OLIGOSACCHARYLTRANSFERASE POLYPEPTIDE
20200032226 ยท 2020-01-30
Assignee
Inventors
Cpc classification
C12N15/74
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
The disclosure relates to an oligosaccharyltransferase polypeptides and their use in the synthesis of glycoconjugates in bacterial cells; vaccines and immunogenic compositions comprising said glycoconjugates and their use in the prevention and/or treatment of bacterial infection. Bacterial expression system comprising said oligosaccharyltransferase polypeptides are also disclosed.
Claims
1. A transcription cassette comprising: i) a nucleic acid molecule comprising a nucleotide sequence that encodes a oligosaccharyltransferase polypeptide as set forth in SEQ ID NO: 1 or 2; ii) a nucleic acid molecule comprising a nucleotide sequence that is degenerate to the nucleotide sequence set forth in SEQ ID NO: 1 or 2 and encodes a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 3; iii) a nucleic acid molecule comprising a nucleotide sequence that encodes an oligosaccharyltransferase polypeptide wherein said nucleotide sequence is at least 97% identical to the nucleotide sequence set forth in SEQ ID NO: 1; or iv) a nucleic acid molecule comprising a nucleotide sequence that encodes an oligosaccharyltransferase polypeptide wherein said nucleotide sequence is at least 77% identical to the nucleotide sequence set forth in SEQ ID NO: 2, wherein said nucleic acid molecule is operably linked to a promoter adapted for expression in a bacterial host cell.
2. The transcription cassette according to claim 1 wherein said nucleic acid molecule comprises a nucleotide sequence that is 98% or 99% identical to the nucleotide sequence set forth in SEQ ID NO: 1.
3. The transcription cassette according to claim 1 wherein said nucleic acid molecule comprises a nucleotide sequence that is at least 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% identical to the nucleotide sequence set forth in SEQ ID NO: 2.
4. The transcription cassette according to claim 1 wherein said transcription cassette further comprises a nucleic acid molecule encoding a carrier polypeptide wherein said carrier polypeptide comprises one or more glycosylation motifs for said oligosaccharyltransferase.
5. The transcription cassette according to claim 1 wherein said transcription cassette further comprises a nucleic acid molecule comprising a nucleotide sequence encoding a biosynthetic locus comprising one or more polypeptides required for the synthesis of a heterologous glycan antigen.
6. The transcription cassette according to claim 1 wherein said oligosaccharyltransferase and/or said carrier polypeptide and/or biosynthetic locus is operably linked to a regulatable promoter to provide regulated expression of each or all nucleic acid molecules encoding said polypeptides.
7. The transcription cassette according to claim 1 wherein said promoter is further operably linked to a ribosome binding site wherein there is provided a nucleotide spacer sequence between the 3 prime end of said ribosome binding site and the 5 initiating start codon of the nucleic acid molecule encoding said oligosaccharyltransferase wherein translation from the nucleic acid molecule encoding said oligosaccharyltransferase is reduced when compared to a control nucleic acid molecule encoding said recombinant polypeptide that does not comprise said nucleotide spacer sequence.
8. The transcription cassette according to claim 1 wherein said promoter is further operably linked to a ribosome binding site wherein there is provided a nucleotide spacer sequence between the 3 prime end of said ribosome binding site and the 5 initiating start codon of the nucleic acid molecule encoding said carrier polypeptide wherein translation from the nucleic acid molecule encoding said carrier polypeptide is reduced when compared to a control nucleic acid molecule encoding said recombinant polypeptide that does not comprise said nucleotide spacer sequence.
9. The transcription cassette according to claim 1 wherein said promoter is further operably linked to a ribosome binding site wherein there is provided a nucleotide spacer sequence between the 3 prime end of said ribosome binding site and the 5 initiating start codon of the nucleic acid molecule encoding said one or more polypeptides required for the synthesis of a heterologous glycan antigen wherein translation from the nucleic acid molecule encoding said biosynthetic locus is reduced when compared to a control nucleic acid molecule encoding said recombinant polypeptide that does not comprise said nucleotide spacer sequence.
