Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
10544416 ยท 2020-01-28
Assignee
Inventors
Cpc classification
C12N2310/111
CHEMISTRY; METALLURGY
A61K48/0016
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
C12N2310/3231
CHEMISTRY; METALLURGY
A61P21/00
HUMAN NECESSITIES
C12Q1/6883
CHEMISTRY; METALLURGY
C12N2310/346
CHEMISTRY; METALLURGY
International classification
C12Q1/6883
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The invention provides a method for generating an oligonucleotide with which an exon may be skipped in a pre-mRNA and thus excluded from a produced mRNA thereof. Further provided are methods for altering the secondary structure of an mRNA to interfere with splicing processes and uses of the oligonucleotides and methods in the treatment of disease. Further provided are pharmaceutical compositions and methods and means for inducing skipping of several exons in a pre-mRNA.
Claims
1. An antisense oligonucleotide of 20 to 23 nucleotides in length, comprising at least 15 consecutive bases of a base sequence of the sequence UCAAGGAAGAUGGCAUUUCU (SEQ ID NO: 27), wherein the antisense oligonucleotide induces exon 51 skipping in the human dystrophin pre-mRNA, and wherein the antisense oligonucleotide comprises a modification.
2. The oligonucleotide of claim 1, wherein the modification is a morpholine ring.
3. The oligonucleotide of claim 1, wherein the modification is a phosphorodiamidate internucleoside linkage.
4. The oligonucleotide of claim 1, wherein the modification is a peptide nucleic acid and/or locked nucleic acid.
5. The oligonucleotide of claim 3, wherein each linkage is a phosphorodiamidate internucleoside linkage.
6. The oligonucleotide of claim 1, wherein the oligonucleotide is a phosphorodiamidate morpholino oligonucleotide.
7. The oligonucleotide of claim 1, wherein the modification is a 2-O-methyl ribose moiety.
8. The oligonucleotide of claim 1, wherein the modification is a phosphorothioate internucleoside linkage.
9. The oligonucleotide of claim 8, wherein each internucleoside linkage is a phosphorothioate linkage.
10. The oligonucleotide of claim 7, wherein said oligonucleotide is a 2-O-methyl phosphorothioate oligonucleotide.
11. The oligonucleotide of claim 1, wherein the oligonucleotide induces dystrophin expression in a human muscle cell upon transfection of the human muscle cell with at least 100 nM of said oligonucleotide and incubation for at least 16 hours.
12. The oligonucleotide of claim 1, wherein the modification confers increased resistance to RNAseH.
13. The oligonucleotide of claim 1, which is 20 nucleotides in length.
14. The oligonucleotide of claim 13, wherein the modification is a 2-O-methyl ribose moiety.
15. The oligonucleotide of claim 13, wherein the modification is a phosphorothioate internucleoside linkage.
16. The oligonucleotide of claim 13, wherein each internucleoside linkage is a phosphorothioate linkage.
17. The oligonucleotide of claim 13, wherein at least one modification is a phosphorothioate internucleoside linkage and at least one modification is a 2-O-methyl ribose moiety.
18. A pharmaceutical composition, comprising the oligonucleotide of claim 1 and a pharmaceutically acceptable carrier.
19. A pharmaceutical composition, comprising the oligonucleotide of claim 13 and a pharmaceutically acceptable carrier.
20. A method for treating Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD), comprising administering to a subject a therapeutically effective amount of the oligonucleotide of claim 1.
21. A method for treating Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD), comprising administering to a subject a therapeutically effective amount of the oligonucleotide of claim 13.
22. The oligonucleotide of claim 17 that consists of the base sequence of SEQ ID NO: 27.
23. A pharmaceutical composition, comprising the oligonucleotide of claim 22 and a pharmaceutically acceptable carrier.
24. A method for treating Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD), comprising administering to a subject a therapeutically effective amount of the oligonucleotide of claim 22.
Description
EXAMPLES
Example 1
(1) Results
(2) This study includes 6 DMD patients affected by different mutations (Table 1). Patient DL 515.2 carries an exon 45-50 deletion; hence exon 51 skipping would be frame correcting. Patient DL 363.2 has a deletion of exon 45-54; the reading frame for this patient would be corrected by an exon 44 skip. For patient 50685.1, who is affected by an exon 48-50 deletion, reading frame correction requires an exon 51 skip. Patient DL 589.2 has an exon 51-55 deletion; the reading frame would be corrected by an exon 50 skip. Patient 53914.1 carries a single exon 52 deletion. Notably, in this case both the skipping of exon 51 or exon 53 would be frame correcting. Finally, patient 50423.1 has a deletion of a single base pair in exon 49, at position 7389 on cDNA level, resulting in a frame-shift and a premature stop codon in exon 49. Since exon 49 is an in-frame exon, skipping of this exon would correct the reading frame for this patient.
(3) We have previously identified AONs with which the skipping of the mentioned target exons 44, 49, 50, 51 and 53 can be induced at concentrations of 1 M (23). In subsequent dose-response experiments, however, we have obtained substantial skipping efficiencies with lower concentrations of 500 nM or 200 nM, and even 100 nM for most AONs (data not shown). This had the extra advantageous effect of lower doses of PEI required for transfection, which significantly reduced the levels of cytotoxicity as found in our earlier transfection experiments. Myotube cultures from the 6 DMD patients were transfected with the relevant AONs. On average 70% to 90% of cells showed specific nuclear uptake of fluorescent AONs. RNA was isolated 24 hours post-transfection and analysed by RT-PCR (
(4) The resulting in-frame transcripts should restore dystrophin synthesis. Indeed, immuno-histochemical analysis of transfected myotube cultures detected dystrophin in the majority of myotubes for each patient (
(5) For one patient, DL 363.2, we also assessed whether the induction of the dystrophin synthesis resulted in the restoration of the DGC (
(6) Discussion
(7) The reading frame correction strategy for DMD patients is aimed at antisense-induced, targeted exon skipping. This would convert a severe DMD phenotype into a mostly milder BMD phenotype. We determined the broad applicability in 6 patients, carrying 5 different deletions and a point mutation in an exon 49 (Table 1). Following AON treatment, we show for each patient the precise skipping of the targeted exon on RNA level, and a dystrophin protein in 75% to 80% of the treated myotubes. In particular, we here report, for the first time, the application of a single AON treatment (i.e. the induced skipping of exon 51) to correct the reading frame for several different deletions.
(8) Interestingly, the levels of exon skipping observed in the DMD patient cells are significantly higher than those previously obtained in human control cells (23). Typically, the novel skip transcript is the major product. This can be explained by the action of the nonsense-mediated decay (NMD) process (25, 32). In control cells, the skip of an out-of-frame exon results in an out-of-frame transcript, which will be susceptible to NMD. In patient cells, the skip of a target exon results in an in-frame transcript that would be resistant to NMD and thus more stable than the out-of-frame transcript originally present.
