern recognition receptors (PRRs). DAMPs can promote pathological inflammatory responses. DAMPs can promote the formation of a multimeric structure known as the inflammasome in macrophages and other cells, including urothelia and microglia. The molecule responsible for the DAMPs-induced inflammation in the bladder can be any molecule known to damage bladder or tissue and/or cells, including urothelial cells, or any combination thereof. Examples of DAMPs include, but are not limited to, extracellular ATP, components of urinary stones, such as calcium pyrophosphate (CPPD), monosodium urate (MSU), and calcium oxalate, high mobility group box-1 (HMG-B1), albumin, uromodulin, uric acid crystals, hypoxia, acrolein, calcium oxalate, cholesterol, reactive oxidative species (ROS) serum amyloid A (SAA), amyloid β fibril, hyaluronan, aluminum, asbestos, silica, UV radiation, drusen, or skin irritants. DAMPs can also include diabetic metabolites (e.g., uric acid, glucose, MSU, HMGB1, AGE, or lipids), ROS from mitochondrial dysfunction, or K+ cellular efflux.
(54) PAMPs, on the other hand, can initiate and perpetuate the infectious pathogen-induced inflammatory response. The pathogen responsible for the PAMPs-induced inflammation in the bladder can be any pathogen known to damage bladder tissue and/or cells, including urothelial cells, smooth muscle cells, or any combination thereof. PAMPs can be a fungus (e.g., Candida albicans, Saccharomyces cerevisiae, or Aspergillus fumigatus), bacteria (e.g., Listeria monocytogenes, Staphylococcus aureus, Escherichia coli, Chlamydia pneumonia, Mycobacterium tuberculosis, Clostridium difficile, Bordetella pertussis, Vibrio cholera, Neisseria gonorrhoeae, or Streptococcus pyogenes), or a virus (e.g., Influenza A, adenovirus, Sendai virus, Varicella-zoster, or herpes). In some embodiments, PAMPs can include lipopolysaccharide (LPS) from the outer membrane of the Gram-negative cell wall, bacterial flagellin, muramyl dipeptide, which can be a constituent of both Gram-positive and Gram-negative bacteria, alpha-hemolysin, lipoteichoic acid, or viral DNA/RNA.
(55) As the inventors have demonstrated, inflammation in the bladder can cause secondary inflammation in the central nervous system (e.g., in the hippocampus), which can cause psychosocial maladies. In particular, the inventors have discovered a link between benign bladder disorders and mood disorders. In particular, the inventors found that cyclophosphamide (CP)-induced hemorrhagic cystitis causes NLRP3-dependent hippocampal inflammation leading to depression symptoms in rats. The inventors found that CP triggered an increase in inflammasome activity (caspase-1 activity) in the hippocampus but not in the pons.
(56) The inventors have also discovered that bladder outlet obstruction (BOO), a bladder-localized event, stimulates NLRP3-dependent inflammation in the rat hippocampus after 12 weeks and this inflammation can cause depressive behavior. This is the first mechanistic explanation of the link between BOO and depression and provides evidence for a distinct bladder-brain axis.
(57) Thus, yet another aspect of the present disclosure provides a method of treating or preventing a condition associated with neuroinflammation, the method comprising administering a therapeutically effective amount of an inflammasome inhibitor. In some embodiments, the subject suffering from neuroinflammation (or at risk for suffering from neuroinflammation) has been diagnosed with inflammation in the bladder or an inflammatory bladder disorder.
(58) In some embodiments, a condition associated with neuroinflammation can be a mood disorder in a subject. Mood disorders include, but are not limited to, depression, dysthymic disorder, bipolar disorder, anxiety, anhedonia, obsessive-compulsive disorder, panic disorder, bulimia, attention deficit hyperactivity disorder (ADHD), narcolepsy, social phobia, or post-traumatic stress disorder. In some embodiments, the mood disorder is depression, anxiety, or anhedonia.
(59) In other embodiments, a patient's bladder inflammation and neuroinflammation can both be treated and/or prevented concurrently by administering an inflammasome inhibitor.
(60) In some embodiments, the above methods further comprise administering a therapeutically effective amount of an antidepressant agent. In some embodiments, the antidepressant agent can be administered concurrently with, prior to, or subsequent to an inflammasome inhibitor.
(61) The antidepressant agent can be a selective serotonin reuptake inhibitors (SSRIs), a norepinephrine-dopamine reuptake inhibitors (NDRIs), or a monoamine oxidase inhibitors (MAOIs).
(62) SSRIs can include, but are not limited to, citalopram, escitalopram, fluoxetine, fluvoxamine, paroxetine, and sertraline. In some embodiments, the antidepressant agent is fluoxetine.
(63) NDRIs can include, but are not limited to, Amineptine, Bupropion, Desoxypipradrol, Dexmethylphenidate, Difemetorex, Diphenylprolinol, Ethylphenidate, Fencamfamine, Fencamine, Lefetamine, Methylenedioxypyrovalerone, Methylphenidate, Nomifensine, 0-2172, Phenylpiracetam, Pipradrol, Prolintane, Pyrovalerone, Solriamfetol, Tametraline, or WY-46824.
(64) MAOIs can include, but are not limited to, Isocarboxazid, Nialamide, Phenelzine, Hydracarbazine, Tranylcypromine, Bifemelane, Moclobemide, Pirlindole, Toloxatone, Rasagiline, Selegiline, or Safinamide.
(65) In certain embodiments, the subject is a mammal. In some embodiments, the mammal is a human.
(66) Inflammasome Inhibitors
(67) Inflammasomes are cytosolic multiprotein oligomers of the innate immune system responsible for the activation of inflammatory responses. Inflammasomes can include the NLR-class of inflammasomes, such as NLRP1, NLRP3, NLRP6, NLRP7, NLRP12, and NLRC4 (IPAF), as well as interferon-inducible protein AIM2 (AIM2). The NLR-class of inflammasomes each have a nucleotide-binding oligomerization domain (NOD), which is bound by ribonucleotide-phosphates (rNTP) and can facilitate self-oligomerization as well as a C-terminal leucine-rich repeat (LRR), which serves as a ligand-recognition domain for other receptors (e.g. TLR) or microbial ligands. The result of any inflammasome activation is the activation of the protease caspase-1. Caspase-1 cleaves pro-IL-1β and pro-IL-18 into their active forms, which then precipitate a wider inflammatory reaction. Multiple inflammasomes are present in the bladder, including but not limited to, the NLRP1 inflammasome, the NLRP3 inflammasome, the NLRP6 inflammasome, the NLRP7inflammasome, the NLRP12 inflammasome, the NLRC4 inflammasome, and the AIM2 inflammasome. Multiple inflammasomes are present in the brain and spinal cord, including but not limited to, the NLRP1 inflammasome, the NLRP3 inflammasome, and the NLRC4 inflammasome.
(68) The term “NLRP1” refers to a gene that encodes NACHT, LRR, FIIND, CARD domain and PYD domains-containing protein 1. NLRP1 can be activated by PAMPS.
(69) The term “NLRP3” refers to NOD-like receptor family, pyrin domain containing 3 inflammasome or NACHT, LRR and PYD domains-containing protein 3 (NALP3), also known as cryopyrin, cold induced autoinflammatory syndrome 1 (CIAS1), caterpiller-like receptor 1.1 (CLR1.1) or Pyrin Domain-Containing Apafl-Like Protein 1 (PYPAF1). NLRP3 is a component of a multiprotein oligomer consisting of the NLRP3 protein, a structural co-factor protein called thioredoxin-interacting protein (TXNIP), ASC (apoptosis-associated speck-like protein containing a CARD) and pro-caspase 1. NLRP3 is involved in inflammation and the immune response. In the presence of activating stimuli, this complex forms, recruits, and activates caspase-1, resulting in the cleavage and maturation of the pro-inflammatory cytokines IL-1β and IL-18. These cytokines are released from the cell via a form of necrotic cell death called pyroptosis, where they go on to promote inflammation.
(70) NLRP3 can respond to both PAMPs and DAMPs.
(71) It would be understood from context in some instances that the NLRP1 inflammasome, the NLRP3 inflammasome, the NLRP6 inflammasome, the NLRP7inflammasome, the NLRP12 inflammasome, the NLRC4 inflammasome, and the AIM2 inflammasome. Multiple inflammasomes are present in the brain and spinal cord, including but not limited to, the NLRP1 inflammasome, the NLRP3 inflammasome, and the NLRC4 inflammasome are referred to herein as NLRP1, NLRP3, NLRP6, NLRP7, NLRP12, NLRC4, and AIM2.
(72) The term “NLRP6” refers to NOD-like receptor family pyrin domain containing 6, is an intracellular protein that plays a role in the immune system. It is also known as NALP6, PYPAF5, PAN3, and CLR11.4, and is one of 14 pyrin domain containing members of the NOD-like receptor family of pattern recognition receptors. NLRP6 role in immunity is related to its ability to regulate caspase-1 and NF-κB activity.
(73) The term “NLRP7” refers to NACHT, LRR and PYD domains-containing protein 7.
(74) The term “NLRP12” refers to NACHT, LRR and PYD domains-containing protein 12.
(75) The term “NLRC4” refers to NLR family CARD domain-containing protein 4. The NLRC4 protein is highly conserved across mammalian species.
(76) The term “AIM2” refers to interferon-inducible protein AIM2.
(77) As used herein, “inflammasome inhibitor” refers to any compound capable of inhibiting the expression and/or function of inflammasomes (e.g., the NLR3 inflammasome), in a cell, including inhibiting the expression and/or function of the proteins in the NLRP3/IL-1β pathway. The term “inflammasome inhibitor” is meant to include one or more compounds capable of inhibiting the expression and/or function, i.e. the term may include two or more inhibitors that may be used in combination, including sequential or concomitant administration. The inflammasome inhibitors as used with the present invention may be inflammasome specific inhibitors. The inflammasome inhibitors may be allosteric inhibitors.
(78) Inflammasome inhibitors can include, but are not limited to, an NLRP1 inflammasome inhibitor, an NLRP3 inflammasome inhibitor, an NLRP6 inflammasome inhibitor, an NLRP7 inflammasome inhibitor, an NLRP12 inflammasome inhibitor, an NLRC4 inflammasome inhibitor, and/or an AIM2 inflammasome inhibitor.
(79) Inflammasome inhibitors can also include compounds or a combination of compounds that inhibit the expression and/or function of the proteins in the NLRP3/IL-1β pathway. Inhibitors of proteins in the NLRP3/IL-1β pathway include, but are not limited to, NLRP3 inflammasome inhibitors, TXNIP inhibitors, ASC inhibitors, NEK7 inhibitors, Gasdermin D inhibitors, capspase-11 inhibitors, capsase-1 inhibitors, IL-1β inhibitors, IL-18 inhibitors and combinations thereof and pharmaceutical compositions thereof.
(80) In some embodiments, the NLRP3 inflammasome inhibitor is a sufonylurea drug such as glyburide or functionally equivalent derivatives thereof, for example, glyburide precursors or derivatives that lack the cyclohexylurea moiety, or functionally equivalent precursors or derivatives that contain the sulfonyl and benamido groups. Examples include 5-chloro-2-methoxy-N-[2-(4-sulfamoylphenyl)-ethyl]-benzamide and 1-[(4-methylbenzene)sulfonyl]-1H-1,3-benzodiazol-2-amine. Functionally equivalent precursors or derivatives of glyburide include precursors or derivatives that retain the activity of glyburide, at least in part, to inhibit or reduce the activity of NLRP3 inflammasome, e.g. that retain at least about 25% of the activity of glyburide, about 50% of the activity of glyburide, or about 70%, 80%, or 90% of the activity of glyburide.
(81) In some embodiments, the NLRP3 inflammasome inhibitor is glyburide, 2-mercaptoethane sulfonate sodium (Mesna), CY09, MCC950, 3,4-Methylenedioxy-β-nitrostyrene (MNS), Tranilast (N-[3′,4′-dimethoxycinnamoyl]-anthranilic acid, TR), OLT1177, Oridonin, 16673-34-0, JC124, FC11A-2, parthenolide, Z-VAD-FMK, Bay 11-7082, aloe vera, curcumin, artesunate, dapansutrile, glybenclamide, Epigallocatechin-3-gallate (EGCG), Genipin, red ginseng extract (RGE), isoliquiritigenin (ILG), NBC 6, NBC 19 INF 39, OXSI 2, (R)-Shikonin, INF 4E, CRID3 sodium salt, Mangiferin, propolis, quercetin, resveratrol, or Sulforaphane (SFN), or combinations thereof.
(82) In some embodiments, the inflammasome inhibitor is a caspase-1 inhibitor. The caspase-1 inhibitor can be a direct inhibitor of caspase-1 enzymatic activity. Alternatively, the caspase-1 inhibitor can be an indirect inhibitor that inhibits initiation of inflammasome assembly or inflammasome signal propagation. Examples of caspase-1 inhibitors can be antioxidants, including reactive oxygen species (ROS) inhibitors. Examples of caspase-1 inhibitors include, but are not limited to, flavonoids including flavones such as apigenin, luteolin, and diosmin; flavonols such as myricetin, fisetin and quercetin; flavanols and polymers thereof such as catechin, gallocatechin, epicatechin, epigallocatechin, epigallocatechin-3-gallate and theaflavin; isoflavone phytoestrogens; and stilbenoids such as resveratrol. Also included are phenolic acids and their esters such as gallic acid and salicyclic acid; terpenoids or isoprenoids such as andrographolide and parthenolide; vitamins such as vitamins A, C and E; vitamin cofactors such as co-enzyme Q10, manganese and iodide, other organic antioxidants such as citric acid, oxalic acid, phytic acid and alpha-lipoic acid, and Rhus verniciflua stokes extract. The caspase-1 inhibitor may be a combination of these compounds, for example, a combination of a-lipoic acid, co-enzyme Q10 and vitamin E, or a combination of a caspase 1 inhibitor(s) with another inflammasome inhibitor such as glyburide or a functionally equivalent precursor or derivative thereof.
