TREATMENT OF CNS INJURY WITH RNAi THERAPEUTICS
20200032268 ยท 2020-01-30
Inventors
- Joerg Ruschel (Cambridge, MA)
- Lisa McKerracher (Boston, MA)
- Emily Niederst (Cambridge, MA)
- Kenneth M. Rosen (Milton, MA)
Cpc classification
C12Y301/03067
CHEMISTRY; METALLURGY
C12N2310/344
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Self-delivering PTEN RNA and methods of reducing PTEN expression are provided herein. Also provided are methods of treating spinal cord injury (SCI) and other neurotrauma with PTEN sdRNA.
Claims
1. A phosphatase and tensin homolog (PTEN) targeting agent comprising an isolated sdRNA molecule.
2. The isolated sdRNA molecule of claim 1 which comprises a nucleotide sequence complementary to a PTEN gene, the isolated sdRNA molecule comprising a guide nucleotide strand, a passenger nucleotide strand, and a cholesterol-TEG molecule attached at the 3 end of the passenger strand, the isolated sdRNA molecule having a double-stranded region and a single-stranded region, the double-stranded region being from 8-15 nucleotides long, and the single-stranded region being at the 3 end of the guide nucleotide strand, being 4-12 nucleotides long, wherein at least 40% of the nucleotides of the sdRNA molecule are modified with at least one modification, and wherein the sdRNA molecule does not form a hairpin.
3. The isolated sdRNA molecule of claim 2, wherein the at least one modification is a phosphorothioate, O-methyl, and/or 2-fluror modification.
4. The sdRNA molecule of claim 2, wherein the guide strand has a nucleotide sequence comprising SED ID NO:5 or SEQ ID NO:7.
5. The sdRNA molecule of claim 4, wherein the passenger stand has a nucleotide sequence comprising SEQ ID NO:6 or SEQ ID NO:8.
6. The sdRNA molecule of claim 5 which is BA-434 and comprises a guide sequence comprising SEQ ID NO:6 and a passenger sequence comprising SDE ID NO:7.
7. A pharmaceutical composition comprising the sdRNA molecule of claim 6 and a pharmaceutically acceptable carrier.
8. A method of inhibiting PTEN expression in a mammalian cell, comprising contacting the cell with an amount of PTEN sdRNA such that PTEN mRNA expression is inhibited.
9. The method of claim 8, wherein the sdRNA molecule comprises a nucleotide sequence complementary to a PTEN gene, the sdRNA molecule comprising a guide nucleotide strand, a passenger nucleotide strand, and a cholesterol-TEG molecule at the 3 end of the passenger nucleotide strands, the sdRNA molecule having a double-stranded region and a single-stranded region, the double-stranded region being from 8-15 nucleotides long, and the single-stranded region being at the 3 end of the guide strand, being 4-12 nucleotides long, wherein at least 40% of the nucleotides of the isolated sdRNA molecule are modified with at least one modification, and wherein the isolated sdRNA molecule does not form a hairpin.
10. The method of claim 9, wherein the sdRNA molecule is BA-434 and comprises a guide sequence comprising SEQ ID NO:8 and a passenger sequence comprising SEQ ID NO:7.
11. The method of claim 8, wherein the cell is located in the central nervous system.
12. The method of claim 8, wherein the mammalian cell is a neuronal cell, an astrocyte, or an oligodendrocyte.
13. The method of claim 8, wherein the cell is in the spinal cord.
14. The method of claim 8, wherein the cell is in the retina or optic nerve.
15. A method of treating a CNS injury, comprising contacting the injury with an amount of the PTEN sdRNA of claim 1 effective to promote axon regeneration.
16. A method of treating a CNS injury, comprising contacting the injury with an amount of the PTEN sdRNA of claim 2 effective to promote axon regeneration.
17. A method of treating a CNS injury, comprising contacting the injury with an amount of the PTEN sdRNA of claim 6 effective to promote axon regeneration.
18. A method of treating a CNS injury, comprising contacting the injury with an amount of the PTEN sdRNA of claim 6 effective to promote astrocyte cell migration to, and proliferation at, the injury.
19. The method of claim 15, wherein the CNS injury is a spinal cord injury or an optic neuropathy.
20. The method of claim 15, wherein plasticity of interneurons is promoted at the injury.
21. A method for promoting the survival or regeneration of a mature CNS neuron, the neuron having an axonal injury, the method comprising contacting the injured neuron with a therapeutically effective amount of PTEN sdRNA.
22. The method of claim 21, wherein the injured neuron is in the spinal cord of a mammalian subject.
Description
DESCRIPTION OF THE DRAWINGS
[0024] The foregoing features of embodiments will be more readily understood by reference to the following detailed description, taken with reference to the accompanying drawings, in which:
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
DESCRIPTION
[0085] Throughout this application, various patents, patent applications, and publications are referenced. The disclosures of these patents, patent applications, and publications are hereby incorporated by reference in their entirety into this application in order to more fully describe the state of the art as known to those skilled therein as of the date of the invention described and claimed herein. The instant disclosure will govern in the instance that there is any inconsistency between the patents, patent applications, and publications and this disclosure.
[0086] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.
[0087] The present disclosure relates to nucleic acids or RNAi therapeutics which target PTEN mRNA within cells with improved in vivo delivery, and which promote axon regeneration in the CNS of an injured mammal. These novel RNAi therapeutics or sdRNAs easily penetrate neurons to silence PTEN and promote axon regeneration after injury such as traumatic brain injury, acute and chronic SCI, and optic neuropathies. This modulation of PTEN expression improves recovery after CNS injury by helping neurons create new adaptive circuitry to overcome deficits caused by loss of connections after injury. In addition, the sdRNAs according to the disclosure promote astrocyte and oligodendrocyte migration to, and proliferation at, the site of the CNS injury.
I. PTEN sdRNA
[0088] The RNAi therapeutic compositions of the present disclosure comprises a PTEN sdRNA. sdRNAs are double-stranded siRNA molecules that are modified to be cell-permeable and to possess increased stability against endo- and exonuclease degradation. Rather than the use of delivery vehicles, self-delivering RNA is effective in vivo by local administration
[0089] sdRNA triggers degradation of mRNA, thereby decreasing expression of the targeted protein. The strategy of inhibiting PTEN mRNA expression by sdRNA technology differs from use of small molecule PTEN inhibitors described in U.S. Pat. No. 8,728,756. PTEN sdRNAs do not inhibit PTEN protein function; rather, they regulate expression levels of the protein. The use of sdRNA has the advantage of less off-target effect to other phosphatases because pharmacological inhibitors of phosphatases will have off-target effects by binding to related protein classes of other phosphatases.
[0090] Furthermore, sdRNAs targeting PTEN expression have a more long-lasting effect on PTEN phosphatase activity. The antisense or passenger strand of sdRNAs is released from the sense strand, which confers lipophilicity to the double-stranded sdRNA. The antisense strand, itself, is lipophobic and hence, remains intracellularly resulting in long lasting inhibition of PTEN protein expression due to increases stability against endonucleases. sdRNA administered to the site of SCI also distributes more locally in contrast to most small molecules, which usually distribute rapidly to other parts of the target organ and other tissues even after local administration. Consequently, off-target tissue exposure is a negligible safety concern for sdRNAs.