(9) For three of the patients (DL 363.2, DL 589.2 and 53914.1) we detected low levels of spontaneous skipping of exons 44, 50 and 53 in untreated cells. This phenomenon has previously also been described for so-called revertant muscle fibers (33-35). These dystrophin positive fibers are present in low amounts (2% to 10%) in DMD muscles, and are considered to be the result of secondary somatic mutations and/or alternative splicing that restore the reading frame. The existence of revertant fibers has been suggested to correlate with the severity of the disease (36, 37).
(10) Restoration of the dystrophin synthesis could be detected as soon as 16 hours post-transfection. At two days post-transfection, dystrophin was detected at the membrane indicating that these novel BMD-like proteins are likely in part functional. Furthermore, we show that restoration of the dystrophin synthesis appears to re-establish the formation of the dystrophin-glycoprotein complex.
(11) In patients DL 363.2 and DL 589.2, the targeted exon skipping enlarged the deletions to span exons 44-54 and 50-55, respectively. So far, these deletions, have not been reported in DMD or BMD patients. This means that they either do not exist, or generate a very mild phenotype not diagnosed as BMD. Considering both the large variety of BMD mutations and the markedly lower incidence of BMD observed, we consider the last explanation more plausible than the first. The out-of-frame deletions from patients DL 515.1, 50685.1 and 50423.1 were converted into in-frame deletions as observed in BMD patients carrying deletions of exon 45-51, exon 48-51 and exon 49 (30, 38-40). Noteworthy, the exon 48-51 deletion has even been described in an asymptomatic person (40). On the other hand however, there are also DMD patients carrying such deletions (38, 41-43). Since most of these theoretically in-frame deletions have been detected on DNA level only, we hypothesize that the dystrophin deficiency in these DMD patients may be caused by additional aberrant splicing patterns on RNA level, resulting in an out-of-frame transcript.
(12) It is feasible to correct over 75% of the mutations reported in the Leiden DMD-mutation database (30). Our results indicate that, antisense-induced reading frame correction will be a promising therapeutic approach for many DMD patients carrying different deletions and point mutations. Towards the establishment of clinical trials, we are currently investigating and optimising delivery methods in muscle tissue of mice in vivo.
(13) Material and Methods
(14) AONs and Primers
(15) The AONs applied (Table 1) were previously described (23). They contain a 5 fluorescein group (6-FAM), a full-length phosphorothioate backbone and 2-O-methyl modified ribose molecules (Eurogentec, Belgium). To avoid interference with the fluorescent signals of the secondary antibodies, unlabelled AONs were used for immuno-histochemical analyses. Primers for RT-PCR analysis (sequences available upon request) were synthesised by Eurogentec (Belgium) or by Isogen Bioscience BV (The Netherlands).
(16) Myogenic Cell Cultures and AON Transfections
(17) Primary human myoblasts from patients DL 515.2 (deletion exon 45-50), DL 363.2 (deletion exon 45-54), 50685.1 (deletion exon 48-50), DL 589.2 (deletion exon 51-55) and 53914.1 (deletion exon 52) were isolated from a muscle biopsy and cultured as described (44). Cultures were seeded in collagen pre-coated flasks and plates (Vitrogen 100, Cohesion). Myotubes were obtained from confluent myoblast cultures, following 7 to 14 days of serum-deprivation. They were subsequently transfected using polyethylenimine (PEI) for 3 h in low-serum medium, according to the manufacturer's instructions (ExGen500; MBI Fermentas), and with 3.5 l PEI applied per g of transfected AON. For RT-PCR analysis, concentrations of 500 nM AON were used. At this concentration highest skipping levels can be obtained, albeit with moderate levels of cell death. Since for immunohistochemical and western blot analysis more viable myotubes are required, concentrations of 200 nM were applied. For patient 50423.1, who carries a point mutation in exon 49, only fibroblasts were available. Following infection (MOI 50-100) with an adenoviral vector containing the MyoD gene (Ad50MyoD), the fibroblasts were forced into myogenesis according to protocols described previously (45-47). Two hours post-infection the medium was replaced by low serum medium, and cells were incubated for 8 to 10 days until myotubes were formed. Transfection conditions were identical to those described above.
(18) RNA Isolation and RT-PCR Analysis
(19) At 24 h post-transfection, total RNA was isolated from the myotube cultures (RNA-Bee RNA isolation solvent, Campro Scientific, The Netherlands). 300 ng of total RNA was used for RT-PCR analysis using C.therm polymerase (Roche Diagnostics, The Netherlands) in a 20 l reaction at 60 C. for 30 min, primed with different DMD gene-specific reverse primers (Table 1). Primary PCRs were performed by 20 cycles of 94 C. (40 sec), 60 C. (40 sec) and 72 C. (60 sec). One l of these reactions was then reamplified in nested PCRs by 32 cycles of 94 C. (40 sec), 60 C. (40 sec) and 72 C. (60 sec). PCR products were analysed on 1.5% or 2% agarose gels. Noteworthy, no evidence for a significant preference for the amplification of shorter fragments was obtained in PCR analyses on a defined series of mixtures of known quantities of the normal and shorter transcript fragments (data not shown).
(20) Sequence Analysis
(21) RT-PCR products were isolated from agarose gels using the QIAquick Gel Extraction Kit (Qiagen). Direct DNA sequencing was carried out by the Leiden Genome Technology Center (LGTC) using the BigDye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems) and analysed on an ABI 3700 Sequencer (PE Applied Biosystems).
(22) Protein Isolation and Western Blot Analysis
(23) Protein extracts were isolated from treated myotube cultures (25 cm2 flasks), using 150 l of treatment buffer (75 mM Tris-HC pH 6.8, 15% SDS, 5% b-mercaptoethanol, 2% glycerol, 0.001% bromophenol blue), at 2 to 4 days post-transfection depending on the survival rate of the myotubes. For the time course experiments, protein extracts were isolated 4 h, 8 h, 16 h, 24 h and 48 h post-transfection (for patient 50685.1) or at 2 days, 4 days and 7 days post-transfection (for patient DL 363.2).
