System and method for creating crystals of human acetylcholinesterase with open active sites
10544421 ยท 2020-01-28
Assignee
Inventors
Cpc classification
C12N15/1031
CHEMISTRY; METALLURGY
International classification
C12N15/66
CHEMISTRY; METALLURGY
Abstract
A system and method for creating crystals from human acetylcholinesterase. The crystals can then be analyzed using X-ray crystallography. A segment of DNA for human acetylcholinesterase is isolated that includes the codon sequence GAGGGC. A polyhistidine tag is inserted between codon GAG and codon GGC to produce a recombinant acetylcholinesterase construct. The recombinant acetylcholinesterase construct is used to transfect cells on a prepared growth medium. The growing cells secrete a portion of the recombinant acetylcholinesterase construct. The secreted portion is concentrated and the tag cleaved. The concentrate is then buffered and used to form crystals.
Claims
1. A method of creating crystals of recombinant human acetylcholinesterase, comprising the steps of: isolating a first polynucleotide encoding human acetylcholinesterase, wherein said first polynucleotide comprises a nucleotide sequence that has an initiation codon that begins said first polynucleotide, and a stop codon that ends said first polynucleotide, wherein said first polynucleotide includes a 32nd codon and a 33rd codon as counted from said initiation codon; inserting a second polynucleotide encoding an octahistidine tag into said first polynucleotide sequence between said 32nd codon and said 33rd codon, therein forming a recombinant human cholinesterase construct; amplifying said recombinant human cholinesterase construct; transfecting cells on a growth medium with said recombinant human cholinesterase construct to create a colony of cells, wherein said colony of cells secrete an octahistidine-tagged recombinant human cholinesterase polypeptide into said growth medium; separating said octahistidine-tagged recombinant human cholinesterase polypeptide from said growth medium to form a concentrate; cleaving said octahistidine-tagged recombinant human cholinesterase polypeptide and removing said octahistidine tag from said concentrate; exchanging said concentrate into a buffer to create a buffered concentrate; and growing crystals of the recombinant human cholinesterase polypeptide with said buffered concentrate using sitting drop vapor diffusion.
2. The method according to claim 1, wherein said human acetylcholinesterase encoded by the first polynucleotide has 574 amino acids.
3. The method according to claim 1, wherein said second polynucleotide encodes the protease recognition sequence of SEQ ID NO: 2 following the octahistidine tag.
4. The method according to claim 1, wherein amplifying said recombinant human cholinesterase polynucleotide includes amplification by polymerase chain reaction.
5. The method according to claim 4, wherein amplifying said recombinant human cholinesterase polynucleotide further includes cloning said recombinant human cholinesterase construct.
6. The method according to claim 1, wherein cleaving said octahistidine-tagged recombinant human cholinesterase includes cleaving said octahistidine-tagged recombinant human cholinesterase with a his-TEV protease.
7. The method according to claim 1, further including the step of purifying said buffered concentrate.
8. The method according to claim 1, wherein said buffer includes 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid, NaCl, and imidazole.
9. The method according to claim 1, wherein growing crystals with said buffered concentrate includes using sitting drop vapor diffusion with a crystallization buffer.
10. The method according to claim 9, wherein said crystallization buffer includes polyethylene glycol and potassium nitrate.
11. The method according to claim 9, further including the step of mixing a ligand into said buffered concentrate.
12. The method according to claim 1, further including the step of soaking said crystals in a solution containing a ligand.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) For a better understanding of the present invention, reference is made to the following description of an exemplary embodiment thereof, considered in conjunction with the accompanying drawings, in which:
(2)
(3)
(4)
(5)
DETAILED DESCRIPTION OF THE DRAWINGS
(6) The methodologies used to produce crystals that are explained below are exemplary. The methodologies can be varied using undescribed, yet functionally equivalent method steps. The methodologies described set forth some of the best embodiments contemplated for the invention. The methodologies, however, are merely exemplary and should not be considered limitations to the novelty of the invention as described and claimed.
(7) Referring to
(8) The process begins with obtaining a cloned DNA fragment (cDNA) that contains the gene sequence that codes for human acetylcholinesterase. The cDNA is obtained from a commercial source. See Block 12. One such commercial source is clone sequence BC105060.1 (I.M.A.G.E. 8144063) sold by the Invitogen division of Thermo Fisher Scientific (Waltham, Mass.). The cDNA fragment is shipped in its accompanying plasmid. The plasmid is removed using standard DNA fragment preparation protocols.
