RECOMBINANT MATURE COMPLEMENT FACTOR I

Abstract

The disclosure provides, in part, compositions comprising mature recombinant mature Complement Factor I (CFI) protein and methods of making and using those compositions.

Claims

1. A composition comprising a recombinant mature Complement Factor I (CFI) protein, wherein the recombinant mature CFI protein comprised in the composition represents greater than about 50% by weight of a total CFI protein content of the composition.

2. The composition according to claim 1, wherein the recombinant mature CFI protein represents greater than about 60% by weight of the total CFI protein content of the composition.

3. The composition according to claim 1 or claim 2, wherein the recombinant mature CFI protein represents greater than about 70% by weight of the total CFI protein content of the composition.

4. The composition according to any preceding claim, wherein the recombinant mature CFI protein represents greater than about 80% by weight of the total CFI protein content of the composition.

5. The composition according to any preceding claim, wherein the recombinant mature CFI protein represents greater than about 90% by weight of the total CFI protein content of the composition.

6. The composition according to any preceding claim, wherein the recombinant mature CFI protein represents greater than about 95% by weight of the total CFI protein content of the composition.

7. The composition according to any preceding claim, which optionally further comprises a recombinant precursor Complement Factor I protein, wherein the ratio of recombinant mature CFI:recombinant precursor CFI in the composition is from greater than 50:50 to 100:0.

8. A composition comprising a recombinant mature Complement Factor I (CFI) protein and optionally a recombinant precursor Complement Factor I protein, wherein the ratio of recombinant mature CFI:recombinant precursor CFI in the composition is from greater than 50:50 to 100:0.

9. The composition according to claim 7 or claim 8, wherein the ratio of recombinant mature CFI:recombinant precursor CFI in the composition is from 60:40 to 100:0.

10. The composition according to any of claims 7 to 9, wherein the ratio of recombinant mature CFI:recombinant precursor CFI in the composition is from 70:30 to 100:0.

11. The composition according to any of claims 7 to 10, wherein the ratio of recombinant mature CFI:recombinant precursor CFI in the composition is from 80:20 to 100:0.

12. The composition according to any of claims 7 to 11, wherein the ratio of recombinant mature CFI:recombinant precursor CFI in the composition is from 90:10 to 100:0.

13. The composition according to any of claims 7 to 12, wherein the ratio of recombinant mature CFI:recombinant precursor CFI in the composition is from 95:05 to 100:0.

14. The composition according to any preceding claim, wherein the recombinant CFI protein is a human CFI protein.

15. The composition according to any preceding claim, wherein the recombinant mature CFI protein comprises a first amino acid molecule comprising an amino acid sequence as set forth in SEQ. ID. No. 1.

16. The composition according to any of claims 1 to 14, wherein the recombinant mature CFI protein comprises a first amino acid molecule comprising an amino acid sequence which has at least 80% sequence identity to the amino acid sequence as set forth in SEQ. ID. No. 1.

17. The composition according to claim 16, wherein the recombinant mature CFI protein comprises a first amino acid sequence that is at least 90% identical to the amino acid sequence as set forth in SEQ ID NO: 1.

18. The composition according to claim 17, wherein the recombinant mature CFI protein comprises a first amino acid molecule comprising an amino acid sequence that is at least 95% identical to the amino acid sequence as set forth in SEQ ID NO: 1.

19. The composition according to any preceding claim, wherein the recombinant mature CFI protein comprises a further amino acid molecule comprising an amino acid sequence as set forth in SEQ. ID. No. 2, wherein the first and further amino acid sequence are linked by a disulphide bond.

20. The composition according to any of claims 1 to 18, wherein the recombinant mature CFI protein comprises a further amino acid molecule comprising an amino acid sequence which has at least 80% sequence identity to the amino acid sequence as set forth in SEQ. ID. No. 2 wherein the first and further amino acid sequence are linked by a disulphide bond.

21. The composition according to claim 20, wherein the recombinant mature CFI protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence as set forth in SEQ ID NO: 1.

22. The composition according to claim 21, wherein the recombinant mature CFI protein comprises a further amino acid molecule comprising an amino acid sequence that is at least 95% identical to the amino acid sequence as set forth in SEQ ID NO: 2.

23. The composition according to any preceding claim, which is essentially free of a furin protein.

24. The composition according to any preceding claim, which is a pharmaceutical composition.

25. The composition according to claim 20, which further comprises one or more pharmaceutically acceptable excipients.

26. The composition according to any preceding claim for use in the treatment of a complement-mediated disorder.

27. The composition according to claim 22 for use in the treatment of a C3 myopathy.

28. The composition according to claim 22 for use in the treatment of a complement-mediated disorder, wherein the complement-mediated disorder is selected from age-related macular degeneration, Alzheimer's Disease, atypical haemolytic uraemic syndrome, membranoproliferative glomerulonephritis Type 2 (MPGN2), atherosclerosis (in particular, accelerated atherosclerosis) and chronic cardiovascular disease.