(24) Polyacrylamide gel electrophoresis and Western blotting were performed as described by Anderson et al, with some minor adjustments (48). Briefly, samples (75 l) were run overnight at 4 C. on a 4% to 7% polyacrylamide gradient gel. Gels were blotted to nitrocellulose for 5 to 6 hours at 4 C. Blots were blocked for 1 h with 5% non-fat dried milk in TBST buffer (10 mM Tris-HCl, 0.15 M NaCl, 0.5% Tween 20, pH 8) followed by an overnight incubation with NCL-DYS2 (which recognizes dystrophin) diluted 1:50. HRP-conjugated anti-mouse (Santa Cruz) diluted 1:10,000 was used as a secondary antibody. Immuno-reactive bands were visualised using Lumi-Lightplus Western Blotting Substrate and scanned with a Lumi-Imager (Roche Diagnostics, The Netherlands).
(25) Immuno-histochemical Analysis
(26) Treated myotube cultures were fixed in 20 C. methanol at 1 to 4 days post-transfection, depending of the survival rate of the myotubes. Prior to reaction with the different antibodies, the cells were incubated for 1 h in a blocking solution containing 5% horse serum (Gibco BRL) and 0.05% Tween-20 (Sigma) in PBS (Gibco BRL). All antibodies used were diluted in this blocking solution. The following antibodies were applied: desmin polyclonal antibody (ICN Biomedicale) diluted 1:100, myosin monoclonal antibody diluted 1:100 (MF20; Developmental Studies Hybridoma Bank, University of Iowa), myosin polyclonal antibody L53 diluted 1:100 (a gift from Dr M. van den Hoff AMC, The Netherlands), MANDYS1 (a gift from Dr G. Morris, North East Wales Institute, UK) diluted 1:10 and NCL-DYS2 (Novacastra Laboratories Ltd) diluted 1:10 to detect dystrophin, NCL-a-SARC (Novacastra Laboratories Ltd) diluted 1:75, NCL-b-SARC (Novacastra Laboratories Ltd) diluted 1:50, NCL-g-SARC (Novacastra Laboratories Ltd) diluted 1:50 and NCL-b-DG (Novacastra Laboratories Ltd) diluted 1:50 to detect -sarcoglycan, -sarcoglycan, -sarcoglycan and -dyetroglycan, respectively. After 1 h incubation, slides were rinsed and incubated for 1 h with the secondary antibodies Alexa Fluor 594 goat anti-rabbit conjugate diluted 1:1000 or Alexa Fluor 488 goat anti-mouse conjugate diluted 1:250 (Molecular Probes Inc). The slides were analysed using a Leica confocal microscope equipped with epifluorescence optics. Digital images were captured using a CCD camera (Photometrics).
Example 2
(27) Materials and Methods
(28) AONs and Primers
(29) A series of AONs (two per exon, see Table 2) was designed to bind to exon-internal target sequences showing a relatively high purine-content and, preferably, an open secondary pre-mRNA structure (at 37 C.), as predicted by the RNA mfold version 3.1 server [22]. The AONs varied in length between 15 and 24 bp, with G/C contents between 26 and 67%. They were synthesized with the following chemical modifications: a 5-fluorescein group (6-FAM), a full-length phosphorothioate backbone and 2-O-methyl modified ribose molecules (Eurogentec, Belgium). The primers used for reverse transcription-polymerase chain reaction (RT-PCR) analysis (Table 3) were synthesized by Eurogentec (Belgium) or by Isogen Bioscience BV (The Netherlands).
(30) In Vitro Experiments
(31) Primary human myoblasts were isolated from a muscle biopsy from a non-affected individual (KM108) by enzymatic dissociation. Briefly, the tissue was homogenized in a solution containing 5 mg/ml collagenase type VIII (Sigma), 5 mg/ml bovine albumin fraction V (Sigma), 1% trypsin (Gibco BRL) in PBS (Gibco BRL). Following serial incubation steps of 15 min at 37 C., suspensions containing the dissociated cells were added to, and pooled in, an equal volume of proliferation medium (Nut.Mix F-10 (HAM) with GlutaMax-1, Gibco BRL) supplemented with 20% fetal bovine serum (Gibco BRL) and 1% penicillin/streptomycin solution (Gibco BRL). After centrifugation, the cells were plated and further cultured in proliferation medium, using flasks that were pre-coated with purified bovine dermal collagen (Vitrogen 100; Cohesion). The myogenic cell content of the culture, as determined by the percentage of desmin-positive cells in an immunohistochemical assay, was improved to 58% by repetitive preplating [23]. Myotubes were obtained from confluent myoblast cultures following 7-14 days of incubation in low-serum medium (DMEM (Gibco BRL), supplemented with 2% GlutaMax-1, 1% glucose, 2% fetal bovine serum and 1% penicillin/streptomycin solution). For transfection of the myotube cultures, we used polyethylenimine (PEI; ExGen 500) according to the manufacturer's instructions (MBI Fermentas). The cultures were transfected for 3 h in low-serum medium with 1 mM of each AON linked to PEI at a ratio-equivalent of 3.5.
(32) RNA isolation and RT-PCR analysis At 24 h post-transfection, total RNA was isolated from the myotube cultures using RNAzol B according to the manufacturer's instructions (Campro Scientific, The Netherlands). One microgram of RNA was then used for RT-PCR analysis using C. therm polymerase (Roche Diagnostics) in a 20 l reaction at 60 C. for 30 min, primed with different DMD gene-specific reverse (RT) primers (Table 3). Primary PCRs were carried out with outer primer sets (see Table 8), for 20 cycles of 94 C. (40 s), 60 C. (40 s), and 72 C. (90 s). One microliter of this reaction was then reamplified in nested PCRs using the appropriate primer combinations (Table 3) for 32 cycles of 94 C. (40 s), 60 C. (40 s), and 72 C. (60 s). PCR products were analysed on 1.5 or 2% agarose gels.
(33) Sequence analysis RT-PCR products were isolated from agarose gels using the QIAquick Gel Extraction kit (Qiagen). Direct DNA sequencing was carried out by the Leiden Genome Technology Center (LGTC) using the BigDye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems), and analysed on an ABI 3700 Sequencer (PE Applied Biosystems).
(34) Results
(35) In Vitro Exon Skipping
(36) AONs were empirically analysed for the induction of exon skipping following transfection into human control myotube cultures, using the cationic polymer polyethylenimine (PEI). As determined by the nuclear uptake of the fluorescent AONs, average transfection efficiencies of 60-80% were obtained. At 24 h post-transfection, transcripts were analysed by RT-PCR using different primer combinations encompassing the targeted exons (Table 3). Of the 30 AONs tested, a total of 21 (70%) reproducibly generated shorter transcript fragments with sizes corresponding to the specific skipping of the targeted exons (
(37) In the specific transcript regions that were screened in these experiments, we observed in the non-transfected control myotubes alternative splicing patterns around exons 2 and 29 (
(38) The majority of AONs induced the precise skipping of the targeted exons, using the original splice sites of the adjacent exons. However, in response to h51AON2, an in-frame cryptic splice site was used in exon 51 (
References to Example 2 (Numbering in This Part Refers Strictly to Numbering Maintained in Example 2)
(39) [1] Hoffman E P, Brown Jr R H, Kunkel L M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell 1987; 51:919-928.
