DNA vaccine containing VEGF-specific epitope and/or angiopoietin-2-specific epitope
10543261 ยท 2020-01-28
Assignee
Inventors
- Hironori Nakagami (Suita, JP)
- Mariko Kyutoku (Suita, JP)
- Ryuichi Morishita (Suita, JP)
- Hideki Tomioka (Ibaraki, JP)
Cpc classification
C12N2730/10143
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C12N2730/10134
CHEMISTRY; METALLURGY
A61K2039/545
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
C12N7/00
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
Abstract
The present invention provides a therapeutic or prophylactic agent for cancer, containing an expression vector encoding a chimeric Hepatitis B virus core antigen polypeptide inserted with an amino acid sequence containing a specific epitope of VEGF and/or a specific epitope of angiopoietin-2, wherein the amino acid sequence containing the specific epitope is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide.
Claims
1. A therapeutic or prophylactic agent for cancer, comprising an expression vector encoding a chimeric Hepatitis B virus core antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of VEGF, wherein the amino acid sequence comprising the specific epitope is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide, and wherein the inserted amino acid sequence comprises the amino acid sequence shown in SEQ ID NO: 1 or 2.
2. The therapeutic or prophylactic agent according to claim 1, wherein the cancer is a solid tumor.
3. The therapeutic or prophylactic agent according to claim 2, wherein the solid tumor is any one kind selected from the group consisting of non-small cell lung cancer, colorectal cancer, breast cancer, pancreatic cancer, gastric cancer, uterine cancer and prostate cancer.
4. The therapeutic or prophylactic agent according to claim 1, wherein the inserted amino acid sequence comprises the amino acid sequence shown in SEQ ID NO: 32 or 33, a partial sequence of the amino acid sequence shown in SEQ ID NO: 32, which comprises the amino acid sequence shown in SEQ ID NO: 1, or a partial sequence of the amino acid sequence shown in SEQ ID NO: 33, which comprises the amino acid sequence shown in SEQ ID NO: 2.
5. The therapeutic or prophylactic agent according to claim 1, which is administered plural times.
6. The therapeutic or prophylactic agent according to claim 5, wherein the administration number is 2, 3 or 4.
7. The therapeutic or prophylactic agent according to claim 6, wherein the administration number is 3.
8. The therapeutic or prophylactic agent according to claim 1, which is administered 3 times at half year intervals.
9. An expression vector encoding a chimeric Hepatitis B virus core antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of VEGF, which is for use in the treatment or prophylaxis of cancer, wherein the amino acid sequence comprising the specific epitope is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide, and wherein the inserted amino acid sequence comprises the amino acid sequence shown in SEQ ID NO: 1 or 2.
10. The expression vector according to claim 9, wherein the cancer is non-small cell lung cancer, colorectal cancer, breast cancer, pancreatic cancer, gastric cancer, uterine cancer, or prostate cancer.
11. A method for the treatment or prophylaxis of cancer in a mammal, comprising administering an effective amount of an expression vector encoding a chimeric Hepatitis B virus core antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of VEGF to the mammal, wherein the amino acid sequence comprising the specific epitope is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide, wherein the inserted amino acid sequence comprises the amino acid sequence shown in SEQ ID NO: 1 or 2, and wherein the expression vector is administered to a mouse when the inserted amino acid sequence comprises the amino acid sequence shown in SEQ ID NO: 1, and the expression vector is administered to a human when the inserted amino acid sequence comprises the amino acid sequence shown in SEQ ID NO: 2.
12. The method according to claim 11, wherein the cancer is a solid tumor.
13. The method according to claim 12, wherein the solid tumor is any one kind selected from the group consisting of non-small cell lung cancer, colorectal cancer, breast cancer, pancreatic cancer, gastric cancer, uterine cancer and prostate cancer.
14. The method according to claim 11, wherein the inserted amino acid sequence comprises the amino acid sequence shown in SEQ ID NO: 32 or 33, a partial sequence of the amino acid sequence shown in SEQ ID NO: 32, which comprises the amino acid sequence shown in SEQ ID NO: 1, or a partial sequence of the amino acid sequence shown in SEQ ID NO: 33, which comprises the amino acid sequence shown in SEQ ID NO: 2.
15. The method according to claim 11, wherein the expression vector is administered plural times.
16. The method according to claim 15, wherein the expression vector is administered 2, 3 or 4 times.
17. The method according to claim 16, the expression vector is administered 3 times.
18. The method according to claim 11, wherein the expression vector is administered 3 times at half year intervals.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11) Data were meansS.E.M. of triplicates.
DESCRIPTION OF EMBODIMENTS
(12) The present invention provides a therapeutic or prophylactic agent for cancer, comprising an expression vector encoding a chimeric hepatitis B virus core antigen polypeptide inserted with an amino acid sequence comprising a specific epitope of VEGF and/or a specific epitope of angiopoietin-2, wherein the amino acid sequence comprising the specific epitope is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide.
(13) When an expression vector encoding a chimeric hepatitis B virus core antigen polypeptide inserted with an amino acid sequence containing a specific epitope of VEGF and/or a specific epitope of angiopoietin-2 is administered, an immune response (preferably humoral immune response such as antibody production and the like) to the specific epitope of VEGF and/or the specific epitope of angiopoietin-2 in the expressed chimeric hepatitis B virus core antigen polypeptide is induced, and the activity of VEGF and/or angiopoietin-2 is neutralized with the antibody, whereby the angiogenesis around the cancer tissues can be suppressed and the growth of the cancer tissue can be inhibited. Accordingly, the cancer to be the target of the therapeutic or prophylactic agent of the present invention is preferably a solid tumor. Examples of the solid tumor include, but are not limited to, non-small cell lung cancer, colorectal cancer, breast cancer, pancreatic cancer, gastric cancer, uterine cancer, prostate cancer and the like.
