IL-1β neutralizing human monoclonal antibodies

Abstract

The present invention is directed to antigen binding proteins and in particular to IL-1β antigen binding proteins. The present invention further provides compositions comprising the antigen binding proteins, use of the antigen binding proteins and methods for production.

Claims

1. A method of treating an inflammatory disease in a subject in need thereof, comprising administering to the subject an isolated monoclonal antibody which specifically binds to IL-1β, or an antigen binding fragment thereof, wherein said antibody or fragment thereof comprises: (i) Complementarity Determining Regions (CDRs) according to the Kabat numbering convention of a light chain comprising the amino acid sequence of SEQ ID NO: 17; and (ii) CDRs according to the Kabat numbering convention of a heavy chain comprising the amino acid sequence of SEQ ID NO: 14.

2. The method of claim 1, wherein the IL-1β is human, and wherein the antibody or fragment is fully human.

3. The method of claim 2, wherein the antibody is of the subtype IgG1, IgG2, IgG3 or IgG4.

4. The method of claim 3, wherein the antibody is of the subtype IgG4.

5. The method of claim 1, wherein the antibody or fragment is in a composition, and wherein the composition further comprises a pharmaceutically acceptable carrier.

6. The method of claim 1, wherein the inflammatory disease is rheumatoid arthritis, gout or inflammatory acne.

7. A method of treating an inflammatory disease in a subject in need thereof, comprising administering to the subject an isolated monoclonal antibody which specifically binds to IL-1β, or an antigen binding fragment thereof, wherein said antibody or fragment thereof comprises the following Complementarity Determining Regions (CDRs): (i) a heavy chain variable region CDR H1 comprising the amino acid sequence DYYWS (SEQ ID NO:26), (ii) a heavy chain variable region CDR H2 comprising the amino acid sequence EIDHSGSTNYNPSLKS (SEQ ID NO:27), (iii) a heavy chain variable region CDR H3 comprising the amino acid sequence ASPSSGWTLDY (SEQ ID NO:28), (iv) a light chain variable region CDR L1 comprising the amino acid sequence GDKLGDKFAF (SEQ ID NO:29), (v) a light chain variable region CDR L2 comprising the amino acid sequence LDNKRPS (SEQ ID NO:30), and (vi) a light chain variable region CDR L3 comprising an amino acid sequence selected from the group consisting of: YAWADTYEV (SEQ ID NO:12), QAWADSFEV (SEQ ID NO:11), YAWDNAYEV (SEQ ID NO:9), EAWDAAAEV (SEQ ID NO:10), and EAWADTYEV (SEQ ID NO:13).

8. The method of claim 7, wherein the light chain variable region CDR L3 comprises the amino acid sequence YAWADTYEV (SEQ ID NO:12).

9. The method of claim 7, wherein the light chain variable CDR3 comprises the amino acid sequence QAWADSFEV (SEQ ID NO:11).

10. The method of claim 7, wherein the IL-1β is human, and wherein the antibody or fragment is fully human.

11. The method of claim 7, wherein the antibody is of the subtype IgG1, IgG2, IgG3 or IgG4.

12. The method of claim 11, wherein the antibody is of the subtype IgG4.

13. The method of claim 7, wherein the antibody or fragment is in a composition, and wherein the composition further comprises a pharmaceutically acceptable carrier.

14. The method of claim 7, wherein the inflammatory disease is rheumatoid arthritis, gout or inflammatory acne.

15. A method of treating an inflammatory disease in a subject in need thereof, comprising administering to the subject an isolated monoclonal antibody which specifically binds to IL-1β, or an antigen binding fragment thereof, wherein said antibody or fragment thereof comprises: (i) a light chain sequence comprising the amino acid sequence of SEQ ID NO: 17; and (ii) a heavy chain sequence comprising the amino acid sequence of SEQ ID NO: 18.