(83) The caspase-1 inhibitor can be a small molecule inhibitor, including cyanopropanate-containing molecules, such as (S)-3-((S)-1-((S)-2-(4-amino-3-chlorobenzamido)-3,3-dimethylbutanoyl)pyrrolidine-2-carboxamido)-3-cyano-propanoic acid, as well as other small molecule caspase-1 inhibitors such as (S)-1-((S)-2-{[1-(4-amino-3-chloro-phenyl)-methanoyl]-amino}-3,3-dimethyl-butanoyl)-pyrrolidine-2-carboxylic acid ((2R,3 S)-2-ethoxy-5-oxo-tetrahydro-furan-3-yl)-amide. Such inhibitors can be chemically synthesized.
(84) In some embodiments, the caspase-1 inhibitor can be Ac-YVAD-cmk, parthenolide, INF 4E, or VX-765.
(85) In some embodiments, the inflammasome inhibitor can be a reactive oxygen species (ROS) scavenger, such as N-acetylcysteine (NAC) or mannitol.
(86) In some embodiments, the inflammasome inhibitor can be a TXNIP inhibitor, such as a calcium channel blocker (e.g., amlodipine, diltiazem, felodipine, isradipine, nicardipine, nifedipine, nisoldipine, or verapamil).
(87) In some embodiments, the inflammasome inhibitor can be an IL-10 inhibitor, such as Anakinra (Kineret), rilonacept, or canakinumab.
(88) In some embodiments, the inflammasome inhibitor can be an ASC inhibitor, such as IC 100.
(89) In some embodiments, the inflammasome inhibitor can be a NEK7 inhibitor, such as Oridonin (Ori).
(90) In some embodiments, the inflammasome inhibitor can be a Gasdermin D inhibitor, such as N-acetyl-Phe-Leu-Thr-Asp-chloromethylketone (Ac-FLTD-CMK).
(91) In some embodiments, the inflammasome inhibitor can be a capspase-11 inhibitor. Examples of a capspase-11 inhibitor include, but are not limited to, wedelolactone, NleF, VX-765.
(92) Inflammasome inhibitors can be small molecules, naturally occurring molecules (flavones, flavonoids, etc.), an interfering oligonucleotides, or an immunological inhibitor (e.g., a monoclonal antibody).
(93) As used herein, “an interfering oligonucleotide” refers to any oligonucleotide that interferes with, i.e. reduces, inhibits, or eliminates, the expression of an inflammasome (e.g., the NLR3 inflammasome). Interfering oligonucleotides include aptamers and other oligonucleotide molecules as described herein.
(94) Also contemplated by the present disclosure are other types of inhibitors of inflammasomes, including inhibitors of the NLRP3/IL-1f3 pathway, including but not limited to, the following:
(95) i. Aptamers
(96) Aptamers, also called nucleic acid ligands, are nucleic acid molecules characterized by the ability to bind to a target molecule with high specificity and high affinity. Almost every aptamer identified to date is a non-naturally occurring molecule.
(97) Aptamers to a given target (e.g. an inflammasome may be identified and/or produced by the method of Systematic Evolution of Ligands by EXponential enrichment (SELEX™) Aptamers and SELEX are described in Tuerk and Gold (Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science. 1990 Aug. 3; 249(4968):505-10) and in WO91/19813.
(98) Aptamers may be DNA or RNA molecules and may be single stranded or double stranded. The aptamer may comprise chemically modified nucleic acids, for example in which the sugar and/or phosphate and/or base is chemically modified. Such modifications may improve the stability of the aptamer or make the aptamer more resistant to degradation and may include modification at the 2′ position of ribose.
(99) Aptamers may be synthesized by methods which are well known to the skilled person. For example, aptamers may be chemically synthesized, e.g. on a solid support.
(100) Solid phase synthesis may use phosphoramidite chemistry. Briefly, a solid supported nucleotide is detritylated, then coupled with a suitably activated nucleoside phosphoramidite to form a phosphite triester linkage. Capping may then occur, followed by oxidation of the phosphite triester with an oxidant, typically iodine. The cycle may then be repeated to assemble the aptamer.
(101) Aptamers can be thought of as the nucleic acid equivalent of monoclonal antibodies and often have K.sub.d's in the nM or pM range, e.g. less than one of 500 nM, 100 nM, 50 nM, 10 nM, 1 nM, 500 pM, 100 pM. As with monoclonal antibodies, they can be useful in virtually any situation in which target binding is required, including use in therapeutic and diagnostic applications, in vitro or in vivo. In vitro diagnostic applications can include use in detecting the presence or absence of a target molecule.
(102) Aptamers according to the present disclosure can be provided in purified or isolated form. Aptamers according to the present disclosure may be formulated as a pharmaceutical composition or medicament.
(103) Suitable aptamers can optionally have a minimum length of one of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides.
(104) Suitable aptamers can optionally have a maximum length of one of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides.
(105) Suitable aptamers can optionally have a length of one of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides.
(106) ii. Oligonucleotide Repression of Inflammasome Expression
(107) Oligonucleotide molecules, particularly RNA, can be employed to regulate gene expression (e.g, expression of the NLRP1 gene, the NLRP3 gene, the NLRP6 gene, the NLRP7 gene, the NTRP12 gene, the NLRC4 gene, the AIM2 gene, the ASC gene, the caspas-1 gene, and/or the TXNIP gene). These include antisense oligonucleotides, targeted degradation of mRNAs by small interfering RNAs (siRNAs), small molecules, post transcriptional gene silencing (PTGs), developmentally regulated sequence-specific translational repression of mRNA by micro-RNAs (miRNAs) and targeted transcriptional gene silencing.
(108) An antisense oligonucleotide is an oligonucleotide, preferably single stranded, that targets and binds, by complementary sequence binding, to a target oligonucleotide, e.g. mRNA. Where the target oligonucleotide is an mRNA, binding of the antisense to the mRNA blocks translation of the mRNA and expression of the gene product. Antisense oligonucleotides may be designed to bind sense genomic nucleic acid and inhibit transcription of a target nucleotide sequence.
(109) In view of the known nucleic acid sequences for inflammasomes, oligonucleotides can be designed to repress or silence the expression of inflammasome s (e.g., those regulated by the NLR-class genes). Such oligonucleotides can have any length, but can be short, e.g. less than 100 nucleotides, e.g. 10-40 nucleotides, or 20-50 nucleotides, and can comprise a nucleotide sequence having complete- or near-complementarity (e.g. 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementarity) to a sequence of nucleotides of corresponding length in the target oligonucleotide, e.g. the inflammasome mRNA (e.g., the NLRP3 inflammasome mRNA). The complementary region of the nucleotide sequence can have any length, but is preferably at least 5, and optionally no more than 50, nucleotides long, e.g. one of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides.
(110) Repression of inflammasome expression (e.g., NLRP3 inflammasome expression) will preferably result in a decrease in the quantity of inflammasome expressed by a cell. For example, in a given cell the repression of an inflammasome by administration of a suitable nucleic acid will result in a decrease in the quantity of inflammasome expressed by that cell relative to an untreated cell. Repression can be partial. Preferred degrees of repression are at least 50%, more preferably one of at least 60%, 70%, 80%, 85% or 90%. A level of repression between 90% and 100% is considered a “silencing” of expression or function.
(111) A role for the RNAi machinery and small RNAs in targeting of heterochromatin complexes and epigenetic gene silencing at specific chromosomal loci has been demonstrated. Double-stranded RNA (dsRNA)-dependent post transcriptional silencing, also known as RNA interference (RNAi), is a phenomenon in which dsRNA complexes can target specific genes of homology for silencing in a short period of time. It acts as a signal to promote degradation of mRNA with sequence identity. A 20-nt siRNA is generally long enough to induce gene-specific silencing, but short enough to evade host response. The decrease in expression of targeted gene products can be extensive with 90% silencing induced by a few molecules of siRNA. RNAi based therapeutics have been progressed into Phase I, II and III clinical trials for a number of indications (Nature 2009 Jan. 22; 457(7228):426-433).
(112) In the art, these RNA sequences are termed “short or small interfering RNAs” (siRNAs) or “microRNAs” (miRNAs) depending on their origin. Both types of sequence may be used to down-regulate gene expression by binding to complementary RNAs and either triggering mRNA elimination (RNAi) or arresting mRNA translation into protein. siRNAs are derived by processing of long double stranded RNAs and when found in nature are typically of exogenous origin. Micro-interfering RNAs (miRNA) are endogenously encoded small non-coding RNAs, derived by processing of short hairpins. Both siRNA and miRNA can inhibit the translation of mRNAs bearing partially complimentary target sequences without RNA cleavage and degrade mRNAs bearing fully complementary sequences.
(113) Accordingly, the present disclosure provides the use of oligonucleotide sequences for down-regulating the expression of inflammasomes.
(114) siRNA ligands are typically double stranded and, in order to optimize the effectiveness of RNA mediated down-regulation of the function of a target gene, it is preferred that the length of the siRNA molecule is chosen to ensure correct recognition of the siRNA by the RISC complex that mediates the recognition by the siRNA of the mRNA target and so that the siRNA is short enough to reduce a host response,
(115) miRNA ligands are typically single stranded and have regions that are partially complementary enabling the ligands to form a hairpin. miRNAs are RNA genes which are transcribed from DNA, but are not translated into protein. A DNA sequence that codes for a miRNA gene is longer than the miRNA. This DNA sequence includes the miRNA sequence and an approximate reverse complement. When this DNA sequence is transcribed into a single-stranded RNA molecule, the miRNA sequence and its reverse-complement base pair to form a partially double stranded RNA segment. The design of microRNA sequences is discussed in John et al, PLoS Biology, 11(2), 1862-1879, 2004.
(116) Typically, the RNA ligands intended to mimic the effects of siRNA or miRNA have between 10 and 40 ribonucleotides (or synthetic analogues thereof), more preferably between 17 and 30 ribonucleotides, more preferably between 19 and 25 ribonucleotides and most preferably between 21 and 23 ribonucleotides. In some embodiments of the invention employing double-stranded siRNA, the molecule may have symmetric 3′ overhangs, e.g. of one or two (ribo)nucleotides, typically a UU of dTdT 3′ overhang. Based on the disclosure provided herein, the skilled person can readily design suitable siRNA and miRNA sequences, for example using resources such the Ambion siRNA finder. siRNA and miRNA sequences can be synthetically produced and added exogenously to cause gene downregulation or produced using expression systems (e.g. vectors). In a preferred embodiment the siRNA is synthesized synthetically.
(117) Longer double stranded RNAs can be processed in the cell to produce siRNAs. The longer dsRNA molecule may have symmetric 3′ or 5′ overhangs, e.g. of one or two (ribo)nucleotides, or may have blunt ends. The longer dsRNA molecules may be 25 nucleotides or longer. Preferably, the longer dsRNA molecules are between 25 and 30 nucleotides long. More preferably, the longer dsRNA molecules are between 25 and 27 nucleotides long. Most preferably, the longer dsRNA molecules are 27 nucleotides in length. dsRNAs 30 nucleotides or more in length may be expressed using the vector pDECAP
(118) Another alternative is the expression of a short hairpin RNA molecule (shRNA) in the cell. shRNAs are more stable than synthetic siRNAs. A shRNA consists of short inverted repeats separated by a small loop sequence. One inverted repeat is complimentary to the gene target. In the cell the shRNA is processed by DICER into a siRNA which degrades the target gene mRNA and suppresses expression. The shRNA can be produced endogenously (within a cell) by transcription from a vector. shRNAs can be produced within a cell by transfecting the cell with a vector encoding the shRNA sequence under control of a RNA polymerase III promoter such as the human H1 or 7SK promoter or a RNA polymerase II promoter. Alternatively, the shRNA can be synthesized exogenously (in vitro) by transcription from a vector. The shRNA can then be introduced directly into the cell. The shRNA molecule can comprise a partial sequence of the inflammasome. The shRNA sequence can be between 40 and 100 bases in length. The stem of the hairpin can be between 19 and 30 base pairs in length. The stem can contain G-U pairings to stabilize the hairpin structure.
(119) siRNA molecules, longer dsRNA molecules or miRNA molecules can be made recombinantly by transcription of a nucleic acid sequence, preferably contained within a vector. The siRNA molecule, longer dsRNA molecule or miRNA molecule can comprise a partial sequence of the inflammasome.
(120) In one embodiment, the siRNA, longer dsRNA or miRNA is produced endogenously (within a cell) by transcription from a vector. The vector can be introduced into the cell in any of the ways known in the art. Optionally, expression of the RNA sequence can be regulated using a tissue specific (e.g. heart, liver, kidney, brain, bladder, or eye specific) promoter. In a further embodiment, the siRNA, longer dsRNA or miRNA is produced exogenously (in vitro) by transcription from a vector.
(121) Suitable vectors can be oligonucleotide vectors configured to express the oligonucleotide agent capable of inflammasome repression. Such vectors may be viral vectors or plasmid vectors. The therapeutic oligonucleotide may be incorporated in the genome of a viral vector and be operably linked to a regulatory sequence, e.g. promoter, which drives its expression. The term “operably linked” can include the situation where a selected nucleotide sequence and regulatory nucleotide sequence are covalently linked in such a way as to place the expression of a nucleotide sequence under the influence or control of the regulatory sequence. Thus a regulatory sequence is operably linked to a selected nucleotide sequence if the regulatory sequence is capable of effecting transcription of a nucleotide sequence which forms part or all of the selected nucleotide sequence.
