METHOD FOR HIGHLY SENSITIVE DNA METHYLATION ANALYSIS
20200032330 ยท 2020-01-30
Inventors
- Chuan He (Chicago, IL)
- Boxuan Simen ZHAO (Chicago, IL, US)
- Pradnya NARKHEDE (Chicago, IL, US)
- Chang LIU (Chicago, IL, US)
- Xiaolong CUI (Chicago, IL, US)
Cpc classification
C12Q2537/164
CHEMISTRY; METALLURGY
C12Q2537/164
CHEMISTRY; METALLURGY
C12P19/34
CHEMISTRY; METALLURGY
C12Y207/07007
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q2537/159
CHEMISTRY; METALLURGY
C12Q2537/159
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
Abstract
Methods, compositions and kits are provided to amplify the amount of genomic methylated DNA can by subsequently analyzed and/or sequenced. It has particular use with small amounts of DNA, including, but not limited to cell free DNA samples. In some embodiments, the ratio of polymerase and methyltransferase is controlled in order to provide maximum yields. In some embodiments, a dual primase/polymerase is used.
Claims
1. A method for amplifying targeted methylated genomic DNA comprising: a) denaturing targeted methylated genomic DNA; b) incubating the targeted methylated genomic DNA with a polymerase and methyltransferase under conditions to reproduce the targeted methylated genomic DNA and create amplified genomic methylated DNA molecules; and, c) isolating the amplified genomic methylated DNA molecules.
2. (canceled)
3. The method of claim 1, wherein the ratio of polymerase units to methyltransferase units is about 1:15 units.
4. The method of claim 1, wherein the amount of targeted genomic methylated DNA that is incubated with the polymerase and methyltransferase is between about 5 picograms (pg) to about 1 microgram (g).
5. The method of claim 1, wherein the targeted genomic methylated DNA is obtained from a tissue sample, a serum sample, a blood sample, a fecal sample, a urine sample, or a cheek or mouth swab.
6. The method of claim 1, wherein denaturing involves alkaline denaturation.
7. The method of claim 1, wherein the polymerase is a strand displacement polymerase.
8-9. (canceled)
10. The method of claim 1, wherein the methyltransferase is DNMT1.
11. The method of claim 1, wherein step b) further includes incubating the targeted methylated genomic DNA with an enzyme comprising a primase and a polymerase dual activity to synthesize primers during the conditions to reproduce the targeted methylated genomic DNA and create amplified genomic methylated DNA molecules.
12. (canceled)
13. The method of any of claim 1, further comprising preparing a separate master mix and an enzyme mix comprising the polymerase and methyltransferase prior to incubating in step b).
14. The method of claim 13, wherein the master mix includes an enzyme with a primase and a polymerase dual activity, dNTPs, buffer, and magnesium.
15-22. (canceled)
16. The method of claim 13, wherein the enzyme mix further comprises a methyl cofactor.
17. The method of claim 16, wherein the methyl cofactor is S-adenosyl methionine (SAM).
18-23. (canceled)
23. The method of claim 1, further comprising one or more of treating the isolated reproduced methylated DNA molecules with bisulfate, sequencing the reproduced targeted methylated DNA molecules, and detecting or identifying 5-methylcytosine in the isolated reproduced methylated DNA molecules.
24-27. (canceled)
28. The method of claim 1, further comprising denaturing the amplified genomic methylated DNA molecules.
29. (canceled)
30. The method of claim 28, further comprising enriching for denatured amplified genomic methylated DNA molecules.
31. The method of claim 30, wherein enriching for denatured amplified genomic methylated DNA molecules involves a 5mC antibody or a methyl-CpG binding protein.
32. The method of claim 28, further comprising analyzing the enriched denatured amplified genomic methylated DNA molecules.
33. The method of claim 28, wherein the method further comprises analyzing the enriched denatured amplified genomic methylated DNA molecules by quantitative PCR, sequencing, or an array-based analysis.
34. The method of claim 1, further comprising one or more of a) amplifying and/or sequencing one or more target genomic regions using at least one pair of primers specific to the target genomic regions; b) comprising preparing a library from the amplified genomic methylated DNA molecules; c) lysing one or more cells from a biological sample from a patient and d) extracting DNA from a biological sample from a patient.
