Methods and Compositions for Inhibiting Skin Inflammation and Determining Cancer Susceptibility
20200030411 ยท 2020-01-30
Inventors
Cpc classification
G01N33/6872
PHYSICS
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
A61P35/00
HUMAN NECESSITIES
C12Q1/6883
CHEMISTRY; METALLURGY
Abstract
Disclosed herein are methods of treating or preventing an autoimmune skin disorder and/or inflammatory skin disorder, skin tumor and obesity in a subject in need thereof by administering an inhibitor capable of inhibiting the activation of inflammasome NLRP1, NLRP1 mutants, an agent that prevents the secretion of stress responsive secreted factors, known pro-inflammatory cytokines, keratinocytes differentiation markers, inflammasome-dependent cytokines, and growth factors in the skin and an agent that reduces the effect of inflammasome-dependent cytokines. The invention encompasses the use of an activator of NLRP1, such as talabostat, specifically for treating skin tumors. Also enclosed herein are methods of determining the likelihood of a subject in developing an autoimmune skin disorder and/or inflammatory skin disorder comprising detecting NLRP1 mutation in a sample obtained from the subject. An inflammasome sensor NLRP1 mutant and compositions for treatment are also disclosed.
Claims
1. A method of treating or preventing an autoimmune skin disorder and/or inflammatory skin disorder in a subject in need thereof, comprising administering a therapeutically effective amount of an inhibitor capable of inhibiting the activation of inflammasome sensor NLRP1.
2. The method of claim 1, wherein the inhibitor prevents the proteolytic cleavage of NLRP1.
3. The method of claim 3, wherein the location of the proteolytic cleavage is within the FIIND domain of NLRP 1.
4. The method of claim 2 or 3, wherein the location of the proteolytic cleavage is between phenylalanine at position 1212 and serine at position 1213.
5. The method of any one of claims 2 to 4, wherein the inhibitor of the proteolytic cleavage is selected from the group consisting of a small molecule, an antibody, a polypeptide, and a nucleic acid.
6. A method of treating or preventing an autoimmune skin disorder and/or inflammatory skin disorder in a subject in need thereof, comprising administering a therapeutically effective amount of an agent that prevents the secretion of stress responsive secreted factors, known pro-inflammatory cytokines, keratinocytes differentiation markers, inflammasome-dependent cytokines, and growth factors in the skin.
7. A method of treating or preventing an autoimmune skin disorder and/or an inflammatory skin disorder in a subject in need thereof, comprising administering a therapeutically effective amount of an agent that reduces the effect of inflammasome-dependent cytokines.
8. The method of claim 6 or 7, wherein the inflammasome-dependent cytokines is at least one or two or more of selected from the group consisting of IL-1 (interleukin-1alpha), IL-1 (interleukin-1beta), and IL-18 (interleukin-18).
9. The method of any one of claims 6 to 8, wherein the agent is selected from the group consisting of a small molecule, an antibody, a polypeptide, and a nucleic acid.
10. The method of claim 9, wherein the agent is an antibody (such as a neutralizing antibody).
11. A method of determining whether a skin inflammation in a subject is an inflammatory skin disorder and/or an autoimmune skin disorder, comprising detecting NLRP1 mutation in a sample obtained from the subject.
12. A method of determining the likelihood (or predisposition) of a subject in developing an inflammatory skin disorder and/or an autoimmune skin disorder, comprising detecting NLRP1 mutation in a sample obtained from the subject.
13. A method of treating a skin inflammation in a subject, comprising: detecting NLRP1 mutation in a sample obtained from the subject; determining whether the subject has NLRP1 mutation; and wherein when the subject has NLRP1 mutation, treating the skin inflammation in the subject by administering any one of selected from the group consisting of: a therapeutically effective amount of an inhibitor capable of inhibiting the activation of inflammasome sensor NLRP1 (Nucleotide-binding domain, leucine-rich repeat containing (NLR) family, pyrin domain containing protein 1NLPR1); a therapeutically effective amount of an agent that prevents the secretion of stress responsive secreted factors, known pro-inflammatory cytokines, keratinocytes differentiation markers, inflammasome-dependent cytokines, and growth factors in the skin; a therapeutically effective amount of an agent that reduces the effect of inflammsome-dependent cytokines; and a therapeutically effective amount of an inflammasome sensor NLRP1 mutant into the subject in need thereof.
14. The method of claim 13, wherein the NLRP1 mutation is located at PYD (pyrin domain) and/or LRR (leucine-rich repeats) domain.
15. The method of any one of claims 13 to 14, wherein the imitation at the PYD domain is a missense mutation.
16. The method of any one of claims 13 to 15, wherein the mutation is at the PYD domain that results in at least one or two or all amino acid substitution selected from the group consisting of A54T, M77T, and A66V.
17. The method of any one of claims 14 to 16, wherein the mutation at the LRR domain is an (in-frame deletion).
18. The method of any one of claims 14 to 17, wherein the mutation is at the LRR domain results in the deletion of amino acid phenylalanine at position 787 to arginine at position 843 (F787 to R843 or F787_R843del).
19. The method of any one of claims 14 to 18, wherein the NLRP1 mutation is detected by increased accumulation of oligomerised NLRP1 in the sample as compared to wild type (non-diseased or non-mutant) NLRP1.
20. The method of claim 19, wherein the accumulation of oligomerisation is detected by anti-ASC antibody.
21. The method of claim 20, further comprises the step of detecting and determining the presence of NLRP3.
22. The method of any one of claims 13 to 21, further comprising determining the NLRP1 haplotype of the subject.
23. The method of any one of claims 13 to 22 wherein the sample is selected from the group consisting of bodily fluid, and skin.
24. The method of any one of the preceding claims, wherein the skin is selected from the group consisting of epidermis, glabrous skin, plantar skin, and epidermal appendages.
25. The method of any one of the preceding claims, wherein the skin is keratinocytes and/or fibroblast.
26. The method of any one of the preceding claims, wherein the inflammatory skin disorder and/or autoimmune skin disorder is selected from the group consisting of MSPC (multiple self-healing palmoplantar carcinoma), FKLC (familial keratosis lichenoides chronica), conjunctiva, CAPSs (cryopyrin-associated periodic syndromes), FMFs (familial Mediterranean fever syndromes), MASs (macrophage activation syndromes), KAs (Keratoacanthomas), MSEE (multiple self-healing squamous epithelioma), KLC (keratosis lichenoides chronica), Nekam's disease, psoriasis, vitiligo-related autoimmune diseases, epidermal inflammation, hyperplasia, epithelial hyperplasia, generalized vitiligo, Addison's disease, congenital toxoplamosis, keratosis pilaris, lichen planus, and skin tumour.
27. The method of any one of the preceding claims, wherein the MSPC is selected from the group consisting of MSPC-TN-1, MSPC-RO-1, MSPC-FR-1, and MSPC SCC.
28. The method of any one of the preceding claims, wherein the FKLC is FKLC-EG-1.
29. A method of treating or preventing a skin tumour in a subject in need thereof, comprising administering a therapeutically effective amount of an inflammasome sensor NLRP1 mutant into the subject in need thereof.
30. The method of claim 13 or 29, wherein the NLRP1 mutant has at least one (or two or three or more) mutation located at PYD (pyrin domain) and/or LRR (leucine-rich repeats) domain.
31. The method of any one of claims 29 to 30, wherein the mutant comprises mutation located at PYD domain is a missense mutation.
32. The method of any one of claims 29 to 31, wherein the mutant comprises mutation located at PYD domain results in at least one or two or all amino acid substitution selected from the group consisting of A54T, M77T, and A66V.
33. The method of any one of claims 30 to 32, wherein the mutant comprises mutation located at LRR domain is a deletion (in-frame deletion).
34. The method of any one of claims 30 to 33, wherein the mutant comprises mutation located at LRR domain results in the deletion of amino acid phenylalanine at position 787 to arginine at position 843 (F787 to R843 or F787_R843del).
35. An isolated polypeptide having at least 70% sequence identity to the polypeptide of mutant NLRP1, or fragment thereof.
36. An isolated nucleic acid having at least 70% sequence identity to the nucleic acid of mutant NLRP1, or fragment thereof.
37. A vector comprising the nucleic acid of claim 36.
38. A host cell comprising the vector of claim 37.
39. The host cell of claim 38, wherein the cell is at least one of selected from the group consisting of a keratinocyte and a fibroblast.
40. A cell culture system comprising the host cell of claim 38 or 39.
41. A method of treating obesity, metabolic syndrome, and/or metabolic disorder in a subject in need thereof, comprising administering a therapeutically effective amount of an inflammasome sensor NLRP1 mutant into the subject in need thereof.
42. A method of treating or preventing cancer in a subject in need thereof, comprising administering a therapeutically effective amount of an activator capable of activating inflammasome sensor NLRP1.
43. The method of claim 42, wherein the activator capable of activating inflammasome sensor NLRP1 is talabostat.
44. The method of claim 42 or 43, wherein the cancer is squamous cell carcinoma.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
DEFINITIONS
[0046] Substitutions are herein indicated by providing the wild-type amino acid residue, followed by the position number, followed by the substituted amino acid residue to be substituted. As would be apparent to the person skilled in the art, the amino acid residue position number is with reference to the amino acid sequence of wildtype human NLRP1 (as provided in
[0047] As would be apparent to the person skilled in the art, the amino acid residue position number is with reference to the amino acid sequence of wildtype human NLRP1 (as provided in
DETAILED DESCRIPTION OF THE PRESENT INVENTION
[0048] A key pathway in the human innate immune system is reliant upon inflammasome complexes, which consist of an array of, for example, ligand-sensing nucleotide-binding domain, leucine-rich repeat containing (NLR) proteins, the adaptor protein ASC, and caspase-1, for activation. As used herein, the term inflammasomes refer to a multi-protein, intracellular complex that detects pathogenic microorganisms and sterile stressors, and that activates the highly pro-inflammatory cytokines interleukin-1b (IL-1b) and IL-18. Inflammasomes also known to induce a form of cell death termed pyroptosis. Dysregulation of inflammasomes is associated with a number of autoinflammatory syndromes and autoimmune diseases.
[0049] For example, ligand-sensing nucleotide-binding domain, leucine-rich repeat containing (NLR) proteins patrol the cytosol and initiate inflammasome assembly, pyroptotic cell death, and pro-inflammatory cytokine release upon ligand binding. While the inflammasome complexes are essential for pathogen clearance under physiological conditions, their aberrant activation can be detrimental to their host. Here, it is shown that germline mutations in the inflammasome sensor NLRP1 cause at least two overlapping skin disorders: multiple self-healing palmoplantar carcinoma (MSPC) and familial keratosis lichenoides chronica (FKLC). A group of non-fever inflammasome disorders has been established, thereby uncovering previously unknown auto-inhibitory function for the pyrin domain, and providing a genetic link between NLRP1 and skin inflammatory syndromes and skin cancer predisposition.
[0050] Thus, in one example, there is disclosed a method of treating or preventing an autoimmune skin disorder and/or inflammatory skin disorder in a subject in need thereof In one example, the method comprises administering a therapeutically effective amount of an inhibitor capable of inhibiting the activation of inflammasome sensor NLRP1 (Nucleotide-binding domain, leucine-rich repeat containing (NLR) family, pyrin domain containing protein 1NLPR1).