(9) The cDNA fragment represented in Table 1 contains approximately 1966 bases in its sequence. See Table 1 provided below. Table 1 shows the listed I.M.A.G.E. 8144063 base sequence that contains the encoding sequence for human AChE. Table 1 corresponds to Seq. No. 1 in the corresponding sequence listings.
(10) TABLE-US-00001 TABLE1 1 gaacatcggccgcctccagctcccggcgcggcccggcccggcccggctcggccgcctcag 61 cagacgccgcctgccctgcagccatgaggcccccgcagtgtctgctgcacacgccttccc 121 tggcttccccactccttctcctcctcctctggctcctgggtggaggagtgggggctgagg 181 gccgggaggatgcagagctgctggtgacggtgcgtgggggccggctgcggggcattcgcc 241 tgaagacccccgggggccctgtctctgctttcctgggcatcccctttgcggagccaccca 301 tgggaccccgtcgctttctgccaccggagcccaagcagccttggtcaggggtggtagacg 361 ctacaaccttccagagtgtctgctaccaatatgtggacaccctatacccaggttttgagg 421 gcaccgagatgtggaaccccaaccgtgagctgagcgaggactgcctgtacctcaacgtgt 481 ggacaccatacccccggcctacatcccccacccctgtcctcgtctggatctatgggggtg 541 gcttctacagtggggcctcctccttggacgtgtacgatggccgcttcttggtacaggccg 601 agaggactgtgctggtgtccatgaactaccgggtgggagcctttggcttcctggccctgc 661 cggggagccgagaggccccgggcaatgtgggtctcctggatcagaggctggccctgcagt 721 gggtgcaggagaacgtggcagccttcgggggtgacccgacatcagtgacgctgtttgggg 781 agagcgcgggagccgcctcggtgggcatgcacctgctgtccccgcccagccggggcctgt 841 tccacagggccgtgctgcagagcggtgcccccaatggaccctgggccacggtgggcatgg 901 gagaggcccgtcgcagggccacgcagctggcccaccttgtgggctgtcctccaggcggca 961 ctggtgggaatgacacagagctggtagcctgccttcggacacgaccagcgcaggtcctgg 1021 tgaaccacgaatggcacgtgctgcctcaagaaagcgtcttccggttctccttcgtgcctg 1081 tggtagatggagacttcctcagtgacaccccagaggccctcatcaacgcgggagacttcc 1141 acggcctgcaggtgctggtgggtgtggtgaaggatgagggctcgtattttctggtttacg 1201 gggccccaggcttcagcaaagacaacgagtctctcatcagccgggccgagttcctggccg 1261 gggtgcgggtcggggttccccaggtaagtgacctggcagccgaggctgtggtcctgcatt 1321 acacagactggctgcatcccgaggacccggcacgcctgagggaggccctgagcgatgtgg 1381 tgggcgaccacaatgtcgtgtgccccgtggcccagctggctgggcgactggctgcccagg 1441 gtgcccgggtctacgcctacgtctttgaacaccgtgcttccacgctctcctggcccctgt 1501 ggatgggggtgccccacggctacgagatcgagttcatctttgggatccccctggacccct 1561 ctcgaaactacacggcagaggagaaaatcttcgcccagcgactgatgcgatactgggcca 1621 actttgcccgcacaggggatcccaatgagccccgagaccccaaggccccacaatggcccc 1681 cgtacacggcgggggctcagcagtacgttagtctggacctgcggccgctggaggtgcggc 1741 gggggctgcgcgcccaggcctgcgccttctggaaccgcttcctccccaaattgctcagcg 1801 ccaccgcctcggaggctcccagcacctgcccaggcttcacccatggggaggctgctccga 1861 ggcccggcctccccctgcccctcctcctcctccaccagcttctcctcctcttcctctccc 1921 acctccggcggctgtgaacacggcctcttcccctacggccacaggg
The frame of the listed base sequences that actually codes for human AChE is contained within an open reading frame that begins at position 84 and ends at position 1937 of Table 1. The open reading frame begins at table position 84 with initiation codon ATG and ends at table position 1937 with stop codon TGA. It will therefore be understood that the open reading frame that encodes for human AChE is a sequence of 1854 bases. The open reading frame of 1854 bases contains 618 codons, wherein each sequential three-base combination is a codon that encodes for an amino acid in the human AChE protein with the exception of the last stop codon. The stop codon TGA directs the termination of translation of DNA to protein at that site and does not encode an amino acid. The open reading frame begins with initiation codon ATG and ends with stop codon TGA. The open reading frame codon sequence 11 is shown in
(11) Referring to
(12) A targeted segment of the reading frame codon sequence 11 is first isolated using conventional molecular biology techniques. Using pre-processed protein 5 numbering, including native secretion signal, a the segment of the human DNA fragment 11 to be isolated extends from the initiation codon ATG to a targeted codon. The targeted codon is the 574.sup.th codon ACC. The targeted codon ACC ends at base position 1805 in Table 1. See Block 14. Accordingly, in the isolated segment of the reading frame codon sequence 11 starts with the initiation codon ATG at codon position No. 1 and extends a to new TGA stop codon that is added to codon position 575 after the ACC codon at position 574.