35-43. (canceled)
44. A method of analyzing methylated cell-free DNA from a cell-free biological sample from a patient comprising: a) denaturing methylated cell-free DNA (cfDNA) from the cell-free biological sample; b) incubating the methylated cfDNA with a polymerase and methyltransferase under conditions to reproduce the methylated cfDNA and create amplified genomic methylated DNA molecules, wherein the polymerase and methyltransferase are present at a ratio between about 1:5 units to about 1:20 units; and, c) isolating the amplified genomic methylated DNA molecules.
45-48. (canceled)
49. A kit comprising, in suitable container(s), strand displacement polymerase, DNMT1, S-adenosine methionine, dNTPs, random primers, and one or more nucleic acid buffers.
50-53. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0062] The present disclosure relates to the methods and kits for manipulating, producing, creating, amplifying purifying, isolating, analyzing, assaying, measuring, sequencing, and evaluating methylation of nucleic acids, particularly genomic DNA. What is provided is a way to amplify DNA from very limited biological samples (e.g. from small number of cells, body fluids, or biopsy samples) with DNA methylation (5-methylcytosine, 5mC) information faithfully copied from the starting material. A step for processing the DNA into unstructured form from various biological samples while being compatible with subsequent enzymatic reactions; a step for amplifying the template DNA molecules while copying the 5mC patterns of template into the product DNA molecules; a step of purifying the enzymatic reaction and prepare the amplified products for downstream applications. An enzymatic reaction system comprising of salts, S-adenosyl-methionine (SAM), deoxynucleotide triphosphates (dNTPs), random primers, and a mixture of a DNA polymerase with strand displacement activity and a DNA methylation-maintenance enzyme at an exact ratio.
[0063] It is generally desirable to be able sensitively, specifically, qualitatively and/or quantitatively to detect methylated DNA, and in particular genomic DNA, in a sample, including for example in fixed or fresh cells or tissues or in a cell free biological sample. It may be particularly desirable to detect, sequence, or evaluate methylated DNA in a single cell. For example, in population-based assays that analyze the content of many cells, molecules in rare cells may escape detection due to the low abundance of material to evaluate. This is similarly true for cell-free biological samples.
[0064] The sample may, for example, be derived from a tissue or organ of the body, or from a bodily fluid. Such a sample will advantageously be or comprise a cell or group of cells such as a tissue. The sample may, for example, be a colon, lung, pancreas, prostate, skin, thyroid, liver, ovary, endometrium, kidney, brain, testis, lymphatic fluid, blood, plasma, urinary bladder, or breast sample, or comprise colon, lung, pancreas, prostate, skin, thyroid, liver, ovary, endometrium, kidney, brain, testis, lymphatic fluid, blood, urinary bladder, or breast cells, groups of cells or tissue portions. Samples may be cultured or harvested or biopsied cell or tissue samples, e.g. as mentioned above, in which the methylated genomic DNA may be detected to reveal the qualitative or quantitative nature of the methylation that it is present, or the nucleotide sequence of methylated nucleic acids at one or more specific genes, regions, CpG islands and the like. The sample of cells may be freshly prepared or may be prior-treated in any convenient way such as by fixation or freezing. Accordingly, fresh, frozen or fixed cells or tissues may be used, e.g. FFPE tissue (Formalin Fixed Paraffin Embedded). Thus, tissue sections, treated or untreated, may be used.
[0065] A CpG island as used herein refers to regions of DNA with a high G/C content and a high frequency of CpG dinucleotides relative to the whole genome of an organism of interest. Also used interchangeably in the art is the term CG island. The p in CpG island refers to the phosphodiester bond between the cytosine and guanine nucleotides.
[0066] DNA may be isolated from an organism of interest, including, but not limited to eukaryotic organisms and prokaryotic organisms, preferably mammalian organisms, such as humans.
[0067] DNA methyltransferases (MTases) that transfer a methyl group from S-adenosylmethionine to either adenine or cytosine residues, are found in a wide variety of prokaryotes and eukaryotes.