29. A method of preparing a composition comprising a recombinant mature Complement Factor I (CFI) protein, wherein the recombinant mature CFI protein represents greater than 50% by weight of a total CFI protein content of the composition, the method comprising: a. contacting a recombinant precursor CFI protein with a furin protein or fragment thereof; and b. incubating the recombinant precursor CFI protein with the furin protein or fragment thereof for a predetermined period of time, whereby the furin protein or fragment thereof cleaves the recombinant precursor CFI protein at or adjacent to a RRKR linker sequence site to form the recombinant mature Complement Factor I protein.

30. The method according to claim 29, wherein the recombinant precursor CFI protein is a human precursor CFI protein.

31. The method according to claim 29 or claim 30, wherein the recombinant precursor CFI protein comprises a tag.

32. The method of claim 31, wherein the tag is a His-tag.

33. The method according to any of claims 29 to 32, which further comprises expressing the recombinant precursor CFI protein prior to step (a).

34. The method according to claim 33, which comprises expressing the recombinant precursor CFI protein in a eukaryotic cell.

35. The method according to claim 33, which comprises expressing the recombinant precursor CFI protein in a prokaryotic cell.

36. The method of claim 35, wherein the prokaryotic cell is Escherichia coli.

37. The method according to claim 34, wherein the eukaryotic cell is selected from an insect, a yeast or a mammalian cell.

38. The method according to claim 37, wherein the mammalian cell is a CHO cell.

39. The method according to any of claims 29 to 38, which comprises isolating the expressed recombinant precursor CFI protein prior to step (a).

40. The method according to any of claims 29 to 39, wherein step (a) comprises adding the furin protein or fragment thereof to a solution comprising the expressed recombinant precursor CFI protein.

41. The method according to any of claims 29 to 40, wherein step (b) comprises incubating the furin protein or fragment thereof with the recombinant precursor CFI protein at a temperature of between about 25 C. to about 42 C.

42. The method according to any of claims 29 to 41, wherein step (b) comprises incubating the furin protein or fragment thereof with the recombinant precursor CFI protein at a temperature of between about 30 C. to about 42 C.

43. The method according to any of claims 29 to 41, wherein step (b) comprises incubating the furin protein or fragment thereof with the recombinant precursor CFI protein at a temperature of between about 35 C. to about 38 C.

44. The method according to any of claims 29 to 43, wherein step (b) comprises incubating the furin protein or fragment thereof with the recombinant precursor CFI protein in a solution having a pH of between about 5 and 7.

45. The method according to claim 44, wherein step (b) comprises incubating the furin protein or fragment thereof with the recombinant precursor CFI protein in a solution having a pH of between about 5 and 6.

46. The method according to claim 44 or claim 45, wherein the solution comprises calcium ions.

47. The method according to claim 46, wherein the solution comprises calcium ions at a concentration of between about 1 mM to about 5 mM.

48. The method according to any of claims 44 to 47, wherein the solution further comprises potassium ions.

49. The method according to any of claims 29 to 48, wherein step (b) comprises incubating the furin protein or fragment thereof with the recombinant precursor CFI protein for between about 5 hours and about 48 hours.

50. The method according to any of claims 29 to 49, wherein step (b) comprises incubating the furin protein or fragment thereof with the recombinant precursor CFI protein for between about 8 hours and about 20 hours.

51. The method according to any of claims 29 to 50, wherein the furin protein or fragment thereof comprises the amino acid sequence as set forth in SEQ. ID. No. 4 or a fragment thereof.

52. The method according to claim 51, wherein the furin protein fragment comprises at least amino acid residues 108 to 715 of a protein comprising the amino acid sequence as set forth in SEQ. ID. No: 4.

53. The method according to any of claims 29 to 52, which further comprises isolating the recombinant mature CFI protein.

54. The method according to claim 53, which further comprises purifying the isolated recombinant mature CFI protein.

55. The method according to any of claims 29 to 53, wherein the recombinant precursor CFI protein comprises an amino acid sequence as set forth in SEQ. ID. No: 3.

56. The method according to any of claims 29 to 54, wherein the recombinant precursor CFI protein comprises an amino acid sequence as set forth in SEQ. ID. No. 3.

57. A composition obtainable from the method of any of claims 29 to 56.

58. A method of treating a complement-mediated disorder, the method comprising: a. administering a therapeutically effective amount of a composition according to any of claims 1 to 28 or claim 57 to a subject in need thereof.

59. The method according to claim 58, which is a method of treating a C3 myopathy.

60. The method according to claim 59, which is a method of treating a complement-mediated disorder, wherein the complement-mediated disorder is selected from age-related macular degeneration, Alzheimer's Disease, atypical haemolytic uraemic syndrome, membranoproliferative glomerulonephritis Type 2 (MPGN2), atherosclerosis (in particular, accelerated atherosclerosis) and chronic cardiovascular disease.

61. The method according to claim 60, which is a method of treating age-related macular degeneration.

62. A pharmaceutical composition comprising the composition of any one of claims 1-28, and a pharmaceutically acceptable carrier.