[0091] The present disclosure provides selected sdRNA molecules useful in the reduction of expression or knock down of PTEN mRNA and protein levels in CNS cells and tissues, such as neurons, astrocytes, and glial cells.
[0092] The sdRNA molecule comprises a nucleotide sequence complementary to a PTEN gene and comprises a guide (antisense) nucleotide strand, a passenger (sense) nucleotide strand. There is a cholesterol-TEG molecule attached to the 3 end of the passenger strand. The sdRNA molecule has a double-stranded region 8-15 nucleotides long and a single-stranded region at the 3 end of the guide nucleotide strand 4-12 nucleotides long. At least 40% of the nucleotides of the sdRNA molecule comprise at least one modification, and one nucleotide can have more than one different modification. These modifications include any chemical modifications to the nucleotides which provides stability without interfering with the targeting PTEN effector abilities of the sdRNA. Such modifications include but are not limited to, phosphorothioate, O-methyl, and 2-fluoro modifications. How to make these modifications and other useful modifications are described in e.g., U.S. Pat. No. 9,340,786
[0093] These sdRNA molecules do not form a hairpin.
[0094] A representative PTEN sdRNA (BA-434) is shown in
[0095] The PTEN sdRNA can be commercially obtained e.g. from Advirna LLC, Cambridge, Mass.; Trilink Biotechnologies, San Diego, Calif.).
[0096] Alternatively, the PTEN sdRNA can be synthesized according to known methods, (e.g., Byrne et al., (2013) J. Ocul. Pharmacol. Ther. 29(10):855-64.). In brief, RNAs are synthesized from Therapure ribo phosphoramidite monomers with a oligonucleotide synthesizer using phosphoramidite chemistry. Synthesized oligonucleotides are cleaved from the solid CPG supports and the protecting groups are removed by the treatment of 3:1 aqueous ammonia:ethanol. Passenger strands are synthesized from CPG functionalized with cholesterol-triethyeneglycol-glycerol succinate. Crude oligonucleotides are precipitated with isopropanol, centrifuged and purified using ion exchange chromatography. The yield is analyzed by reverse-phase ion-pair chromatography, selected fractions are pooled and desalted by Tangential Flow Filtration and evaporated to dryness. Purity and molecular weight of filtered material is determined by HPLC analysis and ESI-MS analysis.
[0097] The correct sequence of PTEN to be effectively targeted by a sdRNA, a number of different PTEN-targeting siRNAs sequences were designed and tested for their ability to: (1) promote axon regeneration of CNS neurons; (2) be effectively delivered without the use of carriers; (3) not cause off-target effects; and (4) act on both rodent and human cells to facilitate clinical development. These PTEN sdRNAs are listed in
[0098] As described above, the BA-434 sdRNA sequence (
[0099] The sustained change in protein levels over several days indicates the stability of the response of neurons to PTEN protein knockdown. This is important for axon regeneration. As described below in Example 620, a robust axon regeneration was demonstrated herein 2 weeks after optic nerve injury (
[0100] The studies described in the present disclosure demonstrate that (1) BA-434 sdRNA is truly self-delivering; (2) BA-434 mRNA levels decrease rapidly after delivery (by 24 hours), whereas protein levels show a delay before decrease; (3) PTEN protein decreases significantly at 72 hours and longer after sdRNA delivery; and (4) knock-down of PTEN mRNA is sustained for at least 120 hours in primary neurons, while protein levels are reduced for at least 10 days (EXAMPLE 13,
IV. Pharmaceutical Compositions
[0101] The PTEN sdRNAs of the present disclosure are useful in pharmaceutical compositions and methods for treating CNS neurotrauma. These pharmaceutical compositions include a therapeutically effective amount of a PTEN sdRNA. A therapeutically effective amount as used herein refers to that amount which provides a therapeutic and/or prophylactic therapeutic effect on the neurotrauma site. Such effects include, but are not limited to, axon regeneration, and glial cell proliferation at, and migration to, the site of the neurotrauma.
[0102] Such compositions can be prepared with a pharmaceutically acceptable carrier in accordance with known techniques, for example, those described in Remington. The Science And Practice of Pharmacy (9th Ed., 1995). The term pharmaceutically acceptable carrier is to be understood herein as referring to any substance that may, medically, be acceptably administered to a patient, together with a compound of this invention, and which does not undesirably affect the pharmacological activity thereof; a pharmaceutically acceptable carrier may thus be for example a pharmaceutically acceptable member(s) selected from the group comprising or consisting of diluents, preservatives, solubilizers, emulsifiers, adjuvant, tonicity modifying agents, buffers as well as any other physiologically acceptable vehicle. This pharmaceutical formulation may further contain additional Rho inhibitors.
[0103] The pharmaceutical compositions may be prepared in pharmaceutically acceptable dosage forms such as for oral, injectable, transdermal, epidural, and transmembrane use, and the like, or may be formulated for co-delivery in a delivery matrix, as described in U.S. Pat. Nos. 7,141,428 and 7,491,692.
[0104] Compositions suitable for oral administration may be presented in the form of a solution, the pharmaceutically acceptable carrier is one that does not inhibit the activity of the PTEN sdRNA, and can be, e.g., an aqueous liquid, such as buffered with a pharmaceutically acceptable pH buffer, or in non-aqueous liquid such as DMSO, or be prepared as an oil-in-water or water-in-oil emulsion.
[0105] Injectable dosage forms may be sterilized in a pharmaceutically acceptable fashion, for example, by steam sterilization of an aqueous solution sealed in a vial under an inert gas atmosphere at 120 C. for about 15 minutes to 20 minutes, or by sterile filtration of a solution through a 0.2 M or smaller pore-size filter, optionally followed by a lyophilization step, or by irradiation of a composition containing a compound of the present invention by means of emissions from a radionuclide source.
[0106] The therapeutic compositions may be delivered in discrete units or dosage forms. If orally administered, these dosage forms may be capsules, cachets, lozenges, tablets, pills, powders, granules, chewing gum, suspensions, solutions, and the like. Each dosage form contains a predetermined amount of PTEN sdRNA.
[0107] A therapeutically effective dosage of the PTEN-targeting sdRNA therapeutic compound varies from patient to patient, and may depend upon factors such as the age of the patient, the patient's genetics, and the diagnosed condition of the patient, and the route of delivery of the dosage form to the patient. One useful therapeutically effective dose is the from about 10 g to 950 g of sdRNA. A therapeutically effective dose and frequency of administration of a dosage form may be determined in accordance with routine pharmacological procedures known to those skilled in the art. For example, dosage amounts and frequency of administration may vary or change as a function of time and severity of the spinal cord injury.
VI. Therapeutic Delivery Methods
[0108] Administration of the pharmaceutical compositions according to the disclosure can be local or systematic depending on the target tissue being treated. Alternatively, administration may be by injection into the cerebrospinal fluid as a solution or as a suspension suitable for sustained release from the injected pharmaceutical dosage form such as from a vesicle. For example, Administration may be made to the lesion site by neurosurgical application or by stereotactic injection.