(122) Viral vectors encoding promoter-expressed siRNA sequences are known in the art and have the benefit of long-term expression of the therapeutic oligonucleotide. Examples include lentiviral, adenovirus, and retroviruses.
(123) In other embodiments a vector can be configured to assist delivery of the therapeutic oligonucleotide to the site at which repression of inflammasome expression is required. Such vectors typically involve complexing the oligonucleotide with a positively charged vector (e.g., cationic cell penetrating peptides, cationic polymers and dendrimers, and cationic lipids); conjugating the oligonucleotide with small molecules (e.g., cholesterol, bile acids, and lipids), polymers, antibodies, and RNAs; or encapsulating the oligonucleotide in nanoparticulate formulations.
(124) In one embodiment, a vector can comprise a nucleic acid sequence in both the sense and antisense orientation, such that when expressed as RNA the sense and antisense sections will associate to form a double stranded RNA.
(125) Alternatively, siRNA molecules can be synthesized using standard solid or solution phase synthesis techniques which are known in the art. Linkages between nucleotides may be phosphodiester bonds or alternatives, for example, linking groups of the formula P(O)S, (thioate); P(S)S, (dithioate); P(O)NR′2; P(O)R′; P(O)OR6; CO; or CONR′2 wherein R is H (or a salt) or alkyl (1-12C) and R6 is alkyl (1-9C) is joined to adjacent nucleotides through —O— or —S—.
(126) Modified nucleotide bases can be used in addition to the naturally occurring bases, and may confer advantageous properties on siRNA molecules containing them.
(127) For example, modified bases can increase the stability of the siRNA molecule, thereby reducing the amount required for silencing. The provision of modified bases can also provide siRNA molecules which are more, or less, stable than unmodified siRNA.
(128) The term “modified nucleotide base” encompasses nucleotides with a covalently modified base and/or sugar. For example, modified nucleotides include nucleotides having sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3′ position and other than a phosphate group at the 5′ position. Thus modified nucleotides may also include 2′ substituted sugars such as 2′-O-methyl-; 2′-O-alkyl; 2′-O-allyl; 2′-S-alkyl; 2′-S-allyl; 2′-fluoro-; 2′-halo or azido-ribose, carbocyclic sugar analogues, a-anomeric sugars; epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, and sedoheptulose.
(129) Modified nucleotides are known in the art and include alkylated purines and pyrimidines, acylated purines and pyrimidines, and other heterocycles. These classes of pyrimidines and purines are known in the art and include pseudoisocytosine, N4,N4-ethanocytosine, 8-hydroxy-N6-methyladenine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5 fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyl uracil, dihydrouracil, inosine, N6-isopentyl-adenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyl uracil, 5-methoxy amino methyl-2-thiouracil, -D-mannosylqueosine, 5-methoxycarbonylmethyluracil, 5methoxyuracil, 2 methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methyl ester, psueouracil, 2-thiocytosine, 5-methyl-2 thiouracil, 2-thiouracil, 4-thiouracil, 5methyluracil, N-uracil-5-oxyacetic acid methylester, uracil 5-oxyacetic acid, queosine, 2-thiocytosine, 5-propyluracil, 5-propylcytosine, 5-ethyluracil, 5ethylcytosine, 5-butyluracil, 5-pentyluracil, 5-pentylcytosine, and 2, 6,diaminopurine, methylpsuedouracil, 1-methylguanine, 1-methylcytosine.
(130) Methods relating to the use of RNAi to silence genes in C. elegans, Drosophila, plants, and mammals are known in the art.
(131) Accordingly, the present disclosure provides a nucleic acid that is capable, when suitably introduced into or expressed within a mammalian, e.g. human, cell that otherwise expresses inflammasome(s) or NLRP3/IL-β pathway proteins, of suppressing inflammasome expression or expression of NLRP3/IL-β pathway proteins by RNAi.
(132) The nucleic acid may have substantial sequence identity to a portion of the inflammasome mRNA, or the complementary sequence to said mRNA.
(133) The nucleic acid may be a double-stranded siRNA. As the skilled person will appreciate, and as explained further below, a siRNA molecule may include a short 3′ DNA sequence also.
(134) Alternatively, the nucleic acid may be a DNA (usually double-stranded DNA) which, when transcribed in a mammalian cell, yields an RNA having two complementary portions joined via a spacer, such that the RNA takes the form of a hairpin when the complementary portions hybridize with each other. In a mammalian cell, the hairpin structure may be cleaved from the molecule by the enzyme DICER, to yield two distinct, but hybridized, RNA molecules.
(135) Only single-stranded (i.e. non self-hybridized) regions of an mRNA transcript are expected to be suitable targets for RNAi. It is therefore proposed that other sequences very close in the inflammasome mRNA transcript can also be suitable targets for RNAi.
(136) Accordingly, the present disclosure provides nucleic acids that are capable, when suitably introduced into or expressed within a mammalian cell that otherwise expresses inflammasome(s), of suppressing inflammasome expression by RNAi, wherein the nucleic acid is generally targeted to the sequence of, or portion thereof, of the inflammasome
(137) By “generally targeted” the nucleic acid can target a sequence that overlaps with the inflammasome or is in the pathway activated by the inflammasome that causes inflammation. In particular, the nucleic acid can target a sequence in the mRNA of a human inflammasome that is slightly longer or shorter than one of an inflammasome, but is otherwise identical to the native form.
(138) It is expected that perfect identity/complementarity between the nucleic acid of the invention and the target sequence, although preferred, is not essential. Accordingly, the nucleic acid of the invention can include a single mismatch compared to the mRNA of the inflammasome. It is expected, however, that the presence of even a single mismatch is likely to lead to reduced efficiency, so the absence of mismatches is preferred. When present, 3′ overhangs may be excluded from the consideration of the number of mismatches.
(139) The term “complementarity” is not limited to conventional base pairing between nucleic acid consisting of naturally occurring ribo- and/or deoxyribonucleotides, but also includes base pairing between mRNA and nucleic acids of the invention that include non-natural nucleotides.
(140) In one embodiment, the nucleic acid (herein referred to as double-stranded siRNA) includes the double-stranded RNA sequences for the inflammasome.
(141) However, it is also expected that slightly shorter or longer sequences directed to the same region of the inflammasome mRNA will also be effective. In particular, it is expected that double-stranded sequences between 17 and 23 bp in length will also be effective.
(142) The strands that form the double-stranded RNA may have short 3′ dinucleotide overhangs, which may be DNA or RNA. The use of a 3′ DNA overhang has no effect on siRNA activity compared to a 3′ RNA overhang, but reduces the cost of chemical synthesis of the nucleic acid strands. For this reason, DNA dinucleotides may be preferred.
(143) When present, the dinucleotide overhangs can be symmetrical to each other, though this is not essential. Indeed, the 3′ overhang of the sense (upper) strand is irrelevant for RNAi activity, as it does not participate in mRNA recognition and degradation.
(144) Any dinucleotide overhang can therefore be used in the antisense strand of the siRNA. Nevertheless, the dinucleotide is preferably —UU or -UG (or -TT or -TG if the overhang is DNA), more preferably -UU (or -TT). The -UU (or -TT) dinucleotide overhang is most effective and is consistent with (i.e. capable of forming part of) the RNA polymerase III end of transcription signal (the terminator signal is TTTTT). The dinucleotides AA, CC and GG can also be used, but are less effective and consequently less preferred.
(145) Moreover, the 3′ overhangs can be omitted entirely from the siRNA.
(146) The present disclosure also provides single-stranded nucleic acids (herein referred to as single-stranded siRNAs) respectively consisting of a component strand of one of the aforementioned double-stranded nucleic acids, preferably with the 3′-overhangs, but optionally without. The present disclosure also provides kits containing pairs of such single-stranded nucleic acids, which are capable of hybridizing with each other in vitro to form the aforementioned double-stranded siRNAs, which may then be introduced into cells.
(147) The present disclosure also provides DNA that, when transcribed in a mammalian cell, yields an RNA (herein also referred to as an shRNA) having two complementary portions which are capable of self-hybridizing to produce a double-stranded motif or a sequence that differs from any one of the aforementioned sequences by a single base pair substitution.
(148) The complementary portions will generally be joined by a spacer, which has suitable length and sequence to allow the two complementary portions to hybridize with each other. The two complementary (i.e. sense and antisense) portions may be joined 5′-3′ in either order. The spacer will typically be a short sequence, of approximately 4-12 nucleotides, preferably 4-9 nucleotides, more preferably 6-9 nucleotides.
(149) The 5′ end of the spacer (immediately 3′ of the upstream complementary portion) can consist of the nucleotides -UU- or -UG-, (though the use of these particular dinucleotides is not essential). A suitable spacer, recommended for use in the pSuper system of OligoEngine (Seattle, Wash., USA) is UUCAAGAGA. In this and other cases, the ends of the spacer may hybridize with each other.
(150) Similarly, the transcribed RNA preferably includes a 3′ overhang from the downstream complementary portion. Again, this can be —UU or -UG.
(151) Such shRNA molecules may then be cleaved in the mammalian cell by the enzyme DICER to yield a double-stranded siRNA as described above, in which one or each strand of the hybridized dsRNA includes a 3′ overhang.
(152) Techniques for the synthesis of the nucleic acids of the invention are of course well known in the art.
(153) The skilled person is well able to construct suitable transcription vectors for the DNA of the present disclosure using well-known techniques and commercially available materials. In particular, the DNA will be associated with control sequences, including a promoter and a transcription termination sequence.
(154) Of particular suitability are the commercially available pSuper and pSuperior systems of OligoEngine (Seattle, Wash., USA). These use a polymerase-III promoter (H1) and a T.sub.5 transcription terminator sequence that contributes two U residues at the 3′ end of the transcript (which, after DICER processing, provide a 3′ UU overhang of one strand of the siRNA).
(155) The double-stranded siRNAs of the present disclosure may be introduced into mammalian cells in vitro or in vivo using known techniques, as described below, to suppress expression of the inflammasome.
(156) Similarly, transcription vectors containing the DNAs of the present disclosure can be introduced into cells (e.g., bladder cells) in vitro or in vivo using known techniques, as described below, for transient or stable expression of RNA, again to suppress expression of the inflammasome.
(157) Accordingly, the present disclosure also provides a method of suppressing inflammasome expression in a mammalian, e.g. human, cell, the method comprising administering to the cell a double-stranded siRNA of the present disclosure or a transcription vector of the present disclosure.
(158) Similarly, the present disclosure further provides a method of treating a pathogenically-induced and/or chemically-induced bladder inflammation or neuroinflammation in a subject in the subject, the method comprising administering to a subject a double-stranded siRNA of the invention or a transcription vector of the present disclosure.
(159) The present disclosure further provides the double-stranded siRNAs of the present disclosure and the transcription vectors of the present disclosure, for use in a method of treatment, preferably a method of treating a pathogen-induced and/or chemical-induced bladder inflammation or neuroinflammation in a subject.
(160) The present disclosure further provides the use of the double-stranded siRNAs of the present disclosure and the transcription vectors of the present disclosure in the preparation of a medicament for the treatment of a pathogenically-induced and/or chemically-induced bladder inflammation or neuroinflammation in a subject in a subject.
(161) The present disclosure further provides a composition comprising a double-stranded siRNA of the present disclosure or a transcription vector of the present disclosure in admixture with one or more pharmaceutically acceptable carriers. Suitable carriers include lipophilic carriers or vesicles, which may assist in penetration of the cell membrane.
(162) Materials and methods suitable for the administration of siRNA duplexes and DNA vectors of the present disclosure are well known in the art and improved methods are under development, given the potential of RNAi technology.
(163) Generally, many techniques are available for introducing nucleic acids into mammalian cells. The choice of technique will depend on whether the nucleic acid is transferred into cultured cells in vitro or in vivo in the cells of a patient. Techniques suitable for the transfer of nucleic acid into mammalian cells in vitro include the use of liposomes, electroporation, microinjection, cell fusion, DEAE dextran and calcium phosphate precipitation. In vivo gene transfer techniques include transfection with viral (typically retroviral) vectors and viral coat protein-liposome mediated transfection.
(164) In particular, suitable techniques for cellular administration of the nucleic acids of the present disclosure both in vitro and in vivo are known in the art, and include: RNA interference; Gene silencing in mammals by small interfering RNAs; Gene silencing mediated by small interfering RNAs in mammalian cells; RNAi: gene-silencing in therapeutic intervention; Systemic delivery using liposomes: Efficient delivery of siRNA for inhibition of gene expression in postnatal mice; Effective expression of small interfering RNA in human cells; Gene silencing by systemic delivery of synthetic siRNAs in adult mice; Virus mediated transfer; Lentiviral-mediated RNA interference; Retroviral delivery of small interfering RNA into primary cells; Retrovirus-delivered siRNA; Gene silencing by adenovirus-delivered siRNA; Peptide delivery. Other technologies that may be suitable for delivery of siRNA to the target cells are based on nanoparticles or nanocapsules.
(165) Another aspect of the present disclosure is a composition comprising an inflammasome inhibitor and a pharmaceutically acceptable carrier or excipient.