16. The method of claim 15, wherein the heavy chain sequence comprises the amino acid sequence of SEQ ID NO: 14.

17. The method of claim 15, wherein the IL-1β is human, and wherein the antibody or fragment is fully human.

18. The method of claim 15, wherein the antibody is of the subtype IgG1, IgG2, IgG3 or IgG4.

19. The method of claim 18, wherein the antibody is of the subtype IgG4.

20. The method of claim 15, wherein the inflammatory disease is rheumatoid arthritis, gout or inflammatory acne.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) The accompanying drawings illustrate a disclosed embodiment and serve to explain the principles of the disclosed embodiment. It is to be understood, however, that the drawings are designed for purposes of illustration only, and not as a definition of the limits of the invention.

(2) FIG. 1 shows the neutralization of IL-1β by Fab clones 1H and 2H. IL-1β neutralization was measured based on the optical density (OD) read at 655 nm and the concentration of Fab. The results show that clones 1H and 2H block the activation of IL-1β with an IC50 of 1.31 and 0.21 respectively.

(3) FIG. 2 shows the sequencing results of the heavy and light chains of the 1H and 2H Fab clones. The sequences correspond to SEQ ID NOs: 7, 3, 5, 1, 8, 4, 6, and 14 from top to bottom.

(4) FIG. 3 shows the neutralization of human IL-1β by IgG1 1H and 2H. IL-1β neutralization was measured based on the optical density (OD) read at 655 nm and the concentration of IgG. The results show that clones 1H and 2H neutralize human IL-1β with a potency (EC50) of 2.6 nM and 0.17 nM respectively.

(5) FIG. 4 shows the neutralization of mouse IL-1β by IgG1 1H and 2H. IL-1β neutralization was measured based on the optical density (OD) read at 655 nm and the concentration of IgG. The results show that clones 1H and 2H neutralized mouse IL-1β with a potency (EC50) of 11.5 nM and 1.5 nM respectively.

(6) FIG. 5 shows that IgG 1H and 2H inhibit human IL-1β-induced IL-6 production in MRCS cells. Human IL-1β neutralizing potency was determined by measuring the level of IL-6 produced in the presence of IgG 1H and 2H. MRCS cells were stimulated by 4 pM of IL-1β together with various concentrations of IgG 1H and 2H. The results show that IgG 1H and 2H have an inhibition potency (EC50) of 3.92 nM and 0.35 nM respectively.

(7) FIG. 6 shows that IgG 2H inhibits the human IL-1β induced IL-6 production in vivo in Balb/c mice. Neutralizing potency of IgG 2H was assessed by injecting mice intraperitoneally with 4 or 20 mg/kg of 2H or 400 μL of PBS and human IL-1β or PBS the following day. The blood was collected and IL-6 measured by ELISA. The results show that IgG 2H was able to inhibit human IL-1β induced production of IL-6 in mice in a dose dependent manner.

(8) FIG. 7 shows that IgG 2H is specific for IL-1β and does not recognize IL-1α. Binding specificity of IgG 2H was determined based on the optical density (OD) at 460 nm and the concentration of IgG 2H. The results show that while IgG 2H bound to both human and mouse IL-1β in a dose dependent manner, it failed to bind to either human or mouse IL-1α.

(9) FIGS. 8 and 9 show the neutralization potency of 5 IgG clones obtained from the affinity maturation of IgG 2H. Neutralization potency was determined based on the concentration of secreted IL-against the concentration of each of the IgG clones. The results show that all matured IgG clones presented high neutralization potency for both mouse and human IL-1β. The results also show that matured clones were 2 to 8-fold more effective in neutralizing mouse IL-1β (FIG. 8) and 3 to 23-fold more effective in neutralizing human IL-1β (FIG. 9) than the non-matured IgG 2H.

(10) FIG. 10 shows the sequence of P2D7KK. P2D7KK was derived from P2D7 by changing one arginine and one serine residue by lysine residues (bold and underlined) at positions 75 and 81 of the heavy chain variable region. The sequences correspond to SEQ ID NOs: 18 and 17 from top to bottom.