63. The pharmaceutical composition of claim 62, wherein the composition is substantially pyrogen free.

64. The pharmaceutical composition of claim 62 or 63, wherein the composition is sterile.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0104] Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which:

[0105] FIG. 1 depicts an overview of certain aspects of the complement system;

[0106] FIG. 2 depicts the amino acid sequences of proteins described herein. Particularly: [0107] SEQ. ID. No. 1 is an amino acid sequence of human heavy chain of a mature Complement Factor I; [0108] SEQ. ID. No. 2 is an amino acid sequence of human light chain of a mature Complement Factor I; [0109] SEQ. ID. No. 3 is an amino acid sequence of human precursor Complement Factor I; [0110] SEQ. ID. No. 4 is an amino acid sequence of a human furin protein; and [0111] SEQ. ID. No. 7 is an amino acid sequence of a linker sequence of human Complement Factor I.

[0112] FIG. 3 depicts AKTA purification of WT Factor I (FI). FI was detected by measuring UV absorbance at 280 nm, as demonstrated by the blue trace. The green trace represents the imidazole gradient. The red circle highlights the point at which FI was eluted from the column. Samples of fractions corresponding to this area and surrounding fractions were run under reduced conditions on a western. There is a single band at 88 kDa and this corresponds to the proform of FI only.

[0113] FIG. 4 is a representation of the processing of recombinant human FI in mammalian cell lines. Pro-FI undergoes processing before secretion. When CFI is expressed in cell lines, incomplete processing of the protein results in the secretion of both Pro-FI with an intact RRKR linker, and the mature FI in which the heavy and the light chain is linked only by a disulfide bond.

[0114] FIG. 5 shows appearance of FI on a Western blot. Diagram shows how different forms of FI appear on both non-reduced and reduced Western blots. Pro-FI will appear at 88 kDa under reduced and non-reduced conditions. Mature FI will appear at 88 kDa under non-reducing conditions, but when reduced will appear at 50 kDA due to breakage of the disulphide bond. FI broken down into its two constituent chains will always appear at 50 kDa under both reduced and non-reduced conditions. The light chain is not often detected on a western blot as antibodies used for detection predominantly detect heavy chain epitopes.

[0115] FIG. 6 shows Western blots to show effect of adding furin to pro-FI in sodium acetate (pH 5.0) buffer and Pro-FI in HEPES (pH 7.0) buffer. All reactions had a final concentration of 100 mM buffer and 5 mM CaCl.sub.2. All samples were incubated for 15 hours at 37C unless stated otherwise. Lane 1 contains purified Pro-FI before exchange into different buffers, non-incubated. Lane 2 contains Pro-FI alone in sodium acetate buffer. Lane 3 contains Pro-FI in sodium acetate buffer with furin. Lane 4 contains Pro-FI alone in HEPES buffer. Lane 3 contains Pro-FI in HEPES buffer with furin.

[0116] FIG. 7 shows a Western blot (reduced and non-reduced) to determine the minimum concentration of furin required to achieve full cleavage of Pro-FI at the RRKR linker. All reactions had a final concentration of 100 mM sodium acetate (pH 5) and 5 mM CaCl.sub.2. Lane 1 contains Pro-FI and buffer only. Lane 2 contains Pro-FI in buffer with half of the concentration of furin in lane 1. Concentration of furin is halved a further 3 times in lanes 4, 5 and 6. Non-reduced Western confirms the nature of FI in cleavage reactions is cleaved FI.

[0117] FIG. 8 shows a Western blot (reduced) which shows the effect of changing concentration of calcium ions and potassium ions on furin efficacy. All reactions had a final concentration of 1/32 furin compared to previous experiments and 100 mM sodium acetate (pH 5) buffer. All reactions were incubated at 37C for a period of 16 hours. The first lanes contain Pro-FI in a buffer containing 5 mM CaCl.sub.2. The second lanes contain pro-CFI in a buffer containing 5 mM CaCl.sub.2 with furin. The third lanes contain pro-CFI in a buffer containing 1 mM CaCl.sub.2. The fourth lanes contain Pro-FI in a buffer containing 1 mM CaCl.sub.2 with furin. All four lanes in the bottom western also contain 20 mM KCl. The first lanes contain Pro-FI in a buffer containing 5 mM CaCl.sub.2. The second lanes contain pro-CFI in a buffer containing 5 mM CaCl.sub.2 with furin. The third lanes contain pro-CFI in a buffer containing 1 mM CaCl.sub.2. The fourth lanes contain Pro-FI in a buffer containing 1 mM CaCl.sub.2 with furin. All four lanes in the bottom western also contain 20 mM KCl.

[0118] FIG. 9 shows the results of a C3b cofactor assay to determine the activity of Pro-FI compared to mature FI. All reactions were incubated at 37C for 20 min. Two separate exposures are used due to low intensity of the lower bands, and too high intensity of the bands above 50 kDa. Lane 1 contains iC3b (cleaved C3b), positive control. Lane 2 contains uncleaved C3b, negative control. Lane 3 contains C3b and previously non-incubated pro-FI. Lane 4 is empty. Lane 5 contains C3b and Pro-FI. Lane 6 contains C3b and furin only, to demonstrate furin does not cleave C3b, Lane 7 contains furin alone, to demonstrate antibodies used do no cross react with furin. Lane 8 contains C3b, Pro-FI and furin (therefore cleaved FI). Appearance of 2 band in lane 1 and lane 8 only suggests cleavage of C3b took place in these lanes only. Therefore, this data suggests that only cleaved FI has activity, and Pro-FI is inactive.