(166) In some embodiments, the inflammasome inhibitor is a NLRP3 inflammasome inhibitor. In some embodiments, the inflammasome inhibitor is glyburide, 2-mercaptoethane sulfonate sodium (Mesna), CY09, MCC950, 3,4-Methylenedioxy-β-nitrostyrene (MNS), Tranilast (N-[3′,4′-dimethoxycinnamoyl]-anthranilic acid, TR), OLT1177, Oridonin, 16673-34-0, JC124, FC11A-2, parthenolide, Z-VAD-FMK, Bay 11-7082, aloe vera, curcumin, artesunate, dapansutrile, glybenclamide, Epigallocatechin-3-gallate (EGCG), Genipin, red ginseng extract (RGE), isoliquiritigenin (ILG), NBC 6, NBC 19 INF 39, OXSI 2, (R)-Shikonin, INF 4E, CRID3 sodium salt, Mangiferin, propolis, quercetin, resveratrol, or Sulforaphane (SFN), or combinations thereof.
(167) In some embodiments, the composition comprises an inflammasome inhibitor and an antidepressant agent. In some embodiments, the antidepressant agent is fluoxetine.
(168) Administration of Inflammasome Inhibitors
(169) The inflammasome inhibitors may be administered to a subject, either alone or as a composition comprising the inflammasome inhibitor and a pharmaceutically acceptable carrier/excipient (i.e., a pharmaceutical composition), in an amount sufficient to induce an appropriate response in the subject.
(170) The present disclosure further provides for the administration to a subject an effective amount of an inflammasome inhibitor for use with the methods disclosed herein. An “effective amount” as used herein means an amount which provides a therapeutic or prophylactic benefit. Effective amounts of the compositions/pharmaceutical compositions provided herein can be determined by a physician with consideration of individual differences in age, weight, tumor size, extent of infection or metastasis, and condition of the patient (subject). The optimal dosage and treatment regime for a particular patient can readily be determined by one skilled in the art of medicine by monitoring the patient for signs of disease and adjusting the treatment accordingly.
(171) An effective amount of the composition(s) described herein can be given in one dose, but is not restricted to one dose. Thus, the administration can be two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more, administrations of the vaccine. Where there is more than one administration in the present methods, the administrations can be spaced by time intervals of one minute, two minutes, three, four, five, six, seven, eight, nine, ten, or more minutes, by intervals of about one hour, two hours, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours, and so on. In the context of hours, the term “about” means plus or minus any time interval within 30 minutes. The administrations can also be spaced by time intervals of one day, two days, three days, four days, five days, six days, seven days, eight days, nine days, ten days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, and combinations thereof. The invention is not limited to dosing intervals that are spaced equally in time, but encompass doses at non-equal intervals, such as a priming schedule consisting of administration at 1 day, 4 days, 7 days, and 25 days, just to provide a non-limiting example.
(172) A “pharmaceutically acceptable excipient and/or carrier” or “diagnostically acceptable excipient and/or carrier” includes but is not limited to, sterile distilled water, saline, phosphate buffered solutions, amino acid-based buffers, or bicarbonate buffered solutions. An excipient selected and the amount of excipient used will depend upon the mode of administration. Administration comprises an injection, infusion, or a combination thereof.
(173) An effective amount for a particular subject/patient may vary depending on factors such as the condition being treated, the overall health of the patient, the route and dose of administration and the severity of side effects. Guidance for methods of treatment and diagnosis is available (see, e.g., Maynard, et al. (1996) A Handbook of SOPs for Good Clinical Practice, Interpharm Press, Boca Raton, Fla.; Dent (2001) Good Laboratory and Good Clinical Practice, Urch Publ., London, UK).
(174) A dosing schedule of, for example, once/week, twice/week, three times/week, four times/week, five times/week, six times/week, seven times/week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, and the like, is available for the invention. The dosing schedules encompass dosing for a total period of time of, for example, one week, two weeks, three weeks, four weeks, five weeks, six weeks, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, and twelve months.
(175) Provided are cycles of the above dosing schedules. The cycle can be repeated about, e.g., every seven days; every 14 days; every 21 days; every 28 days; every 35 days; 42 days; every 49 days; every 56 days; every 63 days; every 70 days; and the like. An interval of non-dosing can occur between a cycle, where the interval can be about, e.g., seven days; 14 days; 21 days; 28 days; 35 days; 42 days; 49 days; 56 days; 63 days; 70 days; and the like. In this context, the term “about” means plus or minus one day, plus or minus two days, plus or minus three days, plus or minus four days, plus or minus five days, plus or minus six days, or plus or minus seven days.
(176) The composition(s) according to the present disclosure may also be administered with one or more additional therapeutic agents. Methods for co-administration with an additional therapeutic agent are well known in the art.
(177) Co-administration can refer to administration at the same time in a subject, but can also include administrations that are spaced by hours or even days, weeks, or longer, as long as the administration of the one or more therapeutic agents is the result of a single treatment plan. The co-administration can comprise administering the composition(s) of the present disclosure before, after, or at the same time as the additional therapeutic agent. By way of example, the composition(s) of the present disclosure can be given as an initial dose in a multi-day protocol, with additional therapeutic agent(s) given on later administration days; or the additional therapeutic agent(s) given as an initial dose in a multi-day protocol, with the composition(s) of the present disclosure given on later administration days. On another hand, one or more additional therapeutic agent(s) and the composition(s) of the present disclosure can be administered on alternate days in a multi-day protocol. In still another example, a mixture of one or more additional therapeutic agent(s) and the compositions of the present disclosure can be administered concurrently. This is not meant to be a limiting list of possible administration protocols.
(178) An effective amount of a therapeutic agent is one that will decrease or ameliorate the symptoms normally by at least 10%, more normally by at least 20%, most normally by at least 30%, typically by at least 40%, more typically by at least 50%, most typically by at least 60%, often by at least 70%, more often by at least 80%, and most often by at least 90%, conventionally by at least 95%, more conventionally by at least 99%, and most conventionally by at least 99.9%.
(179) Formulations of the one or more therapeutic agents can be prepared for storage by mixing with physiologically acceptable carriers, excipients, or stabilizers in the form of, e.g., lyophilized powders, slurries, aqueous solutions or suspensions.
(180) The following Examples are provided by way of illustration and not by way of limitation.
EXAMPLES
(181) Materials and Methods for Examples 1-7
(182) Experimental Approach
(183) The approach in this study is three-pronged: 1) in vitro analysis of the activation of the inflammasome in normal mouse urothelia by diabetic-associated DAMPS; 2) in vivo urinary function (cystometry) in diabetic mice with a genetic deletion of NLRP3 and 3) quantitation of nerve densities in the bladders of these mice to assess potential changes in specific nerves thought mediate specific DBD symptoms.
(184) Animals
(185) All protocols adhere to the NIH Guide for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee at Duke University Medical Center. Founder mice from The Jackson Laboratory (Bar Harbor, Mass.) consisted of Akita (C57BL/6J-Ins2Akitaa mice; stock number: 003548) (Wang et al. (1999) The Journal of clinical investigation 103:27-37) and NLRP3.sup.−/− (B6.129S6-Nlrp3.sup.tm1Bhk/J (stock number: 021302) mice (Kovarova et al. (2012) Journal of immunology 189:2006-2016). While the strain of origin for the NLRP3.sup.−/− mice (12956/SvEvTac) is different from the Akita background (C57BL/6J) these mice have been backcrossed to C57BL/6J for >11 generations (www.jax.org). Mice were bred by the Breeding Core Facility at Duke University through an independently approved protocol and only female mice were used. All animals were genotyped by Transnetyx, Inc. (Cordova, Tenn.) and provided to the laboratory around 4 weeks of age.
(186) The results of genotyping were used to assign them to one of the 4 experimental groups. Nondiabetics are “nondiab” and diabetics are “diab”. The groups are 1. NLRP3.sup.+/+, nondiab,—homozygote wt NLRP3 genes, homozygote wt Ins2 genes—i.e. control mice 2. NLRP3.sup.+/+, diab—homozygote wt NLRP3 genes; heterozygote for Akita mutation at the Ins2 gene—i.e. Akita diabetic control. 3. NLRP3.sup.−/−, nondiab—both NLRP3 genes knocked out, homozygote wt Ins2 genes—i.e. NLRP3 knockout control. 4. NLRP3.sup.−/−, diab,—both NLRP3 genes knocked out, heterozygote for Akita mutation at the Ins2 gene. This is the experimental mouse generated for this study.
(187) Animals were received at 5 weeks of age. Blood glucose becomes high in Akita mice (200-300 mg/dL) around 4 weeks of age and remains high thereafter (Yoshioka et al. (1997) Diabetes 1997; 46:887-894; Dolber et al. (2013) Neurourology and urodynamics 34:72-8). Mice were grown to 15 weeks when DBD becomes apparent (Inouye et al. (2018) Res Rep Urol 10:219-225). No changes in urinary dysfunction were found at previous time points (Inouye et al. (2018) Res Rep Urol 10:219-225).
(188) In Vitro Experiments
(189) NLRP3.sup.+/+, nondiab mice (i.e. control littermates) were used at 7-8 weeks of age. Urothelial cells were isolated (Kloskowski et al. (2014) Hum Cell 27:85-93) and plated (black-walled 96 well plates) at 50,000 cells/well in 90 μl complete media [F-12K media, 10% low-endotoxin dialyzed fetal bovine serum, 10 μM non-essential amino acids (all HyClone Laboratories, Logan, Utah), 1.0 μg/ml hydrocortisone (Sigma-Aldrich, St. Louis, Mo.), 10 μg/ml insulin, 5 μg/ml transferrin and 6.7 ng/ml selenium (ITS, Gibco, Gaithersburg, Md.). Following a 24 hr incubation (37° C., 95% air/5% CO.sub.2), DAMPS (10 μl) were added and incubated as indicated. 1 h prior to harvest 1.25 mM ATP was added to untreated wells. In studies that examined ATP doses, cells were plated for 24 h, then treated with 1 μg/ml LPS (E Coli 055:B5; Sigma) in PBS or PBS alone for 24 h before treatment with the indicated doses of ATP for 1 h. Caspase-1 activity was then measured as previously described (Hughes et al. (2015) Int Urol Nephrol 47:1953-1964). Control florescence (0 mM DAMP) was subtracted from all wells and results normalized to the ATP response (except for the ATP dose response studies).
(190) Histological Preparation
(191) Bladders were formalin-fixed and paraffin-embedded in a transverse orientation. Sections (5 μm) from the lower third of the bladder were stained with anti-NLRP3 (1:100; cat #LS-C334192; Life Span BioSciences, Inc., Seattle, Wash.), anti-PGP9.5 (1:200; cat #381000; ThermoFisher, Waltham, Mass.), anti-Neurofilament 200 (NF-200; Aδ-fibers; 1:200, cat #N4142, Sigma-Aldrich, St. Louis, Mo.) or anti-Calcitonin Gene Related Peptide (CGRP; C-fibers; 1:80, cat #PC205L, Calbiochem, Burlington, Mass.) antibodies using standard methods and citrate antigen retrieval. Staining was visualized with secondary antibodies conjugated to either Alexa Fluor 488 (NLRP3, NF-200 and CGRP) or HRP (PGP9.5; developed with Vectastain ABC Staining Kit; Vector Laboratories, Burlingame, Calif.). All sections were imaged on a Zeiss Axio Imager 2 microscope (Zeiss, Oberkochen, Germany) running Zen software (Zeiss). Tiling micrographs encompassing the entire cross section were captured by the software and stitched into a continuous image. Calibration bars were inserted and images exported as TIFF files.
(192) FAM-FLICA Caspase-1 Assay
(193) Caspase-1 activity was assessed using the FAM-FLICA Caspase-1 Assay Kit (ImmunoChemistry Technologies, Bloomington, Minn., USA) and the manufacturer's recommended protocol. Cells were analyzed on a FACSCalibur flow cytometer (BD-Bioscience; San Jose, Calif.) (excitation 488 nm, emission 533 nm) and dot plots of forward versus side scatter were used to gate on single cells. Histograms were created and gates were drawn to allow quantitation of the mean florescent intensity (MFI). The geometric mean of the MFI (the Geo Mean) of each sample was used for comparisons.
(194) Blood Glucose
(195) Blood from the submandibular vein was assessed with the AimStrip Plus blood glucose testing system (Germaine Laboratories, San Antonio, Tex.).
(196) Evans Blue Dye Extravasation
(197) Extravasation of Evans blue dye is a direct measurement of vascular permeability which is increased during inflammation. Thus, movement of this dye into a tissue is used as an indirect measurement in inflammation (Hughes et al. (2014) American journal of physiology Renal physiology 306:F299-308; Hughes et al. (2016) The Journal of urology 195:1598-1605; Hughes et al. (2016) J Clin Cell Immunol 7:396; Inouye et al. (2018) Res Rep Urol 10:219-225). In this study mice were injected (i.v.) with 10 mg/kg dye in saline and 1 h later sacrificed. Bladders were weighed and incubated overnight (56° C.) in 1 ml formamide and the absorbance (620 nM) of the formamide measured. Dye amounts were calculated from a standard curve and normalized to bladder weight.
(198) Cystometry
(199) Awake restrained cystometry was performed (Hughes et al. (2014) American journal of physiology Renal physiology 306:F299-308; Hughes et al. (2016) The Journal of urology 195:1598-1605; Hughes et al. (2016) J Clin Cell Immunol 7:396; Inouye et al. (2018) Res Rep Urol 10:219-225). One week prior, suprapubic tubes (PE-10 tubing with a flared end) were implanted in the bladder and secured with a purse string suture (6-0 silk). The tube was externalized at the back of the neck. One week later animals were placed in a Ballman-type restrainer (Natsume Seisakusho Co., Tokyo, Japan) inside of a Small Animal Cystometry Lab Station (Med Associates, St. Albans, Vt.) and positioned above an analytical balance to measure voided volume. The catheter was connected to a syringe pump via an in-line pressure transducer and sterile saline infused at 15 μl/min for 60-120 min. Scale and pressure readings were continuously recorded with Med-CMG software (Med Associates, St. Albans, Vt.). After voiding cycles stabilized (typically 3-4 cycles) an additional 3-8 cycles were recorded for quantitation. Immediately after the last void, infusion was stopped, the catheter attached to a 3 ml syringe and the plunger was withdrawn for 10-15 sec to recover any PVR. CMG Analysis software (version 1.06; Med Associates, St. Albans, Vt.) was used to analyze voiding cycles, defined as the time intravesicular pressure returned to baseline after a previous void until it returned to baseline following the next void. Voiding pressure is defined as the peak intravesical pressure, void volume as the amount of change on the scale and frequency as the number of voids per hour. Voiding efficiency was calculated as 100×the voiding volume divided by the bladder capacity (void volume+PVR).