(11) FIG. 11 shows arthritic scores in DBA mice after induction of arthritis with anti-collagen antibodies. Mice were injected either with 5 mg/kg isotype, 5 mg/kg P2D7KK or 15 mg/kg P2D7KK. The results show that mice treated with P2D7KK had much lower arthritic scores than mice injected with the isotype control.

(12) FIG. 12 shows a representative front (top) and hind (bottom) paw swelling after arthritis induction and administration of isotype control (left), P2D7KK 5 mg/kg (middle) or P2D7KK 15 mg/kg (right). The results show that P2D7KK clearly contained inflammation as mice treated with P2D7KK did not experience swelling of the paws as compared to mice injected with the isotype control.

(13) FIG. 13 shows a representative histological analysis of front (top) and hind (bottom) paws joints from mice injected with the isotype antibody (left) or treated with either 5 mg/kg (middle) or 15 mg/kg (right) of P2D7KK. The results show that in mice treated with P2D7KK, joints remain virtually free of immune cell infiltration while joints of isotype-injected mice were the site of a highly inflammatory reaction.

(14) FIG. 14 shows infiltration of immune cells in the peritoneal cavity after injection of PBS (1) or monosodium urate crystals followed by administration of PBS (2), Anakinra 30 mg/kg (3), isotype human antibody 15 mg/kg (4), P2D7KK 5 mg/kg (5) or P2D7KK 15 mg/kg (6). Shown are mean±s.e.m. Unpaired t-test: * p<0.05; ** p<0.01; ***p<0.001; n.s. not significant.

(15) FIG. 15 shows tumour growth between days 7 and 17 post carcinoma cell inoculation in mice treated with P2D7KK or with the isotype control. Shown are means±SD, 2-way ANOVA test (Turkey's multiple comparison) *=p<0.05.

(16) FIG. 16 shows absolute numbers of cells in mice auricular draining lymph nodes. Graph 1 represents mice not infected with P. acnes; graph 4 represents mice infected with P. acnes and injected with PBS; graph 3 represents mice infected with P. acnes and injected with isotype control; graph 2 represents mice infected with P. acnes and treated with P2D7KK.

(17) FIG. 17 shows the number of lymphocytes in epidermis of mice not infected with P. acnes (first bar from the left of each group), infected with P. acnes and injected with PBS (second bar from the left of each group), infected with P. acnes and injected with isotype control (third bar from the left of each group), or infected with P. acnes and treated with P2D7KK (fourth bar from the left of each group). p-values refer to an unpaired t-test.

EXAMPLES

(18) Non-limiting examples of the invention, including the best mode, and a comparative example will be further described in greater detail by reference to specific Examples, which should not be construed as in any way limiting the scope of the invention.

Example 1—Isolation of the Anti-Human IL-1β Antibodies and Characterization of the IL-1β Neutralization Capacity in Cell-Based Assays

(19) Anti-IL-1β antibodies were isolated from a human antibody phage display library (Humanyx HX-02 library) via in vitro selection. IL-1β specific monoclonal antibodies in the Fab format were initially identified by ELISA. These ELISA-positive Fabs were added to HEK-Blue™ IL-1β cells (InvivoGen, USA) which is an engineered HEK293 cell line that overexpresses recombinant human IL-1 receptor.

(20) Binding of IL-1β to its receptor IL-1β on the surface of HEK-Blue™ IL-1β cells triggers a signaling cascade leading to the activation of NF-kB and the subsequent production of secreted alkaline phosphatase (SEAP). Detection of SEAP in the supernatant of HEK-Blue™ IL-1β cells can be readily assessed using QUANTI-Blue™, a colorimetric SEAP substrate. The HEK-Blue cells are sensitive to both human and mouse IL-1β, but are insensitive to human IL-1α or INF-α.

(21) Of the 22 ELISA-positive Fabs, two clones, 1H and 2H, were found to block the activation of the HEK-Blue IL-1β cells by IL-4 stimulation with IC.sub.50 (concentration inhibiting 50% of IL-1β activity) of 1.31 and 0.21 nM, respectively (FIG. 1). Sequencing results revealed that both clones possessed A light chain. Sequences of the heavy and light chains of clones 1H and 2H are shown in FIG. 2.