(40) [2] Monaco A P, Bertelson C J, Liechti-Gallati S, Moser H, Kunkel L M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics 1988; 2:90-95.
(41) [3] Koenig M, Beggs A H, Moyer M, et al. The molecular basis for Duchenne versus Becker muscular dystrophy: correlation of severity with type of deletion. Am J Hum Genet 1989; 45:498-506.
(42) [4] Zubrzycka-Gaarn E E, Bulman D E, Karpati G, et al. The Duchenne muscular dystrophy gene product is localized in sarcolemma of human skeletal muscle. Nature 1988; 333:466-469.
(43) [5] Yoshida M, Ozawa E. Glycoprotein complex anchoring dystrophin to sarcolemma. J Biochem (Tokyo) 1990; 108:748-752.
(44) [6] Ervasti J M, Campbell K P. Membrane organization of the dystrophinglycoprotein complex. Cell 1991; 66:1121-1131.
(45) [7] Koenig M, Monaco A P, Kunkel L M. The complete sequence of dystrophin predicts a rod-shaped cytoskeletal protein. Cell 1988; 53:219-226.
(46) [8] van Deutekom J C, Floyd S S, Booth D K, et al. Implications of maturation for viral gene delivery to skeletal muscle. Neuromuscul Disord 1998; 8:135-148.
(47) [9] Mayeda A, Hayase Y, Inoue H, Ohtsuka E, Ohshima Y. Surveying cis-acting sequences of pre-mRNA by adding antisense 20-O-methyl oligoribonucleotides to a splicing reaction. J Biochem (Tokyo) 1990; 108:399-405.
(48) [10] Galderisi U, Cascino A, Giordano A. Antisense oligonucleotides as therapeutic agents. J Cell Physiol 1999; 181:251-257.
(49) [11] Baker B F, Monia B P. Novel mechanisma for antisense-mediated regulation of gene expression. Biochim Biophys Acta 1999; 1489:3-18.
(50) [12] Kole R, Sazani P. Antisense effects in the cell nucleus: modification of splicing. Curr Opin Mol Ther 2001; 3:229-234.
(51) [13] Sicinski P, Geng Y, Ryder-Cook A S, Barnard E A, Darlison M G, Barnard P J. The molecular basis of muscular dystrophy in the mdx mouse: a point mutation. Science 1989; 244:1578-1580.
(52) [14] Dunckley M G, Manoharan M, Villiet P, Eperon I C, Dickson G. Modification of splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides. Hum Mol Genet 1998; 7:1083-1090.
(53) [15] Mann C J, Honeyman K, Cheng A J, et al. Antisense-induced exon skipping and synthesis of dystrophin in the mdx mouse. Proc Natl Acad Sci USA 2001; 98:42-47.
(54) [16] Wilton S D, Lloyd F, Carville K, et al. Specific removal of the nonsense mutation from the mdx dystrophin mRNA using anti-sense oligonucleotides. Neuromuscul Disord 1999; 9:330-338.
(55) [17] Takeshima Y, Wada H, Yagi M, et al. Oligonucleotides against a splicing enhancer sequence led to dystrophin production in muscle cells from a Duchenne muscular dystrophy patient. Brain Dev 2001; 23:788-790.
(56) [18] Pramono Z A, Takeshima Y, Alimsardjono H, Ishii A, Takeda S, Matsuo M. Induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence. Biochem Biophys Res Commun 1996; 226:445-449.
[19] Watakabe A, Tanaka K, Shimura Y. The role of exon sequences in splice site selection. Genes Dev 1993; 7:407-418.
[20] Tanaka K, Watakabe A, Shimura Y. Polypurine sequences within a downstream exon function as a splicing enhancer. Mol Cell Biol 1994; 14:1347-1354.
[21] van Deutekom J C, Bremmer-Bout M, Janson A A, et al. Antisenseinduced exon skipping restores dystrophin expression in DMD patient derived muscle cells. Hum Mol Genet 2001; 10:1547-1554.
[22] Mathews D H, Sabina J, Zuker M, Turner D H. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 1999; 288:911-940.
[23] Richler C, Yaffi D. The in vitro cultivation and differentiation capacities of myogenic cell lines. Dev Biol 1970; 23:1-22.
[24] Surono A, Takeshima Y, Wibawa T, Pramono Z A, Matsuo M. Six novel transcripts that remove a huge intron ranging from 250 to 800 kb are produced by alternative splicing of the 50 region of the dystrophin gene in human skeletal muscle. Biochem Biophys Res Commun 1997; 239:895-899.
[25] Shiga N, Takeshima Y, Sakamoto H, et al. Disruption of the splicing enhancer sequence within exon 27 of the dystrophin gene by a nonsense mutation induces partial skipping of the exon and is responsible for Becker muscular dystrophy. J Clin Invest 1997; 100:2204-2210.
[26] Wells D J, Wells K E, Asante E A, et al. Expression of human fulllength and minidystrophin in transgenic mdx mice: implications for gene therapy of Duchenne muscular dystrophy. Hum Mol Genet 1995; 4:1245-1250.
[27] Sironi M, Pozzoli U, Cagliani R, Comi G P, Bardoni A, Bresolin N. Analysis of splicing parameters in the dystrophin gene: relevance for physiological and pathogenetic splicing mechanisms. Hum Genet 2001; 109:73-84.