10. The transcription cassette according to claim 4 wherein said carrier polypeptide includes the amino acid motif: Asn-X-Ser or Asn-X-Thr where X is any amino acid except proline.
11. The transcription cassette according to claim 10 wherein said carrier polypeptide includes the amino acid motif: D/E-X-N-X-S/T (SEQ ID NO: 46), wherein X is any amino acid except proline.
12. The transcription cassette according to claim 5 wherein said heterologous glycan antigen is a heptasaccharide.
13. The transcription cassette according to claim 5 wherein said biosynthetic locus is the Pgl locus.
14. The transcription cassette according to claim 13 wherein said Pgl locus comprises genes encoding said one or more polypeptides selected from the group consisting of: PglG, PglF, PglE, optionally Cj1122c; PglD, PglC, PglA, PglJ, PglI, PglH, PglK.
15. The transcription cassette according to claim 13 wherein said nucleic acid molecule encoding one or more polypeptides required for the synthesis of a heterologous glycan antigen comprises a nucleotide sequence as set forth in SEQ ID NO: 10, wherein said SEQ ID NO 10 does not include a functional version of PglB as set for the in SEQ ID NO: 18.
16.-17. (canceled)
18. A vector comprising a transcription cassette according to claim 1.
19.-20. (canceled)
21. A bacterial cell genetically modified with a transcription cassette according to claim 1 or a vector comprising the transcription cassette.
22. The bacterial cell according to claim 21 wherein said nucleic acid molecule encoding said oligosaccharyltransferase and/or carrier polypeptide and/or biosynthetic locus is stably integrated into the genome of said bacterial cell.
23.-24. (canceled)
25. The bacterial cell according to claim 21 wherein said bacterial cell is a non-human pathogen.
26. The bacterial cell according to claim 21 wherein said bacterial cell is a zoonotic bacterial species.
27.-30. (canceled)
31. A process for the production of one or more glycoconjugates comprising: i) providing a bacterial cell culture comprising a cell according to claim 21; ii) providing cell culture conditions; and optionally iii) isolating one or more glycoconjugates from the bacterial cell or cell culture medium.
32. (canceled)
33. An oligosaccharyltransferase polypeptide wherein the polypeptide comprises an amino acid sequence set forth in SEQ ID NO: 3, or polymorphic sequence variant thereof, wherein the amino acid sequence is modified by deletion or substitution of at least one amino acid residue and said modified polypeptide has altered substrate specificity and/or increased oligosaccharyltransferase activity when compared to an unmodified oligosaccharyltransferase polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 3.
34.-38. (canceled)
39. A nucleic acid molecule that encodes a polypeptide according to claim 33.
40. The nucleic acid molecule according to claim 39 wherein said nucleic acid molecule comprises a nucleotide sequence that encodes a polypeptide comprising the amino acid sequence set forth in SEQ ID NO 43.
41. The nucleic acid molecule according to claim 40 wherein said isolated nucleic acid molecule comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 42 or a degenerate variant thereof.
42. The nucleic acid molecule according to claim 41 wherein said nucleic acid molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 42.
43. The nucleic acid molecule according to claim 41 wherein said nucleic acid molecule is part of a transcription cassette.
44. A vector comprising a nucleic acid molecule according to claim 39 or a transcription cassette comprising the nucleic acid molecule.
45.-46. (canceled)
47. A cell transformed or transfected with a nucleic acid molecule according to claim 39 or an expression vector comprising the nucleic acid molecule.