[0119] FIG. 10 illustrates a western blot to determine the activity of pro-FI to mature FI. Equal samples were available for lane 4 and lane 7, which allowed a valid comparison between the activity of pro-CFI and cleaved CFI to be made. All reactions were incubated at 37C for 20 min. Lane 1 uncleaved C3b, negative control. Lane 2 contains C3b and previously non-incubated Pro-FI. Lane 3 is empty. Lane 4 contains C3b and pro-CFI. Lane 5 contains C3b and furin only, to demonstrate furin does not cleave C3b, Lane 6 contains furin alone, to demonstrate antibodies used do no cross react with furin. Lane 7 contains C3b, Pro-FI and furin (therefore cleaved FI).

METHODS AND MATERIALS

Mutagenesis

[0120] The pDR2 E1F vector used for expression of recombinant pro-CFI (pro-rCFI), was provided by Dr Kevin Marchbank (Institute of Cellular Medicine Newcastle University). Site-directed mutagenesis was performed using the QuikChange site directed mutagenesis kit (Stratagene, La Jolla, Calif.) (Cat #200523) to add a 6 histidine tag to CFI cDNA in pDR2 EF1 to form pDR2 EF1. Primers used for the mutagenesis are shown in Table 1. Full length Maxiprep sequencing was undertaken to ensure fidelity of both the wild-type and mutant vectors.

TABLE-US-00001 TABLE1 Mutagenesisprimers Reverse GAGATCACAATTTTAATGATGATGATGATGATGCTTATC GTCATCGTCTACATTGTACTGAGAAATAAAAGG (SEQ.ID.NO5) Forward CCTTTTATTTCTCAGTACAATGTAGACGATGACGATAAG CATCATCATCATCATCATTAAAATTGTGATCTC (SEQ.ID.NO6)

Cell Culture

[0121] Chinese hamster ovary cells (CHO) cells were maintained in DMEM:F12 mixture (Lonza Group Ltd) supplemented with L-Glutamine (final concentration 4.5 mM, Life Technologies), penicillin and streptomycin (100 U/ml each, Life technologies) and 10% heat inactivated Fetal Bovine Serum (FBS) (Biosera). Transient transfection of CHO cells was performed using a jetPEI DNA transfection protocol.

Cell Transfection

[0122] Cells were counted with a haemocytometer and diluted to 75,000 cells/ml. A 6 well culture plate had 2 ml of cells added per well (150,000 cells per well). 3 g of DNA encoding the pro-CFI cDNA was diluted with sodium chloride (NaCl) to a final concentration of DNA in a volume of 100 l. 6 L of jetPEI reagent (Polyplus) was diluted in NaCl to a final concentration in a volume of 100 ul. The jetPEI solution was added in its entirety to the DNA solution, and this mixture was incubated for 30 minutes at room temperature. 200 L of jetPEI/DNA mix was added per well to the cells in 1 ml of serum containing medium. Plates were then incubated at 37 C. for 24 hours. After 24 hours, the supernatant was removed from the flasks and checked for expression of CFI using a nickel pulldown assay.

Nickel Pulldown

[0123] Hygromycin was added to incubated cells to remove non-transfected cells. Single clones were then isolated using limited dilution. Growth of cells was monitored and wells which contained a single colony of cells were established. These were transferred to separate flasks and supernatant removed to perform western blot analysis using nickel-Sepharose beads (Ni Sepharose Excel, GE Healthcare Life Sciences) to establish the best expressers of FI. 50 L of bead slurry was placed in phosphate buffered saline (PBS) and centrifuged at 300g to precipitate the beads, before removal of the PBS. 1 ml of cell culture supernatant was then added to the beads. The cell culture supernatant and bead mix was then incubated for 2 hours at room temperature end over end or at 4 C. overnight. After incubation the samples were centrifuged at 300g and supernatant was removed gently so as to not disturb the pellet which should be bound to the His-tagged protein. The pellet was then washed with 20-40 mM imidazole to remove non-specifically bound proteins. After washing, samples were spun at 300g and supernatant was removed, leaving the pellet. Pelleted nickel beads and bound protein were then subjected to western blot analysis to check for expression of pro-CFI.

[0124] The protocol followed is as follows: [0125] 1. Using 1.5 ml V bottomed tubes wash 50 ul aliquots of bead slurry (25 ul of beads+25 ul 20% EtOH) in PBS (each 50 ul is enough to pull down 1 ml of supernatant) [0126] 2. Spin beads at 300g, remove PBS [0127] 3. Add 1 ml supernatant [0128] 4. Incubate for 2 hr @ RT end over end (or o/n at 4 degrees) [0129] 5. Spin at 300g and gently remove supernatant [0130] 6. Wash with 20-40 mM Imidazole to remove non-specific binders [0131] 7. Spin at 300g and gently remove supernatant [0132] 8. Wash with PBS [0133] 9. Spin at 300g and gently remove supernatant leaving approx 35 ul of PBS [0134] 10. Add relevant volume of loading buffer for western 10 ul 5 loading buffer to account for buffer between beads [0135] 11. Boil as normal [0136] 12. Spin at 300g remove sample and load 35 ul on western

Protein Purification

[0137] Supernatant of rCFI expressing cells was collected and purified on an AKTA purifier (GE Healthcare, Piscataway, N.J.) using a 1 ml His-Trap column. A 0-0.5 M imidazole gradient in 20 mM phosphate was used to disrupt interaction of the His-tagged pro-rCFI with the His-Trap column, eluted fractions were collected. Western blots were conducted in order to determine which fractions contained pro-CFI. The fractions containing pro-rCFI were then pooled together.