A. Aartsma-Rus et al./Neuromuscular Disorders 12 (2002) S71-S77.
Example 3
(57) Results
(58) Double-exon Skipping in Two DMD Patients
(59) This study includes two DMD patients affected by different frame-disrupting mutations in the DMD gene that require the skip of two exons for correction of the reading frame (Table 5). Patient DL 90.3 carries a nonsense mutation in exon 43. Considering that this single exon is out-of-frame, the skipping of exon 43 would remove the nonsense mutation but not restore the reading frame. Since the combination with exon 44 is in-frame, we aimed in this patient at double-exon skipping, targeting both these exons. Patient DL 470.2 is affected by a deletion of exons 46 to 50. Frame restoration would require a double-exon skipping of both exons flanking the deletion. Myotubes cultures from both patients were transfected with a mixture of exon 43 and 44 specific AONs (DL90.3) or exon 45 and 51 specific AONs (DL470.2). The individual AONs (Table 5) were previously highly effective in single exon skipping. Transfection efficiencies were typically over 80%, as indicated by the number of cells with specific nuclear uptake of the fluorescent AONs. RT-PCR analysis at 24 to 48 hours post-transfection, indeed demonstrated the feasibility of specific double-exon skipping in both samples (
(60) Multi-exon Skipping
(61) The splicing of exon 44 directly to exon 52 (as induced in DL470.2) generates an in-frame transcript. We hypothesized that by inducing the skipping of the entire stretch of exons in between, i.e. multi-exon skipping, we would induce a BMD-like deletion (45-51) that covers and restores several known, smaller, DMD mutations. This would further enlarge the group of DMD patients that would benefit from one type of frame correction. The feasibility of multi-exon skipping was first shown in human control myotubes that were treated with a mixture of the exon 45 and 51 specific AONs (
(62) Double- and multi-exon skipping using a U-linked AON-combination The skipping of more than one exon from one pre-mRNA molecule requires that both AONs are present in the same nucleus, targeting the same molecule. To enlarge this chance, we here studied the feasibility of one combined AON carrying both AONs specific for exons 45 and 51 (h45AON5 and h51AON2) linked by 10 uracil nucleotides (Table 5). Following transfection of this U-linker AON into myotubes from human control, and the DMD patients DL470.2 and 50685.1, RT-PCR analysis demonstrated its efficacy to generate the anticipated in-frame transcript with exon 44 spliced to exon 52 (
(63) Material and Methods
(64) AONs and Primers
(65) AONs (Table 5) targeting exons 43, 44 and 51 were previously described [Aartsma-Rus, 2002]. AONs targeting exon 45 were newly designed (sequences upon request). All AONs contain a 5 fluorescein group (6-FAM), a full-length phosphorothioate backbone and 2-O-methyl modified ribose molecules (Eurogentec, Belgium). To avoid interference with the fluorescent signals of the secondary antibodies, unlabelled AONs were used for immuno-histochemical analyses. Primers for RT-PCR analysis (Table 5, sequences available upon request) were synthesised by Eurogentec (Belgium).
(66) RNA Isolation and RT-PCR Analysis
(67) At 24 to 48 h post-transfection, total RNA was isolated from the myotube cultures (RNA-Bee RNA isolation solvent, Campro Scientific, The Netherlands). 300 ng of total RNA were used for RT-PCR analysis using C.therm polymerase (Roche Diagnostics, The Netherlands) in a 20 l reaction at 60 C. for 30 min, primed with different DMD gene-specific reverse primers (Table 5). Primary PCRs were performed by 20 cycles of 94 C. (40 sec), 60 C. (40 sec) and 72 C. (60 sec). One l of these reactions was then re-amplified in nested PCRs by 32 cycles of 94 C. (40 sec), 60 C. (40 sec) and 72 C. (60 sec). PCR products were analysed on 1.5% or 2% agarose gels. For quantification of the transcript products, nested PCR's were performed using 24 cycles. PCR products were analysed using the DNA 7500 LabChip Kit and the Agilent 2100 bioanalyzer (Agilent Technologies, The Netherlands).
(68) Sequence Analysis
(69) RT-PCR products were isolated from agarose gels using the QIAquick Gel Extraction Kit (Qiagen). Direct DNA sequencing was carried out by the Leiden Genome Technology Center (LGTC) using the BigDye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems) and analysed on an ABI 3700 Sequencer (PE Applied Biosystems).
Example 4
(70) Expression vectors encoding a transcript comprising an oligonucleotide of the invention.
(71) Due to the defined turnover rate of both the dystrophin pre-mRNA and the AONs, our DMD frame-correction therapy would require repetitive administrations of AONs. In addition, relatively high levels of antisense RNA will be necessary within the nucleus, where transcription and splicing of the dystrophin pre-mRNA occur. Therefore, we have set up a vector system in which specific AON sequences are incorporated into a modified gene. In this example this embodiment is described for U7 small nuclear RNA (U7snRNA). U7snRNA is the RNA component of the U7 ribonucleoprotein particle (U7snRNP) that is involved in the processing of the 3 end of histone pre-mRNAs. Inherent to its function, U7snRNA is efficiently transported back from the cytoplasm to the nucleus in which it gets subsequently incorporated into very stable U7snRNP complexes. A similar approach was successfully applied in AON-based gene therapy studies on -thalassemia (53, 54). In these studies, different plasmids were engineered containing a modified U7snRNA gene from which the natural antisense sequence directed to the histone pre-mRNA was replaced with antisense sequences targeted to different -thalassemia-associated aberrant splicing sites in the -globin gene. Following transfection of these plasmids, correct splicing and expression of the full-length -globin protein could be restored with an efficiency of up to 65% in cultured cells expressing the different mutant -globin genes.
(72) We have engineered various U7snRNA gene constructs as described in reference 53 with the modification that the -globin sequences were exactly replaced by the antisense sequences derived from the different AONs. In this example, the sequences were replaced by the antisense sequences of m46AON4, 6, 9, or 11 that were effective in inducing the skipping of mouse exon 46. A sense construct was included as negative control (m46SON6). Following construct validation by sequencing, the plasmids were tested in vitro by transfection into cultured C2C12 mouse myoblasts. The U7snRNA-m46AON6 construct was most efficient.
(73) To enhance delivery of the AON-U7snRNA gene constructs, we have cloned them into recombinant adeno-associated viral (rAAV) vectors. AAV is a single-stranded DNA parvovirus that is non-pathogenic and shows a helper-dependent life cycle. In contrast to other viruses (adenovirus, retrovirus, and herpes simplex virus), rAAV vectors have demonstrated to be very efficient in transducing mature skeletal muscle. Whereas application of rAAV in classical DMD gene addition studies has been hindered by its restricted packaging limits (<5 kb), we apply rAAV for the efficient delivery of the much smaller U7snRNA antisense constructs (<600 bp) to mature murine skeletal muscle. The rAAV-U7-AON vectors also contain the gene for green fluorescence protein (GFP-cDNA), which allows analysis of transduction efficiencies in muscle post-injection. High titre virus productions were effective in inducing exon skipping.
BRIEF DESCRIPTION OF THE DRAWINGS
(74)
(75)
(76)
(77)
(78)
(79)
(80)
REFERENCES (TO THE GENERAL PART, EXCLUDING EXAMPLE 2)
(81) 1. Hoffman, E. P., Brown, R. H., Jr., Kunkel, L. M. (1987) Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell, 51, 919-928.
(82) 2. Hoffman, E. P., Fischbeck, K. H., Brown, R. H., Johnson, M., Medori, R., Loike, J. D., Harris, J. B., Waterston, R., Brooke, M., Specht, L., et al. (1988) Characterization of dystrophin in muscle-biopsy specimens from patients with Duchenne's or Becker's muscular dystrophy. N. Engl. J. Med., 318, 1363-1368.