(14) While the cancer to be the target of the therapeutic or prophylactic agent of the present invention is not limited, it is preferably a cancer expressing VEGF and/or angiopoietin-2. The presence or absence of expression of VEGF and/or angiopoietin-2 in cancer can be confirmed by immunological methods (immunohistochemical staining, Western blotting etc.) using a specific antibody to VEGF and/a specific antibody to angiopoietin-2.
(15) While use of VEGF and angiopoietin-2 derived from a mammal of the application target of the therapeutic or prophylactic agent of the present invention is intended in the present invention, it is not limited thereto. The application target of the therapeutic or prophylactic agent of the present invention is a mammal. Examples of the mammal include rodents such as mouse, rat, hamster, guinea pig and the like, lagomorphas such as rabbit and the like, ungulates such as swine, bovine, goat, horse, sheep and the like, carnivore such as dog, cat and the like, primates such as human, monkey, Macaca mulatta, Macaca fascicularis, marmoset, orangutan, chimpanzee and the like, and the like. The mammal is preferably a rodent (mouse etc.) or a primate (human etc.). Therefore, for example, when the therapeutic or prophylactic agent of the present invention is applied to human, use of VEGF and angiopoietin-2 derived from the human is intended, but is not limited thereto. Also, the therapeutic or prophylactic agent of the present invention is applied to mouse, use of VEGF and angiopoietin-2 derived from the mouse is intended, but is not limited thereto.
(16) In the present specification, regarding the particular factor X (polypeptide or polynucleotide), factor X derived from organism Y or organism Y factor X means that the amino acid sequence or nucleic acid sequence of factor X has the same or substantially the same amino acid sequence or nucleic acid sequence as the amino acid sequence or nucleic acid sequence of factor X naturally expressed in organism Y. Being substantially the same means that the amino acid sequence or nucleic acid sequence of interest has not less than 70% (preferably not less than 80%, more preferably not less than 90%, still more preferably not less than 95%, most preferably not less than 99%) identity with the amino acid sequence or nucleic acid sequence of factor X naturally expressed in organism Y, and the function of factor X is maintained.
(17) VEGF and angiopoietin-2 are known angiogenesis factors, and the amino acid sequences and cDNA sequences thereof are also known. VEGF contains 7 subtypes including A, B, C, D, E, PLGF-1 and PLGF-2, and a specific epitope of VEGF of any subtype can be used in the present invention as long as it treats or prevents cancer. Preferably, specific epitopes of VEGF-A, B, C, D, E are used. Representative amino acid sequences include the following and the like.
(18) TABLE-US-00001 TABLE 1 Human Mouse VEGF-A P15692 (SEQ ID NO: 13) Q00731 (SEQ ID NO: 19) VEGF-B P49765 (SEQ ID NO: 14) P49766 (SEQ ID NO: 20) VEGF-C P49767 (SEQ ID NO: 15) P97953 (SEQ ID NO: 21) VEGF-D O43915 (SEQ ID NO: 16) P97946 (SEQ ID NO: 22) VEGF-E Q9NRA1 (SEQ ID NO: 17) Q8CI19 (SEQ ID NO: 23) PLGF-1 P49763 (SEQ ID NO: 18) P49764 (SEQ ID NO: 24)
(19) Representative amino acid sequences of angiopoietin-2 are as follows.
(20) TABLE-US-00002 TABLE 2 Human Mouse Angiopoietin-2 O15123 (SEQ ID NO: 25) O35608 (SEQ ID NO: 26)
(21) In the present specification, epitope refers to a basic element or minimum unit for recognition by each antibody or T cell receptor, which is a particular domain, region or molecular structure the aforementioned antibody or T cell receptor binds to.
(22) An epitope of VEGF and an epitope of angiopoietin-2 to be used in the present invention are specific to said VEGF and angiopoietin-2. Being specific means that the gene products (excluding variable regions of immunoglobulin and T cell receptor) other than the VEGF and angiopoietin-2 naturally expressed in a mammal, from which the VEGF and angiopoietin-2 derive, do not contain said epitope.
(23) As the specific epitope of VEGF and specific epitope of angiopoietin-2 to be used in the present invention, one at a position where the activity of VEGF and angiopoietin-2 is inhibited when an antibody that recognizes the epitope binds to the epitope, is preferably selected. Such epitope can be in a functional site, for example, receptor binding site, divalent ion binding site, site recognized by a specific enzyme and the like. An epitope contained in a site removed during the maturation process of VEGF and angiopoietin-2, such as signal sequence and the like, is preferably excluded from epitope to be used in the present invention. Those of ordinary skill in the art can appropriately select the epitope based on the steric structures and the like of VEGF and angiopoietin-2.
(24) The length of the amino acid sequence of the epitope is generally 5-30 amino acids, preferably 6-25 amino acids, more preferably 10-18 amino acids, furthermore preferably 11-16 amino acids. When the amino acid sequence is too short, the antigenicity of the epitope may be lost. When the amino acid sequence is too long, chimeric hepatitis B virus core antigen polypeptide does not easily form core particles due to self-assembly, as a result of which an antibody that specifically recognizes the epitope may not be produced, and a superior treatment or improvement effect on cancer may not be obtained.