[0068] In certain aspects, the step of enriching a sample for sequences comprising CpG islands can be done in different ways. One technique for enrichment is immunoprecipitation of methylated DNA using a methyl-Cytosine specific antibody (Weber et al., 2005). Alternatively, an enrichment step can comprise digesting the sample with a one or more restriction enzymes which more frequently cut regions of DNA comprising no CpG islands and less frequently cut regions comprising The terms target, target sequence, target region, and target nucleic acid, target DNA etc. are used synonymously herein and refer to the nucleic acid, or to a region or sequence thereof, which is to be detected or to which a reagent used in the method binds, for example the methylated DNA to be detected, or more particularly the regions thereof, to which a probe is hybridized or primers hybridize or amplify. Thus a target sequence may be within a gene or outside a gene or in a coding region or a noncoding region. As discussed above, the methylation may be genomic DNA that includes one or more CpG islands. In some embodiments, multiple CpG islands are targeted.
[0069] The term hybridization, as used herein, refers to the formation of a duplex structure by two single-stranded nucleic acids due to complementary base pairing. Hybridization can occur between fully complementary nucleic acid strands or between substantially complementary nucleic acid strands that contain minor regions of mismatch. Conditions under which hybridization of fully complementary nucleic acid strands is strongly preferred are referred to as stringent hybridization conditions or sequence-specific hybridization conditions. Stable duplexes of substantially complementary sequences can be achieved under less stringent hybridization conditions; the degree of mismatch tolerated can be controlled by suitable adjustment of the hybridization conditions. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length and base pair composition of the oligonucleotides, ionic strength, and incidence of mismatched base pairs, following the guidance provided by the art (see, e.g., Sambrook et al., 1989.; Wetmur, 1991; and Owczarzy et al., 2008, which are incorporated herein by reference). Thus the design of appropriate primers and probes, and the conditions under which they hybridize to their respective targets is well within the routine skill of the person skilled in the art.
[0070] Methods involve a polymerase that replicates methylated genomic DNA. Strand displacement polymerase are used in some embodiments. DNA polymerase such phi29 (29) polymerase, Klenow fragment, Bacillus stearothermophilus DNA polymerase (BST), T4 DNA polymerase, T7 DNA polymerase, or DNA polymerase I may be used.
[0071] In certain aspects, methods also involve incorporation of a primase with potent activity in the amplification step to synthesize DNA primers, such as for example a primase/polymerase from Thermus thermophilus (Tth) PrimPol, so as to lower the bias introduced during priming step and enable near-complete whole genome amplification.
[0072] In some embodiments, methods involve amplifying and/or sequencing one or more target genomic regions using at least one pair of primers specific to the target genomic regions. In certain embodiments, the primers are heptamers. In other embodiments, enzymes are added such as primases or primase/polymerase combination enzyme to the amplification step to synthesize primers.
[0073] An example of an enzyme with dual activity is an enzyme with primase and polymerase function (primpol) is obtained from the thermophilic bacteria Thermus thermophilus. The enzyme combines two distinct and complementary activities in a single thermo-stable protein: primase and polymerase. The enzme creates its own primer sequence.
[0074] PrimPol from T. thermophilus shows a great tolerance to damaged DNA. DNA is subject to chemical modifications within the cells. PrimPol has the ability to introduce a variety of substrate nucleotides (e.g. fluorescent nucleotides) into DNA and RNA template molecule. PrimPol has a role in multiple displacement amplification (MDA) reactions, generating primers for its subsequent use by Phi29 DNA polymerase, thus making unnecessary the use of random synthetic primers and possibly resulting in a more uniform amplification of DNA.
[0075] Primases are enzymes known in the art, such as for example bacterial T7 primase. T7 is used to amplify genomic DNA. However, it is has been used with a method involving low throughput sequencing and qPCR, and with a starting material of at least 1 ng gDNA. This is much larger volume than what is taught in the current disclosure.
[0076] Rolling circle amplification is known in the art. Upon the hybridization of the terminal regions of a padlock probe to a complementary cDNA sequence, the padlock probe is circularized by ligation. The circularization of the padlock probe(s) may be carried out by ligating, directly or indirectly, the ends of said padlock probe(s). Procedures, reagents and conditions for this are well known and described in the art and may be selected according to choice. In specific embodiments, the in the circularization of the padlock probe(s) step, the terminal regions of the padlock probe may hybridize to non-contiguous regions of the cDNA such that there is a gap between said terminal regions.