SDS Polyacrylamide Gel Electrophoresis (SDS-PAGE) and Western Blot Analysis

[0138] 25 L of sample to be studied was added to 1.5 mL tubes which contained 6.25 L of reducing sample buffer (Thermo Scientific, 39000) or non-reducing sample buffer (Thermo Scientific, 39001). All samples were heated at 95 C. for 8 minutes before centrifugation at a speed of 13,200 rpm for 2 seconds. 10% Tris-glycine gels were made according to manufacturer's instructions (Novex, Life Sciences, EC6075BOX). Once set, gels were placed in XCell SureLock Mini-Cells (Novex, Life technologies. E10002) and the mini-cells were filled with 1 running buffer (25 mM Tris base, 192 mM Glycine, 0.1% SDS, deionised Water, pH 8.3) in both compartments. 22 L of sample was loaded into each well of the gel. When required 14 L of Factor I standard was loaded into a well of the gel (Comptech, A138) and used as a marker. 7 L of MW ladder (Biolabs, P7708s) was added to at least one well of each gel. The XCell SureLock Mini-Cell was connected to a Powerpac (Bio-rad, 300V, 400 mA, 75 W) and ran for 35 minutes at 190 volts. After running, gels were transferred onto nitrocellulose membrane (Invitrogen, Life technologies, LC2001) using chilled (4 C.) 1 Tris-Glycine transfer buffer (12 mM Tris base, 96 mM Glycine, DI Water, pH 8.3, 20% Methanol). Transfer was performed by a transfer blotter run for 60 minutes at 100 volts. After transfer was complete, membranes were washed briefly with deionised water before staining with Ponceau S solution (Sigma, P7170) to determine success of transfer. Membranes were de-stained in trays placed on a rotating table. All membranes were blocked overnight at 4 C., or for 1 hour at room temperature using a solution of 5% non-fat milk powder in 1TBST (50 mM Tris. HCl, pH 7.4, 150 mM NaCl, 0.05% Tween 20). The following antibodies were used;

[0139] For detecting pro-CFI and mature CFI: Primary antibody, sheep polyclonal Factor I (Abcam, Cambridge, Mass., ab8843) was applied at a concentration of 2.37 g/ml for 1 hr at room temperature. Membranes were washed with Tris buffered saline tween (TBST) buffer (137 mM NaCl, 2.7 mM KCl, Tris base 19 mM, Tween) three times for 10 minutes. Secondary antibody, Rabbit polyclonal secondary antibody to sheep IgG conjugated to horse radish peroxidase (HRP) (Abcam, Cambridge, Mass.), was applied at a concentrations of 2.37 g/ml for 1 hour at room temperature or overnight at 4 C. Blots were then washed three times for 10 min in TBST. Supersignal Chemiluminescent Substrate (Pierce, Rockford, Ill.) was applied to membranes for 1 minute before exposure to an X-ray film for varying time periods before they were developed using standard film developing techniques.

[0140] For detecting C3b and iC3b: Primary antibody, rabbit polyclonal anti-C3 antibody (Abcam) at a concentration of 1:5000 before the use of goat anti-rabbit IgG HRP antibody

Pro-CFI Cleavage by Furin In Vitro

[0141] Experiments to optimise the in vitro cleavage of pro-rCFI by furin were carried out as detailed herein.

[0142] Purified pro-rCFI was buffer exchanged from elution buffer into 1 cleavage buffer (100 mM HEPES pH 5.2, 0.5% Triton X-100, and 1 mM CaCl.sub.2) using a PD-10 desalting column (GE Healthcare) with a bed volume of 8.3 ml.

[0143] Furin was obtained from R & D Systems. Properties of the furin protein are provided in Table 2

TABLE-US-00002 TABLE 2 Supplier R & D Systems Storage buffer pH 9 Presence of tag(s) C-terminal 10 his-tag Protein structure Truncated (amino acid residues 108-715) Molecular Weight The calculated molecular weight of truncated human furin is 65 kDa. Its apparent molecular weight in SDS-PAGE gels is 65-85 kDa. Source Mouse myeloma cell line. Unit definition Measured by its ability to cleave the fluorogenic peptide substrate pER TKRAMC (Catalog # ES013). The specific activity is >125 pmol/min/g.

[0144] Pro-rFI was buffer exchanged from elution buffer into 1 cleavage buffer (100 mM HEPES pH 5.2, 0.5% Triton X-100, and 1 mM CaCl.sub.2) using a PD-10 desalting column (GE Healthcare) with a bed volume of 8.3 ml.

[0145] Cleavage reactions using furin-RD were made up as detailed in Table 3 below.