(25) Specific examples of a preferable epitope of VEGF and angiopoietin-2 include the following.
(26) TABLE-US-00003 (VEGF) (i) IMRIKPHQGQHIG (SEQIDNO:1) (ii) IMRIKPHQGQHIG (SEQIDNO:2) (angiopoietin-2) (iii) PQRQNTNKFNGIKWYY (SEQIDNO:3) (iv) YYPQRQNTNKE (SEQIDNO:4)
(27) In a further aspect, specific preferable examples of VEGF include the following.
(28) TABLE-US-00004 (v) MRIKPHQ (SEQIDNO:31) (vi) MQIMRIKPHQSQHIGEM (SEQIDNO:32) (vii) MQIMRIKPHQSQHIGEM (SEQIDNO:33)
(viii) an epitope consisting of a partial sequence of the amino acid sequence shown in SEQ ID NO: 32, which contains the amino acid sequence shown in SEQ ID NO: 1 or 31
(ix) an epitope consisting of a partial sequence of the amino acid sequence shown in SEQ ID NO: 33, which contains the amino acid sequence shown in SEQ ID NO: 2 or 31
(29) SEQ ID NOs: 1, 31 and 32 are partial amino acid sequences of mouse VEGF-A. SEQ ID NOs: 2, 31 and 34 are partial amino acid sequences of human VEGF-A. SEQ ID NOs: 3 and 4 are partial amino acid sequences of human angiopoietin-2.
(30) The length of the partial sequence in the above-mentioned (viii) and (ix) is 8, 9, 10, 11, 12, 13, 14, 15 or 16 amino acids.
(31) Hepatitis B virus core antigen polypeptide used in the present invention is
(32) (1) a polypeptide containing the amino acid sequence shown by SEQ ID NO: 6, or
(33) (2) a polypeptide containing an amino acid sequence having not less than 90% (preferably not less than 95%, more preferably not less than 97%, still more preferably not less than 99%) identity with the amino acid sequence shown by SEQ ID NO: 6, and having an activity to form core particles due to self-assembly.
(34) Self-assembly refers to a phenomenon wherein molecules dissolved in a solution associate to form an assembly. Core particle refers to a rigid structure having a specific repetitive constitution. In the present specification, the core particle may be a product of synthesis steps or a product of biological steps.
(35) As the polypeptide of the embodiment of (2), a polypeptide containing the amino acid sequence shown by SEQ ID NO: 7 disclosed in WO 2003/031466 can be mentioned. A polypeptide containing the amino acid sequence shown by SEQ ID NO: 7 except that one or plural cysteine residues of the positions 48, 61, 107 and 185 are deleted or substituted by other amino acid residue (e.g., serine residue) is also preferable as the polypeptide of the embodiment of (2). As recognized by those of ordinary skill in the art, in a polypeptide having an amino acid sequence different from that of SEQ ID NO: 7, cysteine residues at similar positions can be deleted or substituted by other amino acid residues, and polypeptides obtained by such deletion and substitution are also encompassed in the polypeptide of the embodiment of (2).
(36) The polypeptide of the embodiment of (2) also encompasses a variant polypeptide wherein the isoleucine residue at the position corresponding to the position 97 of SEQ ID NO: 7 is substituted by leucine residue or phenylalanine residue (Yuan et al., J. Virol. vol. 73, pages 10122-10128 (1999)). In addition, amino acid sequences of many HBcAg variants and several kinds of hepatitis B core antigen precursor variants are disclosed in GenBank reports AAF121240, AF121239, X85297, X02496, X85305, X85303, AF151735, X85259, X85286, X85260, X85317, X85298, AF043593, M20706, X85295, X80925, X85284, X85275, X72702, X85291, X65258, X85302, M32138, X85293, X85315, U95551, X85256, X85316, X85296, AB033559, X59795, X8529, X85307, X65257, X85311, X85301, X85314, X85287, X85272, X85319, AB010289, X85285, AB010289, AF121242, M90520, P03153, AF110999 and M95589 (each of the disclosures is incorporated in the present specification by reference), and polypeptides containing amino acid sequences of these variants are also encompassed in the polypeptide of the embodiment of (2). The above-mentioned variants have amino acid sequences different at many positions including amino acid residues corresponding to the amino acid residues present at the positions 12, 13, 21, 22, 24, 29, 32, 33, 35, 38, 40, 42, 44, 45, 49, 51, 57, 58, 59, 64, 66, 67, 69, 74, 77, 80, 81, 87, 92, 93, 97, 98, 100, 103, 105, 106, 109, 113, 116, 121, 126, 130, 133, 135, 141, 147, 149, 157, 176, 178, 182 and 183 in SEQ ID NO: 7.
(37) Furthermore, polypeptides containing the amino acid sequences of the HBcAg variants described in WO 01/98333, WO 01/77158 and WO 02/14478, all of which are incorporated in the present specification by reference are also encompassed in the polypeptide of the embodiment of (2).
(38) In the present specification, unless particularly indicated, the positions of amino acid residues in the amino acid sequence of hepatitis B virus core antigen polypeptide are specified with the amino acid sequence shown by SEQ ID NO: 6 as the standard. When a polypeptide does not contain the amino acid sequence shown by SEQ ID NO: 6, the amino acid sequence of the polypeptide is aligned with the amino acid sequence shown by SEQ ID NO: 6, and the position of the corresponding amino acid residue is adopted.
(39) The hepatitis B virus core antigen polypeptide used in the present invention is preferably a polypeptide containing the amino acid sequence shown by SEQ ID NO: 6.