48. The cell according to claim 47 wherein said cell is a microbial cell.
49. (canceled)
Description
[0127] An embodiment of the invention will now be described by example only and with reference to the following figures;
[0128]
[0129]
[0130]
[0131]
MATERIALS & METHODS
[0132] Construction of C. sputorum pglB2 Expression Plasmid pELLA1
[0133] A codon optimised version of C. sputorum pglB2 was generated by DNA synthesis in the cloning vector pUC57 km and designed to have EcoRI (GAATTC) restriction enzyme sites at the 5 and 3 end of the construct. The plasmid pEXT21 was grown in E. coli DH5 cells and purified by plasmid extraction (QIAGEN Ltd UK). 1 g of pUC57Km containing CsPglB2 and 1 g of pEXT21 were digested with EcoRIHF (New England Biolabs U.K.) cloned into the EcoRI site of the IPTG inducible expression vector pEXT21 to generate the vector pELLA1.
Construction of pELLA2
[0134] The gene coding for C. sputorum PglB2 was amplified by PCR with the pTac promoter and LacI repressor from plasmid pEXT21 as a template using accuprime Taq hifi with (SEQ ID 11: 5-TTTTGCGGCCGCTTCTACGTGTTCCGCTTCC-3) as forward primer and (SEQ ID 12: 5-TTTTGCGGCCGCATTGCGTTGCGCTCACTGC-3) reverse primer using the following cycling conditions, 94 C./2 minutes followed by 35 cycles of 94 C. for 30 seconds, 56 C. for 30 seconds and 68 C. for 4 minutes. and ligated into the unique NotI site in pJCUSA1 a Zeocin resistant transposon where the antibiotic marker is flanked by loxP sites allowing for downstream removal of antibiotic marker from the final target strain via the introduction of the CRE enzyme. It has a pMB1 origin of replication and thus can be maintained in any E. coli strain prior to being cut out and transferred along with the Zeocin resistance cassette using SfiI restriction enzyme digestion and transfer into the pUT delivery vector thus generating a functional transposon. The sequence of the transposon is shown below (SEQ ID 13):
TABLE-US-00001 5GGCCGCCTAGGCCGCGGCCGCCTACTTCGTATAGCATACATTATACGA AGTTATGTCTGACGCTCAGTGGAACGACGCGTAACTCACGTTAAGGGATT TTGGTCATGATCAGCACGTTGACAATTAATCATCGGCATAGTATATCGGC ATAGTATAATACGACAAGGTGAGGAACTAAAACATGGCCAAGTTGACCAG TGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCT GGACCGACCGGCTCGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCC GGTGTGGTCCGGGACGACGTGACCCTGTTCATCAGCGCGGTCCAGGACCA GGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACG AGCTGTACGCCGAGTGGTCGGAGGTCGTGTCCACGAACTTCCGGGACGCC TCCGGGCCGGCCATGACCGAGATCGGCGAGCAGCCGTGGGGGCGGGAGTT CGCCCTGCGCGACCCGGCCGGCAACTGCGTGCACTTCGTGGCCGAGGAGC AGGACTGAATAACTTCGTATAGCATACATTATACGAAGTTATGGCCGCCT AGGCC-3.
[0135] The insertion of CspglB2 into this transposon and transfer into the pUT delivery vector resulted in plasmid pELLA2 and maintained in Transformax E. coli strain EC100D pir+ (Cambio U.K.).
Bacterial Conjugation
[0136] To enable transfer of the CspglB2 transposon cargo into the chromosome of a recipient E. coli strain or any other bacterium the plasmids pELLA2 was transferred into E. coli MFD a diaminopimelic acid (DAP) auxotroph. Growth medium was supplemented with Zeocin 100 g/ml and ampicillin 100 g/ml. Both donor and recipient bacteria were growth until late exponential phase. Bacterial cells were pelleted by centrifugation, washed 3 times with PBS and mixed together in a ratio of 1:3 recipient to donor and spotted on a dry LB agar plate with no antibiotics for 4-8 hrs. The cells were scraped and suspended in PBS and dilutions plated on LB agar with appropriate selection antibiotics to select for transconjugants. Individual colonies were picked up and screened for loss of the pUT backbone and for the presence of the transposon.