3. Den Dunnen, J. T., Grootecholten, P. M., Bakker, E., Blonden, L. A., Ginjaar, H. B., Wapenaar, M. C., van Paassen, H. M., van Broeckhoven, C., Pearson, P. L., van Ommen, G. J. (1989) Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications. Am. J. Hum. Genet., 46, 835-847.
4. Koenig, M., Beggs, A. H., Moyer, M., Scherpf, S., Heindrich, K., Bettecken, T., Meng, G., Muller, C. B., Lindlo, M., Kaariainen, H., et al. (1989) The molecular basis for Duchenne versus Becker muscular dystrophy: correlation of severity with type of deletion. Am. J. Hum. Genet., 45, 498-506.
5. Tuffery-Giraud, S., Chambert, S., Demaille, J., Claustree, M. (1999) Point mutations in the dystrophin gene: evidence for frequent use of cryptic splice sites as a result of splicing defects. Hum. Mutat., 14, 359-368.
6. Prior, T. W., Bartolo, C., Pearl, D. K., Papp, A. C., Snyder, P. J., Sedra, M. S., Burghes, A. H., Mendell, J. R. (1995) Spectrum of small mutations in the dystrophin coding region. Am. J. Hum. Genet., 57, 22-33.
7. Moser, H. (1984) Duchenne muscular dystrophy: pathogenetic aspects and genetic prevention. Hum. Genet., 66, 17-40.
8. Emery, A. E. (2002) The muscular dystrophies. Lancet, 359, 687-695.
9. Yoshida, M., Ozawa, E. (1990) Glycoprotein complex anchoring dystrophin to sarcolemma. J. Biochem. (Tokyo), 108, 748-752.
10. Ervasti, J. M., Campbell, K. P. (1991) Membrane organization of the dystrophin-glycoprotein complex. Cell, 66, 1121-1131.
11. Di Blasi, C., Morandi, L., Barresi, R., Blasevich, F., Cornelio, F., Mora, M. (1996) Dystrophin-associated protein abnormalities in dystrophin-deficient muscle fibers from symptomatic and asymptomatic Duchenne/Becker muscular dystrophy carriers. Acta Neuropathol. (Berl), 92, 369-377.
12. Ervasti, J. M., Ohlendieck, K., Kahl, S. D., Gaver, M. G., Campbell, K. P. (1990) Deficiency of a glycoprotein component of the dystrophin complex in dystrophic muscle. Nature, 345, 315-319.
13. Matsumura, K., Burghes, A. H., Mora, M., Tome, F. M., Morandi, L., Cornello, F., Leturcq, F., Jeanpierre, M., Kaplan, J. C., Reinert, P., et al. (1994) Immunohistochemical analysis of dystrophin-associated proteins in Becker/Duchenne muscular dystrophy with huge in-frame deletions in the NH2-terminal and rod domains of dystrophin. J. Clin. Invest., 93, 99-105.
14. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., Kunkel, L. M. (1988) An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics, 2, 90-95.
15. Clemens, P. R., Duncan, F. J. (2001) Progress in gene therapy for Duchenne muscular dystrophy. Curr. Neurol. Neurosci. Rep., 1, 89-96.
16. Khan, M. A. (1993) Corticosteroid therapy in Duchenne muscular dystrophy. J. Neurol. Sci., 120, 8-14.
17. De Angelis, F. G., Sthandier, O., Berarducci, B., Toso, S., Galluzzi, G., Ricci, E., Cossu, G., Bozzoni, I. (2002) Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Delta 48-50 DMD cells. Proc. Natl. Acad. Sci. USA, 99, 9456-9461.
18. Mann, C. J., Honeyman, K., Cheng, A. J., Ly, T., Lloyd, F., Fletcher, S., Morgan, J. E., Partridge, T. A., Wilton, S. D. (2001) Antisense-induced exon skipping and synthesis of dystrophin in the mdx mouse. Proc. Natl. Acad. Sci. USA, 98, 42-47.
19. van Deutekom, J. C., Bremmer-Bout, M., Janson, A. A., Ginjaar, I. B., Bass, F., den Dunnen, J. T., van Ommen, G. J. (2001) Antisense-induced exon skipping restores dystrophin expression in DMD patient derived muscle cells. Hum. Mol. Genet., 10, 1547-1554.
20. Wilton, S. D., Lloyd, F., Carville, K., Fletcher, S., Honeyman, K., Agrawal, S., Kole, R. (1999) Specific removal of the nonsense mutation from the mdx dystrophin mRNA using antisense oligonucleotides. Neuromuscul. Disord., 9, 330-338.
21. Dunckley, M. G., Manoharan, M., Villiet, P., Eperon, I. C., Dickson, G. (1998) Modification of splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides. Hum. Mol. Genet., 7, 1083-1090.
22. Takeshima, Y., Wada, H., Yagi, M., Ishikawa, Y., Minami, R., Nakamura, H., Matsuo, M. (2001) Oligonucleotides against a splicing enhancer sequence led to dystrophin production in muscle cells from a Duchenne muscular dystrophy patient. Brain Dev., 23, 788-790.
23. Aartsma-Rus, A., Bremmer-Bout, M., Janson, A., den Dunnen, J., van Ommen, G., van Deutekom, J. (2002) Targeted exon skipping as a potential gene correction therapy for Duchenne muscular dystrophy. Neuromuscul. Disord., 12, S71.
24. Shiga, N., Takeshima, Y., Sakamoto, H., Inoue, K., Yokota, Y., Yokoyama, M., Matsuo, M. (1997) Disruption of the splicing enhancer sequence within exon 27 of the dystrophin gene by a nonsense mutation induces partial skipping of the exon and is responsible for Becker muscular dystrophy. J. Clin. Invest., 100, 2204-2210.
25. Cartegni, L., Chew, S. L., Krainer, A. R. (2002) Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat. Rev. Genet., 3, 285-298.
26. Schaal, T. D., Maniatis, T. (1999) Multiple distinct splicing enhancers in the protein-coding sequences of a constitutively spliced pre-mRNA. Mol. Cell. Biol., 19, 261-273.
27. Takeshima, Y., Nishio, H., Sakamoto, H., Nakamura, H., Matsuo, M. (1995) Modulation of in vitro splicing of the upstream intron by modifying an intra-exon sequence which is deleted from the dystrophin gene in dystrophin Kobe. J. Clin. Invest., 95, 515-520.
28. Pramono, Z. A., Takeshima, Y., Alimsardjono, H., Ishii, A., Takeda, S., Matsuo, M. (1996) Induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence. Biochem. Biophys. Res. Commun., 226, 445-449.