(40) In the chimeric hepatitis B virus core antigen polypeptide to be used in the present invention, an amino acid sequence comprising a specific epitope of VEGF and/or a specific epitope of angiopoietin-2 is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide. That is, the chimeric hepatitis B virus core antigen polypeptide to be used in the present invention contains the following elements (a)-(c):
(41) (a) N-terminus part polypeptide residues of hepatitis B virus core antigen polypeptide (consisting of the continuous partial amino acid sequence of hepatitis B virus core antigen polypeptide from N-terminus to the amino acid residue 80),
(42) (b) an amino acid sequence consisting of a specific epitope of VEGF and/or a specific epitope of angiopoietin-2, and
(43) (c) C-terminus partial polypeptide residues of hepatitis B virus core antigen polypeptide (consisting of the continuous partial amino acid sequence of hepatitis B virus core antigen polypeptide from the amino acid residue 81 to C-terminus) in the order of (a), (b), (c) from the N terminus side.
(44) The chimeric hepatitis B virus core antigen polypeptide to be used in the present invention having the above-mentioned constitution forms core particles due to self-assembly, and a specific epitope of VEGF and/or a specific epitope of angiopoietin-2 is presented on the outside of the particles.
(45) The amino acid sequence inserted between constituent element (a) and constituent element (c) may further contain, in addition to constituent element (b) (amino acid sequence consisting of a specific epitope of VEGF and/or a specific epitope of angiopoietin-2), one or more (preferably 1-3, more preferably 1) specific epitopes. The further specific epitope may be inserted at any position between constituent element (a) and constituent element (b), or constituent element (b) and constituent element (c). The length of the amino acid sequence of the further specific epitope is generally 5-30 amino acids, preferably 6-25 amino acids, more preferably 10-18 amino acids, further more preferably 11-16 amino acids.
(46) When plural specific epitopes are inserted between constituent element (a) and constituent element (c), the specific epitopes may be directly linked by a covalent bond, or linked via a spacer sequence. The spacer sequence means an amino acid sequence containing one or more amino acid residues to be inserted between two adjacent constituent elements contained in the chimeric hepatitis B virus core antigen polypeptide. The specific epitopes are preferably linked via a spacer sequence so that plural specific epitopes can be stably presented while maintaining their structures. The length of the spacer sequence is not limited as long as the chimeric hepatitis B virus core antigen polypeptide forms core particles by self-assembly, and all inserted specific epitopes are presented outside the particles, and is generally 1-10 amino acids, preferably 1-5 amino acids, more preferably 1-3 amino acids, most preferably 2 or 3 amino acids.
(47) A specific epitope on the most N-terminal side between constituent element (a) and constituent element (c), and constituent element (a) may be directly connected by a covalent bond or via a spacer sequence. The element (a) and the specific epitope on the most N-terminal side are preferably connected via a spacer sequence so that a specific epitope of VEGF and/or a specific epitope of angiopoietin-2 will be stably presented on the outside of the particles formed by self-assembly of chimeric hepatitis B virus core antigen polypeptides, while maintaining its structure. While the length of the spacer sequence is not limited as long as chimeric hepatitis B virus core antigen polypeptide forms core particles due to self-assembly and a specific epitope of VEGF and/or a specific epitope of angiopoietin-2 is presented on the outside of the particles, it is generally 1-10 amino acids, preferably 1-5 amino acids, more preferably 1-3 amino acids, most preferably 2 or 3 amino acids. Also, the kind of the spacer sequence is not limited as long as chimeric hepatitis B virus core antigen polypeptide forms core particles due to self-assembly and a specific epitope of VEGF and/or a specific epitope of angiopoietin-2 is presented on the outside of the particles. Examples of a preferable spacer sequence include, but are not limited to, IT, GAT, CGG and the like.
(48) A specific epitope on the most C-terminal side between constituent element (a) and constituent element (c), and constituent element (c) may be directly connected by a covalent bond or via a spacer sequence. The element (b) and the element (c) are preferably connected via a spacer sequence so that a specific epitope of VEGF and/or a specific epitope of angiopoietin-2 will be stably presented on the outside of the particles formed by self-assembly of chimeric hepatitis B virus core antigen polypeptides, while maintaining its structure. While the length of the spacer sequence is not limited as long as chimeric hepatitis B virus core antigen polypeptide forms core particles due to self-assembly and a specific epitope of VEGF and/or a specific epitope of angiopoietin-2 is presented on the outside of the particles, it is generally 1-10 amino acids, preferably 1-5 amino acids, more preferably 1-3 amino acids, most preferably 2 or 3 amino acids. Also, the kind of the spacer sequence is not limited as long as chimeric hepatitis B virus core antigen polypeptide forms core particles due to self-assembly and a specific epitope of VEGF and/or a specific epitope of angiopoietin-2 is presented on the outside of the particles. Examples of a preferable spacer sequence include, but are not limited to, IT, GAT, CGG and the like.
(49) The length of the amino acid sequence inserted between constituent element (a) and constituent element (c) is not particularly limited as long as chimeric hepatitis B virus core antigen polypeptide forms core particles due to self-assembly, and a VEGF specific epitope and/or a angiopoietin-2 specific epitope is presented on the outside of the particles, and cancer can be treated or prevented, and is generally 5-80 amino acids. When the inserted amino acid sequence is too short, the antigenicity as an epitope may be lost. When the inserted amino acid sequence is too long, formation of core particles by chimeric hepatitis B virus core antigen polypeptide due to self-assembly becomes difficult, as a result of which an antibody specifically recognizing the inserted epitope is not produced, and a good treatment or improvement effect on cancer may not be obtained.