[0109] In addition to regeneration of long-tract projections axons, with a focus on the corticospinal tract (CST), contralateral sprouting from uninjured axons and plasticity of the central pattern generators (CPGs) is also functionally important. Plasticity of interneurons in the spinal cord as used herein is the ability of the non-projection neurons to reform synaptic connections locally within the spinal cord which may be axon-dendrite connection, dendrite-dendrite connection, or dendrite-neuronal-cell body connections. Contralateral growth of CST fibers originating from uninjured axons may contribute to recovery of motor function after PTEN suppression following SCI. During CNS development there is an over-production of connections that are later pruned, and the CST also overproduces collateral branches prior to the refinement of circuits (Maier et al. (2006) Philosoph. Trans. Roy. Soc. B: Biol. Sci. 361(1473); 1611-1634). The major components of CPG networks are ventral interneurons that establish the rhythm and pattern of output of locomotor circuits. Delivering PTEN sdRNA inhibitors directly at the level of the injury is important in recovery after SCI, and stimulating plasticity of the ventral spinal cord is a good focus. Therefore, delivery of a compound that enhances sprouting and regeneration of axons is best delivered directly to the spinal cord, rather than targeting diverse nuclei of long tract neurons in brain and brainstem. For this reason, a local delivery approach is used here.
[0110] Local delivery of sdRNA targeted to PTEN enhances regeneration of long-tract neurons via retrograde transport of the sdRNA to the cell body where it decreases expression of PTEN. sdRNA can be retrogradely transported (
[0111] Fibrin sealants, when delivered to the injured spinal cord, are used to seal dural tears after spinal surgery. When delivered with a pre-filled syringe, the sealant forms a clot on the spinal cord that dissolves over several weeks. An alternative method of delivering a sdRNA molecule as described herein is the injection of the concentrated sdRNA solution directly into the clot. This delivery ensures that the sdRNA is not lost with surgical fluids and blood during the surgery, but will be released slowly over time. Delivery of sdRNA directly in the clot is useful because of their potency, and small volumes are required. For example, about 50 g to about 500 of sdRNA is required for direct delivery to the spinal cord in a volume of about 1 l to about 50 l. The volume is injected into a 2 mL clot which is the volume typically used by surgeons when they decompress the spinal cord by surgical intervention.
[0112] Chitosan hydrogels are suitable delivery systems for siRNAs. Chitosan hydrogel applied to the injured spinal cord in vivo are a permissive scaffold for axon regeneration after experimental SCI (Gnavi et al. (2013) Int. Rev. Neurobiol. 109:1-62). Therefore, delivery of chitosan gels containing PTEN sdRNA to a spinal cord lesion site in patients, either epidurally or by injection into the lesion cavity, is a useful method to enhance the axon regeneration, and at the same time provides a scaffold to support axon growth through the lesion site. sdRNA diluted in chitosan hydrogel can be delivered to the spinal cord injury site in liquid form an polymerizes into a gel at 37 C. siRNA in chitosan gels shows sloe release in vivo for at least 2 weeks (Ma et al. (2014) J. Nanotechnol. 12:23). Together with the prolonged activity of sdRNA, in vivo sdRNAs delivery by chitosan gels can provide exposure for at least one month after application to the injury site.
[0113] The following examples provide specific exemplary methods of the invention, and are not to be construed as limiting the invention to their content.
EXAMPLES
Example 1
Assay for Identification of Self-Deliverable PTEN sdRNA Compounds
[0114] The PTEN targeting agents described herein were designed and sent for synthesis as separate modified sense (s) and antisense (as) RNA strands. These strands were then annealed to form the sdRNA prior to testing (
[0115] The PTEN targeting agents were identified by treating HeLa cells carrying rat PTEN sequence with designed sdRNA compounds. For that, a luciferase reporter plasmid (
[0116] HeLa cells were transfected with the PTEN plasmid using Fugene HD (Promega, Madison, Wis.) according to the manufacturer instructions. Briefly, cells were seeded at 2.510.sup.6 cells/10 cm.sup.2 dish in the EMEM (ATCC, Manassas, Va.) medium without antibiotics. Cells were transfected 6 hr later with the plasmid at the 2.5:1 FuGENE:DNA ratio. Cells were left in the tissue culture incubator for 16 hr to 18 hr.
[0117] For sdRNA transfection, 2 M solutions of each PTEN lead candidate, MAP4K4 (positive control) and NTC (non-targeting control) sdRNAs were prepared in serum-free EMEM medium at 50 l/well of 96-well plate.
[0118] Luciferase-PTEN expressing HeLa cells were collected by trypsinization in a 50 ml tube, washed twice with medium containing 10% FBS without antibiotics, centrifuged at 200g for 5 min at room temperature (RT) and resuspended in EMEM medium containing 6% FBS and without antibiotics. The cells were dispensed at 50 l/well into the plate with pre-diluted oligos and placed in the incubator for 48 hrs.
[0119] For luciferase assay, cell lysates were prepared in Glo lysis buffer (Promega) at 50 l/well, incubated 30 min at RT and split into 2 white 96-well plates. Cell lysates were mixed with Renilla and Firefly assay buffers separately. Luminescence was detected in SpectraMax i3 (Molecular Devices, Sunnyvale, Calif.). The Renilla signal was normalized for the firefly signal and expressed as a percentage of non-targeting control sdRNA (NTC) transfected cells.
[0120]
Example 2
Delivery of sdRNA Into Rat Pheochromaocytoma PC-12 Cells
[0121] PC-12 cells (ATCC) were cultured on collagen I coated vessels in the presence of 100 ng/ml Nerve Growth Factor (NGF) (Sigma-Aldrich, St. Louis, Mo.). For transfection, cells were collected by trypsinization and diluted with RPMI medium containing 1% FBS and 100 ng/ml NGF and seeded into 96-well plate at 10,000 cells/well.
[0122] MAP4K4 sdRNA conjugated with Cy3 fluorophore was added to the cells at 1 M final concentration. Images were taken on EVOS FL Imaging System (Life Technologies, Carlsbad, Calif.) at various incubation times between 10 min and 24 hrs.
[0123]
Example 3
Validation of sdRNA Gene Silencing Efficacy in PC-12 Cells
[0124] PC-12 cells were cultured as described in EXAMPLE 1. The efficacy of MAP4K4 sdRNA was tested by qRT-PCR. 2 solutions of MAP4K4 and NTC (non-targeting control) sdRNAs were prepared in serum-free EMEM medium, by diluting 100 M oligonucleotides to 0.08 M-4 M final concentration in the total volume of medium for each oligo concentration. Oligonucleotides were dispensed into a 96-well plate at 50 l/well.
[0125] PC-12 cells were collected for transfection by trypsinization in a 50 ml tube, washed twice with medium containing 10% FBS without antibiotics, spun down at 200 g for 5 min at room temperature and resuspended in EMEM medium containing twice the required amount of FBS for the experiment (2%) and NGF (200 ng/ml). Cell concentration was adjusted to 120,000 cells/ml. Cells were dispensed into 50 l/well into the 96-well plate with pre-diluted oligos and placed in the incubator for 48 hr.