Example 2—Neutralization of IL-1β by IgG1 1H and 2H in the HEK-Blue Cell Assay

(22) The two Fab clones 1H and 2H were converted into full length IgG by amplifying the heavy and light chains of each clone separately by PCR and cloning into the mammalian cell expression vector. The resulting plasmids, with human IgG1 subtype, were subsequently used for full length antibody expression by transient transfection into mammalian cells. Antibodies were purified by Protein G column.

(23) Human IL-1β

(24) The neutralizing potency of the IgG clone 1H and 2H on human IL-1β was then assayed using HEK-Blue cells as described above. Cells were stimulated with 4 pM human IL-1β together with various concentrations of the antibody. The dose-response curve was fitted by the sigmoidal non-linear regression (variable slope) equation from which the EC.sub.50 (the half maximal effective concentration) is calculated. In this assay clones 1H and 2H neutralized human IL-1β with potency (EC.sub.50) of 2.6 nM and 0.17 nM, respectively (FIG. 3).

(25) Mouse IL-1β

(26) The neutralizing potency of the IgG clone 1H and 2H on mouse IL-1β was examined using HEK-Blue cells as described above. However, cells were stimulated with mouse IL-1β together with various concentrations of the antibody. In this assay clones 1H and 2H neutralized mouse IL-1β with potency (EC.sub.50) of 11.5 nM and 1.5 nM, respectively (FIG. 4).

Example 3—Inhibition of Human IL-1β Induced IL-6 Production IgG 1H and 2H

(27) In Vitro

(28) Inhibition of human IL-1β induced IL-6 production by IgG 1H and 2H was examined in vitro using the human fibroblast cell line, MRCS. Stimulation of the human lung fibroblast cell, MRCS, by IL-1β results in IL-6 production.

(29) The human IL-1β neutralizing potency of IgG 1H and 2H was examined by measuring the level of IL-6 produced in the presence of the antibodies. Cells were stimulated with human IL-1β together with various concentrations of the antibodies, and the IL-6 was quantified by ELISA. In this assay, IgG 1H and 2H showed inhibition potency (EC.sub.50) of 3.92 and 0.35 nM, respectively (FIG. 5).

(30) In Vivo

(31) Inhibition of human IL-1β induced IL-6 production by IgG 1H and 2H was examined in vivo in Balb/C mice. Administration of human IL-1β into Balb/c mice is followed by a rapid secretion of mouse IL-6 that is detectable in the serum by ELISA.

(32) To assess the neutralizing potency of IgG 2H, mice were injected intraperitoneally with 4 or 20 mg/kg of 2H or with 400 μL of PBS. The following day, mice received human IL-1β or PBS (negative control). Two hours after IL-1β injection, blood was collected and IL-6 was measured in the serum by ELISA.

(33) The results showed that 2H was able to inhibit the human IL-1β-induced production of IL-6 in mice in a dose-dependent manner (FIG. 6).

Example 4—Specificity of IgG 2H

(34) The binding specificity of IgG 2H was examined against the two subtypes of IL-1, α and β, by direct ELISA. The results show that while IgG 2H bound to both human and mouse IL-1β in a dose dependent manner, it failed to bind to either human or mouse IL-1α at the concentration range tested (FIG. 7). Thus, IgG 2H displayed strong selectivity for IL-1β over IL-1α. Accordingly, IgG 2H is specific for IL-1β and does not recognize IL-1α.

Example 5—Affinity Maturation of IgG 2H

(35) IgG 2H was affinity matured using the phage-display method and 5 matured clones with mutations in the CDR3 region of the light chain were selected after IL-1β neutralization assay on MRCS cells.