(50) The expression vector used in the present invention is a recombinant vector incorporating a polynucleotide encoding the above-mentioned chimeric hepatitis B virus core antigen polypeptide. When the expression vector is administered to a target mammal, the expression vector is intracellularly incorporated into the target mammal, and the cell expresses the above-mentioned chimeric hepatitis B virus core antigen polypeptide. Examples of the expression vector inserted with polynucleotide encoding chimeric hepatitis B virus core antigen polypeptide include plasmid, virus, phage, cosmid and other vectors conventionally used in the art. Examples of the plasmid vector include, but are not limited to, pCAGGS (Gene 108: 193-199 (1991)), pCR-X8 (Vaccine 24: 4942-4950 (2006)), pcDNA3.1 (trade name, Invitrogen), pZeoSV (trade name, Invitrogen), pBK-CMV (trade name, Stratagene) and the like. The virus vector is a DNA virus or an RNA virus. Examples of the virus vector include, but are not limited to, detoxicated retrovirus, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, poxvirus, polio virus, Sindbis virus, Hemagglutinating Virus of Japan (HVJ), SV40, human immunodeficient virus (HIV) and the like. Furthermore, Hemagglutinating Virus of Japan envelope (HVJ-E) and the like can also be utilized.
(51) In the above-mentioned expression vector, polynucleotide (preferably DNA) encoding chimeric hepatitis B virus core antigen polypeptide is operably connected to a promoter capable of exhibiting a promoter activity in the cell of a mammal (preferably human) to be the administration subject.
(52) The promoter to be used is not particularly limited as long as it can function in the cell of a mammal (preferably human) to be the administration subject. Examples of the promoter include pol I promoter, pol II promoter, pol III promoter and the like. Specifically, virus promoters such as SV40-derived initial promoter, cytomegalovirus LTR and the like, mammal constituting protein gene promoters such as -actin gene promoter and the like, RNA promoters such as tRNA promoter and the like, and the like are used.
(53) The above-mentioned expression vector preferably contains a transcription termination signal, i.e., terminator region, at the downstream of the polynucleotide encoding chimeric hepatitis B virus core antigen polypeptide. It can further contain a selection marker gene for the selection of a transformed cell (gene conferring resistance to medicaments such as tetracycline, ampicillin, kanamycin and the like, gene complementing auxotrophic mutation etc.).
(54) In one embodiment, the above-mentioned expression vector may contain an immune stimulatory sequence (ISS) (also referred to as CpG) to potentiate the immune effect. The immune stimulatory sequence is a DNA containing a non-methylated CpG motif of bacterium, and is known to function as a ligand of a particular receptor (Toll-like receptor 9) (see Biochim. Biophys. Acta 1489, 107-116 (1999) and Curr. Opin. Microbiol. 6, 472-477 (2003) for the detail). Preferable examples of the immune stimulatory sequence include the following.
(55) TABLE-US-00005 CpG-B101822bp (SEQIDNO:8) 5-tgactgtgaacgttcgagatga-3 CpG-AD1920bp(Dtype) (SEQIDNO:9) 5-ggtgcatcgatgcagggggg-3 CpG-CC27421bp (SEQIDNO:10) 5-tcgtcgaacgttcgagatgat-3 CpG-CC69525bp (SEQIDNO:11) 5-tcgaacgttcgaacgttcgaacgtt-3
(56) Alternatively, 2, 3 or 4 from these ISSs may be connected and used. Preferable examples of the connected ISS sequence include the following.
(57) TABLE-US-00006 (SEQIDNO:12) 5-ggtgcatcgatgcaggggggtgactgtga acgttcgagatgatcgtcgaacgttcgagat gattcgaacgttcgaacgttcgaacgtt-3
(58) Those of ordinary skill in the art can construct the aforementioned expression vector according to well-known genetic engineering techniques described in, for example, edit. Sambrook et al., Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory (1989) N.Y., edit. Ausubel et al., Current Protocols in Molecular Biology (1987) John Wiley & Sons and the like.
(59) The therapeutic or improving agent of the present invention can be provided as a pharmaceutical composition containing, in addition to a therapeutically effective amount of the above-mentioned expression vector, any carrier, for example, a pharmaceutically acceptable carrier.
(60) Examples of the pharmaceutically acceptable carrier include, though not limited thereto, excipients such as sucrose, starch, mannit, sorbit, lactose, glucose, cellulose, talc, calcium phosphate, calcium carbonate and the like, binders such as cellulose, methylcellulose, hydroxypropylcellulose, gelatin, gum arabic, polyethylene glycol, sucrose, starch and the like, disintegrants such as starch, carboxymethylcellulose, hydroxypropylstarch, sodium-glycol-starch, sodium hydrogen carbonate, calcium phosphate, calcium citrate and the like, lubricants such as magnesium stearate, aerosil, talc, sodium lauryl sulfate and the like, aromatics such as citric acid, menthol, glycyrrhizin.ammonium salt, glycine, orange power and the like, preservatives such as sodium benzoate, sodium bisulfite, methylparaben, propylparaben and the like, stabilizers such as citric acid, sodium citrate, acetic acid and the like, suspending agent such as methylcellulose, polyvinylpyrrolidone, aluminum stearate and the like, dispersing agents such as surfactant and the like, diluents such as water, saline and the like, base waxes such as cacao butter, polyethylene glycol, white kerosine and the like, and the like.