[0126] Gene expression was analyzed by qRT-PCR as follows. RNA was isolated from transfected PC-12 cells using the PureLink Pro96 total RNA purification Kit (ThermoFisher Scientific, Waltham, Mass.), with Quanta qScript XLT One-Step RT-qPCR ToughMix, ROX (VWR, Radnor, Pa.). The isolated RNA was analyzed for gene expression using the Human MAP4K4-FAM (Taqman Hs0377405_ml) and Human GAPDH-VIC (Applied Biosystems, Foster City, Calif.) gene expression assays.
[0127] The incubated plate was spun down and washed once with 100 l/well PBS and lysed with 150 l/well buffer provided in the kit. RNA isolation was conducted according to the manufacturer's instructions. RNA was eluted with 100 l RNase-free water, and used undiluted for one-step qRT-PCR.
[0128] Dilutions of non-transfected (NT) cells of 1:5 and 1:25 were prepared for the standard curve using RNase-free water. qRT-PCR was performed by dispensing 9 l/well into a low profile PCR plate and adding 1 l RNA/well from the earlier prepared RNA samples. After brief centrifugation, the samples were placed in the real-time cycler and amplified using the settings recommended by the manufacturer.
[0129] MAP4K4 gene expression was measured by qPCR, normalized to GAPDH and plotted as percent of expression in the presence of non-targeting sdRNA. The results were compared to the normalized according to the standard curve.
[0130] As shown in
Example 4
Validation of PTEN Gene Silencing Efficacy in PC-12 Cells
[0131] Six out of 20 sdRNAs targeting PTEN with more than 70% knock-down efficacy in luciferase assay (
[0132] Solutions of PTEN and NTC (non-targeting control) sdRNAs were prepared in serum-free EMEM medium. The final concentration range of oligonucleotides was 0.04 M-2 M. Treatment with sdRNA (48 hr) and qRT-PCR analysis were performed as described in EXAMPLE 3. PTEN expression was normalized to GAPDH and plotted as percent of expression of NTC sdRNA-treated cells.
[0133]
Example 5
Cross-Reactivity of Rat PTEN sdRNA Compounds in HeLa Cells
[0134] Cross-species PTEN targeting agents described herein were identified by comparison of human and rat gene sequences and validated by treating HeLa cells with designed sdRNA compounds.
[0135] For sdRNA transfection, 2 M solutions of PTEN, MAP4K4 (positive control) and NTC (non-targeting control) sdRNA were prepared in serum-free EMEM medium at 50 l/well of 96-well plate.
[0136] HeLa cells were collected by trypsinization as described in EXAMPLE 1 and dispensed at 6,000 cells/50 l/well into the plate with pre-diluted sdRNAs and placed in the incubator for 48 hrs.
[0137] PTEN expression was determined by qRT-PCR, as described in EXAMPLE 4.
[0138] Cross-species reactivity of PTEN sdRNA sequences is demonstrated by PTEN gene silencing activity in HeLa cells (
Example 6
Validation of PTEN Silencing in HeLa Cells
[0139] The dose response effect of the silencing activity of the most potent PTEN compound identified in EXAMPLE 5, BA-434, was measured in HeLa cells.
[0140] Solutions of PTEN sdRNA BA-434 and NTC (non-targeting control) sdRNA were prepared in serum-free EMEM medium. The final concentration range of oligonucleotides was 0.04 M-2 M. Treatment with sdRNA (48 hr) and qRT-PCR analysis were performed as described in EXAMPLE 3. PTEN expression was normalized to GAPDH and plotted as percent of expression of NTC sdRNA-treated cells.
[0141] As shown in
Example 7
Validation of PTEN sdRNA With Alternative Modification Pattern in PC-12 Cells
[0142] Silencing activity of fully stabilized PTEN compound (BA-434_fm) was tested in PC-12 cells for dose-response.
[0143] PC-12 cells were cultured and treated with sdRNA as described in EXAMPLE 3. Briefly, cells were treated with BA-434, BA-434_fm or NTC (non-targeting control) sdRNAs at the concentrations 0.04 M-1 M for 48 hr. Total RNA was isolated using PureLink Pro96 purification kit and used in one-step qRT-PCR. PTEN expression was normalized to GAPDH and plotted as percent of expression of NTC sdRNA-treated cells.
[0144]
Example 8
Longevity of BA-434_fm-Induced Silencing in PC-12 Cells
[0145] Longevity of PTEN gene silencing by BA-434 and BA-434_fm sdRNA was tested in PC-12 cells as follows.
[0146] PC-12 cells were cultured and prepared for sdRNA transfection as described in EXAMPLE 3. Cells were treated with BA-434, BA-434_fm or NTC sdRNAs at 1 concentration for 48 hrs. Transfection medium was then changed for the fresh RPMI with 1% FBS and 100 ng/ml NGF. At the specified time (48 hr, 72 hr, 96 hr, and 7 d), cells were washed once with 100 l/well PBS and once with FCW buffer. After removal of supernatant, cell processing mix of 23.5 l FCPL and 1.5 l gDNA wipeout solution was added to each well and incubated for 5 min at room temperature. Lysates were then transferred to PCR strips and heated at 75 C. for 5 min.
[0147] For qRT-PCR set up, the lysates were mixed with QuantiTect reagents from the FastLane Cell Multiplex Kit and with primer probe mix for PTEN-FAM/GAPDH-VIC. A volume of 9 l/well of each reaction mix was mixed with 1 l lysate per well and amplified using the settings recommended by the manufacturer. PTEN expression was normalized to GAPDH and plotted as percent of expression of NTC sdRNA-treated cells.
[0148] As shown in
[0149] PC12 cells were grown in DMEM/F12 media with 10% FBS, 5% horse serum, glutamine and Penicillin/Streptomycin, then 30,000 cells per well were plated in 24-well plates coated with collagen.
Example 9
PTEN Expression in PC12 Cells
[0150] PC12 cells were grown in DMEM/F12 media with 10% FBS, 5% horse serum, glutamine and Penicillin/Streptomycin, then 30,000 cells per well were plated in 24-well plates coated with collagen.
[0151] PC12 cells were treated for 72 hr with 1 M of BA-441, BA-442, BA-434 or non-targeting sdRNA diluted in DMEM-F12 supplemented with 1% FBS and 100 ng/ml NGF. PTEN protein expression was examined by Western blotting. The primary antibodies used were mouse anti-GAPDH (1:3000 dilution, Santa Cruz, Dallas, Tex.) and rabbit anti-PTEN (1:1500, Cell Signaling Technology, Danvers, Mass.) and corresponding secondary antibodies conjugated to horse radish peroxidase (1:5000, Cell Signaling Technology).
[0152]
Example 10
qPCR Analysis of PTEN Knock-Down in Rat Primary Neurons
[0153] Timed pregnant Sprague Dawley rats were purchased from Taconic Biosciences (Rensselear, N.Y.). Animals were euthanized by CO.sub.2 asphyxiation and embryonic day 17 (E17) embryos were removed from uterus. The embryo heads were separated, stored in Hibernate-E medium (Life Technologies, Woburn, Mass.) on ice. The cortex and hippocampus of the embryo were isolated from whole brain in DM (dissociation medium: HBSS with 2 mM MgCl.sub.2, 0.2 mM kynurenic acid, 2 mM HEPES, pH 7.2) under dissecting microscope, and transferred into a 15 ml conical tubes with DM on ice.