[0051] As used here, the term inhibiting or inhibition refers to the ability of a given compound to limit, prevent or block the action or function of the target compound. This can be cause by, for example, the binding of the inhibitor resulting in a conformational change in the target compound, thus rendering the target compound unable to further function in a normal fashion compared to an uninhibited target compound. The binding of the inhibitor can be, for example, reversible or irreversible, depending on the principles underlying the binding of the inhibitor to the target molecule. In terms of inhibition mechanisms, this can take place using different biological or chemical principles. For example, in terms of enzyme inhibition, an inhibitor can inhibit an enzyme via inhibition that is competitive, uncompetitive, non-competitive or mixed. An enzyme can also be inhibited via covalent inactivation, which is an example of irreversible inhibition.
[0052] As used herein, the term inhibitor capable of inhibiting the activation of inflammasome sensor NLRP1 or NLRP1 inhibitor refers to an agent or a compound that is capable of inhibiting the activation of NLRP1. For example, a compound capable of preventing oligomerisation of NLRP1, a mechanism by which the NLRP1 protein initialises downstream pathways, is considered to fall within the ambit of the term NLRP1 inhibitor.
[0053] The term oligomerisation refers to a chemical process that links monomeric (that is single unit) compounds, for example, but not limited to, amino acids, nucleotides, monosaccharides, or chemical monomers, to form dimers, trimers, tetramers, or longer chain molecules (also known as multimers or oligomers).
[0054] Examples of oligomerisation include, but are not limited to, self-oligomerisation, which is the oligomerisation of one peptide unit with one or more multiple units of itself (that is being identical in structure or sequence), and examples of oligomerisation of peptides to other peptides that are not identical in structure or sequence.
[0055] Thus, in one example, the inhibitor inhibits the activation of NLRP1 by preventing an oligomerisation of NLRP1. In another example, the inhibitor inhibits the activation of NLRP1 by preventing self-oligomerisation of NLRP1. In another example, the inhibitor inhibits the activation of NLRP1 by preventing oligomerisation between the NLRP1, or fragments thereof, and inflammasome adaptor protein ASC (apoptotic speck protein).
[0056] Other methods of inhibition include, for example, inhibiting the binding of the intended binding partner of a protein, for example a receptor or another protein, by displaying the same binding site as the receptor, for example, but not acting in the same manner as the intended binding partner once the peptide is bound. Another example of protein inhibition is mimicking the function of a natural inhibitor and thereby inhibiting the function of the target protein. Thus, in one example, the inhibitor inhibitis the activation of NLRP1 by mimicking the function of wild type PYD domain (pyrin domain) and wild type LRR (leucine-rich repeats) domain.
[0057] Compounds or agents capable of such inhibition may not belong to the same chemical group or have structural similarities, but are grouped together by their ability to function as NLRP1 inhibitor. Examples of such inhibitors as disclosed above are, but are not limited to, a small molecule, an antibody, a polypeptide, and a nucleic acid. In one example, the inhibitor of the oligomerisation between NLRP1, or fragments thereof, and the inflammasome adaptor protein ASC is, but is not limited to, a small molecule, an antibody, a polypeptide, and a nucleic acid.
[0058] Another method by which the self-activating properties of NLRP1 can be prevented is, for example, by preventing proteolytic cleavage of NLRP1. Proteolytic cleavage is a process by which peptides are usually degraded, in other words, cut into shorter fragments. In some example, only specific sections of the peptide are cleaved, for example the N- or the C-terminus of a peptide, thereby conferring the cleaved peptide with new or previously dormant capabilities. One example of such peptides is a zymogen, which is an inactive precursor of an enzyme. Zymogens require a biochemical change (for example, a hydrolysis reaction revealing the active site, cleavage to an active form, or changing the configuration to reveal the active site) in order for it to become an active enzyme.
[0059] Thus, in one example, the inhibitor prevents the proteolytic cleavage of NLRP1. In another example, the location of the proteolytic cleavage is within the FIIND domain of NLRP1. In another example, wherein the location of the proteolytic cleavage is between phenylalanine at position 1212 and serine at position 1213 (also written as F1212-S1213).
[0060] In another example, the inhibitor of the proteolytic cleavage is selected from the group consisting of a small molecule, an antibody, a polypeptide, and a nucleic acid.
[0061] Disclosed herein are also methods of treating or preventing an autoimmune skin disorder and/or inflammatory skin disorder in a subject. In one example, the method comprises administering a therapeutically effective amount of an agent that prevents the secretion of stress responsive secreted factors (also known as pro-inflammatory cytokines), keratinocytes differentiation markers, inflammasome-dependent cytokines, and growth factors in the skin.
[0062] In one example, the inflammasome-dependent cytokine is, but is not limited to, IL-1 (interleukin-1alpha), IL-1 (interleukin-1beta), and IL-18 (interleukin-18). In another example, the inflammasome-dependent cytokine is at least one, at least two, or more inflammasome-dependent cytokines. In yet another example, the inflammasome-dependent cytokine is one, two, three or four of the inflammasome-dependent cytokines disclosed herein.
[0063] Also disclosed herein is a method of determining whether a skin inflammation in a subject is an inflammatory skin disorder and/or an autoimmune skin disorder.
[0064] Examples of an inflammatory skin disorder and/or an autoimmune skin disorder are, but are not limited to MSPC (multiple self-healing palmoplantar carcinoma), FKLC (familial keratosis lichenoides chronica), conjunctiva, CAPSs (cryopyrin-associated periodic syndromes), FMFs (familial Mediterranean fever syndromes), MASs (macrophage activation syndromes), KAs (keratoacanthomas), MSEE (multiple self-healing squamous epithelioma), KLC (keratosis lichenoides chronica), Nekam's disease, psoriasis, vitiligo-related autoimmune diseases, epidermal inflammation, hyperplasia (for example, epithelial hyperplasia), generalized vitiligo, Addison's disease, congenital toxoplamosis, keratosis pilaris, lichen planus, and skin tumour (for example, epithelial skin tumour). In one example, the inflammatory skin disorder and/or an autoimmune skin disorder is MSPC. In another example, the MSPC is, but is not limited to, MSPC-TN-1, MSPC-RO-1, MSPC-FR-1, and MSPC SCC. In yet another example, the inflammatory skin disorder and/or an autoimmune skin disorder is FKLC. In a further example, the FKLC is FKLC-EG-1. In one example, the inflammatory skin disorder and/or an autoimmune skin disorder is skin tumour. In another example, the skin tumour is skin cancer. In another example, the skin cancer is squamous cell carcinoma (for example, cutaneous squamous cell carcinoma or malignant squamous cell carcinoma).
[0065] Disclosed herein is a method of treating or preventing cancer in a subject in need thereof. In one example, the method comprises administering a therapeutically effective amount of an activator capable of activating inflammasome sensor NLRP1.
[0066] Examples of such activators capable of activating inflammasome sensor NLRP1 are, but are not limited to, compounds that are known to have antineoplastic and/or hematopoiesis-stimulating activities. In another example, the activators are small molecules. Examples of such activators as described herein are, but are not limited to talabostat, CHEMBL305170, CHEMBL195189, CHEMBL383705, CHEMBL16709, CHEMBL66032, CHEMBL63406, CHEMBL1790483, CHEMBL63698, CHEMBL1813248, CHEMBL460984, and CHEMBL65406. In one example, the activator is talabostat, also known as Val-boro-Pro (PubChemCID: 6918572).
[0067] Also disclosed herein is a method of treating obesity, metabolic syndrome, and/or metabolic disorder in a subject in need thereof, comprising administering a therapeutically effective amount of an inflammasome sensor NLRP1 mutant into the subject in need thereof.
[0068] As used herein, the term obesity refers to a medical condition in which excess body fat has accumulated to the extent that it can have a negative effect on health. In general, subjects are considered to be obese when their body mass index (BMI), a measurement obtained by dividing a person's weight by the square of the person's height, is over 30 kg/m.sup.2, whereby the range of 25 to 30 kg/m.sup.2 is defined as being overweight. The definition of obesity, as established by the World Health Organisation, is provided in the table below:
TABLE-US-00001 BMI (kg/m.sup.2) from Up to Classification 18.5 Underweight 18.5 25.0 Normal weight 25.0 30.0 Overweight 30.0 35.0 Class I obesity 35.0 40.0 Class II obesity 40.0 45.0 Class III obesity
[0069] Having said that, a person skilled in the art will appreciate that the BMI index definition for obesity may vary depending on the race or heritage of the subject. For example, for a subject from East Asian countries, lower BMI values may apply. This is due to negative health consequences due to obesity arising at lower BMI values than the standard BMI values defined for Caucasians, for example. For example, Japan defines obesity as any BMI value greater than 25 kg/m.sup.2, while China utilises a BMI value of greater than 28 kg/m.sup.2 to define obesity.
[0070] It has been shown that deletion of NLRP1 in mice leads to obesity and metabolic syndrome/disorders. Without being bound by theory, it is thought that loss of NLRP1 results in a decreased IL-18 production and lipolysis, as seen in subjects with an IL-18 deficiency. Interleukin-18 (IL-18) has been shown to be activated by Caspase-1 in inflammasome complexes and has been shown to have anti-obesity effects. As used herein, the term metabolic syndrome refers to a clustering of at least three of the five following medical conditions (giving rise to a total of 16 possible combinations, all of which are understood to fall under metabolic syndrome): abdominal (central) obesity (see also thin-outside-fat-inside, TOFI individuals), high blood pressure, high blood sugar, high serum triglycerides, and low high-density lipoprotein (HDL) levels. Metabolic syndrome is associated with the risk of developing cardiovascular disease and type 2 diabetes. The syndrome is thought to be caused by an underlying disorder of energy utilization and storage.
[0071] As used herein, the term metabolic disorder refers to the situation wherein abnormal chemical reactions in the body alter the normal metabolic process. The underlying cause for such a metabolic disorder can be, but is not limited to, underlying genetic mutations or single gene anomalies. Most of these mutations and/or anomalies are inherited in an autosomal recessive fashion. Some of the possible symptoms that can occur as a result of metabolic disorders are, but are not limited to, lethargy, weight loss, jaundice, and seizures. The symptoms expressed are understood to vary depending on the type of metabolic disorder present. The symptoms of metabolic disorders can be sorted into four categories: acute symptoms, late-onset acute symptoms, progressive general symptoms and permanent symptoms.
[0072] Examples of metabolic disorders are, but are not limited to, Phenylketonuria (PKU), Malignant PKU, Type 1 tyrosinemia, Type 2 tyrosinemia, Alkaptonuria, Homocystinuria, Hyperhomocysteinemia, Maple Syrup Urine disease, Propionic Acidemia, Multiple Carboxylase deficiency, Methylmalonic Acidemia, Hyperlipidemia and hypercholesterolemia, Fatty Acid Oxidation disorders, Glycogen Storage diseases, Galactosemia, Congenital Disorders of Glycosylation, Purine Overproduction, Lesch-Nyhan syndrome, Gaucher disease Types I and II, Tay-Sachs disease, Fabry disease, Hurler syndrome, Hunter syndrome, Sanfilippo syndrome, Maroteaux-Lamy syndrome, Morquio syndrome, Refsum disease, and Alanine-glyoxylate transaminase defect.