(61) The therapeutic or improving agent of the present invention may further contain an adjuvant to potentiate its effect. Examples of the adjuvant include aluminum hydroxide, complete Freund's adjuvant, incomplete Freund's adjuvant, pertussis adjuvant, poly(I:C), CpG-DNA and the like.
(62) To promote intracellular introduction of an expression vector, the therapeutic or prophylactic agent of the present invention may further contain a reagent for nucleic acid introduction. As the reagent for nucleic acid introduction, cationic lipids such as lipofectin (trade name, Invitrogen), lipofectamine (trade name, Invitrogen), transfectam (trade name, Promega), DOTAP (trade name, Roche Applied Science), dioctadecylamidoglycyl spermine (DOGS), L-dioleoyl phosphatidyl-ethanolamine (DOPE), dimethyldioctadecyl-ammonium bromide (DDRB), N,N-di-n-hexadecyl-N,N-dihydroxyethylammonium bromide (DHDEAB), N-n-hexadecyl-N,N-dihydroxyethylammonium bromide (HDEAB), polybrene, poly(ethyleneimine) (PEI) and the like can be used. In addition, an expression vector may be included in any known liposome constituted of a lipid bilayer such as electrostatic liposome. Such liposome may be fused with a virus such as inactivated Hemagglutinating Virus of Japan (HVJ). HVJ-liposome has a very high fusion activity with a cellular membrane, as compared to general liposomes. When retrovirus is used as an expression vector, RetroNectin, fibronectin, polybrene and the like can be used as transfection reagents.
(63) While the content of the above-mentioned expression vector in the pharmaceutical composition is not particularly limited and appropriately selected from a wide range, it is generally about 0.00001 to 100 wt % of the whole pharmaceutical composition.
(64) By introducing the above-mentioned expression vector into a tissue (or cell) of an application target mammalian, the therapeutic or prophylactic agent of the present invention induces in vivo expression of the above-mentioned chimeric Hepatitis B virus core antigen polypeptide, induces production of an antibody to the epitope of VEGF and/or the epitope of angiopoietin-2 contained in the chimeric Hepatitis B virus core antigen polypeptide, and suppresses angiogenesis around the cancer tissues and inhibits the growth of cancer tissues by neutralization of the activity of the VEGF and/or angiopoietin-2 by the induced antibody. Various methods for introducing nucleic acids such as expression vector and the like into the body are known (T. Friedman, Science 244: 1275-1281 (1989)), and any introduction method can be adopted as long as it can induce in vivo expression of the above-mentioned chimeric Hepatitis B virus core antigen polypeptide, induce production of an antibody to the epitope of VEGF and/or the epitope of angiopoietin-2 contained in the chimeric Hepatitis B virus core antigen polypeptide, and treat or prevent cancer.
(65) Examples of the method for introducing an expression vector into a mammalian tissue (or cell) in vivo include, but are not limited to, inner liposome method, electrostatic liposome method, HVJ-liposome method, HVJ-AVE liposome method, receptor-mediated transgene, particle gun method, naked DNA method, introduction method by positive electric charge polymer, electroporator method and the like.
(66) Alternatively, cells such as blood cells, bone marrow cells and the like may be isolated from the application target mammal, the above-mentioned expression vector may be introduced into the cells ex vivo, after which the obtained cells containing the above-mentioned expression vector may be returned to the application target mammal.
(67) Examples of the method for introducing an expression vector into a mammalian cell ex vivo include, but are not limited to, lipofection method, calcium phosphate coprecipitation method, DEAE-dextran method, direct DNA introduction method using glass microcapillary, electroporator method and the like.
(68) The therapeutic or prophylactic agent of the present invention may be administered by any method as long as in the administration subject mammal, the agent induces in vivo expression of the above-mentioned chimeric hepatitis B virus core antigen polypeptide, induces production of an antibody to the specific epitope of VEGF and/or the specific epitope of angiopoietin-2 contained in the chimeric hepatitis B virus core antigen polypeptide, and treats or prevents cancer. Preferably, the therapeutic or prophylactic agent of the present invention parenterally administered in an amount sufficient to induce production of an antibody to the specific epitope of VEGF and/or the specific epitope of angiopoietin-2 contained in the chimeric hepatitis B virus core antigen polypeptide, and treats or prevents cancer. For example, injection via intravenous, intraperitoneal, subcutaneous, intradermal, intraadipose tissue, intramammary gland tissue, or intramuscular pathway; gas induced particle bombarding method (by electron gun and the like); a method in the form of collunarium and the like via a mucosal pathway, and the like are recited as examples of the administration methods. In one embodiment, the therapeutic or prophylactic agent of the present invention is injected subcutaneously or intramuscularly.
(69) In one embodiment, the therapeutic or prophylactic agent of the present invention is subcutaneously administered by a needleless injector. The needleless injector is preferably a pressure injector. Examples of the needleless injector include, but are not limited to, ShimaJET (trade name, SHIMADZU CORPORATION), Twinject EZII (trade name, Japan chemical research), Syrijet (trade name, Keystone), ZENEO (trade name, Crossject) and the like. In this case, the therapeutic or therapeutic agent of the present invention can be provided as an injection preparation containing the above-mentioned expression vector and needleless injector, wherein the expression vector is enclosed in the needleless injector.