(36) All matured IgG clones presented high neutralization potency for both mouse and human IL-1β in this assay. Matured clones were 2 to 8-fold more effective in neutralizing mouse IL-4 and 3 to 23-fold more effective in neutralizing human IL-1β than the initial IgG 2H, with potency ranging from EC.sub.50 of 158.4 to 623.2 pM for the mouse cytokine (FIG. 8) and EC.sub.50 from 6.5 to 45.3 pM for its human counterpart (FIG. 9)

(37) Matured clones (except P1E8) were tested for affinity towards mouse and human IL-1β using the ProteOn bioanalyzer (BioRad, Hercules, USA).

(38) The results showed that affinities for mouse IL-1β were 3 to 13-fold higher for matured clones compared to IgG 2H and 8 to 25-fold higher regarding human IL-1β (Table 1).

(39) TABLE-US-00002 TABLE 1 Affinities of matured clones towards mouse and human IL-1β compared to IgG 2H. Affinity (KD) in PM mouse human IL-1β IL-1β Original 2H 142 78.3 Ig Matured Ig P2D7 10.9 3.1 P2D8 16.6 4.57 P1D9 23.6 6.73 P1H8 48.9 10.1

(40) Sequences of Affinity Matured Clones

(41) The matured clones were sequenced and the amino acid sequences of their light chain CDR3 region are presented in the Table 2.

(42) TABLE-US-00003 TABLE 2 Amino acid sequences of the light chain CD3 region of each of the matured clones. Original 2H QAWDSNIEV (SEQ ID NO: 19) Ig Matured Ig P1D9 YAWDNAYEV (SEQ ID NO: 9) P1E8 EAWDAAAEV (SEQ ID NO: 10) P1H8 QAWADSFEV (SEQ ID NO: 11) P2D7 YAWADTYEV (SEQ ID NO: 12) P2D8 EAWADTYEV (SEQ ID NO: 13)

(43) The corresponding nucleotide sequences of the light chain CDR3 regions after reverse translation are presented below:

(44) TABLE-US-00004 >2H (SEQ ID NO: 20) CAGGCGTGGGACAGCAACATTGAAGTA   A  T     TTCT  T  C  G  T      A        A     A     C      C        G           G (original 2H sequence) (sequences encoding the same amino-acids) >P1D9 (SEQ ID NO: 21) TATGCTTGGGATAATGCTTATGAAGTT   C  C     C  C  C  C  G  C      A           A        A      G           G        G >P1E8 (SEQ ID NO: 22) GAAGCTTGGGATGCTGCTGCTGAAGTT   G  C     C  C  C  C  G  C      A        A  A  A     A      G        G  G  G     G >P1H8 (SEQ ID NO: 23) CAAGCTTGGGCTGATTCTTTTGAAGTT   G  C     C  CAGC  C  G  C      A     A     A        A      G     G     G        G >P2D7 (SEQ ID NO: 24) TATGCTTGGGCTGATACTTATGAAGTT   C  C     C  C  C  C  G  C      A     A     A        A      G     G     G        G >P2D8 (SEQ ID NO: 25) GAAGCTTGGGCTGATACTTATGAAGTT   G  C     C  C  C  C  G  C      A     A     A        A      G     G     G        G

Example 6—In Vivo Efficacy of P2D7KK

(45) Derivation of P2D7KK

(46) Out of the 5 affinity matured clones, P2D7 was selected and engineered to be a germline-like antibody, named P2D7KK. P2D7KK was derived from P2D7 by changing one arginine and one serine residues by lysine residues in positions 75 and 81 of the heavy chain variable region (FIG. 10).

(47) P2D7KK was then tested for preliminary in vivo efficacy in 4 different animal models of disease (1) CAIA: collagen antibody-induced arthritis, a model of rheumatoid arthritis, (2) MSU: monosodium urate crystals-induced inflammation, a model mimicking gout, (3) RCC: renal cell carcinoma growth, to evaluate the use of IL-1β antibody in the tumour microenvironment to inhibit tumour growth and (4) P. acnes: a model of inflammatory acne using Propionibacterium acnes.