(200) Analysis of Nerve Densities
(201) Quantitation of PGP9.5 and Aδ-nerve density in the bladder wall was carried out exactly as previously described (Lutolf et al. (2018) Neurourology and urodynamics 37:952-959) while quantitation of C-fibers in the urothelium required only minor modifications. Briefly, TIFF files were imported into NIS-Elements software (Nikon Co., Tokyo, Japan), calibrated and the bladder wall or urothelia layer demarcated (the ROI) and area calculated. PGP9.5.sup.+ neurons were defined as black/brown spots>50 um.sup.2. Aδ-fibers were defined as fluorescent areas>50 um.sup.2 that stained positive with a nuclear co-stain (DAPI). C-fibers were defined as continuous fluorescent fibers>1 μm. Neuronal density in a given section was calculated by dividing the number of nerves by the μm.sup.2 of the ROI.
(202) Statistical Analysis
(203) All parameters were assessed by either a two-tailed Students T-test or a one-way analysis of variance (ANOVA) followed by a Tukey's post-hoc analysis. Both analyses used GraphPad InStat software (La Jolla, Calif.) and statistical significance was defined as p<0.05.
Example 1: Diabetic DAMPS Activate the Inflammasome In Vitro
(204) To assess the ability of diabetic DAMPS to trigger inflammasome activation, urothelial cells were treated in vitro and caspase-1 activity measured (Hughes et al. (2015) Int Urol Nephrol 47:1953-1964). ATP was prepared as a 25 mM stock in complete media (pH adjusted with 0.5 N NaOH) and dilutions made with complete media. The indicated final doses of ATP (in 10 μl) were then added to cells for 1 h prior to caspase-1 analysis. ATP, the quintessential NLRP3-activating DAMP, elicited a classic dose response (
(205) Discussion:
(206) The diabetic bladder is unique in that tissue damage can be caused by two independent mechanisms; 1) polyuria and 2) hyperglycemia. Here, the data demonstrate that it is the NLRP3 inflammasome, located within the urothelium, senses and responds to metabolic dysregulation by initiating an inflammatory response. Most importantly, diabetic mice lacking the NLRP3 gene do not develop diabetic bladder dysfunction.
(207) Numerous diabetic DAMPS activated the NLRP3 inflammasome in vitro, demonstrating their pro-inflammatory potential. Interestingly, activation of NLRP3 did not require priming as in most cell types (Hughes et al. (2014) American journal of physiology Renal physiology 306:F299-308). While atypical, this has been reported and suggests urothelia either do not require priming or are already primed when isolated, possibly through exposure to the commensal microbiome (Patel et al. (2017) Trends Mol Med 23:165-180). As shown herein, streptozotocin is an activator of NLRP3. Streptozotocin is not a diabetic metabolite but rather a pancreatic toxin commonly used to induce diabetes in experimental models. These results discouraged the use of that model in DBD studies.
Example 2: NLRP3 is Activated During Diabetes
(208) To explore a role for the inflammasome in DBD it is essential to demonstrate that it is activated in the bladder by diabetes. Urothelia were isolated and stained with a FAM-FLICA Caspase-1 Assay Kit (Immunochemistry Tech., Bloomington, Minn.) as described. All mice were examined at 15 weeks of age.
Example 3: NLRP3 is Expressed in the Mouse Urothelia and its Distribution does not Change with Diabetes
(209) Although documented in rat (Hughes et al. (2015) Int Urol Nephrol 47:1953-1964; Hughes et al. (2014) American journal of physiology Renal physiology 306:F299-308), NLRP3 has never been examined in the mouse bladder. Sections of bladder (5 μm) from the indicated mice were stained for NLRP3 using standard immunocytochemistry and antigen retrieval protocols along with an Alexa Flour 488 conjugated secondary antibody. Isotype controls used normal rabbit serum instead of primary antibodies. n=3 (nondiabetic), 4 (diabetic). As shown in
Example 4: The NLRP3.SUP.−/− Genotype does not Affect Blood Glucose in the Diabetic
(210) To assess a role for NLRP3 in DBD numerous endpoints were explored both in nondiabetic and diabetic animals with intact NLRP3 (NLRP3.sup.+/+) and nondiabetic and diabetic mice with NLRP3 genetically deleted (NLRP3.sup.−/−). Blood glucose levels were assessed at week 15 using the AimStrip Plus blood glucose testing system. Blood glucose levels in these groups is shown in
Example 5: Inflammation is Present in the Diabetic Bladder and is Mediated Through NLRP3
(211) While there is general evidence that inflammation is present in many tissues during diabetes, there is little or no evidence in the bladder. Therefore, the Evans blue dye extravasation assay, which is a direct measure of vascular permeability and an indirect measure of inflammation, was used to gain insight into inflammation in the diabetic bladder. The effect of diabetes on the induction of inflammation in the bladder was assessed in the presence and absence of NLRP3 using the Evans Blue dye extravasation assay described in the Methods section. As shown in
(212) Discussion:
(213) It has been shown that bladder inflammation and DBD develop in the Akita diabetic mouse by 15 weeks Inouye et al. (2018) Res Rep Urol 10:219-225). In that study (and this), extravasation of Evans blue was pronounced. This study also demonstrated a concurrently activation of the inflammasome. To investigate the role of NLRP3, the Akita mouse was crossed with an NLRP3.sup.−/− strain to create a unique substrain of diabetic mice lacking this inflammasome. Deletion of NLRP3 did not affect serum glucose levels but it did abolish the inflammatory response in the diabetic. Therefore, it appears urothelial NLRP3 is indeed capable of sensing the metabolic dysregulation of diabetes and promoting an inflammatory response.
Example 6: NLRP3 is Responsible for Bladder Dysfunction Associated with DBD
(214) To investigate the effects of NLRP3 on bladder dysfunction, cystometry was performed at 15 weeks of age on the four experimental groups (Schneider et al. (2015) BJU international 115:8-15).
(215) Quantitative summaries are shown in
(216) The development of DBD, while complex, is thought to progress from an early, OAB phenotype to a later stage underactive bladder (UAB) characterized by increased post-void residual (PVR) volumes and decreased voiding efficiency (Gomez et al. (2011) Current urology reports 12:419-426). This UAB phenotype is indicative of a decompensated bladder. In the diabetic mouse at 15 weeks (
(217) Discussion
(218) Cystometrically, the diabetic animal model demonstrate clear signs of early DBD at 15 weeks with decreased voiding volume, increased frequency and increased PVR. In the absence of NLRP3, diabetes did not change the frequency or void volume, unequivocally demonstrating that NLRP3 is responsible for the urinary changes of DBD. Interestingly, the diabetic bladder retained a significant PVR typically associated with later stage DBD and underactive bladder, thus suggesting that the transition towards a decompensated state has begun. Importantly, in the absence of NLRP3, the bladder maintained normal voiding volumes and efficient emptying, showing the importance of NLRP3 in the transition to decompensation where there is a much greater risk of complications such as infection and stone formation.
Example 7: NLRP3 Controls Changes in the Densities of Nerves Related to Specific DBD Symptoms
(219) DBD is associated with peripheral neuropathy and one gauge of neuropathy in a tissue is the alteration in nerve number and/or density which would be expected to decrease in diabetes and may be dependent on the NLRP3 inflammasome. To examine neuropathy in the bladder total nerves were quantitated using PGP9.5 as a pan neuronal marker in the bladder wall (Thompson et al. (1983) Brain research 278:224-228). Representative staining is shown in
(220) Next, the specific nerve types thought to underlie individual bladder symptoms in diabetics were assessed. First, bladder fullness is relayed to the CNS via Aδ-fibers and patients often report a reduced sensation of bladder fullness. Thus, there may be a decrease in the number and/or density of these fibers in the diabetic mice which may be driven by the NLRP3 inflammasome. Because Aδ-fibers are predominantly in the bladder wall, they were quantitated in this compartment. Representative staining is shown in
(221) C-fibers are associated with an OAB phenotype (38) which is common in early stage diabetic patients and also apparent in our mice at 15 weeks of age (
(222) Discussion:
(223) While traditional concepts of DBD postulated that the sole pathological cause was autonomic neuropathy (Kaplan et al. (1988) J Diabet Complications 2:133-139), more conventional views recognize multifactorial disturbances (Liu et al. (2014) Chinese medical journal 127:1357-1364). Considering the known association between peripheral neuropathy and the development of DBD (Tanik et al. (2016) Int Neurourol J 2016; 20:232-23), various DBD-related symptoms could result from deleterious effects on the nerves within the bladder and decreased nerve density in the bladder wall in the diabetic mice was observed. Furthermore, the effects on different types of nerves vary. The Aδ-fibers, which sense fullness in the bladder, were decreased in the bladder wall and this may explain why a diminished sense of fullness is often reported with diabetic patients. On the other hand, the C-fiber population in the urothelium increased in the diabetic bladders. C-fibers normally sense pain but they are also associated with the emergence of an overactive bladder phenotype (Fowler (2002) Urology 59:37-42) which is common in early stage diabetic patients. Thus, the differential effects of inflammation on these two types of nerves provide a possible explanation for the specific symptoms associated with DBD.
(224) The current study provides a convincing mechanism whereby a plethora of diabetic insults converge on NLRP3 in the urothelia and translate into inflammation and damage to the bladder. These insults include ATP and numerous metabolites but also likely include additional insults such as reactive oxygen species, created from excessive oxidative phosphorylation, and ischemia which is a well-known activator of NLRP3 that recent studies suggest play a role in DBD (Gotoh et al. (2018) Neurourology and urodynamics 37:666-672). The signal emanating from the urothelia to trigger effects in the other bladder tissues has unidentified but likely attributable to the major products of the inflammasome, IL-1β and IL-18, acting in a paracrine fashion. Indeed it has been shown that IL-1β is responsible for the decrease in PGP9.5.sup.+ nerves in the bladder wall in a rat model of bladder outlet obstruction (Lutolf et al. (2018) Neurourology and urodynamics 37:952-959) and that IL-1β is implicated it in bladder smooth muscle hypertrophy (Haldar et al. (2015) The Journal of biological chemistry 290:6574-6583).
(225) The central role of NLRP3 in development of DBD suggests a strategy for the prevention and management of this diabetic complication. According to the DCCT trial, only 58% of patients are able to maintain the strict glycemic control favored by the American Diabetic Association (Selvin et al. (2014) Ann Intern Med 160:517-525). While strict regulation does prevent retinopathy, nephropathy and other diabetic complications, bladder dysfunction still remains a problem for these patients (Genuth et al. (2006) Endocr Pract 12 Suppl 1:34-41; Sarma et al. (2009) Urology 73:1203-1209). The present study demonstrates that NLRP3 inhibitors can prevent or treat DBD and possibly other diabetic complications where this pathway plays a central role.
(226) The results clearly show that activation of the NLRP3 inflammasome, possibly by diabetic metabolites, underlies bladder dysfunction and denervation during DBD in mice and therefore may serve as a critical pharmacological target for combating this complication in humans.
(227) Materials and Methods for Examples 8-10
(228) Animals
(229) All protocols adhere to the NIH Guide for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use committee at Duke University Medical Center. Female Sprague Dawley rats (≈200 grams, 40-50 days of age, Envigo, Indianapolis, Ind.) were used in all studies.
(230) Cell Isolation
(231) The cell isolation protocol was modified from a previously published method (Hughes et al. (2018) Diabetes 68:430-440; Kloskowski et al. (2014) Hum Cell. 27(2):85-93). Briefly, rats were sacrificed and the bladders removed and placed in sterile PBS. Bladders were then inverted over an 18-gauge blunt tip needle, inflated with PBS, and a purse string suture was used to tie off the bladder. The inflated bladder was then submerged in Collagenase P (1 mg/ml in complete media) and shaken for 1 hour at 37° C. Cells were then passed through a 40 μm nylon mesh to remove debris, pelleted and resuspended in complete media [F-12K media (HyClone Laboratories, Logan, Utah) supplemented with 10% low-endotoxin dialyzed fetal bovine serum (HyClone Laboratories, Logan, Utah), 10 μM non-essential amino acids (HyClone Laboratories, Logan, Utah), 1.0 μg/ml hydrocortisone (Sigma-Aldrich, St. Louis, Mo.), 10 μg/ml insulin (Gibco Laboratories, Gaithersburg, Md.), 5 μg/ml transferrin (Gibco Laboratories, Gaithersburg, Md.), 6.7 ng/ml selenium (Gibco Laboratories, Gaithersburg, Md.), 100 U/mL penicillin (Gibco Laboratories, Gaithersburg, Md.), and 100 μg/mL streptomycin (Gibco Laboratories, Gaithersburg, Md.)]. Cells were counted and plated at 50,000 cells/well in 90 μl complete media in black-walled 96-well plates. Cells were then incubated in a water-saturated environment for 24 hours at 37° C., 95% air, and 5% CO.sub.2. Media was removed and replaced with fresh media (90 μL for agonist studies, 80 μL for inhibitor studies) just prior to the start of experimental treatments.