(70) In one embodiment, the therapeutic or prophylactic agent of the present invention is administered subcutaneously, intradermally or intramuscularly with a gene gun. In this case, the above-mentioned expression vector may be applied onto the carrier particles such as colloidal gold particles and the like to be introduced into the body and used for administration. A technique for coating carrier particles with polynucleotide is known (see, for example, WO 93/17706). Finally, the expression vector can be prepared in an aqueous solution such as physiological saline and the like suitable for administration to the body.
(71) To induce good immune responses, the therapeutic or improving agent of the present invention is preferably administered plural times at given intervals. While the frequency can be appropriately determined by monitoring the level of immune response, it is generally 2-10 times, preferably 2-6 times, more preferably 2, 3 or 4 times, most preferably 3 times.
(72) The administration frequency is generally once per 1 week-1 year, preferably-once per 1-6 months.
(73) In one embodiment, the therapeutic or prophylactic agent of the present invention is administered to a target mammal 3 times at 6 months intervals.
(74) While the dose of the therapeutic or improving agent of the present invention depends on the immunogenicity of the epitope of VEGF and/or the epitope of angiopoietin-2 contained in the chimeric hepatitis B virus core antigen polypeptide encoded by the active ingredient expression vector in an administration subject mammal, those of ordinary skill in the art can determine the dose necessary for a good immune response by administering a given amount of an expression vector to an administration subject mammal, measuring the antibody titer specific to the epitope by a detection method such as ELISA and the like, and observing the immune response. Those of ordinary skill in the art appreciate that the immunogenicity of the therapeutic or prophylactic agent of the present invention also depends on the strength of the regulatory sequence such as promoter used for the expression vector as an active ingredient. Moreover, those of ordinary skill in the art can also control the dose of the therapeutic or prophylactic agent of the present invention with ease depending on the kind of the expression vector to be used.
(75) When an expression vector encoding a chimeric hepatitis B virus core antigen polypeptide inserted with an amino acid sequence containing a specific epitope of VEGF and/or a specific epitope of angiopoietin-2 is administered, an immune response (preferably humoral immune response such as antibody production and the like) to the specific epitope of VEGF and/or the specific epitope of angiopoietin-2 in the expressed chimeric hepatitis B virus core antigen polypeptide is induced, and the activity of VEGF and/or angiopoietin-2 is neutralized with the antibody, whereby the angiogenesis around the cancer tissues can be suppressed and the growth of the cancer tissue can be inhibited. Accordingly, the subject of administration of the therapeutic or prophylactic agent of the present invention includes cancer patients, those having clinical history of cancer, non-cancer patients having a risk of developing cancer and the like. Cancer is treated by administering an expression vector encoding a chimeric hepatitis B virus core antigen polypeptide inserted with an amino acid sequence containing a specific epitope of VEGF and/or a specific epitope of angiopoietin-2 to cancer patients, thereby suppressing angiogenesis around the cancer tissues of the cancer patients and inhibiting growth of the cancer tissues. In addition, metastasis can be suppressed by suppressing angiogenesis around micrometastatic lesion in cancer patients. Recurrence of cancer can be suppressed by administering an expression vector encoding a chimeric hepatitis B virus core antigen polypeptide inserted with an amino acid sequence containing a specific epitope of VEGF and/or a specific epitope of angiopoietin-2 to those having clinical history of cancer, thereby suppressing angiogenesis around micrometastatic lesion possibly lying latent in the body of those having clinical history of cancer, and inhibiting growth of the cancer tissues. Moreover, the onset of cancer in non-cancer patients having a risk of developing cancer can be prevented by administering an expression vector encoding a chimeric hepatitis B virus core antigen polypeptide inserted with an amino acid sequence containing a specific epitope of VEGF and/or a specific epitope of angiopoietin-2 to the non-cancer patients.
(76) All references cited herein, including patents and patent applications, are hereby incorporated in full by reference, to the extent that they have been disclosed herein.
(77) The present invention is explained in more detail in the following by referring to Examples, which do not limit the present invention in any way.
EXAMPLES
Example 1
Preparation of Construct Expressing HBc-mVEGF (13aa) and HBc-hAng2 (16aa)
(78) Plasmid pPLc3 (Accession number LMBP 2470) was purchased from BCCM/LMBP Plasmid Collection. DNA fragments encoding modified HBc, wherein a partial amino acid sequence (SEQ ID NO: 1) of mouse VEGF or a partial amino acid sequence (SEQ ID NO: 3) of human angiopoietin-2 is inserted between the amino acid residues 80 and 81 of HBc, were obtained by PCR and ligation. This DNA fragment was TA-cloned into pcDNA 3.1/V5-His TOPO TA Expression Kit (Invitrogen) to give the HBc-AngII ISS() vector. Similarly, PCR was performed using a template (plasmid pPLc3) and a primer set (HBcF and HBcR) to prepare a DNA fragment encoding a full-length polypeptide of HBc, and this DNA fragment was TA-cloned into the pcDNA 3.1/V5-His TOPO vector to give HBc-mVEGF expression vector and HBc-hAng2 expression vector. The amino acid sequences of the prepared HBc-mVEGF and HBc-hAng2 are shown in SEQ ID NOs: 28 and 30, respectively, and the nucleotide sequences encoding the amino acid sequences are shown in SEQ ID NOs: 27 and 29, respectively. The following regions correspond to the inserted sequences.