[0154] The neuron cells were dissociated in a tissue culture hood. The DM was removed from the cortex and hippocampus tissues, a 5 mL warm sterilized papain/DL-cysteine (12.5 units of papain in 1 DM solution, with DL-cysteine) was added into the tube, and the tube inverted once to mix the brain tissues with solution, which was then incubated at 37 C. water bath for 5 min. The tube was transferred from the water bath into the tissue culture incubator, and brain tissue pieces were allowed to settle down to the bottom of the tube. The papain solution was removed and 5 mL 1% trypsin inhibitor (Worthington, Lake Wood, N.J.) in 1 DM was added to the brain tissue. The tube was inverted and then placed in the oven at 37 C. for 3 min. The trypsin inhibitor was then removed and this procedure was repeated 2 more times. After removal of the final trypsin inhibitor solution, 2 mL of ice cold plating medium was added and the cells triturated with a glass pipette and a latex bulb 10 to 20 times, until tissue was fully dissociated. For cortical neurons from 1 litter (between 8 to 12 embryos), the neurons were placed into 20 mL cold plating medium and trituration was performed as described before.
[0155] For plating and culture of the neurons, 24-well plates were pre-coated with 0.1 mg/mL poly-D-lysine overnight and washed with sterile water twice and ready for cell plating. Cortical neurons were plated at a density of 200 k to 400 k cells/well and cultured at 37 C. incubator with 5% CO.sub.2. Hippocampus neurons were plated at a density of 5,000 to 20,000 cells/well in 8-well chamber slide pre-coated with PDL.
[0156] If the plating medium was DMEM with 10% FBS, 1 P/S, and 1 Glutamax, the medium was exchanged to Neurobasal medium supplemented with 1 B27, 1 P/S, and 1 Glutamax after one day. Half of the cell culture medium was replaced with fresh Neurobasal medium every 4 days.
[0157] To examine effects of BA-434 on PTEN mRNA expression in primary neurons, neurons were cultured for 8 days and then treated with different concentrations of BA-434, BA-441 or BA-442 ranging from 0.1 M to 1 M. Corresponding concentrations of NTC and MAP4K4 sdRNA were used as negative controls. sdRNAs were diluted in complete neurobasal culture medium and applied to the cells.
[0158] RNA was isolated from cells at 72 hr after treatment and PTEN mRNA was analyzed by qPCR. RNA was isolated from neuronal cells using Purelink RNA mini kit (Thermo Fisher Scientific) according to the manufacture's instruction. cDNA was prepared from RNA using High Capacity cDNA Reverse transcription kits (Thermo Fisher Scientific). 500 ng of RNA was mixed in a reaction tube with 10 Reaction buffer, 25 dNTP mix, 10 RT random primers and MultiScribe Reverse Transcriptase. Tubes were loaded on thermal cycler and the following program was run: 25 C. for 10 min, 37 C. for 120 min, and then 85 C. for 5 min to inactivate the RT reaction.
[0159] qPCR was performed using SYBR green PCR master mix (Thermo Fisher Scientific) using the following primers specific for PTEN and CSF-1 (housekeeping gene for internal normalization) transcript sequences:
[0160] The primers for PTEN transcript sequence are:
TABLE-US-00001 5 forward: (SEQIDNO:1) AAGGACCAGAGATAAAAAGGGAGT; 5 reverse: (SEQIDNO:2) ACCTTTAGCTGGCAGACCAC;
[0161] The primers for CSF-1 transcript sequence are:
TABLE-US-00002 5 forward: (SEQIDNO:3) CAAGGACTATAAGGAACAGAACGAG(housekeeping geneCSF1); 5 reverse: (SEQIDNO:4) GAAATTCTTGATTTTCTCCAGCA.
[0162] 25 ng/L of cDNA diluted 1:5 and 1.5 L of dilution were mixed with qPCR master mix (Thermo Fisher Scientific). Each reaction was run in duplicate. Ct values were collected and normalized with housekeeping gene CSF1 for each sample (Ct). All the samples are then normalized with non-targeting control (NTC) samples (Ct) and converted to 2{circumflex over ()}Ct.
[0163]
Example 11
Protein Analysis in Primary Neurons Treated with sdRNA
[0164] Primary cortical neurons were prepared as described in EXAMPLE 10 and cultured for 8 days.
[0165] Neurons were treated for 48 hr, 72 hr or 96 hr with 1 M sdRNAs BA-434, BA-441 and BA-442 and then collected and lysed in RIPA buffer with proteinase inhibiter and phosphatase inhibitors (HALT, Thermo Fisher Scientific). A total of g of protein per sample was loaded 10% Bis-Tris protein gels (Thermo Fisher Scientific), resolved by SDS-PAGE and transferred onto Immobilon-P PVDF membrane (Millipore, Billerica, Mass.). The membranes were incubated with antibodies against PTEN (Cell Signaling), Phospho-S6 Serine 240/44 (Cell Signaling), Phospho-Akt Threonine 308 (Cell Signaling), unphosphorylated S6 protein (Cell Signaling) and GAPDH (Santa Cruz). The membranes were washed with TBS-T buffer and blotted with anti-rabbit IgG (Promega) or anti-mouse IgG (Promega) secondary antibodies conjugated with horseradish peroxidase. Proteins were detected by chemiluminescence using Chemi-Doc imager (Biorad, Hercules, Calif.). The densitometric measurements of each band were performed with ImageJ. Values for PTEN and pS6 bands were normalized with the values of GAPDH band.
[0166]
[0167]
[0168] Use of RNAi for knock down of protein expression is typically effective immediately after it is added to cells in tissue culture. However, when sdRNA was applied to primary cortical neurons, it took at least 3 days to observe PTEN mRNA and protein knockdown (
Example 12
Effect of Modification of BA-434 and Potency of BA-434 in Comparison to Commercially Available Self-Delivering siRNAs
[0169] To improve the stability of BA-434, the lead sdRNA sequence with highest efficacy in neuronal cells, a fully fluoro- and methyl-modified (34FM) BA-434 (BA-434_fm) was synthesized. BA-434_fm has the same nucleotide sequence as BA-434 but increased fluoro-modification. Efficacy of BA-434 and BA-434_fm were compared against each other and against commercially available Accell sdRNAs produced by Dharmacon (Lafayette, Colo.).
[0170] Rat primary neurons were obtained and cultured as described in EXAMPLE 10. After 9 days in culture, cortical neurons were treated for 4 days with 0.1 M or 0.5 M BA-434, BA-434_fm or NTC sdRNA or Accell PTEN sdRNA or Accell NTC sdRNA. After 4 days of treatment, neurons were either extracted for PTEN mRNA analysis by qPCR as described in EXAMPLE 10 or for western blotting as described in EXAMPLE 11.
[0171]
[0172] These results demonstrate that BA-434 sdRNA is a more efficacious compound than commercially available sdRNAs and possesses the optimal nucleotide modification for maximum potency in neuronal cells.