(13) Referring to
(14) The rhAChE construct 15 is amplified using polymerase chain reaction (PCR) protocols. See Block 18. The rhAChE construct 15 is amplified using the appropriate primers. The amplified rhAChE construct 15 is then cloned in the appropriate plasmid vectors and reagents, such as those provided in the pcDNA 3.3-TOPO brand cloning kit sold by Invitrogen division of Thermo Fischer Scientific (Waltham, Mass.).
(15) A growth medium is prepared by growing an adherent layer of human embryonic kidney cells (HEK 293-H cells) in a basal medium, such as the DMEM GlutaMAX medium sold by Thermo Fischer Scientific (Waltham, Mass.). See Block 20. The basal medium preferably contains 10% heat-inactivated fetal bovine serum. Once the HEK 293-H cells have matured, the HEK 293-H cells are co-transfected with approximately 0.8 g each of the amplified rhAChE construct 15 and an appropriate plasmid, such as the integrase-expressing plasmid pJTI PhiC31 Int, sold by the Invitogen division of Thermo Fisher Scientific (Waltham, Mass.). See Block 22. Using a transfection reagent, such as Lipofectamine, with growth media containing a protein synthesis inhibitor, such as 150 g/L Hygromycin-B, growth is promoted for approximately 10 days. This creates stable colonies of cells. See Block 24.
(16) After growth is stabilized, individual cell colonies are isolated by dilution of cells from the stable pool into 96-well plates. Growth is subsequently expanded in the well plates. Relative expression levels are determined once the expansion of the cell colonies reaches the 6-well level on the well plates. The expression levels are determined using an appropriate assay kit, such as the QuantiChrom Acetylcholinesterase Assay Kit from BioAssay Systems (Hayward, Calif.). The most prolific of the cell colonies are selected for expansion into cell culture vessels. See Block 26. As the selected prolific cell colonies grow, they secrete a portion of the recombinant rhAChE with the octahistidine tag into the cell growth media. That is, the cell colonies secrete the segment of the recombinant rhAChE from the polyhistidine tag to stop codon ACC at after codon 574. The fragment in the construct between the initiation codon ATG and the polyhistidine tag are used to direct the secretion. After secretion, the cell colonies are removed from the growth medium and can be preserved for future use. See Block 28.
(17) What remains is the cell growth medium that contains the secreted octahistidine-tagged recombinant rhAChE. The tagged recombinant rhAChE is separated from the cell growth media. The removed tagged recombinant rhAChE is then concentrated. See Block 30. A binding buffer 32 is provided. The preferred binding buffer 32 contains 20 mM 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES) pH 7.6, 500 mM NaCl, and 40 mM imidazole. The tagged recombinant rhAChE concentrate is then exchanged into the binding buffer 32 using cross-flow diafiltration cells. See Block 34. A two-column purification system is utilized to purify the tagged recombinant rhAChE from the buffered concentrate. The two-column purification system includes a 1 mL nickel affinity column followed by gel filtration column, such as the Superdex 200 16/20 gel filtration column, sold by GE Healthcare Bio-Sciences (Pittsburgh, Pa.). See Block 36. The elution buffer consists of 0.5M imidazole in binding buffer, and the gel filtration buffer consists of 20 mM HEPES pH 7.6, 150 mM NaCl, and 20 mM imidazole.