[0073] Disclosed herein is also a method of treating or preventing a skin tumour in a subject in need thereof. In one example, the method comprises administering a therapeutically effective amount of an inflammasome sensor NLRP1 mutant into the subject in need thereof.
[0074] As used herein, the term mutation or mutated refers to a natural or artificial modification, or genetic alteration of the genome or part of a nucleic acid sequence of any biological organism, virus or extra-chromosomal genetic element. This mutation can be induced artificially using, but not limited to, chemicals and radiation, but can also occur spontaneously during nucleic acid replication in cell division. Mutations may or may not produce discernible changes in the observable characteristics (phenotype) of an organism. There are various types of mutations known, which can either be small-scale mutations or large-scale mutations. Examples of small-scale mutations are, but are not limited to, substitution mutations, silent mutations, missense mutations, nonsense mutations, frame-shift mutations, insertions, and deletions. Examples of large-scale mutations are, but are not limited to, amplifications, deletions, chromosomal translocations, interstitial deletions, chromosomal inversions and mutations that result in a loss of heterozygosity. Mutations can also be grouped by their effect on the function of the resulting product. These include, but are not limited to, loss-of-function (inactivating) mutations, gain-of-function (activating) mutations, dominant-negative (antimorphic) mutations, lethal mutations and back or reverse mutations. Point mutations, for example, also known as single base modification, are a type of mutation that causes a single nucleotide base substitution, insertion, or deletion of the genetic material, DNA or RNA. The term frame-shift mutation indicates the addition or deletion of a base pair, thereby resulting in a shift in the reading frame with which the DNA is read.
[0075] For example, silent mutations are mutations in DNA that do not significantly alter the phenotype of the organism in which they occur. Silent mutations can occur in non-coding regions (outside of genes or within introns), or they may occur within exons. When they occur within exons, they either do not result in a change to the amino acid sequence of a protein (also known as a synonymous substitution), or they result in the insertion of an alternative amino acid with similar properties to that of the original amino acid. In either case, there is no significant change in the resulting phenotype. The phrase silent mutation is often used interchangeably with the phrase synonymous mutation. However, synonymous mutations only occur within exons, and are not always silent mutations. Synonymous mutations are mutations that can affect transcription, splicing, mRNA transport, and translation, any of which could alter phenotype, rendering the synonymous mutation non-silent.
[0076] In one example, the NLRP1 mutant is caused by one or more of the following non-limiting examples of mutations: substitutions, insertions, deletions, frame-shift mutations, missense mutations, nonsense mutations, duplications, and repeat expansion mutations.
[0077] In one example, the NLRP1 mutant has at least one, at least two, at least three, or more mutations. In another example, the NLRP1 mutant has one, two, three, or more mutations. In yet another example, the mutations are located at PYD (pyrin domain) and/or LRR (leucine-rich repeats) domain. In a further example, the mutation located at PYD domain is a missense mutation. In one example, the mutation at the PYD domain results in at least one or two or all amino acid substitution, wherein the amino acid substitution is, but is not limited to, A54T (which is the substitution of an alanine at position 54 to threonine), M77T (which is the substitution of a methionine at position 77 to threonine), and A66V (which is the substitution of an alanine at position 66 to valine). In one example, the mutation at the PYD domain results in one mutation. In another example, the mutation at the PYD domain results in two mutations. In yet another example, the mutation at the PYD domain results in three mutations.
[0078] In one example, the amino acid substitution is A54T. In another example, the amino acid substitution is M77T. In a further example, the amino acid substitution is A66V. In one example, the mutation comprises two amino acid substitutions, wherein one amino acid substitution is A54T, and the other amino acid substitution is one of A66V or M77T. In another example, the mutation comprises two amino acid substitutions, wherein one amino acid substitution is A54T, and the other amino acid substitution is M77T. In yet another example, the mutation comprises two amino acid substitutions, wherein one amino acid substitution is A54T, and the other amino acid substitution is A66V. In a further example, the mutation comprises three amino acid substitutions, wherein the amino acid substitutions are A54T, A66V, and M77T.
[0079] The term sequence identity means that two nucleic acid or amino acid sequences are identical (i.e., on a nucleotide-by-nucleotide or residue-by-residue basis) over the comparison window. The term percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) or residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. The terms substantial identity as used herein denotes a characteristic of a polynucleotide or amino acid sequence, wherein the polynucleotide or amino acid comprises a sequence that has at least 85 percent sequence identity, preferably at least 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a reference sequence over a comparison window of at least 18 nucleotide (6 amino acid) positions, frequently over a window of at least 24-48 nucleotide (8-16 amino acid) positions, wherein the percentage of sequence identity is calculated by comparing the reference sequence to the sequence which may include deletions or additions which total 20 percent or less of the reference sequence over the comparison window. The reference sequence may be a subset of a larger sequence.
[0080] Thus, in one example, there is disclosed an isolated polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% sequence identity to the polypeptide of mutant NLRP1, or fragment thereof. In another example, there is disclosed an isolated nucleic acid having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% sequence identity to the nucleic acid of mutant NLRP1, or fragment thereof.
[0081] Also disclosed is a vector comprising the nucleic acid described herein. The present application also describes a host cell comprising the vector or nucleic acid as disclosed herein. In one example, the host cell is, but is not limited to, a keratinocyte and a fibroblast (such as dermal fibroblast). In another example, there is disclosed a cell culture system comprising the host cell as described herein. In yet another example, the cell culture system has a three dimensional structure, for example, 3D organotypic cultures, cultures in scaffolding and the like
[0082] One of the methods disclosed herein is a method of determining the likelihood (or the predisposition) of a subject developing an inflammatory skin disorder and/or an autoimmune skin disorder.
[0083] In one example of any of the methods disclosed herein, the skin inflammation is an inflammatory skin disorder. In another example, the skin inflammation is an autoimmune skin disorder. In yet another example, the method comprises detecting NLRP1 mutation in a sample obtained from the subject.
[0084] In another example, the method comprises administering a therapeutically effective amount of an agent that reduces the effect of inflammasome-dependent cytokines. Examples of such agents are, but are not limited to, a small molecule, an antibody, a polypeptide, and a nucleic acid. In one example, the agent is an antibody. In another example, the antibody is a neutralising antibody.
[0085] Also disclosed herein is a method of treating a skin inflammation in a subject, comprising detecting NLRP1 mutation in a sample obtained from the subject. In one example, the method comprises determining whether the subject has NLRP1 mutation. In another example, the method comprises, when the subject is shown to have NLRP1 mutation, treating the skin inflammation in the subject by administering any one of the following: an inhibitor capable of inhibiting the activation of inflammasome sensor NLRP1 (Nucleotide-binding domain, leucine-rich repeat containing (NLR) family, pyrin domain containing protein 1NLPR1); an agent that prevents the secretion of stress responsive secreted factors, known pro-inflammatory cytokines, keratinocytes differentiation markers, inflammasome-dependent cytokines, and growth factors in the skin; an agent that reduces the effect of inflammasome-dependent cytokines and an inflammasome sensor NLRP1 mutant. In one example, the agents and inhibitors are each to be administered, or are each administered, in a therapeutically effective amount. In another example, the method comprises method of treating a skin inflammation in a subject, comprising detecting NLRP1 mutation in a sample obtained from the subject, determining whether the subject has NLRP1 mutation, and wherein when the subject has NLRP1 mutation, treating the skin inflammation in the subject by administering any one of selected from the group consisting of a therapeutically effective amount of an inhibitor capable of inhibiting the activation of inflammasome sensor NLRP1 (Nucleotide-binding domain, leucine-rich repeat containing (NLR) family, pyrin domain containing protein 1NLPR1); a therapeutically effective amount of an agent that prevents the secretion of stress responsive secreted factors, known pro-inflammatory cytokines, keratinocytes differentiation markers, inflammasome-dependent cytokines, and growth factors in the skin; a therapeutically effective amount of an agent that reduces the effect of inflammasome-dependent cytokines; and a therapeutically effective amount of an inflammasome sensor NLRP1 mutant into the subject in need thereof.
[0086] Thus, in one example, the NLRP1 mutation is, but is not limited to, one or more substitutions, insertions, deletions, frameshifts mutations, missense mutations, nonsense mutations, duplications, and repeat expansions.
[0087] In another example, the NLRP1 mutation is located at PYD (pyrin domain) and/or LRR (leucine-rich repeats) domain. In yet another example, the mutation is located at the PYD domain. In a further example, the mutation is located at the LRR domain.
[0088] In one example, the NLRP1 mutation is detected by increased accumulation of oligomerised NLRP1 in the sample as compared to wild type (that is non-diseased or non-mutant) NLRP1. In another example, the accumulation of oligomerisation is detected by anti-ASC antibody. In yet another example, the method of detecting the NLRP1 mutation further comprises the step of detecting and determining the presence of NLRP3.
[0089] In a further example, the method disclosed herein further comprises determining the NLRP1 haplotype of the subject. As used herein, the term haplotype refers to a group of genes within an organism that was inherited together from a single parent. The word haplotype is a portmanteau of the words haploid, which describes cells with only one set of chromosomes, and from the word genotype, which refers to the genetic makeup of an organism. A haplotype can describe a pair of genes inherited together from one parent on one chromosome, or it can describe all of the genes on a chromosome that were inherited together from a single parent. This group of genes was inherited together because of genetic linkage, or the phenomenon by which genes that are close to each other on the same chromosome are often inherited together. The term haplotype can also refer to the inheritance of a cluster of single nucleotide polymorphisms (SNPs), which are variations at single positions in the DNA sequence among individuals.
[0090] Examination of haplotypes can assist in the identification of patterns of genetic variation that are associated with health and disease states. For instance, if a haplotype is associated with a certain disease, stretches of DNA near the SNP cluster can be analysed in an attempt to identify the gene or genes responsible for causing the disease.
[0091] In one example, analysis and identification of the presence or absence of the one or more mutations as disclosed herein is performed utilising, but not limited to, at least one of the following: exome sequencing; PCR, RT-PCR (reverse transcriptase), qPCR (quantitative PCR); Western Blot; gel electrophoresis, such as, but not limited to polyacrylamide gel electrophoresis (PAGE), sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), Blue-Native PAGE, and 2D-PAGE); enzyme-linked immunosorbent assay (ELISA); immunohistochemistry, such as, but not limited to, histology, immunofluorescence staining; in situ staining, and Disuccinimidyl suberate (DSS) crosslinker protocol. In one example, where in the event that the method disclosed herein is performed by RT-PCR, the primer, or primer pair, is selected from the primers as provided in Table 4.
[0092] The methods disclosed herein can be performed on samples obtained from a subject. The samples can be, but are not limited to, bodily fluids (for example, but not limited to, saliva, blood, tears, sweat, urine, seminal fluid, amniotic fluid, and the like), and skin (such as, but not limited to, skin obtained from a skin lesion). In one example, the skin is, but is not limited to epidermis, glabrous skin, plantar skin, epidermal appendages (such as hair follicles), keratinocytes, fibroblast (such as dermal fibroblast), and combinations thereof In another example, the skin is keratinocytes and/or fibroblast.