(48) CAIA—Collagen Antibody-Induced Arthritis

(49) Arthritis was induced in Balb/c mice by intraperitoneal injection of 1.5 mg/mouse of anti-collagen antibody cocktail at day 0, followed by injection of 25 pg of lipopolysaccharide (LPS) at day 3.

(50) A group of 8 mice received 5 mg/kg of P2D7KK intraperitoneally at days 2, 5 and 9. Another group received 15 mg/kg of P2D7KK and one control group received 5 mg/kg of the isotype control following the same schedule.

(51) The results showed that mice treated with P2D7KK have much lower arthritic scores than mice injected with the isotype control (FIG. 11). Accordingly, administration of P2D7KK inhibited the development of arthritis.

(52) The results also showed that P2D7KK clearly contained inflammation as mice treated with P2D7KK did not experience swelling of the paws as did the mice injected with an isotype antibody (FIG. 12).

(53) Histological analyses of hind paws showed that in mice treated with P2D7KK, joints remains virtually free of immune cells infiltration while joints of isotype-injected mice were the site of a highly inflammatory reaction (FIG. 13).

(54) MSU—Monosodium Urate Crystals-Triggered Inflammation

(55) Six groups of C57/BL6 mice were injected intraperitoneally with 3 mg of monosodium urate in 200 μL of PBS, or PBS alone for the control group. Mice were then injected with: P2D7KK 5 mg/kg in 300 μL of PBS (n=5) P2D7KK 15 mg/kg in 300 μL of PBS (n=4) Isotype antibody 15 mg/kg in 300 μL of PBS (n=5) Anakinra 30 mg/kg in 300 μL of PBS 9n=5) 300 μL of PBS (n=3, vehicle control group) 300 μL of PBS (n=5, no MSU control group)

(56) Six hours after antibody administration, mice were culled and peritoneum lavaged with 5 mL of cold complete media. Neutrophils and monocytes were counted in lavage fluid by flow cytometry.

(57) The results showed that injection of MSU in the peritoneum induces recruitment of neutrophils and monocytes. Like Anakinra, P2D7KK was able to significantly reduce infiltration of neutrophils (at both 15 and 5 mg/kg) and monocytes (only at 15 mg/kg) in the peritoneal cavity (FIG. 14).

(58) RCC—Human Renal Cell Carcinoma Xenograft

(59) Female SCID mice aged 6-8 weeks were injected intramuscularly with 2×10.sup.6 RCC4 cells. One group of 6 mice then received 100 μg/mouse of P2D7KK injected in the tumour site, on days 1, 3, 5, 7 and 9 post-tumour inoculation. Another group of 6 mice received the isotype control antibody.

(60) Tumour growth was monitored every 2 days between days 7 and 17.

(61) The results showed that P2D7KK significantly reduced tumour growth in the treated mice (FIG. 15).

(62) P. acnes—Inflammatory Acne

(63) C57/BL6 mice were injected intraperitoneally with 400 μg of either P2D7KK or the isotype control at day −1 and at day 1. At day 0, mice were infected with 10.sup.8 colony-forming units of Propionibacterium acnes in the right ear and received PBS in the left ear. Some control mice were not infected, some were infected but did not receive any antibody.

(64) Immune parameters in the dermis and in the epidermis were assessed on days 2, 5 and 9.

(65) The results showed that at day 9, P2D7KK reduced the inflammation as observed by the cell number decrease in the lymph nodes (FIG. 16). Without being bound by theory, it is likely that P2D7KK reduces lymphocytes infiltration in the epidermis (FIG. 17).

(66) Accordingly, P2D7KK showed in vivo efficacy in 4 different models of human disease, namely rheumatoid arthritis, gout, renal cell carcinoma and inflammatory acne.

Applications

(67) It will be apparent that various other modifications and adaptations of the invention will be apparent to the person skilled in the art after reading the foregoing disclosure without departing from the spirit and scope of the invention and it is intended that all such modifications and adaptations come within the scope of the appended claims.