[0077] The term library refers to a collection (e.g., to a plurality) of vehicles that comprise the amplified genomic methylated DNA molecules. The vehicle may be a vector, construct, array, or other physical vehicle. A vector or construct (sometimes referred to as gene delivery or gene transfer vehicle) refers to a macromolecule, complex of molecules, or viral particle, comprising a polynucleotide to be delivered to a host cell, either in vitro or in vivo. The polynucleotide can be a linear or a circular molecule. One of skill in the art would be well equipped to construct a vector through standard recombinant techniques (see, for example, Maniatis et al., 1988 and Ausubel et al., 1994, both incorporated herein by reference). An array comprises a solid support with nucleic acid probes attached to the support. Arrays typically comprise a plurality of different nucleic acid probes that are coupled to a surface of a substrate in different, known locations. These arrays, also described as microarrays or colloquially chips have been generally described in the art, for example, U.S. Pat. Nos. 5,143,854, 5,445,934, 5,744,305, 5,677,195, 6,040,193, 5,424,186 and Fodor et al., 1991), each of which is incorporated by reference in its entirety for all purposes. Techniques for the synthesis of these arrays using mechanical synthesis methods are described in, e.g., U.S. Pat. No. 5,384,261, incorporated herein by reference in its entirety for all purposes. Although a planar array surface is used in certain aspects, the array may be fabricated on a surface of virtually any shape or even a multiplicity of surfaces. Arrays may be nucleic acids on beads, gels, polymeric surfaces, fibers such as fiber optics, glass or any other appropriate substrate, see U.S. Pat. Nos. 5,770,358, 5,789,162, 5,708,153, 6,040,193 and 5,800,992, which are hereby incorporated in their entirety for all purposes.
Example 1
Reaction Set-up
[0078] This invention is directed to a method of amplifying the target DNA molecules with retained 5mC information comprising: [0079] (a) a step of denaturing the target DNA molecule to remove secondary structures, [0080] (b) a whole genome amplification step coupled with DNA methyltransferase adding 5mC to the semi-methylated products while they are being produced, [0081] (c) a step of purifying the product to extract the amplified DNA with 5mC information faithfully copied from the starting material.
[0082] The design of the workflow is shown in
[0084] First prepare buffers: Prepare Buffer D1 by adding 16 ul water to 4.5 ul Buffer DLB and Buffer N1 by adding 42.5 ul water to 7.5 ul Stop Solution.
[0085] Then dilute genomic brain DNA to a concentration of 200 pg/ul. Add 9 ul water to 1 ul diluted genomic DNA (200 pg). Add 10 ul Buffer D1 to genomic DNA, vortex and briefly centrifuge the mixture, and incubate at room temperature for 3 minutes.
[0086] Add 20 ul Buffer N1 to the denatured genomic DNA, then vortex and briefly centrifuge the mixture.
[0087] The final DNA concentration of the solution is 5 pg/ul. For each 5-pg input reaction, add 5 ul random heptamer primer stock (for example, from ThermoFisher) to 1 ul denatured gDNA and place on ice. [0088] (b) Whole genome amplification step coupled with DNA methyltransferase, for example use Phi29 as polymerase and human DNMT1 as methyltransferase, both from NEB.
[0089] First prepare a WGA master mix on ice based on the following single-reaction volumes: 5 ul 10Dnmt1 Buffer, 1.67 ul 10 mM dNTPs, 0.5 ul 100BSA, 0.5 ul 1 M MgCl2, 0.5 ul 1 M (NH4)2SO4, 17.83 ul water, totaling 26.00 ul.
[0090] Then aliquot the master mix into the appropriate number of reactions, and add 6 ul genomic DNA/primer mix to each.
[0091] Next prepare WGA enzyme mix on ice based on the following single-reaction volumes: 15 ul DNMT1 [30 units]; 1.0 ul 32 mM SAM; 2 ul of 10Phi29 dilution [2 units]. Note that do not combine the enzyme mix with the above master mix yet, as Phi29 polymerase is maximally active at a lower temperature than Dnmt1 and reaction coupling may be lost.