29. Koenig, M., Monaco, A. P., Kunkel, L. M. (1988) The complete sequence of dystrophin predicts a rod-shaped cytoskeletal protein. Cell, 53, 219-226.
30. Den Dunnen, J. (1996) The Leiden Muscular Dystrophy pages; http://www.dmd.nl.
31. Mann, C. J., Honeyman, K., McClorey, G., Fletcher, S., Wilton, S. D. (2002) Improved antisense oligonucleotide induced exon skipping in the mdx mouse model of muscular dystrophy. J. Gene Med., 4, 644-654.
32. Kerr, T. P., Sewry, C. A., Robb, S. A., Roberts, R. G. (2001) Long mutant dystrophins and variable phenotypes: evasion of nonsense-mediated decay?Hum. Genet., 109, 402-407.
33. Klein, C. J., Coovert, D. D., Bulman, D. E., Ray, P. N., Mendell, J. R., Burghes, A. H. (1992) Somatic reversion/suppression in Duchenne muscular dystrophy (DMD): evidence supporting a frame-restoring mechanism in rare dystrophin-positive fibers. Am. J. Hum. Genet., 50, 950-959.
34. Sherratt, T. G., Vulliamy, T., Dubowitz, V., Sewry, C. A., Strong, P. N. (1998) Exon skipping and translation in patients with frameshift deletions in the dystrophin gene. Am. J. Hum. Genet., 53, 1007-1015.
35. Lu, Q. L., Morris, G. E., Wilton, S. D., Ly, T., Artem'yeva, O. V., Strong, P., Partridge, T. A. (2000) Massive idiosyncratic exon skipping corrects the nonsense mutation in dystrophic mouse muscle and produces functional revertant fibers by clonal expansion. J. Cell Biol., 148, 985-996.
36. Nicholson, L V., Johnson, M. A., Bushby, K. M., Gardner-Medwin, D. (1993) Functional significance of dystrophin positive fibres in Duchenne muscular dystrophy. Arch. Dis. Child, 68, 632-636.
37. Vainzof, M., Passos-Bueno, M. R., Takata, R. I., Pavanello Rde, C., Zats, M. (1993) Intrafamilial variability in dystrophin abundance correlated with difference in the severity of the phenotype. J. Neurol. Sci., 119, 38-42.
38. Singh, V., Sinha, S., Mishra, S., Chaturvedi, L. S., Pradhan, S., Mittal, R. D., Mittal, B. (1997) Proportion and pattern of dystrophin gene deletions in north Indian Duchenne and Becker muscular dystrophy patients. Hum. Genet., 99, 206-208.
39. Melacini, P., Fanin, M., Danieli, G. A., Fasoli, G., Villanova, C., Angelini, C., Vitiello, L., Miorelli, M., Buja, G. F., Mostacciuolo, M. L., t al. (1993) Cardiac involvement in Becker muscular dystrophy. J. Am. Coll. Cardiol., 22, 1927-1934.
40. Melis, M. A., Cau, M., Muntoni, F., Mateddu, A., Galanello, R., Boccone, L., Deidda, F., Loi, D., Cano, A. (1998) Elevation of serum creatine kinase as the only manifestation of an intragenic deletion of the dystrophin gene in three unrelated families. Europ. J. Paediatr. Neurol., 2, 255-261.
41. Onengut, S., Kavaslar, G. N., Battaloglu, E., Serdaroglu, P., Deymeer, F., Ozdemir, C., Calafell, F., Tolun, A. (2000) Deletion pattern in the dystrophin gene in Turks and a comparison with Europeans and Indians. Ann. Hum. Genet., 64, 33-40.
42. Rosenberg, C., Navajas, L., Vagenas, D. F., Bakker, E., Vainzof M., Passos-Bueno, M. R., Takata, R. I., Van Ommen, G. J., Zatz, M., Den Dunnen, J. T. (1998) Clinical diagnosis of heterozygous dystrophin gene deletions by fluorescence in situ hybridization. Neuromuscul. Disord., 8, 447-452.
43. Sertic, J., Barisic, N., Sostarko, M., Brzovic, Z., Stavljenic-Rukavina, A. (1997) Deletion screening of the Duchenne/Becker muscular dystrophy gene in Croatian population. Coll. Antropol., 21, 151-156.
44. Rando, T. A., Blau, H. M. (1994) Primary mouse myoblast purification, characterization, and transplantation for cell-mediated gene therapy. J. Cell Biol., 125, 1275-1287.
45. Murry, C. E., Kay, M. A., Bartosek, T., Hauschka, S. D., Schwartz, S. M. (1996) Muscle differentiation during repair of myocardial necrosis in rats via gene transfer with MyoD. J. Clin. Invest., 98, 2209-2217.
46. Roest, P. A., van der Tuijn, A. C., Ginjaar, H. B., Hoeben, R. C., Hoger-Vorst, F. B., Bakker, E., den Dunnen, J. T., van Ommen, G. J. (1996) Application of in vitro Myo-differentiation of non-muscle cells to enhance gene expression and facilitate analysis of muscle proteins. Neuromuscul. Disord., 6, 195-202.
47. Havenga, M. J., Lemckert, A. A., Ophorst, O. J., van Meijer, M., Germeraad, W. T., Grimbergen, J., van Den Doel, M. A., Vogels, R., van Deutekom, J., Janson, A. A., et al (2002) Exploiting the natural diversity in adenovirus tropism for therapy and prevention of disease. J. Virol., 76, 4612-4620.
48. Anderson, L. V., Davison, K. (1999) Multiplex Western blotting system for the analysis of muscular dystrophy proteins. Am. J. Pathol., 154, 1017-1022.
49. Neugebauer, K M, et al., J Cell Biol 129:899-908 (1995).
50. Tacke R and Manley J L, Proc Soc Exp Biol Med 220:59-63 (1999).
51. Graveley B R et al., Curr Biol 9:R6-7 (1999).
52. Misteli T et al., Nature 387:523-527 (1997).
53. Gorman L, Suter D, Emerick V, et al. Stable alteration of pre mRNA splicing patterns by modified U7 small nuclear RNAs. Proc Natl Acad Sci USA 1998; 95:4929 4934.