Generation of Unmarked pglB Insertion
[0137] The transposon carrying CspglB2 and loxP recombination sites around a Zeocin resistance cassette was introduced into PoulVAc E. coli. Following selection for Zeocin resistant colonies, the antibiotic selection marker was removed by introduction via electroporation, the temperature sensitive vector pCRE5 (Reference: Appl Environ Microbiol. 2008 February; 74(4): 1064-1075. Genetic Tools for Select-Agent-Compliant Manipulation of Burkholderia pseudomallei. Kyoung-Hee Choi, Takehiko Mima, Yveth Casart, Drew Rholl, Ayush Kumar, Ifor R. Beacham and Herbert P. Schweizer).
[0138] PoulVAc E. coli was cultured at 28 C. in the presence of kanamycin 50 g/ml, rhamnose was added to induce expression at 0.2% final concentration and the organism subcultured several times to select for colonies that had lost resistance to Zeocin but maintained resistance to kanmaycin indicating that the bleomycin resistance gene had been flipped out of the chromosome.
[0139] This E. coli mutant was then sub-cultured at 42 C. to cure out the pCRE5 plasmid. Screening for colonies that had once again become sensitive to kanamycin confirmed loss of pCRE5 and completed generation of an unmarked inducible copy of pglB on the chromosome of E. coli.
Carrier Polypeptide
[0140] Attenuated bacterial strains are transformed with the plasmid pGVXN150:GT-ExoA encoding a modified carrier polypeptide [GT-ExoA]. The GT-ExoA construct was engineered to express a modified version of P. aeruginosa Exotoxin A in the vector pGH and closed into a vector derived from pEC415 using the restriction enzymes NheI and EcoRI (NEB). The synthesized protein contains two internal modifications that allow glycosylation of the protein by Pgl, as well as containing four N-glycosylation sequons at the N terminal and an additional 4 at the C terminals glycotags. In addition, a hexa-histidine tag was added to the C-terminus of the protein to facilitate putification and an and an E. coli DsbA signal peptide was added to the N-terminal sequences enabling Sec-dependent secretion to the periplasm. pGVXN150: GT-ExoA is ampicillin resistant and L-(+)-Arabinose inducible. The construct sequence was then confirmed using Sanger sequences with the primers GTExoA NF (SEQ ID NO 14; GCGCTGGCTGGTTTAGTTT), GTExoA NR (SEQ ID NO 15; CGCATTCGTTCCAGAGGT), GTExoA CF (SEQ ID NO 16; GACAAGGAACAGGCGATCAG) and GTExoA CR (SEQ ID NO 17; TGGTGATGATGGTGATGGTC).
[0141] Reducing the toxicity of PglB
[0142] Protein glycan coupling technology requires the use of Campylobacter jejuni PglB. This enzyme has 13 transmembrane domain and is toxic when overexpressed in E. coli. The pglB gene was originally amplified by PCR with oligonucleotides PglBEcoRI (EcoRI in bold) using the primers (SEQ ID NO 37: AAGAATTCATGTTGAAAAAAGAGTATTTAAAAAACCC) and PglBNcoI-HA (SEQ ID NO 38: AACCATGGTTAAGCGTAATCTGGAACATCGTATGGGTAAATTTTAAGTTTAAAAACCTTAGC), using Pfu polymerase with pACYC(pgl) as template. Oligonucleotide PglBNcoI-HA encodes an HA-tag to follow PglB expression by Western blot. The PCR product was digested with EcoRI and NcoI and cloned in the same sites of vector pMLBAD. The plasmid obtained was named pMAF10. Arabinose-dependent expression of PglB was confirmed by Western blot (Feldman et al. 2005). This construct has been subcloned into the EcoRI site of the vector pEXT21 allowing for IPTG dependant inducible expression of CjpglB. This plasmid and ORF combination has been used for several years in order to produce several glycoconjugate vaccines. In a recent modification using PglB from Campylobacter sputorum we have carried out tests and found that the ribosome binding site is encoded within the pEXT21 vector itself. This means that translational efficiency is partly controlled by the distance between the RBS and the ATG start codon of pglB. We noticed that inserting the PglB coding gene into the vector pEXT21 with an extended 10 base pairs of DNA sequence resulted in reduced toxicity of the enzyme and subsequently increased growth in the carrier E. coli strain as measured by optical density. Therefore it may be possible to reduce the toxicity of C. jejuni PglB by the simple modification of insertion of additional nucleotides before the ATG start codon or alternatively clone the gene further away from the RBS carried within the expression plasmid.