(18) After purification, the polyhistidine tag 16 is cleaved from the tagged recombinant rhAChE, leaving just the desired cleaved protein of rhAChE. The tagged recombinant rhAChE is pooled and the tag cleaved using a his-TEV protease. See Block 38. This process takes approximately four hours at room temperature. With the polyhistidine tag removed, the remaining cleaved protein corresponds to human acetylcholinesterase fragment from codon 33 to codon 574 as shown in
(19) The purified rhAChE is dialyzed overnight into a storage buffer, such as 10 mM HEPES (pH 7.0) and 10 mM NaCl. The solution is concentrated to 16-20 mg/ml for crystallization. See Block 42.
(20) A crystallization buffer 44 is provided. The preferred crystallization buffer 44 contains 15-21% polyethylene glycol (PEG) 3350 and 0.17-0.21M potassium nitrate. Crystals of rhAChE are grown by sitting drop vapor diffusion at 22 C. against the crystallization buffer 44. See Block 46. Clustered hexagonal rod-shaped crystals (2020600 m) are typically nucleated within 5 days and grow to full size within 3 days. Once the crystals are full size, they are harvested and flash frozen using liquid nitrogen. See Block 48. The harvested crystals 10 can then be cut and subjected to X-ray crystallography and modeling in the traditional manner. See Block 50. Since the rhAChE crystals 10 are not complexed, the X-ray crystallography produces models that more accurately represent AChE in the human brain. Additionally, the active sites that are obfuscated by snake venom in the prior art are open and active.
(21) For the purposes of experimentation and/or comparison, it may be desirable to produce rhAChE crystals that are intentionally complexed with small molecular ligands. This may be done to model how certain drugs interact with AChE on the molecular level. The complexed rhAChE crystals can be produced using two methodologies.
(22) Referring to
(23) Base rhAChE crystals 10 are produced using the methodology previously described. The resulting rhAChE crystals 10 are grown and harvested. A modified crystallization buffer 54 is then created by mixing the complexing ligand 52 into the crystallization buffer 44. The rhAChE crystals 10 are then soaked in a modified crystallization buffer 54. See Block 56.
(24) After the soak, the new complex crystals 60 are produced. The complex crystals 60 are flash frozen, cut, and subjected to X-ray crystallography in the manner previously described.
(25) The compound used as the ligand 52 can include, without limitation, any chemical compound that has an affinity to the active site of human AChE. For example, the chemical entity can include a cholinesterase inhibitor. More particularly, the cholinesterase inhibitor can be selected from the group consisting of donepezil, galantamine, rivastigmine, huperzine A, fasciculin-2, and derivatives thereof.
(26) If donepezil is selected as the ligand 52, the complex rhAChE crystals 60 are characterized with space group P3,21 and have unit cell parameters a=105.152 , b=105.152 , c=322.982 , =90, =90, and =120. More particularly, in one embodiment, the complex rhAChE crystals 60 have atomic coordinates as deposited with the Protein Data Bank under PDB ID Code 4EY7.
(27) If galantamine, such as 30(-)galamine is selected as the ligand 52, the complex rhAChE crystals 60 are characterized with space group P3,21 and have unit cell parameters a=104.982 , b=104.982 , c=323.402 , =90, =90, and =120. More particularly, in one embodiment, the crystalline composition has atomic coordinates as deposited with the Protein Data Bank under PDB ID Code 4EY6.
(28) If huperzine, such as 5(-)-huperzine is selected as the ligand 52, the complex rhAChE crystals 60 are characterized with space group P3,21 and has unit cell parameters a=105.222 , b=105.222 , c=323.292 , =90, =90, and =120. More particularly, in one embodiment, the crystalline composition has atomic coordinates as deposited with the Protein Data Bank under PDB ID Code 4EY5.
(29) If fasciculin-2 is selected as the ligand 52, the complex rhAChE crystals 60 are characterized with space group R32 and have unit cell parameters a=151.702 , b=151.702 , c=247.862 , =90, =90, and =120. More particularly, in one embodiment, the crystalline composition has atomic coordinates as deposited with the Protein Data Bank under PDB ID 15 Code 4EY8.
(30) It will be understood that the embodiments of the present invention that are illustrated and described are merely exemplary and that a person skilled in the art can make many variations to those embodiments. All such embodiments are intended to be included within the scope of the present invention as defined by the claims.