TABLE-US-00003 TABLE 3 Cleavage Total Furin-RD Pro-rCFI buffer volume Sample (L) (L) (L) (L) 1A (pro-CFI only) 0 234 141 375 2A (pro-CFI only 0 234 141 375 3A (pro-CFI + furin) 0 234 126 375 1B (pro-CFI only) 0 31.2 18.8 50 2B (pro-CFI only 0 31.2 18.8 50 3B (pro-CFI + furin) 2 31.2 16.8 50 4B (Furin only) 2 0 48 50

Optimisation of Cleavage Reaction pH

[0146] In order to test the optimum pH for cleavage of pro-CFI a number of buffers with different pH values were tested. Firstly the purified pro-rCFI was exchanged from elution buffer into three buffers of differing pH using PD MidiTrap G-25 columns (GE Healthcare). Columns were equilibrated using 15 ml in total of the respective buffer which was 100 mM (sodium acetate, pH 5.0 or HEPES, pH 7 or Tris-base pH 9). 0.93 ml pro-rCFI in elution buffer was added to each column before centrifugation at 1000g for 2 minutes. To establish whether buffer exchange was successful, 30 L of pro-rCFI exchanged at each pH was subjected to western blot analysis as described previously. Exact quantities of reaction mixes are shown in Table 4 below.

TABLE-US-00004 TABLE 4 Volumes used for buffer exchange. 1M 50 mM Pro-rCFI corresponding CaCl.sub.2 DI H.sub.2O Total Sample (L) stock buffer (L) (L) (L) (L) pH 5 30 2 5 13 50 pH 7 30 2 5 13 50 pH 9 30 2 5 13 50

[0147] Furin cleavage reactions were then set up containing 30 L of pro-rCFI in the respective buffer and 2 L of furin. In order to ensure the concentrations of the buffer to which the pro-rCFI had been exchanged to 2 L of 1 M stock solution of each respective buffer was added to samples before making samples up to 50 L with deionised water. Control reactions without furin were set up for each pH buffer. Reactions were incubated at 37C for 15 hours. Non-incubated samples of pre-exchange, purified pro-rCFI were also set up. Quantities of each reaction are shown in Table 5.

TABLE-US-00005 TABLE 5 Volumes for pH optimisation of pro-rCFI cleavage by furin. 1M stock Pro-Factor I (of buffer (at the appropriate Furin the appropriate 50 mM H.sub.2O Total Sample Incubated pH) (ul) (ul) pH) (ul) CaCl.sub.2 (ul) (ul) (ul) Previously purified No 30 L 0 2 5 13 50 Batch Pro-CFI (previously purified WT CFI) Newly purified batch No 30 L 0 2 5 13 50 Pro-rCFI (before desalting) (newly purified CCFI before desalting) pH 5 Pro-rCFI only Yes 30 L (pH 5) 0 2 5 13 50 pH 5 Pro-rCFI and furin Yes 30 L (pH 5) 2 2 5 11 50 pH 7 Pro-rCFI only Yes 30 L (pH 7) 0 2 5 13 50 pH 7 Pro-rCFI and furin Yes 30 L (pH 7) 2 2 5 11 50 pH 9 Pro-rCFI only No 30 L (pH 9) 0 2 5 13 50 pH 9 Pro-rCFI only Yes 30 L (pH 9) 0 2 5 13 50 pH 9 Pro-rCFI and furin Yes 30 L (pH 9) 2 2 5 11 50

[0148] After incubation the samples were subjected to western blot analysis as described previously to assess the level of conversion of pro-CFI to mature CFI by detection of the constitute bands of each.

Testing Effect of Furin Concentration on Pro-CFI Cleavage

[0149] In order to test the minimal amount of furin needed for relatively high rates of cleavage of pro-rCFI serial dilutions of furin were made up: 1:2, 1:4, 1:8 and 1:16. The diluted furin was used for cleavage reactions set up as shown in Table 6. Samples were incubated at 37 C. for 16 hours.

TABLE-US-00006 TABLE 6 Volumes of reactions to test furin concentration effect on cleavage rate. pro-rCFI exchanged into Furin 1M stock sodium 100 mM sodium Furin dilution acetate pH 5 50 mM H.sub.2O Total Sample acetate pH 5 (L) (L) factor buffer (L) CaCl.sub.2 (L) (L) (L) 1 30 0 0 2 5 13 50 2 30 10 1:1 2 5 3 50 3 30 10 1:2 2 5 3 50 4 30 10 1:4 2 5 3 50 5 30 10 1:8 2 5 3 50 6 30 10 1:16 2 5 3 50

[0150] After incubation samples were subjected to western blot analysis as described previously.

Testing Effect of Ion Concentration on Furin Cleavage of Pro-CFI

[0151] In order to test the effect that ion concentration had on the cleavage of pro-rCFI by furin differing potassium and calcium concentrations were tested. Furin was diluted to 1/32 of the original concentration before use in reaction mixes as detailed in Table 7 below.