[0093] Discussed herein are two overlapping Mendelian monogenic skin disorders: multiple self-healing palmoplantar carci-noma (MSPC; OMIM: 616964) and familial keratosis lichenoides chronica (FKLC). These two skin diseases are allelic and caused by distinct gain-of-function mutations in the inflammasome sensor protein, NLR family, pyrin domain containing protein 1 (NLRP1). It is shown that NLRP1 is the most prominently ex-pressed inflammasome sensor in human skin. Through functional analyses of the disease-causing mutations, it was shown that the mechanism of activation for NLRP1 that differs from other inflammasome sensors. Wild-type NLRP1 is kept as an inactive monomer by the combined action of the PYD (pyrin domain) and LRR domain. MSPC and FKLC mutations disrupt these two domains, respectively, leading to constitutive NLRP1 self-oligomerisation and inflammasome activation. Furthermore, spontaneous inflammasome activation and IL-1 secretion is shown to be present in, for example, patients' keratinocytes. Using ex vivo organotypic skin models, it was shown that inflammasome-dependent IL-1 cytokines can directly cause skin hyperplasia. These findings expand the clinical diversity of inflammasome disorders to non-fever skin diseases. Without being bound by theory, it is believed that the present application shows genetic evidence connecting inflammasome signalling to inflammatory skin disorders and skin cancer predisposition.
Pedigrees and Clinical Features of MSPC and FKLC
[0094] A Tunisian kindred (
[0095] Based on these symptoms, two additional MSPC kindreds were ascertained (
[0096] It was further found that a fourth family shared several clinical features with MSPC (FKLC-EG-1) (
[0097] To ascertain the causal mutation(s) in MSPC and FKLC, whole exome sequencing was performed on genomic DNA isolated from MSPC1-TN-1 IV:13 and FKLC-EG-1 V:3 and V:5. After removing annotated polymorphisms, a single heterozygous exonic variant (Chr. 17: 5,487,118 G>A, hg19) in exon 1 of the NLRP1 gene was identified within the candidate genomic locus (Chr. 17: 1,541,109-12,964,181). Further Sanger sequencing confirmed that this mutation segregated with disease among 16 other MSPC-TN-1 family members (
[0098] Thus, in one example, the NLRP1 mutation is located at PYD (pyrin domain). In another example, the mutation at the PYD domain comprises at least one or two or all amino acid substitution, wherein the amino acid substitution is, but is not limited to, A54T (which is the substitution of an alanine at position 54 to threonine), M77T (which is the substitution of a methionine at position 77 to threonine), and A66V (which is the substitution of an alanine at position 66 to valine). In one example, the mutation at the PYD domain comprises one mutation. In another example, the mutation at the PYD domain comprises two mutations. In yet another example, the mutation at the PYD domain comprises three mutations. In a further example, the mutation at the PYD domain is a missense mutation.
[0099] In one example, the amino acid substitution is A54T. In another example, the amino acid substitution is M77T. In a further example, the amino acid substitution is A66V. In one example, the mutation comprises two amino acid substitutions, wherein one amino acid substitution is A54T, and the other amino acid substitution is one of A66V or M77T. In another example, the mutation comprises two amino acid substitutions, wherein one amino acid substitution is A54T, and the other amino acid substitution is M77T. In yet another example, the mutation comprises two amino acid substitutions, wherein one amino acid substitution is A54T, and the other amino acid substitution is A66V. In a further example, the mutation comprises three amino acid substitutions, wherein the amino acid substitutions are A54T, A66V, and M77T.
[0100] Whole exome sequencing of FKLC-EG-1 V:3 and V:5 revealed that both affected children harboured a homozygous deletion within the NLRP1 locus that removed the fifth exon (
NLRP1 is the Predominant Inflammasome Sensor in Human Skin
[0101] The physiological function of NLRP1 remains less understood than that of other inflammasome sensors, such as, for example, NLRP3. Genome-wide association studies have implicated NLRP 1 haplotypes in psoriasis and vitiligo-related autoimmune diseases (OMIM: 606579), suggesting that NLRP1 might play a role in skin-specific immune response. To explore the potential functions of NLRP1 in the skin, the tissue expression profiles of NLRP1 in the Human Protein Atlas RNA-seq database were analysed. It was found that NLRP1 is widely expressed, in contrast to other NLRs such as NLRP3, AIM2, NLRC4, and MEFV, which have more restricted tissue distributions (
[0102] Next, the transcript levels of NLRP1 and other inflammasome components in the three major cell types in the skin, namely, keratinocytes, melanocytes, and fibroblasts, were examined. NLRP1 was readily detectable by RT-PCR in keratinocytes and fibroblasts, but not in melanocytes. In contrast, none of the other known inflammasome NLRs could be detected in the skin cell types (
[0103] Next, the expression of NLRP1 was verified in paraffin preserved primary human skin samples. Using RNAscope in situ staining, it was found that NLRP1 mRNA is expressed throughout the epidermis and in dermal fibroblasts in both glabrous skin and plantar skin (
MSPC and FKLC Mutations Cause Increased Inflammasome Activation
[0104] Many inflammasome-activating NLR proteins share a common domain structure that comprises of an N-terminal PYD followed by a NACHT domain, an evolutionarily conserved NTPase domain, and LRR domain. In general, NLR PYDs are thought to initiate inflammasome assembly, whereas the NACHT and LRR domains regulate self-association and/or ligand binding. Among all PYD-containing NLRs, human NLRP1 uniquely possesses a C-terminal caspase activation and recruitment domain (CARD) preceded by an auto-proteolytic function-to-find domain (FIIND;
[0105] All of the three germline missense mutations in MSPC, A54T, A66V, and M77T are found within the N-terminal PYD (
[0106] Thus, in one example, the mutation at the PYD domain is a missense mutation. In another example, the mutation at the LRR domain is a deletion. In yet another example, the deletion is an in-frame deletion.
[0107] Missense mutations are is a point mutation present in the nucleic acid sequence. This alteration of one single nucleotide results in a codon binding which codes for a different amino acid, thus resulting in a change in the resulting peptide.
[0108] As used herein, the term in-frame deletion refers to any insertion or deletion in the nucleic acid sequence that is evenly divisible by three, thereby resulting in there being no change in the reading frame of the nucleic acid sequence.
[0109] In one example, the mutation is at the LRR domain results in the deletion of amino acid phenylalanine at position 787 to arginine at position 843 (that is F787 to R843 or F787_R843del). In other words, the mutation at the LRR domain results in the truncation of the amino acid sequence between amino acids F787 to R843, thereby retaining the amino acids F878 to R843.
[0110] To investigate the functional consequence of the MSPC and FKLC mutations, it was tested whether overexpressed NLRP1 mutants could nucleate oligomeric assemblies of the inflammasome adaptor protein, ASC. When 293T cells stably expressing ASC-GFP (293T-ASC-GFP) were transfected with plasmids encoding NLRP1 MSPC and FKLC mutants, a significant increase in the percentage of cells with ASC-GFP specks, relative to those expressing wild-type NLRP1 (
[0111] Due to the high degree of natural polymorphisms in NLRP1, all minor alleles of NLRP1 with non-synonymous SNPs in the PYD were cloned. None of the 16 SNPs significantly altered the percentage of 293T-ASC-GFP cells with specks (
[0112] Next, NLRP1 mutants in MSPC were examined to see if these mutants could lead to increased processing of pro-IL-1b by caspase-1. To this end, wild-type NLRP1, NLRP1 mutants, pro-caspase-1, and pro-IL-1b were overexpressed in HEK293T ASC-GFP cells to reconstitute a functional inflammasome complex. All three MSPC and FKLC mutants led to higher amount of pro-IL-1b cleavage than wild-type NLRP1 (
[0113] Although the gain-of-function effect of the FKLC mutant, F787_R843del can be readily rationalized by the auto-inhibitory function of the LRR domain, it is shown that mutations in the PYD, which is widely thought to promote ASC assembly, can lead to a similar effect. To obtain additional evidence to confirm the gain-of-function effects of MSPC NLRP1 mutants, stable THP-1 cell lines that expressed doxycycline-inducible wild-type and mutant NLRP1 (A54T, M77T, or A66V;
The Pyrin Domain of NLRP1 unctions as an Atypical, Auto-Inhibitory Domain
[0114] As compared to other inflammasome sensor proteins, NLRP1 uniquely consists of both a PYD and CARD (
[0115] To further characterize how A54T, A66V, and M77T lead to inflammasome hyperactivation, the possibility that these mutations directly enhance ASC oligomer assembly was tested. While both NLRP3 PYD and AIM2 PYD domain led to robust ASC speck formation when expressed as mCherry-fusion proteins in 293T ASC-GFP cells (
[0116] Based on these results, and without being bound by theory, it is thought that NLRP1 PYD plays a fundamentally different role from other PYDs, and that it maintains NLRP1 in an auto-inhibited, inactive state, instead of directly engaging in ASC oligomer formation. Thus, the ability of a series of N-terminally truncated NLRP1 mutants to initiate ASC-speck formation in 293T ASC-GFP cells (
[0117] Conversely, all C-terminal truncation mutants lacking the CARD failed to increase the number of ASC specks in 293T ASC-GFP cells (
NLRP1 Mutations in MSPC Disrupt PYD Domain Folding
[0118] Functional characterization of NLRP1 PYD suggests that the three missense MSPC mutations likely cause inflammasome hyper-activation by disrupting PYD-dependent auto-inhibition. It had been previously shown that NLRP1 PYD forms a bundle of five a helices, in contrast to the canonical death domain superfamily fold consisting of six helices (
Mechanistic Basis for NLRP1 PYD- and LRR-Mediated Auto-Inhibition
[0119] Elucidating the structural basis for NLRP1 activation has been traditionally hampered by a lack of a bona fide ligand for NLRP1. It was reasoned that the activating mutants identified from MSPC and FKLC kindred offers a unique opportunity to probe the mechanistic basis for NLRP1 inflammasome activation.