(232) Experimental Treatments
(233) In vitro experiments were performed essentially as previously described in the Materials and Methods for Examples 1-7. For agonist response studies, CPPD and MSU (InvivoGen, San Diego, Calif.) were prepared to the stock concentrations of 1.25 mg/mL and 12.5 μg/mL, respectively. Using PBS (for CPPD) or complete media (for MSU), 1:2 serial dilutions were prepared. Wells were then treated with 10 μL of the appropriate dilution of stone DAMP for a final volume of 100 μL. After treatment, cells were incubated for another 24 hours at 37° C.
(234) For inhibition response studies, the general ROS scavenger N-acetylcysteine was prepared to the stock concentration of 5 mM for MSU treatment and to 50 mM for CPPD treatment. Prior to treatment, the stock concentration of NAC was buffered to pH 7.2. Verapamil was prepared to a stock concentration of 1.5 mM for serial dilution and cell treatment. Using complete media for NAC and PBS for Verapamil, 1:2 serial dilutions were prepared. Cells were treated with 10 μL of NAC or Verapamil and incubated at 37° C. for 1 or 4 hours, respectively. After pre-treatment, cells were then treated with 10 μL of CPPD (62.5 μM final) or MSU (1.25 μM final) to a final volume of 100 μL. Plates were then incubated for an additional 24 hours at 37° C. One hour prior to the end of the incubation, untreated control wells were administered 1.25 mM ATP to serve as a standard for maximal caspase response.
(235) Caspase-1 Assay
(236) The caspase-1 assay was performed as reported (Hughes et al. (2015) Int Urol Nephrol. 47(12):1953-1964). Briefly, media was removed and cells lysed in 50 μl lysis buffer (10 mM MgCl.sub.2 and 0.25% Igepal CA-630) for 5 minutes. An additional 50 μL of storage buffer (40 mM HEPES (pH 7.4), 20 mM NaCl, 2 mM EDTA and 20% glycerol) was added, and the plates frozen at −80° C. until use (>30 minutes). Plates were then thawed and 50 μl of 50 mM Hepes with 10% Sucrose and 0.1% CHAPS, 10 μl dithiothreitol (final concentration of 5.5 mM), and 20 μl Z-YVAD-AFC substrate (final concentration of 110 μM) were added to each well. Plates were then incubated in the dark for 1 hour at 37° C. with mild shaking. Florescence was then measured (excitation 400 nm, emission 505 nm). Florescence in untreated wells (0 mM stone DAMP) was subtracted from all wells and results normalized to the ATP response. Results were reported as a percentage of ATP response.
(237) Statistical Analysis
(238) Statistical analysis was performed by a one-way analysis of variance followed by a Dunnett's post-hoc analysis using GraphPad InStat software (La Jolla, Calif.).
Example 8: CPPD, MSU, and Calcium Oxalate Produce a Dose-Dependent Increase in Caspase-1 Activation
(239) To determine if stone DAMPs activate caspase-1, urothelial cells were incubated overnight prior to treatment with calcium pyrophosphate (CPPD), monosodium urate (MSU), or calcium oxalate for 24 hours. Additional wells were treated with 1.25 mM ATP for 1 hour to indicate maximal caspase-1 activation and DAMP-treated wells were normalized to these ATP-treated wells. CPPD triggers a robust and dose-dependent activation of caspase-1 in isolated urothelium in vitro, with a maximal response of approximately 50% of the ATP response and an EC.sub.50 of 62.5 μg/mL (
Example 9: N-Acetylcysteine Inhibits Caspase-1 Activation in Cells Treated with Stone DAMPs
(240) To determine if CPPD and MSU signal for inflammasome activation in the urothelia through ROS, the general ROS scavenger N-acetylcysteine (NAC) was utilized. Urothelial cells were incubated overnight and then treated with decreasing concentrations of NAC for 1 hour before treatment with 62.5 μg/mL CPPD or 1.25 μg/mL MSU for 24 hours. The caspase-1 assay was then performed as described in the Materials and Methods section. CPPD-treated cells had a higher IC.sub.50 (625 μM) versus MSU-treated cells (IC.sub.50=31.25 μM). As shown in
(241) Discussion:
(242) This study provides the first exploration into the urinary DAMP-ROS-NLRP3 inflammasome pathway within the urothelium. It was found that NLRP3 is activated in vitro in urothelial cells by two common stone-forming components. Importantly, it was also found that NLRP3 is mediated through an upregulation in intracellular ROS and release of TXNIP from thioredoxin. Specifically, the general ROS scavenger NAC was able to prevent inflammasome activation in both CPPD and MSU-treated urothelial cells. Further, directed targeting of a ROS-responsive protein (TXNIP) that forms a structural component of the NLRP3 inflammasome was also able to prevent inflammasome activity. These findings demonstrate a ROS-driven pathway in stone-induced urothelial inflammation that relies on the TXNIP protein for functionality.
Example 10: Verapamil Inhibits Caspase-1 Activation
(243) Verapamil (Ver) is a calcium channel blocker that has been shown to downregulate the expression of the NLRP3 binding protein TXNIP (Melone et al. (2018) Pharm Res. 35(2):44; Xu et al. (2012) Diabetes 61(4):848-856), and thus has been used in several studies to assess a role for this critical structural component of the NLRP3 inflammasome in DAMP pathways mediated by ROS (Abais et al. (2014) Journal of biological chemistry 289(39):27159-27168; Xu et al. (2019) Oxid Med Cell Longev 1896041). Urothelial cells were incubated overnight and then treated with decreasing concentrations of Verapamil for 4 hours before treatment with 62.5 μg/mL CPPD or 1.25 μg/mL MSU for 24 hours. The caspase-1 assay was then performed as described in the Materials and Methods section. Both CPPD and MSU-treated cells had the same IC.sub.50 (100 μM). As shown in
(244) Discussion:
(245) Interestingly, while NAC and Verapamil both were able to abolish inflammasome activation by CPPD and MSU, there were exciting differences in their respective abilities to do so. First, NAC doses required to completely inhibit inflammasome activation were higher in cells treated with CPPD (5 mM) compared to MSU (500 μM). This differential response is possibly the result of differences in intracellular ROS production by the various stone DAMPs. Second, there were no differences in treatment dose of Verapamil required to completely inhibit inflammasome activation in either CPPD or MSU-treated cells. Maximal inhibition of caspase-1 activity was seen at a Verapamil dose of 150 μM after treatment with either stone DAMP. Therefore, it appears that functional TXNIP is required for the activation of NLRP3 regardless of the magnitude of ROS production. Based on these findings, targeted therapies aimed at impeding different steps within this pathway may be useful to inhibit stone-mediated inflammasome activity.
(246) NAC is an FDA-approved medication that functions as a general ROS scavenger and acts as a precursor molecule for the regeneration of intracellular glutathione, another scavenger of ROS (Mokhtari et al. (2017) Cell J. 19(1):11-17). Clinically, NAC is very effective in a number of patient populations, such as acetaminophen overdose, polycystic ovarian syndrome, and chronic bronchitis. While the usefulness of NAC in these patient populations is well-established, its potential in treating urinary DAMP-mediated bladder inflammation has never before been explored. Our findings suggest that this drug may be a useful tool in turning off bladder inflammation caused by urinary DAMPs, thereby allowing for reduction in inflammatory complications.
(247) Verapamil is a non-dihydropyridine calcium channel blocker used in a number of medical conditions, such as hypertension, angina, and cluster headaches. An early study suggested that its calcium channel blocking ability might reduce the level of stone forming components in the urine, but a subsequent study did not corroborate this finding (Iguchi et al. (1993) Hinyokika Kiyo. 39(5):425-431; Sarica et al. (2007) Urological research 35(1):23-27). However, in this study, verapamil's ability to downregulate expression of TXNIP (Chen et al. (2009) American J. of physiology Endocrinology and metabolism. 296(5):E1133-1139; Al-Gayyar et al. (2011) British J. of pharmacology 164(1):170-180) proved a useful tool to block stone-DAMP activation of NLRP3. Therefore, while it may not affect the concentration of stone forming moieties, it may actually protect the urinary tract from these pro-inflammatory urinary components.
(248) This study demonstrates that urinary stone-forming DAMPS activate NLRP3 in urothelial cells via ROS production and require the presence of TXNIP. This pathway is effectively blocked by the administration of the anti-oxidant, NAC, or by down-regulating TXNIP expression with verapamil. These agents can be useful in preventing lower urinary tract inflammation, pain, and risk of fibrosis and scarring in stone forming patients. More broadly, and the subject of future studies, many other urinary DAMPs could also activate the NLRP3 inflammasome and provoke an urothelial inflammatory response via the same pathway demonstrated in this investigation. It is well-known that consumption of certain foods, such as chocolate, alcohol, acidic juices, can exacerbate lower urinary tract symptoms in sensitive patients. Abstinence from these dietary factors is very effective, but that requires the identification of the specific item which can be challenging. If the pathway elucidated here is common to many other urinary DAMPs, then targeting ROS production, TXNIP expression and/or NLRP3 activation could be implemented as a treatment strategy even if the inciting factor is unknown. Additionally, it has been shown in Example 1 that diabetic metabolites are capable of activating NLRP3 in urothelium and this contributes to the development of diabetic bladder dysfunction (DBD). If future studies demonstrate that these metabolites have the same mechanism of action as the stone DAMPs (uric acid being an example of both) then targeting ROS production or TXNIP expression may be useful in preventing DBD.
(249) Conclusion
(250) Urinary stones are comprised of components that induce a state of inflammation, which can affect patients in a number of clinically meaningful ways. The present study suggests that this inflammation is due, in part, to the activation of the NLRP3 inflammasome by increased intracellular concentrations of ROS that impinge upon TXNIP. Importantly, this study illuminates steps in the pathway that can be pharmacologically targeted to potentially reduce complications of inflammation in stone patients.
(251) Materials and Methods for Examples 11-15
(252) Animals
(253) All protocols adhere to the NIH Guide for the Care and Use of Laboratory animals and were approved by the Institutional Animal Care and Use Committee at Duke University Medical Center. Female Sprague Dawley Rats (˜200 g) were randomly divided into groups to receive the various treatments shown in Table 1.
(254) TABLE-US-00001 TABLE 1 Groups and Treatments Group Vehicle Gly CP Mesna Fluoxetine Control 10% EtOH Glyburide 2.5 mg/kg CP 150 mg/kg CP + Gly 2.5 mg/kg 150 mg/kg CP + Mesna 150 mg/kg 40 mg/kg CP fluoxetine 5 mg/kg
(255) Not all treatments groups were used for all end points. The rats were then subjected to the dosing regimen shown in
(256) Bladder Weight
(257) Bladder weights were recorded at the time of euthanasia.
(258) Evans Blue Assay and Gross Analysis
(259) Inflammation in the bladder and inflammation/blood brain barrier permeability in the brain was measured using Evans blue dye (Belayev et al. (1996) Brain research 739: 88-96; Michels et al. (2015) Brain Behav Immun 43: 54-59). Rats were injected i.v. in the tail vein (2%, 3 ml/kg). One hour after injection, rats were euthanized and transcardially perfused through a ventricular catheter to remove intravascular dye. For gross analysis brains were isolated and sectioned coronally using a scalpel and photographed. For other analyses bladders were removed, weighed and placed into 1 ml formamide. The hippocampus and pons were dissected out, weighed and placed into 250 μl formamide. Samples were then incubated at 56° C. overnight with shaking. Absorbance was measured (620 nm) and the results calculated as pg Evans blue/μg tissue using a standard curve of Evans blue absorbance.
(260) Caspase-1 Activity
(261) Caspase-1 activity was measured using a fluorometric assay as previously described (28). Briefly, samples were homogenized in 200 μl of Lysis Buffer (10 mM MgCl.sub.2, 0.25% Igepal CA-630), centrifuged (10,000×g, 10 min) and the supernatant mixed with equal parts Storage Buffer [40 mM Hepes (pH 7.4), 20 mM NaCl, 2 mM EDTA, 20% glycerol. Extract (75 μl) was combined with 25 μl of a 1:1 combination of Lysis and Storage buffer, 50 μl assay buffer [25 mm HEPES (pH 7.5), 5% sucrose, 0.05% CHAPS], 10 μl 100 mM DTT and 20 μl 1 mM N-acetyl-Tyr-Val-Ala-Asp-7-Amino-4-trifluoromethylcoumarin (Ac-YVAD-AFC) in blacked-walled 96-well plates. Plates were incubated at 37° C. for 1 hour in the dark with mild shaking. Fluorescence (excitation: 400 nm, emission: 505 nm) was measured and compared with a standard curve of fluorescence versus free AFC to determine the rate of product production. Protein concentrations of sample aliquots were assessed by Bradford assay (Bradford (2004) Anal Biochem 72: 248-254) and rates were normalized to protein to calculate the specific activity of caspase-1.
(262) Quantitative PCR (qPCR)
(263) qPCR was performed by Gene Master LLC (Cary, N.C.) using their standard techniques. RNA was extracted using Trizol (Thermo Fisher, Waltham, Mass.) according to manufacturer's protocol and samples stored at −20° C. until transferred to Gene Master (<2 weeks). cDNA was then generated (Invitrogen Superscript III kit) and qPCR run in triplicate with validated primers (pro-IL-1β: forward primer: caccttcttttccttcatctttg (SEQ ID NO:01), reverse primer: tcgttgcttgtctctccttg (SEQ ID NO:02); pro-IL-18: forward primer: aggctcttgtgtcaacttcaaa (SEQ ID NO:03), reverse primer: agtctggtctgggattcgtt (SEQ ID NO:04); NLRP3: forward primer: gaagattacccacccgagaaa (SEQ ID NO:05), reverse primer: ccagcaaacctatccactcc (SEQ ID NO:06); ASC: forward primer: atctggaggggtatggcttg (SEQ ID NO:07), reverse primer: cttgttttggttgggggtct (SEQ ID NO:08)) using β-actin (forward primer: cccattgaacacggcatt (SEQ ID NO:09), reverse primer: accagaggcatacagggaca (SEQ ID NO:10)) as an internal control. Gene expression levels of vehicle-treated rats were averaged and normalized to a value of one. Results are presented as relative expression (fold increase) of the studied genes in treated rats compared to vehicle.