[0092] Finally finish the setup of the 5mC-WGA reaction by first equilibrate enzyme-less reaction mixes and enzyme mixes at 37 C. for 5 minutes, then add reaction mixes to corresponding enzyme mixes. Incubate reactions at 37 C. for 10 hours, adding 0.5 ul 32 mM fresh SAM to each reaction after 5 hours. Then heat-inactivate DNMT1 and Phi29 polymerase for 20 minutes at 65 C., and hold reactions at 4 C. after completion. [0093] (c) Purification of the product. Using magnetic beads-based protocol is preferred than column-based method, as the size of the product is larger than 10 kb. For example, using Ampure XP beads from Beckman. Adding beads with the reaction with 1:1 ratio in volume, mix well and incubate at room temperature for 15 minutes, wash with 200 ul of 80% ethanol for two times without disturbing the beads, dry the beads at room temperature for 5 minutes, then elute with 20 ul nuclease-free water. The purified products are now ready to be used in the downstream applications. The present invention will be next more specifically described by way of Examples, which will not be construed as limiting the invention. [0094] (d) IF the system includes primases. With alkaline denaturation and the purification remain the same, the workflow is only modified during the amplification step with the addition of the primase. For example, with TruePrime WGA kit, prepare a 20 ul reaction with 1.0 ul denatured DNA; 1.0 ul 10 mM dNTPs; 2.0 ul Reaction Buffer provided; 0.5 ul 32 mM SAM; DNMT1 [20units]; 0.3 ul 10 Enzyme 2 dilution and 1.0 ul 20 Enzyme 2 dilution, replenishing with water. Incubate reactions at 37 C. for 5 hours, followed by heat-inactivate DNMT1 and Phi29 polymerase for 20 minutes at 65 C., and hold reactions at 4 C. after completion. [0095] (1) Bisulfite treatment and Sanger sequencing to detect 5mC patterns of differentially methylated genes after 5mC-WGA amplification of pico grams of human gDNA.
[0096] In this example, the efficiency and accuracy of genomic 5mC amplification by 5mC-WGA are evaluated.
Example 2
Bisulfite Treatment of 5mC-WGA Product
[0097] Bisulfite treatment is carried out with commercial kits, for example using EZ DNA Methylation-Direct Kit from Zymo. 20 ul of 5mC-WGA product is mixed with freshly prepared CT Conversion Reagent solution in a PCR tube, boiled at 98 C. for 8 minutes, followed by incubation at 64 C. for 3.5 hours, then returned to 4 C. The reaction is then purified using the standard column provided in the kit. Note that at this step the products can be quantified using Qubit ssDNA kit (ThermoFisher). For input <50 pg the typical amplification can be over 1,000 fold.
Example 3
Detect 5mC Patterns of Differentially Methylated Genes by Sanger Sequencing
[0098] The purified bisulfite converted product is further subjected to PCR amplification of specific genomic regions using hot start DNA polymerase, for example ZymoTaq DNA Polymerase from Zymo. Example genomic regions, their methylation patterns and bisulfite-specific primer designs are shown in
TABLE-US-00001 NFATC1-For (SEQIDNO:1) TTTTTTGTAATAAGAGGAAGTATAGTTTTA NFATC1-Rev (SEQIDNO:2) ATCTCCCAAATCCAAACTACTATC(hypermethylated) MAPK8IP2-For (SEQIDNO:3) GGTTGTGTAGTTTTTATTGAGTGTTTA MAPK8IP2-Rev (SEQIDNO:4) AATCCCCCCAAAAACCCTAAC(unmethylated)
[0099] 1-4 ul converted product is used as template for PCR amplification, accompanied by 25 ul ZymoTaq PreMix, 5 ul gene specific primer mix (10 uM), and nuclease-free water up to 50 ul total volume. The PCR reaction is carried out with the following protocol: Initial denaturation at 95 C. for 10 min, then a cycle of denaturation at 95 C. for 30 sec, annealing at 55 C. for 30 sec, extension at 72 C. for 60 sec for a total of 40-50 cycles, and a final extension step at 72 C. for 7 min followed by 4 C. holding for >4 min. Completed PCR is then purified using either spin column-based or magnetic beads-based clean up protocol. The purified products are analyzed with Sanger sequencing using corresponding forward primers. Example results are shown in
Example 4
Study of the Optimal Enzymatic Ratio of DNMT1 and Phi29 and Input Amount
[0100] To optimize the coupled enzymatic reactions of DNMT1 and Phi29, different ratios of the two enzymes are used to perform the 5mC-WGA reaction, with the efficiency evaluated by bisulfite treatment and Sanger sequencing described above. 10 ng of human brain gDNA is used as the input sample, different enzyme ratios ranging from 1:4 to 1:15 are used, with rest of experimental steps identical from the previously described protocol. The results are shown in
[0101] To evaluate the versatility of 5mC-WGA for different input DNA amounts, 5 pg-10 ng human brain gDNA are used in 5mC-WGA with the optimal enzyme ratio. The results are shown in
[0103] The applicability of other forms of biological samples to be used directly for 5mC-WGA amplification is discussed in this example. More specifically, the option of using cells directly as input sample for 5mC-WGA, and the option of using cell-free DNA extracted from body fluids (e.g. blood) as input sample for 5mC-WGA, are demonstrated.