[0120] To address this question, blue native PAGE (BN-PAGE) was used to directly visualize the native conformations of wild-type and patient-derived mutant NLRP1 proteins. Overexpressed wild-type NLRP1 migrated as a prominent band at a molecular size of 150 kDa under native conditions (
[0121] Consistent with this model, the DPYD mutant (amino acids 93 to 1474) was found exclusively as a high molecular weight oligomer (
[0122] The role of the C-terminal cleavage fragment in NLRP1 MSPC mutants was further characterised using 2D-PAGE. NLRP1-expressing 293T lysates were fractionated by BN-PAGE, eluted from excised gel slices, and further separated by reducing SDS-PAGE. Full-length wild-type NLRP1 and its C-terminal fragment were both predominantly found in a lower molecular weight fraction corresponding to 150 kDa, similarly to native, tetrameric GAPDH (
[0123] Taken together, these findings lead us to the model for NLRP1 function as shown in
NLRP1 Activation Causes Epidermal Inflammation and Hyperplasia via Paracrine IL-1 Signalling
[0124] As primary human epidermal keratinocytes are the major skin cell type expressing all components of the NLRP1 inflammasome (
[0125] Next, next-generation RNA sequencing was used to characterize the consequences of MSPC NLRP1 mutants on keratinocyte gene expression (
[0126] A closer examination of the up-regulated transcripts revealed a significant overlap with a previous dataset on recombinant IL-1a-inducible genes in primary keratinocytes (
In Vivo Evidence for Keratinocyte Inflammasome Activation in MSPC and FKLC Patients
[0127] To study the endogenous NLRP1 inflammasome in patient cells, skin punch biopsies were obtained from two MSPC probands, MSPC-TN-1 IV:2 (NLRP1A54T/+) and MSPC-RO-1 III:3 (NLRP1A66V/+), and one FKLC proband FKLC-EG-1 V:3 (NLRP1F787_R843del/F787_R843del) and her mildly affected father FKLC-EG-1 III:5 (NLRP1F787_R843del/+). Five independent keratinocyte cultures were successfully isolated and designated NLRP1A54T/+ lesional, NLRP1A54T/+ non-lesional, NLRP1A66V/+ non-lesional, NLRP1F787_R843del/F787_R843del lesional, and NLRP1 NLRP1F787_R843del/+. The Luminex platform was used to compare the cytokine and chemokine profiles of patients' primary keratinocytes to those derived from unrelated healthy donors. The bona fide inflammasome-dependent cytokine IL-1b was the top cytokine up-regulated in keratinocyte cultures derived from MSPC and FKLC probands, followed by TNFa, IL-1RA, IL-1a, TGFa, and GM-CSF (
[0128] Interestingly, keratinocytes derived from the father of the FKLC-EG-1 proband also displayed ASC oligomer formation, despite the fact that there was no significant induction of IL-1b and IL-18 secretion. It was reasoned that the F787_R843del mutation caused only mild inflammasome activation in the heterozygous state, consistent with his subclinical symptoms. In this regard, it is worth noting that an activating gain-of-function mutation in the same region of murine Nlrp1a displayed no phenotypes in the heterozygous state, but has been shown to cause severe auto-inflammation when bred to homozygosity. Finally, the up-regulation of inflammatory markers S100A8/9 and S100A7/psoriasin was validated in a primary squamo-proliferative skin lesion biopsy from the MPSC proband MSPC-TN-1 IV:20 (NLRP1A54T/+) (
[0129] In summary, the genetic etiology of two skin disorders, MSPC and FKLC, has been resolved based on the information provided above. It is shown that MSPC patients experience recurrent keratoacanthomas (KA) in palmoplantar skin, as well as in conjunctival and corneal epithelia, and are highly susceptible to malignant squamous cell carcinoma. FKLC shares multiple clinical symptoms with MSPC but displays more severe symptoms such as generalized lichenoid papular lesions on the limbs and the trunk.
Consequences of NLRP1 Gain- and Loss-of-Function Variants
[0130] The results demonstrate that the two diseases are allelic and both result from germline mutations in the inflammasome sensor, NLRP1. While all MSPC cases are caused by heterozygous missense mutations in the PYD of NLRP1, FKLC arises from bi-allelic inheritance of an internal deletion within the highly conserved NLRP1 LRR domain. Functionally, all MSPC and FKLC mutations in NLRP1 are gain of function and lead to increased inflammasome activation.
[0131] Although the function of endogenous NLRP1 in immune defence is still unclear, it is of note that NLRP I homologs in other mammals such as elephant, hedgehog, and dolphin have acquired a large number of null mutations, insomuch that NLRP1 can be considered to be a pseudo gene in these mammalian species. Importantly, at least five healthy individuals have been found to carry homozygous splice site mutations in NLRP1. The identification of these possible NLRP1-null healthy individuals suggests that the absence of NLRP1 is likely much less detrimental than gain-of-function mutations.
Model of Pathogenesis for MSPC and FKLC
[0132] Without being bound by theory, it is thought that a chronic, unresolved keratinocyte-driven inflammation underlies the pathology in MSPC and FKLC (
A Mechanism of PYD-Mediated Inflammasome Regulation
[0133] The performed biochemical analyses revealed unique biochemical properties of NLRP1. NLRP1 PYD unexpectedly functions as an auto-inhibitory domain, unlike the PYDs of other known inflammasome sensors. Thus, despite having both a PYD and a CARD, it is thought that NLRP1 should be functionally classified as an NOD-, LRR- and CARD-containing (NLRC) protein, rather than an NOD-, LRR-, and pyrin domain containing (NLRP) protein. NLRP1 PYD functions non-redundantly with the LRR domain to maintain NLRP1 in an inactive monomeric form. When either domain is mutated, as in the case of MSPC and FKLC, this auto-inhibitory mechanism is lost. This results in an increased propensity for NLRP1 to oligomerise. It was further demonstrated that the monomer-to-oligomer transition is an obligatory step for NLRP1 inflammasome activation and requires the auto-proteolytic cleavage of the FIIND domain. These findings define a mechanism for inflammasome regulation and provide a conceptual framework for future structural studies.
Inflammasome in Skin Cancer Susceptibility and Skin Inflammatory Diseases
[0134] Murine studies have implicated inflammasome components in epithelial hyperplasia. The data shown herein establishes a link between aberrant inflammasome activation and inherited inflammatory and proliferative skin disorders. Thus, inflammasome modulation can be and is used clinically to ameliorate chronic skin inflammatory diseases and decrease the risk for epithelial skin tumour.
[0135] NLRP1 is highly polymorphic in the general human population. It is thought that each NLRP1 haplotype is associated with a different propensity for activation, with the MSPC and FKLC mutants representing the extreme end of this spectrum. This line of thought concurs with previous genome-wide association studies (GWAS) linking NLRP1 SNPs to generalized vitiligo, Addison's disease, and congenital toxoplasmosis. Moreover, the phenotypes of FKLC overlap significantly with several common dermatologic diseases, such as keratosis pilaris and lichen planus, for which mechanistic insights are currently lacking.
[0136] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms comprising, including, containing, etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[0137] As used in this application, the singular form a, an, and the include plural references unless the context clearly dictates otherwise. For example, the term a genetic marker includes a plurality of genetic markers, including mixtures and combinations thereof.
[0138] As used herein, the term about, in the context of concentrations of components of the formulations, typically means +/5% of the stated value, more typically +/4% of the stated value, more typically +/3% of the stated value, more typically, +/2% of the stated value, even more typically +/1% of the stated value, and even more typically +/0.5% of the stated value.
[0139] Throughout this disclosure, certain embodiments may be disclosed in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosed ranges. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0140] Certain embodiments may also be described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the disclosure. This includes the generic description of the embodiments with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
[0141] The invention has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
[0142] Other embodiments are within the following claims and non-limiting examples. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
EXPERIMENTAL SECTION
Experimental Model and Subject Details
MSPC and FKLC Subjects
[0143] MSPC and FKLC families were identified and diagnosed by clinical geneticists and/or dermatologists. All genomic DNA samples were isolated from saliva using Oragene DNA collection kit (OG-500, DNAGenotek). Informed consent was obtained from all individual family members in accordance with local ethical review board requirements in the following institutions: Comit de Protection des Personnes Sud-Ouest et Outre-Mer II and Comit de Protection des Personnes Sud-Ouest et Outre-Mer II, Toulouse, France; National Institute for Infectious Diseases Matei Bals; Carol Davila University of Medicine and Pharmacy, Bucharest, Romania; Farhat Hached University Hospital, Sousse, Tunisia; Faculty of Medicine, Alexandria University, Egypt; Institute of Medical Biology, A*STAR, Singapore.
Cell Culture
[0144] All 293T and derivative cell lines were cultured in complete high-glucose DMEM media (Life Technologies) supplemented with 10% FBS. THP-1 cells were cultured in RPMI-1640 media supplemented with 10% FBS. THP-1 differentiation was induced by incubation with 400 ng/ml phorbol myristoyl acetate for 48 hours. Primary keratinocytes and fibroblasts from healthy human skin were obtained from de-identified surplus surgical waste with fully informed consent and obtained with full ethical clearance through the IMB Skin Cell Bank. Primary keratinocytes from MSPC and FKLC patients were isolated from fresh skin punch biopsies and grown on mouse 3T3 feeder cells. Immortalized N/TERT-1 keratinocytes were cultured in KSFM media (Life Technologies) supplemented with 300 mM CaCl.sub.2.
Method Details
Exome Sequencing of MSPC Families
[0145] For MSPC exome sequencing, 1 mg of purified genomic DNA was subjected to exome capture using Illumina TruSeq Exome Enrichment Kit (Illumina). Illumina HiSeq2500 high output mode was used for sequencing as 100 bp (basepair) paired-end runs at the UCLA Clinical Genomics Centre. Sequence reads were aligned to the human reference genome (Human GRCh37/hg19 build) using Novoalign (v2.07). PCR duplicates were identified by Picard (v1.42) and GATK (Genome Analysis Toolkit) (v1.1) was used to re-align insertions and deletions (INDELs), recalibrate the quality scores, call, filter, recalibrate, and evaluate the variants. SNVs and INDELs across the sequenced protein-coding regions and flanking junctions were annotated using Variant Annotator X (VAX), a customized Ensembl Variant. Effect Predictor (Yourshaw et al., 2014). An average coverage of 85X was achieved across the exome.
Exome Sequencing of FKLC-EG-1
[0146] Following informed consent, genomic DNAs from two affected siblings were subjected to whole-exome capture using in-solution hybridization with the SureSelect All Exon 50 Mb Version 4.0 (Agilent) followed by massively parallel sequencing (Illumina HiSeg2000) with 100 bp paired-end reads. The resulting variant calls were filtered with the BCFtools utility (samtools.github.io/bcftools/), filtered for a minimum coverage (calls with fewer than four reads filtered) and hard filtered for quality (variants with quality <20 filtered from further analysis). This high-quality call set was then annotated with respect to the genes, and for consequences on protein sequence and/or splicing with the ANNOVAR tool (www.openbioinformatics.org/annovar/). Further annotation was done through further rounds of ANNOVAR annotation against dbSNP135 (www.ncbi.nlm.nih.gov/snp), population frequency estimates from the 1000 Genomes project (www.1000genomes.org/) and the National Institutes of Health Heart, Lung and Blood Institute Grand Opportunity Exome Sequencing Project (esp.gs.washington.edu/drupal/), and 2000 control exomes that have been processed through the same bioinformatics analysis pipeline.
RT-PCR, In Situ Staining and Immunohistochemistry
[0147] Human tissue RNA array was purchased from Clontech. cDNA synthesis was performed with iScript cDNA synthesis kit according to the manufacturer's instructions (Clontech) with 1 g of purified RNA in 20 l. RT-PCR was performed using 1l of 10 diluted cDNA using HotStart Taq polymerase (QIAGEN). Q-PCR was performed in triplicate wells using 1 l of 10diluted cDNA using SYBR Green Master Mix (ThermoFisher). The primers are listed in Table 4.
[0148] Control skin sections for immunohistochemistry were obtained from de-identified surplus surgical waste with informed consent. RNAscope (Advanced Cell Diagnostics) staining was performed using Brown Kit using manufacturer-supplied controls (dapB and POLII) and a custom-synthesized probe against human NLRP1. Standard immunohistochemistry protocols were followed for NLRP1 staining using a rabbit polyclonal NLRP1 antibody (Adipogen, AL176). For antigen retrieval, slides were heated in sodium citrate buffer (10 mM sodium citrate, 0.05% Tween 20 [pH 6.0]) at 95 C. for 20 minutes. Primary antibodies were diluted in antibody dilution buffer (10% normal goat serum, 1% BSA in PBS) overnight at 4 C. Signals were visualized with the Dako EnVision rabbit-HRP kit (Agilent).