Example 13
Time-Course Analysis of BA-434 in Primary Rat Cortical Neurons
[0173] Primary rat cortical neurons from 17 d embryos were obtained from rat cortices (Brainbits Inc. Springfield, Ill.). Cortices were digested with papain and dissociated. After dissociation, cortical neurons were cultured in poly-D-lysine-coated 24-well plates with Neurobasal medium containing NbActiv (Brainbits, Springfield, Ill.), 1% fetal bovine serum and penicillin-streptomycin. After 3 d in culture, cells were treated with 0.01 M, 0.1 M, 0.5 M or 1 M BA-434 sdRNA or 1 M non-targeting control (NTC) sdRNA. After 3 d of treatment, sdRNA was washed out from wells by medium exchange. Neurons were extracted either at 1 d, 4 d, 7 d or 11 d after washout (4 d, 7 d, 10 d and 14 d after treatment administration), and then processed for biochemical analysis. PTEN and GAPDH protein levels in cell culture samples were revealed using immunoblotting and measured by densitometry as described in EXAMPLE 11.
[0174]
Example 14
Evaluation of Neurite Outgrowth in NGF-Deprived PC12 Cells
[0175] PC 12 cells were obtained from ATCC. Cells were plated in collagen-1 (70 g/ml)-coated 6-well plates and cultured in PC12 growth media containing RPMI basal medium (Gibco, ThermoFisher Scientific), 10% horse serum, 5% fetal bovine serum and penicillin streptomycin until reaching 80% confluency. Cells were extracted by trypsinization, plated on PDL pre-coated coverslips coated with 5 g/ml laminin and cultured in DMEM/F12 media supplemented with 1% FBS and 1 ng/ml nerve growth factor (NGF, Peprotech, Rocky Hill, N.J.) for inducing neurite outgrowth. After 3 d in culture, cells were treated with 1 M BA-434 or 1 non-targeting control (NTC) sdRNA for 3 days. Subsequently, sdRNA was washed out from wells by medium exchange and PC12 cells were kept in culture for one additional day until fixation with 4% paraformaldehyde solution. Cells were labeled with fluorescent antibodies against beta-3 tubulin and with Hoechst (ThermoFisher Scientific, Waltham, Mass.) nuclear counterstain. 10 images per coverslip were acquired by fluorescence microscopy, and neurite length per image was semi-automatically quantified using the NeuroJ plugin for ImageJ. In addition, total number of neurites and the number of cells with neurites was manually quantified for each image by experimenter blinded to the experimental conditions.
[0176]
Example 15
Effect of PTEN Knock Down on Astrocyte Wound Healing
[0177] After mammalian spinal cord injury reactive astrocytes form a glial scar (REF). Migration of reactive astrocyte into the lesion epicenter have a crucial role in CNS wound healing after trauma. Enhancing migration of astrocytes into the lesion site after rodent spinal cord contusion injury promotes seclusion of CNS infiltrating blood borne monocytes, to enhance lesion contraction resulting in a reduced lesion area and to improve recovery of hindlimb function. Increased migration of astrocytes in vitro after astrocyte monolayer wound scratch correlates with increased astrocytes migration and enhanced wound healing in vivo (Okada et al. (2006) Nature Medicine 12(7):829-34). PTEN knock-out promotes cell migration and wound healing in vivo (Squarize et al. (2010) PLOS One 5(5): e10643).
[0178] To determine the effects of PTEN knock down by BA-434 on astrocyte migration and wound healing in vitro, primary rat astrocytes (Gibco, Thermo Fisher Scientific). Cells were seeded on PDL precoated glass coverslips (Corning) and grown in DMEM supplemented with 1% N2 (Hyclone, GE Healthcare Life Sciences, Marlborough, Mass.) and 10% FBS (Hyclone) (astrocyte growth media). After 3 d., medium was exchanged to 98% DMEM, 1% N2 and 1% FBS (astrocyte differentiation media) and cells were treated with 1 M of non-targeting control sdRNA, 1 M of BA-434 or left untreated. After 3 d of treatment, media was exchanged to astrocyte growth media to washout sdRNA.
[0179] After sdRNA washout, astrocyte monolayer was scratched with a sterile 100 uL pipette tip to induce an in vitro wound in the monolayer. 3 d after wounding cells were fixed using 4% PFA. Cells were immunolabeled with fluorescent GFAP antibodies. The in vitro wound was imaged using an epifluorescence microscope. The cell free area of the in vitro wound was measured using ImageJ plug-in.
[0180]
Example 16
PTEN Expression in Retinal Tissue
[0181] To determine PTEN expression in the normal retina, immunocytochemistry techniques were used. The eyes of adult rats were removed and fixed by immersion in 4% paraformaldehyde in 0.1 M phosphate buffer. The retinas were dissected, and prepared as flattened whole-mounts, immersed for 1 hr in the fixative solution, and rinsed in buffer, and left 4 h in a solution of 3% bovine serum albumin (BSA) with 2% Triton-X (blocking solution) with rabbit antibodies against PTEN (Cell Signaling). The retinas were rinsed in PBS+2% Triton-X then incubated in blocking solution with mouse antibody against NF-200 (BioLegend, San Diego, Calif.). After rinsing in PBS+2% Triton-X the retinas were incubated with the following secondary antibodies: Cy3-conjugated goat anti-rabbit antibody and a FITC-conjugated goat anti-mouse antibody. After rinsing in PBS+2% Triton-X 3 times over 1 hr, the retinas were given a final rinse in PBS, and then flat mounted on slides for viewing with a fluorescent microscope.
[0182] In
Example 17
PTEN Immunoreactivity in Retinal Tissue
[0183] Using the same whole-mount techniques described in EXAMPLE 14, retinas were prepared to examine PTEN immunoreactivity.
[0184]
Example 18
Knockdown of PTEN in Retinal Tissue
[0185] To investigate the ability of BA-434 to knockdown the expression of PTEN in the retina, 46 g Cy3-BA-434 were injected into the vitreous in a total volume of 5 L using a Hamilton syringe inserted into the posterior chamber without damaging the lens. The needle was inserted in the sclera just above the radial edge of the retina so that the retina was not touched by the needle. For this procedure, the rats were anesthetized, the eye was immobilized between 2 gloved fingers, and the sclera was punctured at the nasal superior aspect of the retina. The compound was injected into the vitreous using 1 mm of the Hamilton syringe capillary needle.
[0186] For the whole mount preparation, the superior aspect of the eye was identified by tying a silk suture to the tissue so that the eye orientation could be identified after removal. During the preparation of the retina, whole mount was prepared (as described in EXAMPLE 16). A longer, deeper cut was made in the superior part of the retina during the flat mount procedure to allow identification of the orientation of the retina on the slide, which allows precise localization of the quadrant of the eye where the test BA-434 was injected.
[0187]
[0188] At higher magnification of a BA-434-treated retina, there is the greatest loss of immunoreaction of axonal PTEN in the quadrant of the retina closest to the injection site (
Example 19
Time-Course Analysis of PTEN Protein Knock-Down in Rat Retina after BA-434 Intravitreal Administration
[0189] The left eye of 12 adult rats was intravitreally injected with 40 g BA-434 as described in EXAMPLE 15. As the control, 3 rats were similarly injected with 40 g NTC (non-targeting control) sdRNA. Whole retinas from the left and right eye of each rat were extracted at 4 d, 7 d, and 14 d after injection of BA-434 (3 rats per time point) or 14 d after injection of NTC, respectively, and snap frozen in liquid nitrogen.