(264) Histological Analysis
(265) Whole brains were immersed in 10% neutral buffered formalin (RT, 48 h), sliced coronally and embedded in paraffin blocks with the cut hippocampal plane on the block face. Sections (10 μm) were then cut and stained with hematoxylin and eosin using routine methods. Sections were visualized using Olympus Vanox BH-2 microscope and analyzed by a board-certified pathologist (WTH) for evidence of inflammation and changes in microglia.
(266) Immunocytochemistry and Quantitation of Microglia
(267) Coronal sections (10 μm) of the hippocampus were stained with anti-IbA1/AIF1 (1:500) (catalog NBP2-19019; Novus Biologicals, Centennial, Colo.) using standard methods and citrate antigen retrieval. HRP development was accomplished with the Vectastain ABC Staining Kit (Vector Laboratories, Burlingame, Calif.) using a secondary antibody provided. All sections were imaged on a Zeiss Axio Imager 2 microscope (Zeiss, Oberkochen, Germany) running Zen software (Zeiss), using the tiling and stitching feature to ensure the entire fascia dentata was visualized. Images were imported into NIS-Elements software (Nikon Co., Tokyo, Japan). One hemisphere was chosen and 600,000-700,000 μm.sup.2 of the fascia dentata was demarcated as the region of interest (ROI). The number of microglia within this region was then counted. Microglia cells were defined as black/brown spots with two or greater associated tendrils and the number present in the ROI was counted. Microglial density was then calculated.
(268) Behavioral Assays
(269) Depressive symptoms were measured using the sucrose preference assay and the forced swim assay. These assays began 24 h after CP treatment and required 24-48 h to complete. No additional medications were given to the animals during this period. In the sucrose preference assay, animals were presented two bottles simultaneously, one containing a 2% sucrose solution and the other containing drinking water. The amount of liquid consumed in each bottle during the 24 h of testing was measured. The location of the two bottles was varied during this period. The sucrose preference score was expressed as percent of total liquid intake.
(270) In the forced swim assay, rats were placed in tap water (25-27° C.) within a large, clear cylinder (Harvard Apparatus; Holliston, Mass. Cat #76-0494), such that the animal's legs nor their tail touched the bottom. Rats were left in this cylinder for a 10 min training period. 24 h later (48 h after CP), rats were then placed back in the cylinder and recorded for 5 min (Logitech Webcam; Silicon Valley, Calif.). The recordings were quantified for time spent immobile by several blinded individuals and the average score used in each individual measurement. Immobility was defined as absence of movement except for those necessary for keeping the nose above water.
(271) Statistical Analysis
(272) Statistical differences were assessed using a two-tail Students t-test or ANOVA followed by a Student-Newman-Keuls post-hoc analysis, as indicated in the figure legends. All statistical analyses were conducted using Graph Pad In Stat Software (La Jolla, Calif.) and results were considered significant if p<0.05.
Example 11: CP Administration Increased Bladder Weight and Inflammation
(273) Bladder weight and inflammation was used to confirm effective induction of cystitis. As shown in
Example 12: Caspase-1 Activity is Increased in the Hippocampus, but not in the Pons
(274) CNS tissue was harvested and processed as described in the Materials and Methods section. As shown in
(275) Discussion:
(276) Chronic inflammatory syndromes are present in every specialty in medicine. Whether it is irritable bowel syndrome in gastroenterology or interstitial cystitis in urology, these conditions present a myriad of challenges to physicians and patients. These patients have high rates of co-morbid depression, anxiety and other related psychiatric disorders and recent studies have begun to demonstrate this adverse psychosocial consequence may be due to neuroinflammation mediated by the NLRP3 inflammasome (Miller et al. (2016) Nature reviews Immunology 16: 22-34). The present study has shown for the first time that an acute insult to the bladder in an animal model can also result in neuroinflammation in the CNS and the associated symptoms of depression,
(277) The studies began by looking for signs of inflammasome activation (caspase-1 activity) in the hippocampus, due to its known association with depression, and the pons, due to its well-known function in micturition. An increase within the hippocampus 24 h after CP-treatment was found, but there were no significant changes in the pons. This differential response suggests the effect is specific to this region and not a non-specific, perhaps toxic, response of the brain to CP or its metabolites.
Example 13: Pro-IL-1β and Pro-IL-18 mRNA Expression are Increased in the Hippocampus
(278) Gene expression of pro-IL-1β and pro-IL-18 was measured in the hippocampus and pons.
(279) NLRP3, and other critical components of the inflammasome such as the associated speck-like protein containing a COOH-terminal caspase recruitment domain (ASC), have been found to be upregulated in many other inflammatory conditions, although their expression is regulated by mechanisms different than those regulating pro-IL-1β and pro-IL-18 (54). However, as shown in in
(280) Discussion:
(281) Often associated with inflammasome activation is an increase in expression of pro-IL-1β and/or pro-IL-18. Increased mRNA expression of both of these pro-inflammatory cytokines in the hippocampus was observed, consistent with inflammasome activation or at least the beginning of an inflammatory response. Surprisingly, pro-IL-18 was significantly increased in the pons suggesting this region of the brain is actually responding to CP. However, no other indication of an inflammatory reaction was observed.
Example 14: CP-Induced Cystitis Induces NLRP3-Dependent Inflammation in the Hippocampus
(282) Breakdown of the blood brain barrier is one of the known consequences of NLRP3-induced inflammation within the central nervous system (Song et al. (2017) Front Cell Neurosci 11: 63). In order to evaluate this change, the Evans blue assay was performed. In the hippocampus from CP-treated rats, a significant increase in Evans blue extravasation compared to vehicle-treated or GLY only-treated controls was detected, indicating inflammation and disruption of the blood brain barrier (
(283) Histologically, the hippocampus demonstrated evidence of inflammation in the CP-treated rats (
(284) Discussion:
(285) One of the most significant changes discovered was that CP-induced cystitis triggers breakdown of the blood-brain barrier within the hippocampus, but not the pons. The demarcation between the hippocampus and pons confirms that neither CP itself nor its metabolites are directly causing this breakdown. If direct effects were involved, the breakdown could be expected to occur throughout the CNS and not localize to the hippocampus. It should be noted that these experiments do not rule out inflammation and inflammasome activation in other parts of the brain. Importantly, glyburide prevented this blood brain barrier breakdown. Seeing as glyburide is an inhibitor of NLRP3 with little or no effects on other inflammasomes (Lamkanfi et al. (2009) The Journal of cell biology 187: 61-70), these results specifically implicate the NLRP3 inflammasome in this response. Finally, the breakdown of this barrier was also blocked with Mesna which is well-known to bind acrolein in the urine and prevent it from harming urothelia. Mesna undergoes rapid oxidation in plasma with only a very small portion remaining in circulation. Thus, urinary Mesna concentration vastly exceed that in plasma, essentially restricting this compound to the urinary system (Carless et al. (2008) 17th Expert Committee on the Selection and Use of Essential Medicines; Jenkins (2014) London Cancer). Indeed, doses up to 100 mg/kg (compare to 40 mg/kg used in this study) have produced no apparent effects on bone marrow, hepatic, renal or CNS function (Id.). Thus, Mesna's effectiveness in this study strongly argues that the breakdown of the blood brain barrier in the hippocampus is a direct result of the cystitis triggered by CP in the bladder.
(286) While Evan's blue does detect breakdown of the blood brain barrier it is also a harbinger of inflammation in a tissue. Indeed, histological evidence of inflammation was found in the CP-treated rats within the fascia dentata. Quantitation of the activated microglia in this region clearly showed an increased density and this increase was again blocked by both glyburide and Mesna. Thus, these results demonstrate that the NLRP3 inflammasome plays a critical role in inducing inflammation in the hippocampus in response to CP-induced cystitis. Therapeutically, administration of an NLRP3 inhibitor at the time of an acute inflammatory event, can serve as a critical intervention to prevent the emergence of neuroinflammatory changes.
(287) At this time, the mechanism by which inflammation in the bladder results in inflammation in the hippocampus is unclear. Currently there are 3 distinct pathways that may contribute to varying degrees (Miller et al. (2016) Nature reviews Immunology). The first pathway, called the humoral pathway, includes the leaking of peripheral cytokines directly into the CNS through areas of blood brain barrier breakdown. Given serum pro-inflammatory cytokines (such as IL-1β, TNF-α, and IL-6) are increased in response to CP (Kim et al. (2015) Biomol Ther (Seoul) 23: 180-188), and given that barrier breakdown was detected as described herein, this pathway likely contributes to CP-induction of neuroinflammation. Peripheral cytokines may also be directly transported across the barrier through saturable transport molecules (Miller et al. (2016) Nature reviews Immunology 16: 22-34). The second pathway, the neural pathway, involves cytokine stimulation of afferent nerves that carry retrograde transmission of a signal for inflammation through ascending fibers and into the brain where they are translated back into central cytokine signals (Miller et al. (2009) Biol Psychiatry 65: 732-741). Recent evidence has established an inflammatory phenotype within the L6-S1 dorsal quadrants of the spinal cord in CP-cystitis (Liu et al. (2016) Mol Pain 12), suggesting that neural transfer of an inflammatory response may also be playing a role in moving the signal from the bladder to the CNS. Likewise, CP-cystitis is well known to cause bladder pain and acute pain itself can directly stimulate symptoms of depression (Michaelides et al. (2019) Postgrad Med 131: 438-444), most likely through this neural transfer pathway. Finally, a third pathway, called the cellular pathway, has been found to contribute to the transfer of inflammatory signals (D'Mello et al. (2009) J Neurosci 29: 2089-2102). This pathway involves movement of immune cells that have been activated in the periphery directly to the brain vasculature and parenchyma. This pathway was discovered in studies of the inflamed liver, which releases TNF-α. TNF-α crosses the blood brain barrier and stimulates the release of CC-chemokine ligand 2 (CCL2) from microglia which, in turn, passes back into the periphery and triggers the chemotaxis of monocytes into the brain (Id.). As stated earlier, there are increases in serum levels of TNF-α in response to CP (Kim et al (2015) Biomol Ther (Seoul) 23: 180-188), so it is possible this pathway is involved as well.
Example 15: CP-Induced Cystitis Results in NLRP3-Dependent Symptoms of Depression
(288) To determine if CP-induced cystitis results in depressive symptoms, two independent behavioral assays were performed, the sucrose preference assay and the forced swim assay. For these studies, an additional control group of CP-treated rats were administered the antidepressant fluoxetine to differentiate true depression symptoms from sick behavior, which would not be effected by the antidepressant. In the sucrose preference assay (
(289) Discussion:
(290) Regardless of how the peripheral inflammatory signal is transferred, once the brain is inflamed it is well known to bring about symptoms of depression and other negative psychosocial behaviors (Miller et al. (2009) Biol Psychiatry 65:732-741; Miller et al. (2016) Nature reviews Immunology 16:22-34; Noto et al. (2014) Neuroimmunomodulation 21:131-139; Sayana et al. (2017) J Psychiatr Res 92:160-182; Teixeira et al. (2014) Neuroimmunomodulation 21: 71). Indeed, using two distinct and well-established assays of depression, it was found that symptoms of depression strongly correlated with neuroinflammation in the present study. While these studies do not address how neuroinflammation actually brings about these symptoms, numerous theories abound in the literature (Miller et al. (2009) Biol Psychiatry 65:732-741; Miller et al. (2016) Nature reviews Immunology 16:22-34) suggesting the mechanism may be multifactorial. For example, cytokines signals are known to influence the availability of mood-relevant neurotransmitters, particularly the monoamines (Miller (2009) Brain Behav Immun 23: 149-158). Many of these signals, working through well-known STAT, IRF, NF-κB and MAPK pathways (Fujigaki et al. (2006) J Biochem 139:655-662), activate indoleamine 2,3 dioxygenase (IDO) which shifts tryptophan metabolism toward kynurenine and away from serotonin, thus reducing serotonin availability (Dantzer et al. (2008) Nat Rev Neurosci 9:46-56; Schwarcz et al. (2002) The Journal of pharmacology and experimental therapeutics 303:1-10).
(291) Kynurenine (converted to kynurenic acid in microglia) also inhibits release of glutamate and, by extension, dopamine (Borland et al. (2004) J Neurochem 91:220-229). Other work on potential pathways leading to depression demonstrate that cytokine signals may significantly affect neural plasticity, triggering decreased neurotrophic support, decreased neurogenesis, increased oxidative stress and even increased apoptosis in the CNS (Buntinx et al. (2004) J Neurosci Res 76:834-845; Goshen et al. (2007) Psychoneuroendocrinology 32: 1106-1115; Koo et al. (2008) Proceedings of the National Academy of Sciences of the United States of America 105:751-756; Li et al. (2008) J Neurosci 28:5321-5330; McTigue et al. (2008) J Neurochem 107:1-19). Perhaps effects on neural plasticity may explain why, in some disorders of the genitourinary tract such as interstitial cystitis, debilitating psychiatric effects can persist long after any localized inflammation is measureable.