Plasmid Construction
[0149] To construct plasmids used for transient transfections, PCR-amplified NLRP1 and NLRP3 cDNA were cloned into pCS2+ vector using standard restriction cloning with ClaI and XhoI sites. Doxycycline inducible NLRP1 and NLRP3 expression plasmids were constructed by InFusion cloning of the respective cDNA fragments into an AgeI-RcoRI linearized pTRIPZ backbone (Clontech). ASC-GFP lentiviral construct was assembled by Infusion Cloning (Clontech) in pCDH-puro (Systems Bio).
Transient Transfection and Stable Lentiviral Overexpression
[0150] All lentiviruses were produced in 293T cells by co-transfection of second generation helper plasmids, concentrated using Lenti-X (Clontech) and kept as frozen stock until use. 293T transient transfection experiments were performed using Lipofectamine 2000 (Life Technologies), while all transfection experiments in immortalized keratinocytes were carried out using FugeneHD (Promega) using a 3:1 ratio according to the supplied protocol. Pooled siRNAs against human PYCARD (ASC) were purchased from ThermoFisher and transfected with Lipofectamine RNAiMax (Life Technologies).
Disuccinimidyl Suberate (DSS) Crosslinking
[0151] All harvested cell pellets were kept at 80 C. till use. For DSS crosslinking, cell pellets from a confluent well in 6-well plate were suspended in 200 l of 1 mM DSS in PBS for 15 minutes at 37 C. with constant mixing. Crosslinked pellets were centrifuged at 20,000 RCF for 5 minutes. Protein complexes were solubilized in 1Laemmli SDS-PAGE buffer for 10 minutes at 95 C. and centrifuged again at 20,000 RCF for 5 minutes. The supernatant was used for western blot analysis.
SDS-PAGE, Western Blotting, and ELISA
[0152] Protein lysate was quantified using the Bradford assay and 20 mg was used per well for SDS-PAGE. Proteins were transferred using TransBlot (Bio-rad) using the mixed molecular weight setting (25V, 7 minutes). Western blotting was carried out with overnight incubation of primary antibodies diluted in 1TBS with 1% Tween-20 and 3% non-fat milk at 4 C. All ELISA experiments were performed strictly according to the manufacturers' recommended protocols.
Immunofluorescence
[0153] 293T-ASC-GFP cells were seeded at 70% confluence on poly-lysine coated coverslips. N/TERT immortalized keratinocytes were seeded on uncoated coverslips. All cells were grown in growth media and allowed to adhere overnight. Coverslips were fixed with 4% paraformaldehyde in 1PBS and permeablized with 0.5% Triton-X in 1PBS. All primary antibodies were diluted in PBS with 1% BSA and 0.05% Triton-X. Primary antibody incubation was performed at 4 C. overnight with gentle mixing. Secondary antibody incubation was performed for 1 to 2 hours at room temperature. Coverslips were mounted with DAPI-containing Prolong Gold mounting media (ThermFisher).
Blue-Native PAGE and 2D-PAGE
[0154] Blue-Native PAGE was performed using the Novex NativePAGE Bis-Tris gel system (ThermoFisher) according to the manufacturers' instructions with minor modifications. Briefly, 293Ts cells were transfected with various NLRP1 expression plasmids at a ratio of 1 g plasmid per well in a standard 6-well plate using Lipofectamine 2000 reagent (ThermoFisher). Cells were harvested 48 hours post-transfection and lysed in Sample Prep buffer containing 1% digitonin, clarified by centrifugation at 20,000 RCF for 10 minutes and supplemented with Coomassie G-250 to a final concentration of 0.25%. 10 l of protein lysate per well was using for BN-PAGE. Electrophoresis was performed with the dark blue cathode buffer for 1 hr at 150 V constant voltage, followed by the light blue buffer at 250V for 1.5 hours. The proteins were transferred onto a PVDF membrane using a Trans-Blot Turbo system at 25 V for 10 minutes and detected by standard western blot procedures without the recommended acetic acid fixing step. For 2D PAGE, the entire BN-PAGE gel lane was excised and cut into 8 slices. Each slice was eluted in an elution buffer containing 50 mM Tris-HCl, 150 mM NaCl and 0.1% SDS overnight at room temperature with constant mixing. The supernatant was concentrated the next day using an Amicon Ultra 0.5 mL filter (MWCO=30 kDa) (Merck Millipore) to 40 ml and supplemented with 10 ml 1Laemmli buffer.
Luminex Multiplex Cytokine/Chemokine Array
[0155] Luminex multiplex cytokine and cytokine array was performed according the manufacturer's protocol, using the human cytokine/chemokine panel I (HCYTMAG-60K-PX41 Merck Millipore). Cytokine levels from different samples were analysed using hierarchical clustering in Multiple Experiment Viewer (www.tm4.org).
Recombinant Protein Purification and NMR Structural Analysis
[0156] Recombinant GB1-PYD WT and its mutants were expressed in E. coli BL21. All recombinant proteins were purified from the soluble fraction to homogeneity by Superdex 75 gel-filtration chromatography (GE healthcare) with an elution buffer containing 50 mM Na.sub.2HPO.sub.4, 50 mM NaCl, 20 mM DTT at pH 6.5. For NMR studies, U-.sup.15N-labeled proteins were produced by using standard M9 minimal media prepared with .sup.15NH.sub.4Cl. The NMR samples were prepared with protein concentrations between 100 and 200 mM in buffer containing 95%/5% H.sub.2O/D.sub.2O, 50 mM Na.sub.2HPO.sub.4, 50 mM NaCl, 20 mM DTT, at pH 6.5. Due to the low solubility of the cleaved protein, the recombinant PYDs were maintained as GB1 fusion proteins for the NMR experiments. 2D [.sup.15N,.sup.1H]-HSQC spectra were recorded at 25 C. in Bruker 600 and 700 MHz spectrometers equipped with room-temperature and cryogenic triple-resonance probes.
RNA-Seq
[0157] Total RNA samples were processed using the Illumina TruSeq stranded mRNA kit. Prepared libraries were quantified using KAPA qPCR and Agilent Bioanalyzer, and sequenced on the Illumina HiSeq-2000. The reads were processed and mapped using TopHat and Cufflink in the Galaxy suite. Differential gene expression was obtained using CuffDiff.
Phylogenetic Analysis of PYDs
[0158] Amino acid sequences of PYDs in the human genomes were downloaded from Prosite and aligned using the Muscle algorithm. Sequence similarity was computed using ClustalW2-Phylogency using the Neighbour joining clustering method and visualized using Tree-Of-Life (itol.embl.de/).
3D Skin Organotypic Co-Cultures
[0159] Briefly, keeping all solutions on ice, each gel was formed by using 8 parts collagen (rat tail collagen type I (BD biosciences) suspended in acetic acid) mixed with 1 part 10DMEM and 1 part FBS containing 110.sup.5 normal human fibroblasts (NHF). The collagen-NHF mix was then loaded into a cell culture insert (BD Biosciences) and allowed to solidify at 37 C. before adding NHF media to the culture. After three days 110.sup.6 normal human primary keratinocytes (NHK) were seeded on-top of the, collagen gel, in NHK medium. The next day the cultures were raised to the air-medium interface. After airlift, the gels were then treated either with a mixture of cytokines, IL-1a (R & D Systems), IL-1b (R & D Systems), IL-18 (MBL) to give a final concentration of 10 ng/ml each, or left untreated as a control. The additives were then replaced with medium change every 2-3 days. Organotypic co-cultures were harvested after 7 days and embedded in OCT for cryo-sectioning.
Immunofluorescence Staining of Organotypic Cultures
[0160] Frozen sections of 3D organotypic cultures, were exposed to 1:1 methanol:acetone fixation before incubation with 10% goat serum for 20 minutes, to block non-specific binding. Primary antibodies were then added overnight at 4 C. Primary antibodies include rabbit ki67 (ab15580, Abcam, 1:50), mouse keratin 10 (clone DEC10, Leica, 1:50), involucrin (clone SY5, Abeam, 1:100), S100A7 (clone MAC 387, Dako, 1:50) and S100A9/8 (Psoriasin, NovousBio, 1:50). Secondary antibodies (AlexaFluor 594 goat anti-rabbit or AlexaFluor 488 goat anti-mouse) were then added for 20 minutes at room temperature. Nuclei were counter stained with DAPI. Coverslips were mounted onto glass slides using Hydromount mounting media (National Diagnostics) before microscopic visualization.
Circular Dichroism Spectroscopy of NLRP1 PYD Domain
[0161] Circular dichroism (CD) measurements were performed on a Chirascan qCD series spectropolarimeter. Samples were diluted in 50 mM phosphate buffer, 50 mM NaCl, 20 mM DTT (pH 7.4) to a final protein concentration of 0.1 mg/mL. The protein concentration was determined by measuring absorbance at 280 nm. Native CD spectra were recorded over the wavelength range of 200-260 nm in a cuvette with a path length of 0.1 cm at the temperature of 293K. Samples were pre-equilibrated for 15 minutes prior to running the experiments. The blank signal obtained for the buffer alone was subtracted from the individual protein spectra. Thermal denaturation CD profiles were acquired by monitoring the ellipticity at 222 nm in the range from 293K to 365K using a water bath controlled by a Peltier device. The signal was recorded at 0.1K intervals and 1.5 s of response time. The CD signal was converted to mean residue molar ellipticity as follows:
[]=10.sup.6/[C]Nl
where [C] is the protein concentration, N is the protein residue number and l is the path-length (in cm). Calculated mean residue molar ellipticity is given in deg cm.sup.2 dmol.sup.1. The CD thermal unfolding data were analysed using least-squares minimization for the fitting two-state equilibrium unfolding model.
Fluorescence Anisotropy of ASC Filamentation
[0162] A fluorescence polarization-based assay was used to measure the reaction kinetics of ASC filament formation. Dylight Fluor 488 was conjugated irreversibly to a single cysteine residue of ASC in an overnight reaction and under denaturing conditions. Chromophore-labeled ASC-PYD was further purified by dialysis and size exclusion chromatography to remove unreacted free dye. ASC filament reconstitution was initiated by rapid mixing to physiological pH conditions. Filament formation is accompanied by a change in the rotational correlation time of the fluorophore covalently attached to monomeric ASC-PYD, which results in changed fluorescence polarization. The fluorescence polarization time course was measured on a Synergy H1 Hybrid microplate reader (Biotek). Data were acquired in 10 second intervals for a total time of 120 minutes.