(79) nucleotide Nos. 244-297 of SEQ ID NO: 27 (of these,
(80) nucleotide Nos. 250-288 encode SEQ ID NO: 1)
(81) amino acid Nos. 81-98 of SEQ ID NO: 28 (of these, amino acid Nos. 83-95 correspond to SEQ ID NO: 1)
(82) nucleotide Nos. 244-306 of SEQ ID NO: 29 (of these,
(83) nucleotide Nos. 250-297 encode SEQ ID NO: 3)
(84) amino acid Nos. 81-101 of SEQ ID NO: 30 (of these, amino acid Nos. 83-98 correspond to SEQ ID NO: 3)
Example 2
(85) Each expression vector (HBc, HBc-mVEGF, HBc-hAng2) prepared in Example 1 were introduced into BALB/c mice (female, 6-week-old) by electroporator. After immunization 3 times at 2 weeks intervals (0, 2, 4 w) and a lapse of 4 weeks, additional immunization was given (8 w). Colon26 (CT-26) cells in the growth stage Under culture in RPMI (10% FBS, pc/sm) were recovered by trypsin, and suspended in PBS to give a cell suspension having a concentration of 110.sup.7 cells/mL in PBS. One week after the final additional immunization (9 w), the back of the immunized mouse was shaven, and the cell suspension (100 mL, 110.sup.6 cells/mouse) was subcutaneously injected (Day 0). The tumor diameter was measured with a vernier caliper (tumor volume=long diametershort diametershort diameter2).
(86) In the mice immunized with HBc-mVEGF and HBc-hAng2, the tumor growth was suppressed (
Example 3
Results
(87) Production of DNA Vaccine for VEGF
(88) To confirm whether this DNA vaccine system would sufficiently induce anti-VEGF antibody production, BALB/c female mice were immunized with pcDNA3.1-HBc-mVEGF (7 a.a.) [HBc-mVEGF (7 a.a.)], pcDNA3.1-HBc [HBc] or saline, respectively, by intramuscular administration using electroporator, three times every two weeks and additional booster after third immunization (
(89) The titer of anti-VEGF antibody at eighth week, four weeks after third immunization were confirmed (
(90) Neutralizing Activity of Anti-VEGF Antibody Produced by VEGF DNA Vaccination
(91) To examine the neutralizing activity of serum from vaccinated mice, we purified mouse IgG of serum using by Protein G column as described in method section. Treatment of immunized serum, but not control serum, significantly attenuated VEGF-A-induced ERK1/2 phosphorylation in HUVECs (
(92) (Method)
(93) Measurement of Anti-mVEGF Antibody in Serum
(94) Eight or sixteen weeks after first immunization, serum was collected from the immunized mice of all groups. Serum levels of anti-VEGF antibodies in these mice were measured by ELISA. Briefly, ELISA plates were coated with 5 g/mL VEGF 13 a.a. peptide conjugated BSA in carbonate buffer overnight at 4 C. Serial dilutions (1:100 to 1:312500) of serum samples from the immunized mice were added to the wells, and HRP-conjugated mouse IgG (whole IgG; GE Health care, UK, each subtype; Abcam, UK) was added. After four washes with PEST, 3,3,5,5-tetramethylbenzidine (TMB, Sigma-Aldrich, USA) was added. Production of the blue reaction product was stopped by adding 0.5 mol/L sulfuric acid, and the resulting end product (yellow) was read at 450 nm.
(95) IgG Purification
(96) Mouse serum was purified using by Protein G column according to the manufacturer's instructions (MAbTrap Kit; GE Healthcare, UK). Briefly, serum samples were adjusted to the composition of the binding buffer (20 mM sodium phosphate, pH 7.0). The Protein G column was washed out the ethanol preservative with distilled water and equilibrated with binding buffer. The diluted serum was applied and the column was wash with binding buffer until no material appears in the effluent. After that, IgG fraction was eluted by elution buffer (0.1 M glycine-HCl, pH 2.7) and concentrated by centrifugal filter (Amicon Ultra; Millipore, USA).
(97) Tube Formation Assay
(98) The tube formation assay using Matrigel (Becton-Dickinson, USA) was performed according to manufacturer's instructions. Briefly, matrigel was used to coat the wells of 24-well plates (0.25 mL per well) and was left to polymerize at 37 C. for 1 hour. After polymerization, HUVECs (100,000 cells) suspended in 0.3 ml of EBM-2 (containing 20% EGM-2 kit, 0.4% FBS and 20% supplement) with control serum or immunized serum, were added to each well. After 6 hours, the wells were photographed at 50-fold magnification in five randomized fields (Olympus) and the number of their tubular networks was counted by using ImageJ.
(99) Western Blot Analysis
(100) Briefly, for each of three independent experiments, total protein (10 g) was isolated after indicated treatment using RIPA lysis buffer purchased from Millipore (Bedford, Mass.) with protease inhibitor cocktail (Roche, Mannhein, Germany), 10 mmol/L NaF, and 1 mmol/L Na.sub.3VO.sub.4; and size-fractioned by SDS-PAGE and transferred to Immobilon-P purchased from Millipore. The blotted protein was detected with antibodies against pERK and ERK (cell signaling technology); followed by the appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies, and detected by ECL (Amersham, Arlington Heights, Ill.). Chemiluminescent signal was detected with a FujiFilm LAS-1000 camera and analyzed with Multi Gauge 3.2V software. Bands were quantified with ImageJ software.
INDUSTRIAL APPLICABILITY
(101) The present invention provides a superior vaccine for the treatment or prophylaxis of cancer, which targets a tumor angiogenesis-related factor and shows a reduced risk of an adverse influence on the normal blood vessel function.
(102) This application is based on patent application No. 2012-191717 filed in Japan (filing date: Aug. 31, 2012), the contents of which are incorporated in full herein.