[0190] Tissue weight was measured and an equivalent volume of lysis buffer (Boston Bioproducts, Boston, Mass.) was added to each sample. Retinas were homogenized inside lysis buffer using a 16-gauge needle syringe. Samples were incubated on ice for 30 min and then centrifuged at 10,000 rpm for 10 min at 4 C. Supernatant was transferred to a new tube and mixed 3:1 with Laemmli buffer (BioRad). Samples were boiled at 95 C. for min.
[0191] Samples were subjected for SDS-PAGE as described in EXAMPLE 11 for protein separation. Proteins were transferred on PVDF membranes (Millipore). Membranes were immunolabeled with antibodies against PTEN (Cell Signaling) and GAPDH (Santa Cruz).
[0192] PTEN and GAPDH protein levels were revealed by chemiluminescence and measured using densitometric analysis as described in EXAMPLE 11. PTEN levels were normalized against GAPDH and the ratio between left (treated) and right (untreated) eye was determined for each individual animal.
[0193] PTEN and GAPDH levels were also investigated in pooled samples, which contained 10 g of each individual animal per group. In pooled retina samples, levels of phosphorylated AKT (pAKT), glycogen synthase kinase beta (pGSK3) and ribosomal protein S6 (pS6rb) as well as the corresponding unphosphorylated protein (AKT, GSK3 and S6rb) were also examined as described above.
[0194]
Example 20
Promotion of Axon Regeneration by BA-434
[0195] To determine the ability of BA-434 to promote axon regeneration, an optic nerve crush model was used.
[0196] For surgery, the head was immobilized with a rodent head holder/gas mask and the periorbital area was shaved and prepared by cleaning with 70% alcohol followed by iodine (Povidone solution). The skin was opened along the mid-line of the skull and retracted laterally to expose the left superior orbital rim. An incision was made in the rim periosteum to access the superior aspect of the left orbit. The superior rectus and oblique muscles were sectioned near their insertion in the eye and the retractor bulbi muscle was opened longitudinally to access the optic nerve (ON) at its exit from the eye. The optic nerve was crushed with fine forceps or by tying a 10-0 fine suture around the nerve. This procedure was done after lifting the nerve out of the sheath to avoid damaging the ophthalmic artery. The optic nerve was crushed, and at the same time 40 g BA-434 or non-targeting control (NTC) sdRNA was injected into the eye, as described in EXAMPLE 16. In all animals, the left eye was the treated eye and the right eye was untreated (without optic nerve injury). Following optic nerve crush the retinal blood flow was assessed by direct ophthalmoscopy of the eye fundus through the operating microscope. When necessary, eye fundus examination was facilitated by a drop of 1% tropicamide (Alcon). Animals that show ischemia were euthanized.
[0197] Two weeks later 0.5% cholera toxin beta (CTB) subunit conjugated to Alexa 555 (Thermo Fisher Scientific) was injected intravitreally into the left eye to anterogradely label the retinal ganglion cells (RGCs) and their injured axons. Twenty-four hours after injection of CTB, the animals were deeply anaesthetized and then transcardially perfused with 4% paraformaldehyde solution. After perfusion and a 1 cm piece of optic nerve, with the injury site in the center, were extracted and transferred to 30% sucrose solution for 48 hrs. The optic nerve was embedded in Shandon M-1 embedding matrix (Thermo Fisher Scientific) and snap-frozen in cold (80 C.) isopentane. 15 m longitudinal sections of the optic nerve were prepared using a Leica cryostat and mounted on Superfrost Plus microscope slides (Thermo Fisher Scientific).
[0198] Sections were immunolabeled with rabbit anti-IBA-1 primary antibodies and corresponding secondary fluorescent antibody as described in EXAMPLE 13 as well as with DNA-binding dye DAPI (Thermo Fisher Scientific). Sections were then imaged using a Nikon epifluorescence microscope.
[0199] GAP43 is only expressed in growing axons during development or during regeneration. To determine if BA-434 can induce long-distance regeneration, after applying BA-434 to the eye after optic nerves crush the sections were immunolabeled with anti-GAP43 antibody (Abcam, Cambridge, Mass.) as described in EXAMPLE 13.
Example 21
In Vivo Injection of BA-434-Cy3 and Spinal Cord PTEN Expression
[0200] To determine tissue distribution of BA-434 in the spinal cord, a laminectomy was performed in adult Balb-C mice and BA-434 (10 g-50 g) was injected into the grey matter of the spinal cord. 24 hr after intraspinal injection the mice were deeply anaesthetized and then transcardially perfused with 4% paraformaldehyde. A 1.5 cm piece of spinal cord comprising the injection site, was dissected from the vertebral column and transferred to 30% sucrose solution. 20 um cryostat sections were prepared and imaged as described in EXAMPLE 17. Sections were immunolabeled with a PTEN antibody as described in EXAMPLE 13.
[0201]
Example 22
Uptake of BA-434 by Neuronal Axons
[0202] To determine whether BA-434 is taken up by neuronal axons, E17 cortical neurons were obtained as described in EXAMPLE 10 and plated in microfluidic chambers.
[0203] Microfluidic chambers consisted of a cell soma compartment and an axon compartment which are connected by capillary channels with a diameter of 5 m.
[0204] Microfluidic chambers were casted using custom made molds that were filled with polydimethylsiloxane (PDMS) and cured at 60 C. After removal from the molds, PDMS microfluidic chambers were tested for proper sealing and separation of both compartments by adding Trypan blue solution to the axon compartment.
[0205] PDL/Laminin pre-coated coverslips (Fisher Scientific, Hampton, N.H.) and E17 rat cortical neurons were plated on the coverslip. 10 days after plating 1 m of BA-434-Cy3 was added to the axon compartment. 3 days after treatment administration, 4% paraformaldehyde solution was added to each compartment to fix neuronal soma and axons.
[0206] Microfluidic chambers were imaged using an epifluorescence microscope.
Example 23
Delivery, Dose and Therapeutic Window for Treatment of SCI with sdRNA
[0207] To examine the effects of BA-434 on axon regeneration and function recovery after SCI and to validate the clinical route of delivery by direct application to the injured spinal cord during decompression surgery, local delivery in a fibrin or collagen matrix in a rat model of spinal cord injury is used (
[0208] Adult pathogen-free male and female Sprague-Dawley rats (8 weeks) are housed under a 12-h light-dark cycle with free access to water and food. Under isoflurane anesthesia (3-5%), rats are subjected to laminectomy at the level of T9. To do this, the skin is opened and bone removed with rongeurs to expose the T9 spinal cord. The spinal cord is injured by contusion injury using the Infinite Horizon contusion injury device (Precision Systems and Instrumentation because it models human SCI lesions. On the day of surgery, animals are randomized to their respective group.
[0209] After contusion injury sdRNA is delivered by injecting the sdRNA into a matrix already FDA-approved for human use. Either an approved fibrin sealant such as Tisseel, or a collagen matrix, such as Evolence, is used. Both compounds are sold as pre-filled syringes. The gel is applied to the spinal cord and allowed to polymerize and to control residual bleeding from the surgery. Either directly after the injury, 1 d or 3 d after injury, 5 L containing about 40 sdRNA is injected into the formed clot, or using a sterile Hamilton syringe. For controls, a non-targeting sdRNA is injected into the matrix after contusion and laminectomy only (sham) animals are used as well. After test compound application, the overlaying muscle and skin are sutured.