Construction of pELLA3
[0143] The pglB gene from C. sputorum was amplified using the primers CsPglB1fwd: TTTT GAATTCGATTATCGCCATGGCGTCAAATTTTAATTTCGCTAAA (SEQ ID NO 39) and the reverse primer CsPglB1rev: TTTT GAATTC TTATTTTTTGAGTTTATAAATTTTAGTTGAT (SEQ ID NO 40) using Accuprime Taq Hifi and the following cycling conditions 94 C./30 s, followed by 24 cycles of the following conditions 94 C./30 s, 53 C./30 s, 68 C./2 min. The PCR product was cut with the restriction enzyme EcoRI HF for 16 hr at 37 C. The plasmid pEXT21 was also cut with the restriction enzyme EcoRI HF for 16 hr at 37 C. Both plasmid and PCR product were purified with a PCR purification kit (QIAGEN UK) and the plasmid pEXT21 was dephosphorylated by treating with Antarctic phosphatase (NEB UK Ltd) at 37 C. for 1 hr. The enzyme was heat inactivated by heating at 80 C. for 2 min before the plasmid and the insert were ligated together using T4 DNA ligase (Promega UK) and the reaction was incubated overnight at 4 C. The ligation reaction was transformed into E. coli Dh10 cells (NEB UK Ltd) and recovered on LB Spectinomycin plates (80 g/ml). Constructs were then sequenced to confirm that the cloned C. sputorum PglB had not gained any mutations during the cloning process. This new construct was named pELLA3.
In Vitro Mutagenesis of the C. jejuni 81116 pgl Locus Cloned in pACYC184
[0144] Mutagenesis of 11 genes in the C. jejuni 81116 glycosylation locus cloned in pACYC184 (pACYCpgl) was performed in vitro using a customised EZ::TNtransposon system (Epicentre, Madison, Wis., USA). Briefly, a kanamycin resistance cassette (Trieu-Cuot et al., 1985) lacking a transcriptional terminator and therefore unable to exert downstream polar effects was amplified by PCR and cloned into the multiple cloning site of the vector pMOD<MCS> (Epicentre). This construct was linearized by Scal digestion and the kanamycin resistance cassette along with flanking mosaic ends was amplified by PCR using primers FP-1 and RP-1 (Epicentre). The PCR product was combined with plasmid pACYCpgl (Wacker et al., 2002) in an in vitro transposition reaction performed according to manufacturer's instructions (Epicentre). The resultant pool of mutated pACYCpgl plasmids was electroporated into E. coli XL1-Blue MRF (Stratagene) and putative mutants were screened by PCR to identify the location and orientation of the kanamycin cassette. We only used those mutants having the kanamycin resistance cassette inserted with the same transcriptional orientation as the genes of the glycosylation locus, which were also confirmed by sequence analysis.