Quantification and Statistical Analysis
[0163] A custom ImageJ workflow was used for the percentage calculation of ASC-GFP speck-containing cells. Briefly, the total cell number per image was counted in ImageJ using binary intensity thresholding of the DAPI images, a watershed filter followed by the automatic particle count algorithm, with a minimum cut-off radius of 50 pixels. ASC-GFP specks were counted in the same way using the GFP images, except no watershed filter was applied and the minimum radius was set at 10 pixels. For each sample, three fields were chosen at random and at least 100 cells were scored. All bar graphs were calculated based on three independent replicates, except experiments involving primary patient keratinocytes and sera (
[0164] The following experiments were performed with the experimented blinded to the sample. identity: Luminex cytokine/chemokine array (
[0165] The p values from all pairwise comparisons were calculated using two-tailed Student's t test, except the Luminex array data, where a one-tailed t test was used (
Data and Software Availability
Data Resources
[0166] The accession number for the RNA-seq data reported in this paper is GEO: GSE85791.
TABLE-US-00002 TABLE 1 clinical symptoms of MSPC and FKLC patients No. of palmo- Pedigree Mode of Age of plantar Affected Epithelial Tissues Number inheritance NLRP1 Mutation Gender Onset lesions Plantar Palmar Conjunctival Others MSPC-TN-1 AD p. Ala54 Hetero- M 25 10 + + III: 10 Thr zygous MSPC-TN-1 AD p. Ala54 Hetero- M 20 10 + + + III: 11 Thr zygous MSPC-TN-1 AD p. Ala54 Hetero- F 10 10 + + + III: 15 Thr zygous MSPC-TN-1 AD p. Ala54 Hetero- M 5 15 + +/ + Lower IV: 2 Thr zygous lip MSPC-TN-1 AD p. Ala54 Hetero- M 15 10 + + + Base of IV: 5 Thr zygous nose MSPC-TN-1 AD p. Ala54 Hetero- F 3 10 + +/ IV: 8 Thr zygous MSPC-TN-1 AD p. Ala54 Hetero- M 7 10 + + + IV: 9 Thr zygous MSPC-TN-1 AD p. Ala54 Hetero- M 3 15 + + IV: 11 Thr zygous MSPC-TN-1 AD p. Ala54 Hetero- F 1 15 + + + IV: 12 Thr zygous MSPC-TN-1 AD p. Ala54 Hetero- M 5 15 + + + IV: 13 Thr zygous (bi- lateral) MSPC-TN-1 AD p. Ala54 Hetero- M 5 10 + + + IV: 14 Thr zygous MSPC-TN-1 AD p. Ala54 Hetero- M 5 10 + + + IV: 15 Thr zygous MSPC-TN-1 AD p. Ala54 Hetero- M 5 15 + + + IV: 16 Thr zygous MSPC-TN-1 AD p. Ala54 Hetero- M 4 10 + + + IV: 20 Thr zygous MSPC-TN-1 AD p. Ala54 Hetero- M 15 10 + + + V: 4 Thr zygous MSPC-FR-1 AD p.Met Hetero- F 10 20 + + + Cornea II: 2 77Thr zygous MSPC-FR-1 AD p.Met Hetero- M 2 15 + + + Cornea III: 2 77Thr zygous Larynx MSPC-RO-1 AD p.Ala Hetero- M 4 >15 + + I: 1 66Val zygous MSPC-RO-1 AD p.Ala Hetero- M 7 15 + + II: 1 66Val zygous MSPC-RO-1 AD p.Ala Hetero- M 5 15 + + II: 2 66Val zygous MSPC-RO-1 AD p. Ala Hetero- F 4 10 + + lower II: 5 66Val zygous lip MSPC-RO-1 AD p.Ala Hetero- M 18 III: 2 66Val zygous MSPC-RO1- AD p.Ala Hetero- M 5 15 + + lower III: 3 66Val zygous lip, right forearm MSPC-RO1- AD p.Ala Hetero- F IV: 1 66Val zygous NEKAM-EG-1 p. F787_R84 Hetero- M III-5 3del zygous NEKAM-EG-1 p. F787_R84 Hetero- F IV: 1 3del zygous NEKAM-EG-1 p. F787_R84 Homo- F 8 m Not + + + Middle ear V: 3 3del zygous assessed (choles- teatoma), conjunctiva NEKAM-EG-1 p. F787_R84 Homo- M 10 m V: 5 (deceased) 3del zygous NEKAK-EG 1: Patient M III: 4 DNA not (deceased) available Other symptoms Hyper- Subungual Pedigree keratosis lesions/Nail Secondary Evolution Number pilaris thickening Others tumours Period Treatment MSPC-TN-1 Head Months Surgery/ III: 10 and neck to years Acitretin MSPC-TN-1 + Lung Weeks to Acitretin III: 11 months MSPC-TN-1 Weeks III: 15 MSPC-TN-1 Lip SCC. Month to Surgery/ IV: 2 Bilateral years Acitretin heel SCC MSPC-TN-1 + Nose Months Surgery/ IV: 5 to years Acitretin MSPC-TN-1 Months IV: 8 MSPC-TN-1 Weeks Acitretin IV: 9 MSPC-TN-1 Weeks Acitretin IV: 11 MSPC-TN-1 Weeks Surgery/ IV: 12 Acitretin MSPC-TN-1 + Weeks Acitretin IV: 13 MSPC-TN-1 Months Acitretin IV: 14 to years MSPC-TN-1 Weeks to Acitretin IV: 15 years MSPC-TN-1 Weeks Acitretin IV: 16 MSPC-TN-1 + + Years Surgery/ IV: 20 Acitretin MSPC-TN-1 Months Acitretin V: 4 MSPC-FR-1 + Maxillary Years Acitretin II: 2 decalcifi- cation, alveolysis and tooth loss, loss of conscious- ness associated with local anesthetic MSPC-FR-1 + + Bone Years Acitretin III: 2 Decalcifi- (stopped cation, because alveolysis Acitretin- and tooth associated loss dry eye syndrome has caused kerato- prosthesis expulsion) MSPC-RO-1 Months Surgery I: 1 to years MSPC-RO-1 Months Surgery II: 1 to years MSPC-RO-1 Weeks to Surgery II: 2 years MSPC-RO-1 Months Surgery II: 5 to years MSPC-RO-1 palmar III: 2 hyperkera- tosis MSPC-RO1- Weeks to Surgery III: 3 years MSPC-RO1- Eczema IV:1 NEKAM-EG-1 + keratosis III-5 pilaris on the trunk and on soles. NEKAM-EG-1 macular IV: 1 amyloidosis NEKAM-EG-1 + + corneal Conjuncttival Months Acitretin, V: 3 ulcers & squamous surgery for vascularisation, cell carcinoma eye and corneal ear lesions limbal stem cell deficiency, choles- teatoma NEKAM-EG-1 + lichenoid V: 5 papules and (deceased) plaques on arms, legs and the trunk NEKAK-EG 1: + keratosis III: 4 pilaris (deceased)
TABLE-US-00003 TABLE 2 NLRP1 exonic variants for MSPC-RO-1 III:3 NLRP1 exonic variants of MSPC-RO-1 proband III:3 Amino Acid ExAC Allele NLRP1 exon Nucleotide Variant Change Frequency 1 17: 5481087 T/C A66V 0 2 None None 3 17: 5485367 A/T L155H 0.3749 (rs12150220) homozygous 4 17: 5462654 G/A None 0.04865 (rs2001363) 17: 5461847 G/A None 0.05036 (rs61753136) 17: 5461671 G/C T782S 0.05253 (rs52795654) 5 None None 6 17: 5445243 G/A T878M 0.044 (rs11657747) 7 None None 8 17: 5440248 T/C None 0.04298 (rs11657249) 17: 5440221 T/C None 0.04278 (rs7215868) 17: 5440197 T/C None 0.07946 (rs7215856) 9 17: 5437285 G/A T995I 0.04762 (rs34733791) 10 None None 11 17: 5436263 C/T V1059M 0.3248 (rs2301582) 12 17: 5433841 A/G None 0.04797 (rs56872041) 13 17: 5425077 T/C M1184V 0.4549 (rs11651270) homozygous 17: 5424991 G/A None 0.04849 (rs11653580) 17: 5424906 C/G V1241L 0.04863 (rs11653832) 14 None None 15 None None 16 None None 17 None None * Positions are in reference to GRCh37/hg19
TABLE-US-00004 TABLE 3 Sanger sequencing results for TGFBR1 exons for MSPC-RO-1 patients II:5 Affected, TGFBR1 III:3 Affected, NLRP1 Unrelated control, exon NLRP1 A66V/+ A66V/+ Unaffected, NLRP1 +/+ 1 WT* WT WT 2 WT WT WT 3 WT WT WT 4 WT WT WT 5 WT WT WT 6 WT WT WT 7 WT WT c.1255 + 24G > A 8 WT WT c.1386 + 94_1386 + 90delTCTTT 9 WT WT c.*69A > G *Sequence verified using TA-cloning. One out of four clones harboured an in-frame deletion in the polymorphic alanine repeat from A18 to A26, resulting in the removal of 1 alanine.