(292) Finally, cytokines may have dramatic effects on the hypothalamic-pituitary-adrenal (HPA) axis (Goshen et al. (2008) Mol Psychiatry 13:717-728) and dysregulation of the HPA-axis has been suggested to underlie increased psychological stress levels in overactive bladder and interstitial cystitis patients, at least those exposed to chronic early life stress (Taylor (2010) PNAS 107: 8507-8512. The contributions off these various pathways to the mood disorders experienced by patients with diseases of the lower urinary tract represents important and exciting areas for exploration while offering the promise of targeted pharmacological interventions to alleviate the high morbidity and health-care costs associated with the mental suffering of urology patients.
(293) In conclusion, this study has shown in an animal model that an acute insult in the bladder can trigger significant neuroinflammation in the hippocampus which brings about symptoms of depression. Moreover, the inflammation/depression responsive is dependent on activation of the NLRP3 inflammasome. Thus, this study proposes the first-ever causative explanation of the previously anecdotal link between benign bladder disorders and mood disorders.
(294) Materials and Methods for Examples 16-19
(295) Animals
(296) Animal protocols were approved by the Institutional Animal Care and Use Committee at Duke University Medical Center and were performed in accordance with the guidelines set forth in the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health (USA). Sprague Dawley Rats (female, ≈50 days of age, ≈200 g) were purchased from Envigo (Indianapolis, Iowa) used in all experiments. Although in humans BOO occurs most frequently in males, the standard for BOO studies in rodents has long been the female rat. The primary reason is the tortuosity of the male urethra which can lead to physical damage, and consequently inflammation, during catheterization. Other concerns are complications arising from ducts associated with the prostatic gland and seminal vesicles. Thus, male animals are contraindicated in studies of BOO, particularly when examining inflammation and the results of inflammation.
(297) For most studies rats were assigned to 4 groups; 1) Control, 2) Sham, 3) BOO or 4) BOO+glyburide (Gly). An additional group (BOO+fluoxetine) was used for behavior assays. For Sham and all BOO groups, animals were anesthetized [ketamine hydrochloride (90 mg/kg), xylazine (10 mg/kg); i.p.] and a 1 mm o.d. catheter (P50 tubing) inserted transurethrally. BOO was created by urethral ligation over a 1 mm catheter. A 5-0 silk suture was passed around the urethra and tied securely for BOO and loosely for Sham. The catheter was removed and the abdominal wall closed. For BOO+Gly, a subcutaneous pocket was made on the side of the neck and a single 50 mg, 21-day slow release pellet (Innovative Research of America, Sarasota, Fla.) inserted and the incision closed. A new pellet was placed (contralateral side) after 21 days. Sides were alternated thereafter. No signs of urinary tract infection were ever seen in any animal.
(298) In the behavior assays, an additional group of BOO rats were provided with fluoxetine (Sigma, St Louis, Mo.) in the drinking water (0.50 mg/ml) for the last 4 weeks of the experiments. Twice weekly fluoxetine dose was adjusted to insure ≈20 mg/kg/day.
(299) Evans Blue Assay
(300) Rats were weighed and then injected (i.v. 3 ml/kg) with 2% Evan's blue dye in sterile saline by an investigator blinded to the groups (Belayev et al. (1996) Brain Res 739: 88-96). After one hour, rats were euthanized and transcardially perfused with cold PBS to remove intravascular dye. The brain was isolated and the hippocampus dissected, weighed and placed into formamide (0.25 ml) overnight (56° C.). Absorbance (620 nm) was measured and compared to a standard curve to calculate pg Evans blue/μg tissue.
(301) Immunocytochemistry and Quantitation of Microglia and Neurogenesis
(302) Brains were fixed (10% neutral buffered formalin; 48 h, rt) and grossly cut (coronally) to the hippocampus before being embedded in paraffin with the plane of the hippocampus on the block face. Citrate antigen retrieval was used prior to staining 10 μm coronal sections with anti-IbA1/AIF1 (1:500) (NBP2-19019; Novus Biologicals, Centennial, Colo.) or Anti-Ki67 (1:500) (ab15580; Abcam, Cambridge, Mass.) via standardard methodology. IbA1 was visualized via HRP development (Vectastain ABC Kit; Vector, Burlingame, Calif.), biotinylated secondary antibody provided). Ki-67 was visualized using a goat anti-rabbit secondary antibody conjugated to Alexa Fluor 488 (111-545-144; Jackson ImmunoResearch Labs, West Grove, Pa.). All slides were coverslipped using Vectashield Antifade Mounting medium with DAPI (Vector, Burlingame, Calif.).
(303) A Zeiss Axio Imager 2 microscope (Zeiss, Oberkochen, Germany) running Zen software (Zeiss) using the tiling and stitching feature was used to scan one entire hemisphere. Images were exported as TIFFs and imported into NIS-Elements software (Nikon Co., Tokyo, Japan) then calibrated. Slides were quantitated by a researcher blinded to the groups. For microglia, we demarcated 600,000-700,000 μm.sup.2 of the fascia dentata, counted the number of black/brown spots with two or greater associated tendrils and calculated microglial density. For Ki-67.sup.+ cells we demarcated the entire dentate gyrus, CA1, CA2 and CA3 regions, quantitated nuclei (DAPI.sup.+) that were Ki-67.sup.+ (green florescence) and calculated the density.
(304) Behavioral Assays
(305) Open field—Rats are placed in an acrylic open-topped box (45 cm×45 cm×30 cm; L×W×H) and video recorded for 10 min. The bottom is white while the sides are clear. The floor was divided into 16 equal squares. After recording, the video is scored by individuals blinded to treatment and the amount of time in which two or more of the rats paws are inside the central 4 squares (time in middle) recorded.
(306) Sucrose preference—rats are simultaneously provided with bottles containing 2% sucrose or drinking water. The location of the bottles are switched after 24 h. After 48 h the remaining liquid was measured and sucrose preference calculated as a percentage of the total liquid intake.
(307) Statistical Analysis
(308) Statistical assessments were conducted with Graph Pad In Stat Software (La Jolla, Calif.). ANOVA was used to examine differences across the four groups, followed by a Student-Newman-Keuls post-hoc analysis that enabled pairwise comparisons. To examine the effect of BOO on inflammation, bladder weight, neurogenesis and behavioral dysfunction in the hippocampus, we compared control (and sham) group to the untreated obstructed group. To examine whether treatment returned outcomes to baseline, neurogenesis and behavioral dysfunction, we compared control (and sham) group to the treated obstructed group. Lastly, to examine whether treatment ameliorated inflammation, we compared untreated and treated obstructed groups. Results were considered statistically significant if p<0.05.
Example 16: BOO Increased Bladder Weight and this was Partially Blocked by Inhibiting NLRP3
(309) Bladders from the various groups indicated in
(310) Discussion:
(311) At 12 weeks of BOO, bladder weight increased even in the presence of glyburide, although the increase was attenuated in the drug-treated animals. The reason for the bladder weight gain in the glyburide-treated rats was not directly examined, but weight gain is composed of inflammation/edema and muscle hypertrophy and, while glyburide can be expected to blunt the inflammation/edema it is less likely to do so for muscle hypertrophy caused by overuse of the detrusor muscle.
Example: 17 BOO Triggers NLRP3-Dependent Inflammation in the Hippocampus
(312) To determine whether BOO triggers NLRP3-dependent inflammation in the hippocampus, BOO rats were treated with vehicle or glyburide and inflammation was assessed by the Evans blue assay as described in the Materials and Methods section. As shown in
(313) Discussion:
(314) Critical to the hypothesis was the detection of inflammation in the hippocampus, initially ascertained using the Evans blue assay which measures the extravasation potential of the capillaries. When one considers the blood vessels traversing the brain, this assay also equates to a measurement of the integrity of the blood brain barrier (Belayev et al. (1996) Brain Res 739: 88-96). Thus, after 12 weeks BOO has precipitated a notable degradation of the blood brain barrier. The presence of inflammation suggested by the Evans blue assay was confirmed by the increase in activated microglia, the main drivers of neuroinflammation and the cells in the brain possessing NLRP3 (along with astrocytes).
(315) Importantly, both the Evan's blue extravasation and the increase in microglia were blocked by glyburide, indicating their absolute dependence on NLRP3. While that fact is irrefutable, it is somewhat unclear where, exactly, the glyburide is functioning; at the level of the bladder, the brain or both. Undoubtedly, glyburide is acting in the bladder urothelia (Hughes et al. (2016) J Urol 195: 1598-1605; Hughes et al. (2019) Am J Physiol-Renal 316: F113-F120; Lutolf et al. (2018) Neurourol Urodyn 37: 952-959), as there are several publications showing just that. These urothelial effects also support the proposed inflammatory bladder-brain axis. Glyburide activity in the brain is not so clear. In the serum, glyburide is mostly albumin-bound and does not cross the blood brain barrier (Lahmann et al. (2015) LoS One 10: e0134476). However, in the event of a breakdown in the barrier, even transiently, glyburide can cross into the brain (Stokum et al. (2017) Behav Brain Res 333: 43-53) where it could function to block NLRP3 in microglia (and perhaps astrocytes), minimize neuroinflammation and preserve psychiatric health. Thus, the initial, major and perhaps only effect of glyburide is in the bladder but, if its protective effect is overwhelmed and there is breakdown of the blood brain barrier, it may enter the brain and directly prevent a neuroinflammatory response.
Example 18: BOO Causes a Decrease in the Number of Proliferating Cells in the Hippocampus
(316) To determine if BOO causes a decrease in the number of proliferating cells in the hippocampus, cells in 10 μm sections of brain were stained for Ki-67 and then visualized and quantitated as described in the Materials and Method section. As shown in
(317) Discussion:
(318) In the hippocampus BOO caused a statistically significant decrease in proliferating cells (Ki-67.sup.+). Decreases in neurogenesis, and more generally plasticity, in the hippocampus have been directly linked with neuroinflammation and depression (Liu et al. (2017) Neural Plast 6871089), so given the neuroinflammation detected with the Evans blue and microglial activation assays, along with the signs of depression detected with the open field and sucrose preference assays, we feel the difference in Ki-67.sup.+ cells likely reflect differences in neurogenesis. It is thought that these changes may lead to permanent, or at least long lasting, differences in cognitive function or mood that persists after the initiating stimulus is gone (in the case of BOO, after a TURP is performed). This decrease was also blocked by glyburide demonstrating the central role of NLRP3 and suggesting that NLRP3 inhibitors may further help prevent BOO-induced neurodeterioration by suppressing negative changes in neuroplasticity.
Example 19: BOO Rats Show NLRP-3 Dependent Signs of Depression; Anxiety and Anhedonia
(319) Two different behavior assays that assess different signs associated with depression were performed. The open field test measures anxiety as a function of the rat's propensity to explore the middle region of a square open field. Normal rats, being somewhat curious, will naturally explore this region while anxious rats refrain. The assay was performed as described in the Materials and Methods section and scored by a blinded investigator. As shown in
(320) Next, the sucrose preference assay that assesses anhedonia or the inability to feel pleasure was performed. The assay was performed as described in the Materials and Methods section. As shown in
(321) Discussion:
(322) Initial studies on the response of the innate immune system to BOO focused on the local response in the bladder (Hughes et al. (2016) J Urol 195: 1598-1605; Hughes et al. (2019) Am J Physiol-Renal 316: F113-F120; Lutolf et al. (2018) Neurourol Urodyn 37: 952-959). Those studies found that BOO activates the NLRP3 inflammasome in the urothelia to initiate inflammation, fibrosis and denervation. In this study we have greatly expanded that work to examine BOO-induced inflammation in the brain and changes it may make in behavior. Initially, hippocampal inflammation was found after 6 weeks but differences in sucrose preference at that time point were undetectable
(323) The most important observation in this study was the behavioral differences in the BOO rats. Untreated, obstructed animals showed statistically significant signs of anxiety and anhedonia, two core symptoms of depression, and these behavioral differences were blocked by glyburide demonstrating the centrality of this inflammasome in these mood changes. Importantly, the behavioral differences could also be prevented by the antidepressant fluoxetine demonstrating they are not due simply to pain or “sick” behavior as fluoxetine would not be expected to help in those situations.
(324) One intriguing question that arises is the nature of the peripheral-to-central inflammatory signal. This is a hotly debated topic and currently three possible pathways are in vogue that are not mutually exclusive (Miller et al. (2016) Nat Rev Immunol 16: 22-34). The first pathway, the humoral pathway, could result from cytokines produced locally in the bladder travelling systemically via the vascular system, first to the blood brain barrier where they trigger breakdown, and subsequently into the CNS where they initiate microglial activation and neuroinflammation. Given the breakdown of the blood brain barrier in this study, this pathway is likely to contribute to BOO-induced neuroinflammation. Another possibility is the neural pathway where sensory input along afferent nerves carries a retrograde signal for inflammation back to the hippocampus where it is translates into cytokine production. Finally, a cellular pathway could involve transmigration of immune cells activated in the bladder directly across the blood brain barrier and into the brain vasculature and parenchyma. All three of these potential pathways warrant testing in future studies.
(325) This study clearly shows that inflammatory injury to the bladder during BOO causes central inflammation and mood disorders. It implies, therefore, that relieving the obstruction will relieve the mood disorder. This work provides the first experimental animal data tying benign bladder dysfunction to mood disorders, and provides an exciting mechanism that might drive initiation and progression.
(326) Any patents or publications mentioned in this specification are indicative of the levels of those skilled in the art to which the disclosure pertains. These patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. In case of conflict, the present specification, including definitions, will control.
(327) One skilled in the art will readily appreciate that the present disclosure is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The present disclosure is presently representative of embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the disclosure as defined by the scope of the claims.