Example 5
Use Cell-Free DNA as 5mC-WGA Input Sample
[0104] Cell-free DNA extracted from body fluids is generally present at very low abundance and partially degraded, causing major technical difficulties to detect its methylation patterns which contain valuable diagnostic information. The applicability of using cell-free DNA directly as 5mC-WGA input sample is demonstrated. First, a control group using 1 ng mouse gDNA sonicated to 300 bp is used as the input sample for 5mC-WGA reaction to ensure the efficiency of amplification of fragmented DNA. The product is purified and analyzed using Bioanalyzer (Agilent), with result showing efficient amplification (
Example 6
Use Cells as 5mC-WGA Input Sample
[0105] In addition to using purified DNA as the input sample for 5mC-WGA, processed cells can be used directly in 5mC-WGA, skipping extra purification steps and facilitating low cell number or single cell detection applications.
[0106] Extracted cells need to be first lysed before being added into the reaction. The compatible lysis protocol is described here: Prepare two buffers used in the lysis protocol, buffer L (400 mM KOH, 10 mM EDTA, 100 mM DTT) and buffer N (200 mM HCl, 300 mM Tris pH7.5). To the extracted cells (1-15 cells, scale up for more cells), add 5 ul buffer L, incubate on ice for 10 min. Then add 5 ul buffer N, mix well. The lysate can now be added into a 5mC-WGA reaction for amplification of DNA and 5mC patterns.
[0107] (3) MeDIP-Seq of Pico Grams of Human Brain gDNA Using 5mC-WGA Method
[0108] DNA amplified using 5mC-WGA can be further analyzed with high-throughput sequencing to reveal genome-wide 5mC patterns, either in clusters (by MeDIP-seq) or at single-base resolution (by Whole-Genome Bisulfite Sequencing, WGBS).
[0109] For MeDIP-seq, the purified DNA can be sonicated and subjected to the processing with commercial MeDIP and DNA NGS library construction kits. Here we use KAPA HyperPlus and ThermoFisher MethylMiner kits as an example to demonstrate the workflow.
Example 7
Sample Preparation
[0110] 100 pg human brain gDNA is used as the input sample for 5mC-WGA amplification according to the protocol described previously. The product is purified and the concentration is measured with Nanodrop. Both amplified product and template DNA (as positive control) are used for MeDIP-seq library construction.
Example 8
DNA Processing Before MeDIP
[0111] Example use of KAPA HyperPlus kit for pre-MeDIP processing of DNA.
[0112] DNA fragmentation: 100 ng purified 5mC-WGA product and template DNA are subjected to enzymatic fragmentation according to manufacturer's protocol. 14 ul DNA is mixed with 2 ul fragmentation buffer and 4 ul fragmentation enzyme mix, incubated at 37 C. for 30 min, then the reaction is quenched on ice.
[0113] End repair and A-tailling: 20 ul mixture from last step is supplemented with 2.8 ul end repair buffer and 1.2 ul enzyme mix, incubated at 65 C. for 30 min, then left at room temperature for 5-10 min for better repairing.
[0114] Adaptor ligation: 24 ul mixture from last step is supplemented with 1.2 ul index (25 uM, Bioo), 12 ul ligation buffer, 4 ul ligase, and nuclease-free water up to 44 ul. The reaction is kept at 20 C. for 60 min, followed by Ampure beads purification with 1:1 volume ratio. The processed DNA is now ready to be enriched with MeDIP.
Example 9
5mC DNA Enrichment with MeDIP
[0115] Example use of ThermoFisher MethylMiner kit for MeDIP enrichment of methylated DNA fragments.
[0116] Follow the manufacturer's protocol, first prepare the magnetic beads and couple the MBD-biotin protein. Then incubate MBD-beads with processed DNA generated from the previous steps, using the protocol for 5 ng-1 g input DNA. Finally remove the uncaptured DNA and elute the captured, 5mC-containing DNA fragments. These enriched products are now ready for library amplification.