TABLE-US-00005 TABLE4 GenotypingandRT-PCRprimers Related Primerpair Sequence Figure/Table FKLC-EG-1Genotyping AGACCCTCTTGTTATCCTGGGAA; FIG.10B primerpair GTGTCTTTTATCACTCCTCCTCACTG. RT-PCRprimersforNLRP1 ACAGACATGGAGCTCTTAGTGT; FIG.10B exon5cDNA GGGTCTGGTTGGCTCTCAG RT-PCRprimersforNLRP1 CCGCCTGGCCTGTTACTT; FIG.3D,FIG. CCTGGCTTGGAGACTCATGG 10D,10F RT-PCRprimersforNLRP3 CATGCTGCCTGTTCTCATGG; FIG.3D,FIG. CCCCAACCACAATCTCCGAATG 10D,10F RT-PCRprimersforMEFV CGCCCTGGAACACAAGAAGA; FIG.3D,FIG. GCTGCTCCTCCCCTGATTTT 10D,10F RT-PCRprimersforAIM2 AACTTTGGGATCAGCCTCCTG; FIG.3D,FIG. TGAAGCCGTCCAGAAGTGTC 10D,10F RT-PCRprimersfor AAAAGACTTTGTCCATTCAAGTCCT; FIG.3D,FIG. NLRC4 CCCTGCTGACTGAGAGAAC 10D,10F RT-PCRprimersforCASP1 CTGCCTGAGGAGCTGGAAAG; FIG.3D,FIG. CAGTTACCTGGCAGGGACG 10D,10F RT-PCRprimersforASC TCTACCTGGAGACCTACGGC; FIG.3D,FIG. TCCAGAGCCCTGGTGC 10D,10F RT-PCRprimersforIL1B TGGAAGGAGCACTTCATCTGT; FIG.3D,FIG. TCTTCAGCCAATCTTCATTGCTC 10D,10F RT-PCRprimersforIL18 ATCGCTTCCTCTCGCAACAA; FIG.3D,FIG. GTCCGGGGTGCATTATCTCT 10D,10F RT-PCRprimersfor CGACAGTCAGCCGCATCTT; FIG.3D,FIG. GAPDH CCCCATGGTGTCTGAGCG 10D,10F RT-PCRprimersKRT14 CCTCCTCCCAGTTCTCCTCT; FIG.3D,FIG. ATGACCTTGGTGCGGATTT 10D,10F Primerpairtoamplify CGGCGGCGGGGAGGCGG; Table3 TGFBR1Exon-1 CAGGAGCGAGCCAGAGGCC Primerpairtoamplify TGCTACATTTCCITGGGCTTCC; Table3 TGFBR1Exon-2 GTCACTTCTTGCCTCTAAACGG Primerpairtoamplify CCTAGTGGGAGAAGACTGATT; Table3 TGFBR1Exon-3 TCACATTCTAGCAAGTTGGCT Primerpairtoamplify CCCCAGTGAGATAAATTCC; Table3 TGFBR1Exon-4 TGCTATCAAGAGTCAAGAAAA Primerpairtoamplify GGGGCTTACTCTGAGGAACTA; Table3 TGFBR1Exon-5 GGTAGAGATGCGGTTTTGTCA Primerpairtoamplify GTGGGCTGAAATGCTTTGATA; Table3 TGFBR1Exon-6 CTTCTTACCTGTTGGCAATCT Primerpairtoamplify GGCAGTAAGGGGATGATTTTC; Table3 TGFBR1Exon-7 TTTGTTTTCTCTGGCACTCGG Primerpairtoamplify TATCAACTCAGGGAAGTGGCT; Table3 TGFBR1Exon-8 GCCCTTTCAATGTGCTTACAA Primerpairtoamplify CACCAGTACCCTATTGATGG; Table3 TGFBR1Exon-9 CTAACCAGGAGTAAATCACTT PrimerpairforNLRP1 GACAGCACTGTTCTCTGCCT; Table2 exon1 CAGGGAGGGCTCAGTGGT PrimerpairforNLRP1 TGAGAGAGGAGACCAGCTCAG; Table2 Exon2-3 GGGGGAATGAAAAGAAAAAT PrimerpairforNLRP1 GCCCCTCTACTTCAACATGG; Table2 Exon3 AAACAGTGCCTTGGACCAGT PrimerpairforNLRP1 TCCCTCCCTTACTTAGAAATCAGA; Table2 Exon4Fragment1 AGCCCCCTGCAGTATGACTA PrimerpairforNLRP1 CAAAGACCTCACCCCAGAAG; Table2 Exon4Fragment2 TGTGGTGGTCTTGGAAGTCA PrimerpairforNLRP1 GCCTTTAGGTTGGTCAAATCA; Table2 Exon4Fragment3 GTGGCGGCTGAATTTAATG PrimerpairforNLRP1 CTGGAGTCCCTCCACTGCT; Table2 Exon4Fragment4 TAGGAGGAGAGGTGGCAGAC PrimerpairforNLRP1 GGACAAAGCCCAACTGTGTT; Table2 Exon5 CAGCTTCTGCCTTGGATCTC PrimerpairforNLRP1 CCCCAAGTACCATGTGCATT; Table2 Exon6 GAGCTTCCTCCTGAGCCTCT PrimerpairforNLRP1 GTAGGTGCTGGCATCCTGAG; Table2 Exon7 CCAGAGAATTCAGCGACTTG PrimerpairforNLRP1 ATTGGAGACTGCCTCACAGC; Table2 Exon8Fragment1 GCTGTGGTGTCTGGGTTTCT PrimerpairforNLRP1 TGTACCCTCCTCCTCAGAGC; Table2 Exon8Fragment2 TTCTCATGCCTCAGCCTCTT PrimerpairforNLRP1 AGAGATGAGGTGGGGAGGTC; Table2 Exon9 TAACGGAAATCCAGCCAGTT PrimerpairforNLRP1 GCAGCCTAAACCTTCTGAGC; Table2 Exon10Fragment1 AGGGAGTGTGTCTGCAGCTT PrimerpairforNLRP1 GCTCACTGCAGCCTAAACCT; Table2 Exon10Fragment2 AAGCTGCAGACACACTCCCT PrimerpairforNLRP1 CGCCTCCTGAGTAGAACTGG; Table2 Exon10Fragment3 GTGGGCAGGTTGAGAGAGAA PrimerpairforNLRP1 CCGCCTCCTGAGTAGAACTG; Table2 Exon10Fragment4 TGGGCAGGTTGAGAGAGAAC PrimerpairforNLRP1 GAGCAGAAGCTGCAGACACA; Table2 Exon11 TGAAAAGCAGACACCCAGTG PrimerpairforNLRP1 AGGGATCCACAGTCAAGAGC; Table2 Exon12 GAGGCTGGGAGATGTGTTTC PrimerpairforNLRP1 GAGCCGAGATTGTACCATTG; Table2 Exon13 GACGAATTGTTTGCCCACTT PrimerpairforNLRP1 CGGGCTGTCTCTGTAGCAGT; Table2 Exon14 TCCCTCCTCCGAACTFTCTT PrimerpairforNLRP1 CCCTGACTTACCCGTGAGGT; Table2 Exon15 CTCCTGACCTTGTGATCTGC PrimerpairforNLRP1 GCATAAGGAAGGGATTCACC; Table2 Exon16 GATAGGACAAGGGGGTATGG PrimerpairforNLRP1 GACACAGGTGCATTTCTGGA; Table2 Exon17 TTAGTGCTGGAAGGCAAACC
TABLE-US-00006 TABLE 5 Key resources table REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-GFP antibody Abeam RRID: AB_303395, Cat#: ab290 Rabbit polyclonal anti-HA tag antibody Santa Cruz Biotechnology RRID: AB_631618, Cat#: se-805 Mouse monoclonal anti-V5 tag antibody Abeam RRID: AB_471093, Cat#: ab27671 Rabbit polyclonal anti-NLRP1 antibody Adipogen RRID: AB_2490439, Cat#: AL176 Sheep polyclonal anti-NLRP1 antibody R&D Systems RRID: AB_10891678, Cat#: AF6788 Rabbit polyclonal anti-ASC antibody Adipogen RRID: AB_2490440, Cat#: AG-258-0006 Rabbit polyclonal anti-1067 Abeam RRID: AB_443209, Cat#: ab15580 Mouse monoclonal anti-keratin 10 Leica Clone DE-K10 Mouse monoclonal anti-GAPDH antibody Santa Cruz Biotechnology RRID: AB_627679, Cat#: se-32233 Mouse monoclonal anti-involucrin antibody Abeam, ab68 RRID: AB_305856. Mouse anti-100A7 antibody Dako Cat #: M074701, Clone MAO387 Rabbit polyclonal anti-S100A9/6 antibody Novus Biologicals RRID: AB_2184110, Cat #: BAG-6007A Chemicals, Peptides, and Recombinant Proteins Caspase-1/iCE inhibitor 2-WEHD-FMK R&D systems RMK002 Doxycycline Sigma-Aldrich Cat#: D9891, CAS # 24391-14-5 Nigericia Sigma-Aldrich Cat#: N7143, CAS # 28643-80-3 Recombinant human IL-1 R&D Systems 201-LB-025 Recombinant human IL-1 R&D Systems 200-LA-002 Recombinant human IL-1 R&D Systems 9124-IL-010 Critical Commercial Assays Human IL-1 ELISA quantkine ELISA kit R&D Systems DLB50 Human IL-1 ELISA Duoset ELISA kit R&D Systems Dy201 Human IL-1 ELISA kit MBL International 7620 RNAScope 2.5 Brown kit Advanced Cell Diagnostics 322370 Noved Native-PAGE-Bio-Tris gel system ThermoFisher BN2008, BN2007, BN1004BOX FirstChoice Human Total RNA Survey Panel Applied Biosystems/Ambion AM6000 TruSeq Exome Enrichment IGt (used for whole Ilumina FC-150-1001 exome sequencing for MSPC-TN-1) Illumina HiSeq 2500 (used for whole exome Illumina HiSeq2500 sequencing for MSPC-TN-1) Script cDNA synthesis kit Bierad 1708891 Dako Envision rabbit-HRP kit Dako KA01111 Lent-X concentrator Clontech 831232 Fugene-HD Promega E2312 Fugene-HD Promega E2312 Lipofectamine RNAiMax ThermoFisher 13778030 QuickChange II site-directed Mutagenesis Agilent 200522 InFusion HD Cloning Kit Takara/Clontech 638910 Human cytokine/chemokine panel I HCYTMAG-60K-PX41 Merck Millipore Illumina TruSeq stranded mRNA kit Illumina RS-122-2101 Oragene DNA collection kit DNAGenotek OG500 ExoSAP-IT Affymetrix 78201 BigDye Terminator v3.1 Cycle Sequencing Kit Applied Biosystems 4337454 Auricon Ultra 0.5 ml liter (MYYCO = 30 Kda) Merck Millipore UFP503024 Deposited Data PolyA RNA-seq This paper GEO: GSE86791 Experimental Models: Cel Lines HEK293T Lab stock RRID: CVCL_0063 Primary neonatal human keratinocytes CELLnTEC Cat#: HPEKp N/TERT-1 Immortalized human keratinocytes Rheinwald lab N/A 3T3 mouse fibroblasts Lab stock N/A THP-1 ATCC RRID: CVCL_0006 THP1-Cas9 Baker et al., 2015: S. Masters' lab N/A THP1-Cas9 ASC/ Baker et al., 2015: S. Masters' lab N/A Recombinant DNA pCI-Caspase 1 Addgene #41552 pCDH-ASC-GFP This paper N/A pCS2-NLRP1-HA wild type, missence, This paper N/A and deletion mutants pTRIPZ-NLRP1-HA, wild type, A55T, This paper N/A M77T and A66V pCS2-NLRP1-PVD-mCherry wild type, This paper N/A A55T, M77T and A66V pCS2-NLRP3 This paper N/A pCS2-NLRP3-PYD-mCherry This paper N/A pCS2-AIM2-PYD-mCherry This paper N/A pET20-GB1-NLRP1-PYD Hiller et al., 2003 N/A pET20-GB1-NLRP1-PYD(A54T) This paper N/A pET20-GB1-NLRP1-PYD(S55L) This paper N/A pET20-GB1-NLRP1-PYD(E63K) This paper N/A pET20-GB1-NLRP1-PYD(Q64K) This paper N/A pET20-GB1-NLRP1-PYD(A66V) This paper N/A pET20-GB1-NLRP1-PYD(M77T) This paper N/A pET20-NLRP1-CARD This paper N/A Sequence-Based Reagents. Human PYCARD siGENOME siRNA ThermoFisher M-004378-01-0005 Primers used in the study, see Table S4 This paper N/A Software and Algorithms Picard (v1.42) https://broadinstitutegillab.io/picard/ N/A Novoalign (v2.07) http://www.novacalt.com/products/novoalign N/A GATK (Genome Analysis Toolk1) (v1-1) https://software.broadinstitute.org/gatk/ N/A OutLink http://cole-tapnell-labgillab.io/outlinks/ N/A RVIS http://genic-intolerance/org/ N/A BADTools http://laurchpad.net/abiomo/+source/badtools/ N/A ANNOVAR http://annovar.openbioinformation.org/en/latest/ N/A SAMtools http://samtools.source.forge.net/ N/A ITOL interactive Tree of Life http://itol.embl.de N/A Muscle http://www.eblac.uk/Tools/msa/muscle/ N/A ClustsW2 phylogeny http://www.eblac.uk/Tools/phylogeny/ N/A clustaW2_phylogeny/ Multiple Experiment Viewer http://www.im4.org N/A