54. Suter D, Tomasini R, Reber U, et al. Double target antisense U7 snRNAs promote efficient skipping of an aberrant exon in three human beta thalassemic mutations. Hum Mol Genet 1999; 8:2415 2423
(83) TABLE-US-00001 TABLE 1 Overview of the patients, the AONs and the primer sets used in this study Targeted RT- Primary PCR Nested Patients Mutations exons AONs.sup.a primers.sup.b sets.sup.b PCR sets.sup.b DL 515.2 Deletion exon 45-50 Exon 51 h51AON1 h53r h41f-h53r h42f-h52r DL 363.2 Deletion exon 45-54 Exon 44 h44AON1 h55r2 h42f-h55r2 h44f-h55r 50685.1 Deletion exon 48-50 Exon 51 h51AON1 h53r h46f-h53r h47f-h52r DL 589.2 Deletion exon 51-55 Exon 50 h50AON1 h58r h47f-h58r h49f-h57r 53914.1 Deletion exon 52 Exon 51 h51AON1 h55r h49f-h55r h50f-h54r Exon 53 h53AON1 50423.1 Point mutation exon 49 Exon 49 h49AON1 h52r h46f-h52r h47f-h51r .sup.aAON sequences were published previously (23). .sup.bPrimer sequences available upon request.
(84) TABLE-US-00002 TABLE2 CharacteristicsoftheAONsusedtostudythetargetedskippingof15 differentDMDaxons.sup.a Length Exon Name Antisensesequence(5-3) (bp) G/C% U/C% skip Transcript h2AON1 cccauuuugugaauguuuucuuuu 24 29 75 + OF h2AON2 uugugcauuuacccauuuugug 22 36 68 - OF h29AON1 uauccucugaaugucgcauc 20 45 65 + IF h29AON2 ggunauccucugaaugucgc 20 50 60 + IF h40AON1 gagccuuuuuucuucuuug 19 37 79 + IF h40AON2 uccuuucgucucugggcuc 19 58 79 + IF h41AON1 cuccucuuucuucuucugc 19 47 95 + IF h41AON2 cuucgaaacugagcaaauuu 20 35 50 + IF h42AON1 cuugugagacaugagug 17 47 41 + IF h42AON2 cagagacuccucuugcuu 18 50 67 + IF h43AON1 ugcugcugucuucuugcu 18 50 78 - OF h43AON2 uuguuaacuuuuucccauu 19 26 79 + OF h44AON1 cgccgccauuucucaacag 19 58 63 + OF h44AON2 uuuguauuuagcauguuccc 20 35 70 + OF h45AON1 gcugaauuauuucuucccc 19 42 74 - OF h45AON5 gcccaaugccauccugg 17 65 58 + OF h46AON4b cugcuuccuccaacc 15 60 80 + OF h46AON8b gcuuuucuuuuaguugcugc 20 40 75 + OF h47AON1 ucuugcucuucugggcuu 18 50 78 - IF h47AON2 cuugagcuuauuuucaaguuu 21 29 67 - IF h48AON1 uuucuccuuguuucuc 16 38 94 - IF h48AON2 ccauaaauuuccaacugauuc 21 33 62 - IF h49AON1 cuuccacauccgguuguuu 19 47 74 + IF h49AON2 guggcugguuuuuccuugu 19 47 68 + IF h50AON1 cucagagcucagaucuu 17 47 59 + OF h50AON2 ggcugcuuugcccuc 15 67 73 - OF h51AON1 ucaaggaagauggcauuucu 20 40 45 + OF h51AON2 ccucugugauuuuauaacuugau 23 30 65 + OF h53AON1 cuguugccuccgguucug 18 61 72 + OF h53AON2 uuggcucuggccuguccu 18 61 72 - OF .sup.aTwo AONs were tested per exon. Their different lengths and G/C contents (%) did not correlate to their effectivity in exon skipping (1, induced skipping, 2, no skipping). The AONs were directed to purine (A/G)-rich sequences as indicated by their (antisense) U/C content (%). Skipping of the target axons resulted in either an in-frame (IF) or an out-of-frame (OF) transcript. bvan Deutekom et al., 2001 [21].
(85) TABLE-US-00003 TABLE 3 Primer sets used for the RT-PCR analyses to detect the skipping of the targeted exons.sup.a Primary PCR Nested PCR Target exon RT-primer primer set primer set 2 h4r h1f1-h4r h1f2-h3r 2 h9r h1f1-h9r h1f2-h8r 29 h31r h25f-h31r h26f-h30r 40 h44r h38f-h44r h39f-h43r 41 h44r h38f-h44r h39f-h43r 42 h44r h38f-h44r h39f-h43r 43 h47r h41f-h47r h42f-h46r 44 h47r h41f-h47r h42f-h46r 45 h47r h41f-h47r h42f-h46r 46 h48r h44f-h48r h45f-h47r 47 h52r h44f-h52r h46f-h51r 48 h52r h44f-h52r h46f-h51r 49 h52r h44f-h52r h46f-h51r 50 h52r h44f-h52r h46f-h51r 51 h53r h47f-h53r h49f-h52r 53 h55r h50f-h55r h51f-h54r .sup.aPrimer sequences are available upon request.
(86) TABLE-US-00004 TABLE 4 Overview and frequency of the DMD-causing mutations in the Leiden DMD (LDMD) Database, theoretically correctable by skipping one of the 12 exons successfully targeted in this study Therapeutic for DMD-mutations: % of No. of % of dupli- nonsense Deletions deletions Dupli- cations mutations Skippable (exons) in LDMD cations in LDMD in LDMD exon (exons) Database (exons) Database Database 2 3-7, 3-19, 3-21 2.9 2 9.0 29 5 40 1 41 4 42 0 43 44, 44-47, 3.7 43 3.0 44-49, 44-51 44 5-43, 14-43, 7.8 44 3.0 19-43, 30-43, 35-43, 36-43, 40-43, 42-43, 45, 45-54 46 21-45, 45, 5.6 47-54, 47-56 49 1 50 51, 51-53, 5.2 50 3.0 51-55 51 45-50, 47-50, 17.5 51 1.5 48-50, 49-50, 50, 52, 52-63 53 10-52, 45-52, 7.5 46-52, 47-52, 48-52, 49-52, 50-52, 52
(87) TABLE-US-00005 TABLE 5 Overview of the patients, the AONs and the primer sets used in example 3 Targeted RT- Primary PCR Nested PCR Patients Mutations exons AONs primers.sup.b primer sets.sup.b primer sets.sup.b DL 90.3 Nonsense mutation Exon 43 h43AON2.sup.a h48r h41f-h48r h42f-h47r exon 43 Exon 44 h44AON1.sup.a DL470.2 Deletion exon 46-50 Exon 45 h45AON5 h53r h42f-h53r h43-h52r Exon 51 h51AON2.sup.a Exon 45 U-linker h53r h42f-h53r h43f-h52r Exon 51 AON.sup.c .sup.aSeperate AON sequences were published previously [Aartsma-Rus, 2002]. .sup.bPrimer sequences available upon request. .sup.cU linker AON consists of h45AON5 linked to h51AON2 by 10 uracils.