TABLE-US-00007 TABLE 7 Ion concentration experiments, reaction volumes. 1M Pro- Furin stock sodium rCFI pH 5 diluted acetate pH 5 10 mM 50 mM H.sub.2O KCl Total Sample buffer (L) 1:16 (L) buffer (L) CaCl.sub.2 (L) CaCl.sub.2 (L) (L) 250 mM (L) 1 15 0 1 0 2.5 6.4 0 25 2 15 2.5 1 0 2.5 4 0 25 3 15 0 1 2.5 0 6.5 0 25 4 15 2.5 1 2.5 0 4 0 25 5 15 0 1 0 2.5 4.5 2 25 6 15 2.5 1 0 2.5 2 2 25 7 15 0 1 2.5 0 4.5 2 25 8 15 2.5 1 2.5 0 2 2 25

Optimised Pro-CFI Digestion Reaction Volumes

[0152] Pro-rCFI digestion was performed using the reaction mixes detailed in Table 8. Pro-rCFI was used in pH5 buffer (100 mM sodium acetate pH 5).

TABLE-US-00008 TABLE 8 Optimised cleavage reactions. Reaction Reactant Pro-rCFI + Furin Pro-rCFI only Furin only Pro-CFI 15 L 15 L 0 L Furin 5 L 0 L 5 L 1M pH 5 stock 1 L 1 L 2.5 L 50 mM CaCl.sub.2 2.5 L 2.5 L 2.5 L H.sub.2O 1.5 L 6.5 L 15 L Total 25 L 25 L 25 L

C3b Inactivation Assay: Comparison of Pro-CFI Vs Mature FI

[0153] A C3b inactivation assay was used to compare the activity of pro-rCFI and mature CFI. A sample of pro-rCFI was cleaved by furin using conditions identified in the optimisation (as detailed previously). Three control reactions were set up: 2 Pro-CFI only (incubated and non-incubated) and furin only (incubated) in order to determine whether any C3b cleavage occurred with pro-rCFI that had been cleaved by furin but subjected to the same conditions. All incubated samples were incubated at 37 for 16 hours.

[0154] 25 l reactions were set up with a final concentration of C3b at 0.2 g/l. (Comptech). CFH (Comptech) was used as a cofactor and each reaction contained a final CFH concentration of 66.6 ng/l. A positive control containing C3b and serum CFI (sFI) (Comptech) at a final concentration of 10 ng/L (Comptech) was made up. A negative control for uncleaved C3b had no CFI and only C3b in. Two further controls of pro-rCFI only (incubated and non-incubated) were set up and also a control of furin only were set up by adding 10 L of each respective reaction prepared previously. A further control of furin without the presence of CFH, CFI or C3b was also made up. Reactions were made up to the final volume of 25 L using low salt buffer. The 7 reactions made up are detailed in Table 9.

TABLE-US-00009 TABLE 9 C3b inactivation assay reaction volumes Reactant Low Total Sample C3b sCFI CFH Pro- salt volume Sample description [1.6 g/L] [11.11 ng/L] [333 ng/L] CFI Furin buffer (L) 1 Cleaved C3b 3 L 4.5 5 L 5 L 12.5 L 25 L control 2 Uncleaved C3b 3 L 5 L 10 L 7 L 25 L control 3 Pro-rCFI ONLY 3 L 5 L 10 L 7 L 25 L (pre-incubated) 4 Cleaved rCFI 3 L 5 L 10 L 7 L 25 L (pre-incubated) 5 Furin 3 L 5 L 10 L 10 L 7 L 25 L control 6 Pro-rCFI ONLY 3 L 5 L 10 L 7 L 25 L (non-incubated) 7 Furin ONLY 10 L 15 L 25 L Final Concentration 0.2 g/L 2 ng/L 66.6 ng/L

[0155] A 10 L aliquot was removed at 20 minutes from each reaction mix. Each aliquot was added to an equal volume of 1 laemelli buffer and western blot analysis was performed as outlined previously using the antibodies detailed for detecting C3b. Activity of rCFI was determined by generation and intensity of the 1 and 2 bands upon developing of x-ray images.

[0156] Also ran on some gels was a sample of inactivated (cleaved) C3b (iC3B) to act as a marker for C3b cleavage products.

Results & Discussion

Factor I Purification

[0157] Supernatant of rCFI expressing cells was collected and purified as described herein. Collected fractions were run on a polyacrylamide gel under reducing conditions before western blotting of the gel. The presence of rCFI is confirmed by the band at a molecular weight of 88 kDa, corresponding to the MW of pro-rCFI (uncleaved). This is further confirmed by the absence of a band corresponding to a molecular weight of 50 kDa which would be expected from cleaved mature CFI. The concentration of the rCFI was determined by ELISA testing to be 0.6 ng/L.

Factor I Cleavage Optimisation

[0158] Cleavage of the .sup.318RRKR.sup.321 cleavage site was optimised by testing a range of conditions, to ensure that the maximum level of cleavage of pro-rCFI to mature rCFI was achieved in vitro. All samples were subjected to polyacrylamide gel electrophoresis in reducing and non-reducing conditions to allow the distinction between mature rCFI and the heavy chain alone which may be dissociated due to degradation of the protein.

[0159] Under non-reducing conditions, both the pro-rCFI and mature rCFI should have a MW of approximately 88 kDa; when Pro-rCFI is reduced, it should remain at 88 kDa due to the existence of the RRKR linker; Mature rCFI should separate into the heavy chain (50 kDa) and light chain (37 kDa) as the di-sulphide bridge between the two chains is reduced. The light chain is not often detected on a western blot as antibodies used for detection predominantly detect heavy chain epitopes. FIG. 4 summarizes the processing of CFI in mammalian cells and demonstrates the effect of reduction on the different forms. FIG. 5 provides a diagram of how different forms of CFI are expected to appear on a western blot under both reducing and non-reducing conditions.