[0210] Determination of sdRNA diffusion and activity in spinal cord tissue is determined by using Cy-3 fluorescently labeled sdRNA (both BA-434 and NTC). The animals are sacrificed with an overdose of anesthetics and perfused with 0.9% saline followed by perfusion with 4% PFA solution. A 2 cm spinal cord piece, with the lesion site in the center will be dissected from the vertebral column and transferred to 30% sucrose. 30 m serial longitudinal cryostat sections of the spinal cord are prepared and mounted onto superfrost microscope slides and the area of Cy3 fluorescence will be revealed and measured with epifluorescence microscopy.
[0211] To examine efficacy and activity of BA-434 in the rat spinal cord, the biomarkers PTEN, p-S6 and p-AKT are evaluated in spinal cord tissue at different time-points after treatment administration. Western blotting of spinal cord tissue is performed as described in EXAMPLE 13. The animals are sacrificed with an overdose of anesthetics and perfused with 0.9% saline. 3 pieces of spinal cord tissue are collected including the lesion site and the dorsal and ventral regions directly adjacent to the lesion site. After tissue is dissected from vertebral column it is snap frozen with liquid nitrogen.
[0212] Tissue samples are processed as described in EXAMPLE 19. Proteins are resolved with SDS-PAGE as described in EXAMPLE 11 and probed with antibodies as described in Example 11.
[0213] For anterograde labeling of regenerating CST axons, 4 months after injury, CST fibers are labeled by injection of the anterograde tracer BDA (Molecular Probes, Eugene, Oreg.) into the motor cortex using a 10 l Hamilton syringe. Approximately 3 L 10% BDA prepared in saline is injected at 8 sites from each side. The animals are euthanized with anesthetic overdoses 2 weeks later, and perfused transcardially with saline, then 4% paraformaldehyde. The spinal cords are removed and serial longitudinal cryostat sections of the spinal cord are cut at 30 m thickness and reacted for BDA with avidin-biotin-peroxidase complex or with fluorescent secondary antibodies. Sections are co-labelled with fluorescent antibodies against GAP-43 as described in EXAMPLE 17 to identify regenerating axons. Measurement of axon regeneration is assessed as described in Dergham J. Neurosc (2002). 22:6570-6577).
[0214] For the demonstrating anatomical spinal cord regeneration and repair, the rats are sacrificed with an overdose of anesthetic and were intracardially perfused with 0.9% saline, followed by phosphate-buffered 4% paraformaldehyde (PFA). Brain and spinal cord (containing also the site of SCI) is extracted from skull and the vertebral column, respectively. CNS tissue is post-fixed in 4% PFA for 2 hr and transferred into a 30% sucrose solution for at least 48 h. Cryostat sections of the PFA-fixed spinal cord piece are prepared. Spinal cord is embedded into tissue molds using Shandon M1 embedding matrix (Thermo Fisher Scientific) and snap-frozen in cold isopentane. 15 m longitudinal sections of the lesion site and coronal sections of the adjacent rostral and caudal spinal cord regions are obtained using a Leica cryostat, mounted onto Super Frost microscope slides and dried. Sections are permeabilized with 0.1% Triton-X in 1PBS for 1 hr and subsequently incubated for 1 hr with a blocking solution (5% normal goat serum, 3% BSA in PBS).
[0215] Regenerating fibers are detected with fluorescent antibodies against serotonin (to reveal regeneration of raphespinal fibers), PKC-gamma (to reveal regeneration of CST fibers) and GAP43 (to reveal all regenerating fibers). Antibody labeling procedure is performed as described in EXAMPLE 13. Images of the tissue sections are acquired by fluorescent microscopy. The number v, caudal and inside the lesion site will be manually counted by an experimenter blinded to the experimental conditions.
[0216] Spinal cord repair and wound healing is revealed by immunolabeling the tissue section with antibodies against the astrocyte marker GFAP. Immunolabeling is performed as described in EXAMPLE 13. The size of the lesion is identified by increased GFAP immunoreactivity of the astroglial scar. Lesion area of every 6th consecutive section will be measured with ImageJ and average area is determined for each animal.
[0217] Motor function of control and sdRNA treated rats treated with sdRNA is assessed using a battery of behavioral assays that measure hindlimb locomotor function including the Basso, Beattie, and Bresnahan (BBB) Open Field Locomotor Rating Scale (Basso, et al. (1995) ibid.) and the horizontal ladder. For BBB scoring, rats are evaluated by two observers for 4 min. Locomotion is taped using a video camera by another observer. Hindlimb BBB scores are determined for each animal in a blinded fashion for both hind-limbs and then averaged to obtain the score of each animal. For horizontal ladder animals are video recorded while passing an elevated horizontal with variable spaced ladder rungs and foot slips between the ladder rungs are counted for each animal. The average number of foot slips per animal from two ladder runs will be obtained and used as a measure for voluntary hind limb control.
[0218] Delivery of BA-434 locally to the spinal cord lesion site promotes after SCI enhances regeneration and spinal cord repair. Neurons in the spinal cord grey matter highly express PTEN (
Example 24
Prevention of Retinal Ganglion Neuron Loss in a Model of Glaucoma with sdRNA
[0219] To determine the effects of BA-434 on retinal ganglion neuron survival and functional recovery in the setting of glaucoma (as a model of optic neuropathy), local intravitreal delivery of BA-434 is performed (as also described for
[0220] One week after the procedure to induce an elevation in intraocular pressure in the left eye, BA-434 is injected intravitreally in one cohort as described above in EXAMPLE 18. For a control cohort, NTC is injected intravitreally and another group receives no injection. One to two weeks after sdRNA injection, the animals are perfused transcardially with 4% paraformaldehyde to fix the tissues. Optic nerves are dissected and immersion fixed for an additional 24 hours. They are then embedded in plastic to allow for ultrathin sectioning. Ultrathin cross sections of the optic nerve from the area immediately adjacent to the eye globe are stained using Luxol Fast Blue to identify myelinated axons in the nerve. Counting of the myelinated axons in high power microscopic views show that knockdown of PTEN using BA-434 prevents loss of myelinated axons as compared to the NTC control, thus lessening the nerve loss caused by elevated intraocular pressure. Degenerative changes in the nerve (which only contains axons derived from retinal ganglion cells) are also reduced by BA-434 treatment.
[0221] As a companion validation, retinas are removed from the eyes of the BA-434 and NTC treated rats and prepared for flat mount fluorescent microscopy characterization as described in EXAMPLE 18 above. Immunofluorescent histochemistry shows using antibodies against Brn3a identifies all retinal ganglion cells (RGCs) in the flatmount specimen. Counting of the stained cell bodies shows that BA-434 treatment prevents the loss of RGCs in eyes with elevated intraocular pressure, modeling glaucoma, while NTC treatment or no injection show no capacity for preventing loss of RGCs in the retina.
EQUIVALENTS
[0222] Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments described specifically herein. Such equivalents are intended to be encompassed in the scope of the following claims.