Example 10
MeDIP-seq Library Amplification
[0117] Example use of KAPA HyperPlus kit for post-MeDIP amplification of DNA library.
[0118] qPCR of the enriched DNA fragments: To determine the accurate number of PCR cycles needed for amplifying the MeDIP library, 1 ul of template DNA or MeDIP enriched DNA is used in a 20 ul qPCR reaction containing 10 ul qPCR master mix (e.g. Roche FastStart SYBR Green) and 2 ul primer mix. The cycle number generating enough library is determined and used in the subsequent PCR reaction.
[0119] Amplification of MeDIP libraries: Based on the cycle numbers determined by qPCR, a 50 ul reaction containing template or enriched DNA, 25 ul KAPA HiFi HotStartReadyMix, and 5 ul primer mix is prepared and amplified in a thermal cycler. The products are further purified and subjected to NGS-sequencing.
[0120] The resulting data demonstrate good maintenance of genome-wide 5mC patterns using 5mC-WGS. A few example regions are shown in
[0121] (4) WGBS of 5mC-WGA Amplified DNA from Limited Biological Samples.
[0122] For WGBS, the purified DNA is first subjected to bisulfite treatment, followed by processing using commercial WGBS library construction kits. Here we use Illumina TruSeq DNA Methylation kit as an example to demonstrate the workflow.
Example 11
Bisulfite Treatment of 5mC-WGA Product
[0123] Same with the protocol described in the first example. Note EZ DNA Methylation-Gold and EZ DNA Methylation-Lightning kits from Zymo can be used as alternative options.
Example 12
WGBS Library Construction
[0124] Example use of Illumina TruSeq DNA Methylation kit for WGBS library construction from bisulfite treated 5mC-WGS products.
[0125] Follow the manufacturer's protocol, first anneal the DNA synthesis adaptors to the denatured ssDNA, then synthesize complementary DNA strand to produce dsDNA product, next tag the dsDNA with known adaptor sequences at both ends, finally amplify the library with specific indexes sequences for multiplexed NGS-sequencing.
Example 13
5mC-Retained Amplification of Specific Loci from Limited Biological Samples
[0126] The reaction for specific loci with methylated sites retained is only different from the one for whole genome amplification with the addition of 4 ul both forward and reverse primers (10 nM) of the region of interest. Example use is the amplification of the FMR1 gene as a potential diagnosis of Fragile X Syndrome. Corresponding primers are:
FMR1 Forward GCTCAGCTCCGTTTCGGTTTCACTTCCGGT (SEQ ID NO:5)
FMR1 Reverse CCTCCATCTTCTCTTCAGCCCT (SEQ ID NO:6)
[0127] The reaction is prepared also with 8 ul primer pairs (each one at 5 nM) and incubated based on the same thermocycle.
[0128] Preferred embodiments of this invention are described herein, including appropriate examples known to the inventors for the application of this invention. The applications described above are exemplary only, and should not be considered as limiting the scope of this invention.
REFERENCES
[0129] Lorthongpanich, C., Cheow, L. F., Balu, S., Quake, S. R., Knowles, B. B., Burkholder, W. F., Solter, D. and Messerschmidt, D. M., 2013. Single-cell DNA-methylation analysis reveals epigenetic chimerism in preimplantation embryos. Science, 341(6150), pp. 1110-1112. [0130] Guo, H., Zhu, P., Wu, X., Li, X., Wen, L. and Tang, F., 2013. Single-cell methylome landscapes of mouse embryonic stem cells and early embryos analyzed using reduced representation bisulfite sequencing. Genome research, 23(12), pp. 2126-2135. [0131] Smallwood, S. A., Lee, H. J., Angermueller, C., Krueger, F., Saadeh, H., Peat, J., Andrews, S. R., Stegle, O., Reik, W. and Kelsey, G., 2014. Single-cell genome-wide bisulfite sequencing for assessing epigenetic heterogeneity. Nature methods, 11(8), pp. 817-820. [0132] Picher, A. J., Budeus, B., Wafzig, O., Kruger, C., Garcia-Gomez, S., Martinez-Jimenez, M. I., Diaz-Talavera, A., Weber, D., Blanco, L. and Schneider, A., 2016. TruePrime is a novel method for whole-genome amplification from single cells based on TthPrimPol. Nature communications, 7: 13296