Optimisation of pH for Cleavage of Pro-rCFI by Furin

[0160] After incubation with furin it can be seen from the western blots shown in FIGS. 5A (reducing conditions) and 5B (non-reducing conditions) that no pro-rCFI or mature rCFI is detectable when the reaction is performed at pH 7 (lanes 4 and 5) as is indicated by the absence of bands at 88 and/or 50 kDa. When the reaction was performed at pH5 the presence of a band at 50 kDa in FIG. 5A and absence of a band at 88 kDa indicates that all detectable amounts of the pro-rCFI has been cleaved to the mature CFI form.

[0161] A broad pH is provided in the prior art for cleavage of pro-CFI. These experiments show that the pH of the reaction can help maximize the cleavage of pro-rCFI to the mature form. It has been suggested that slightly acidic pH may help to increase the rate of proteolytic cleavage due to conformational change that may help to expose the cleavage site. The data here indicates that a high rate of cleavage occurs at pH 5 but other pH values may also allow for a high rate of cleavage depending on other reaction conditions and reactants that may be used.

Optimisation of Furin Concentration

[0162] It can be seen from FIGS. 6A and 6B that even at low concentrations furin is able to provide a high rate of cleavage of pro-CFI. This can be seen by the presence of a band in the western blot performed in reducing conditions (FIG. 6A) at 50 kDa which corresponds to cleaved mature rCFI and the absence of a band at 88 kDa which corresponds to uncleaved pro-CFI. Even when furin is diluted by a factor of 16 a relatively high rate of cleavage is observed.

[0163] Cleavage by furin is confirmed by the absence of a band at 50 kDa in FIG. 6A lane 1 which corresponds to a pro-rCFI control. If degradation of the protein was the cause of the band seen at 50 kDa it would be expected to be seen for the pro-rCFI only control as well.

Optimisation of Ion Concentration

[0164] The results indicate that the regardless of potassium ion concentration, calcium ions enhances the rate of cleavage. This can be seen in FIG. 7A by the presence of a band at 50 kDa corresponding to cleaved mature rCFI in lane 2. The corresponding band in lane 4 which shows the products of a cleavage reaction performed with a lower (1 mM CaCl.sub.2) calcium ion concentration and is less intense indicating that a higher (5 mM CaCl.sub.2) calcium ion concentration may increase the cleavage rate.

[0165] It can be seen when comparing the western blots shown in FIGS. 8A and 8B that the presence of potassium ions may help increase the rate of pro-rCFI cleavage by furin by the fact that the bands corresponding to cleaved mature rCFI (50 kDa) in lanes 2 and 4 of FIG. 8B have a greater intensity than that seen in FIG. 8A.

[0166] It is noted though that for shorter incubation times the presence of potassium ions may help speed up the cleavage reaction allowing for faster cleaving of all of the pro-CFI to mature CFI.

[0167] Following the optimisation tests the reaction mix and condition for cleavage of pro-CFI using furin was as given in Table 10:

TABLE-US-00010 TABLE 10 Optimised furin cleavage of pro-FI Pro-rCFI + Furin Pro-CFI 15 L Furin 5 L 1M pH 5 stock 1 L 50 mM CaCl.sub.2 2.5 L H.sub.2O 1.5 L Total 25 L

[0168] Pro-rCFI was first exchanged into 100 mM sodium acetate pH 5. Samples were incubated at 37 C. for 16 hours. Potassium ions were not included in the reaction as the effect they had when using the given reaction conditions was considered negligible.

C3b Inactivation Assay: Comparison of Pro-rCFI Vs Mature CFI

[0169] In order to test then vitro activity of the in vitro cleaved mature rCFI a C3b inactivation assay was performed. It is expected that if CFI is in the active mature form it will cleave C3b into its inactive state iC3b by cleavage of the chain to produce two chains with molecular weights of 68 kDa (1) and 46 kDa (2) the 2 chain is further cleaved to a final molecular weight of 43 kDa. This change in the structure of C3b can be seen by analysing the products of an C3b inactivation reaction using a western blot and comparing the intensity and occurrence of a band that corresponds to the chain and the intensity and occurrence of bands that correspond to the 1 and 2 chains. This therefore allows for the activity of the mature CFI to cleave C3b to be accessed.

[0170] It can be seen from FIG. 9 that when compared to control experiments (lanes 2, 3, 4, 5, 6, and 7) lane 8 which corresponds to a sample containing the in vitro cleaved mature rCFI, is the only sample containing bands that correspond to the 1 and 2 chains. This scan be confirmed by comparing the western blot bands seen for the iC3b cleaved by incubation with mature sCFI.

[0171] The separation of the and 1 bands was not as defined as possible and so a second western blot was performed. FIG. 10 shows the western blot analysis with the separation of the and 1 bands. The activity of the in vitro cleaved rCFI can be seen to be comparable to sCFI indicating that the amount of cleavage of pro-CFI to CFI is relatively high.