EXAMPLE 1
[0145] The construct pELLA1 was transformed into E. coli CLM24 cells alongside a pEC415vector coding for Pseudomonas aeruginosa exotoxin A with a single internal glycosylation site and the plasmid pACYCpglB::km coding for the entire C. jejuni heptasaccharide with a disruption in the pglB gene by insertion of a miniTn5km2 element. As a comparison the exotoxin A and C. jejuni heptasaccharide coding constructs were transformed into an E. coli CLM24 cell carrying pEXT21pglB from C. jejuni. 500 ml LB containing 30 g/ml.sup.1 cm, 100 g/ml.sup.1 amp, 80 g/ml.sup.1 spectinomycin were inoculated with 10 ml of an O/N culture of either CLM24 construct combination and incubated with shaking at 37 C. Optical density 600 nm reading were taken at hourly intervals and protein expression induced at an OD.sub.600 nm of 0.4 by the addition of IPTG 1 mM and L-arabinose 0.2% final concentration. 5 hr post initial induction, 0.2% L-arabinose was added and OD.sub.600 nm continued to be measured (
[0146] The growth of E. coli CLM24 cells without any induction of protein expression was also measured. This was carried out in the same way as described above for the E. coli CLM24 cells carrying pELLA1 except that no IPTG or L-arabinose was added (
EXAMPLE 2
[0147] E. coli CLM24 cultures carrying plasmids coding for singly glycosylatable exotoxinA, C. sputorum PglB2 or C. jejuni PglB were used to inoculate 500 ml of LB broth. Protein expression was induced as described in example 1 with the modification that the cultures were incubated for a further 16 hr after the second 0.2% L-arabinose addition. At this point cells were pelleted by centrifugation at 4000g for 30 min and lysed using a high pressure cell homogeniser (Stansted Fluid power) HIS tagged exotoxinA was purified from CLM24 cells using NiNTA binding. Protein was separated on a 12% Bis-tris gel (Invitrogen) before transferring onto a nitrocellulose membrane. This was probed with primary rabbit hr6 anti-campy glycan antibody and mouse anti-HIS. Goat anti-rabbit and anti-mouse infrared dye labelled secondary antibodies were used to enable visualisation of glycoprotein using an Odyssey LI-COR scanner (LI-COR Biosciences UK Ltd) (
EXAMPLE 3
[0148] pACYCpglB::kan was introduced into PoulVAC E. coli by electroporation alongside the plasmid pWA2 coding for a HIS tagged diglycosylatable CmeA and pELLA1. After induction with 1 mM IPTG and a total of 24 hr incubation at 37 C. with shaking. 200 ml of culture was obtained and centrifuged at 10,000g for 10 min. Cells were lysed by high pressure and purification carried out using NiNTA. The protein was then purified according to manufacturer's instructions (QIAExpressioninst, Qiagen UK) and eluted in 40.5 ml before concentrating the sample to 50 l. An equal volume of 2SDS PAGE loading dye was added 20 l was loaded into a 12% Bis-Tris gel and stained by coomassie (
EXAMPLE 4
[0149] Salmonella Typhimurium strain SL3749 was transformed with pUA31 (coding for the acceptor protein CjaA), pACYCpglB::km (coding for C. jejuni heptasaccharide coding locus but with pglB knocked out) and pELLA1 (coding for IPTG inducible C. jejuni pglB). A 10 ml O/N 37 C. shaking culture was prepared and used to inoculate 200 ml of LB broth. This continue to be shaken 37 C. until an OD600 nm of 0.4 was reached. At this point 1 mM IPTG was added to induce CsPglB2 expression. The culture was incubated for a further 16 hr at 37 C. with shaking. Bacterial cultures were pelleted by centrifugation at 6000g for 30 min and resuspended in 30 ml 25 mM Tris, 0.15 M NaCl pH 7.5 (TBS). Cells were lysed using a high-pressure cell homogeniser. 2% SDS and 1% Triton X-100 were added and the lysed material incubated for 3 hr at 4 C. with mixing. The material was then centrifuged at 4000g for 20 min. Pellet was discarded before 300 l of c-Myc sepharose (Thermo Scientific USA) was added. This was allowed to incubate 0/N at 4 C. with mixing. The material was then centrifuged at 4000g for 10 min and the supernatant removed. 1 ml TBS was added with 0.05% Tween. This was washed 5 times by pulsing at 10,000g. Protein elution was achieved by the addition of 300 l 2SDS loading buffer containing 3 l DTT and boiled for 10 minutes. Western blot was carried out to visualise the result.
EXAMPLE 5
[0150] We have used the transposon pELLA2 carrying an IPTG inducible copy of CspglB to integrate this gene into the chromosomes of glycoengineering E. coli strains W3110, CLM24, CLM37, S874, SCM7, SCM6, SCM3 as well as PoulVAc E. coli and S. typhimurium.