Transgenic mouse model for dementia

Abstract

Disclosed is a vector pair for screening tau oligomer formation, a mouse embryo introduced with the vector pair, a transgenic model mouse of neurological disease, obtained from the mouse embryo, and a method of screening a tau oligomer formation inhibitor candidate using the transgenic model mouse. More specifically, the present invention provides vector pair for screening tau oligomer formation, comprising: a first vector comprising a first tau gene, a first fluorescence protein gene and a first neuron-specific promoter; and a second vector comprising a second tau gene, a second fluorescence protein gene and a second neuron-specific promoter, wherein a protein expressed from the first fluorescence protein gene and a protein expressed from the second fluorescence protein gene bind to each other to display fluorescence, by association between a protein expressed from the first tau gene and a protein expressed from the second tau gene.

Claims

1. A transgenic mouse whose genome comprises: a first expression vector comprising a first tau gene, a first fluorescence protein gene under the control of a first neuron-specific Thy-1 promoter; and a second expression vector comprising a second tau gene, a second fluorescence protein gene under the control of a second neuron-specific Thy-1 promoter, wherein a protein expressed from the first fluorescence protein gene and a protein expressed from the second fluorescence protein gene bind to each other to display fluorescence, by association between a protein expressed from the first tau gene and a protein expressed from the second tau gene, wherein the first tau gene and the first fluorescence protein gene are operably linked to each other, and the second tau gene and the second fluorescence protein gene are operably linked to each other, wherein the first expression vector and the second expression vector comprise the nucleotide sequence as set forth in SEQ ID NO: 6 and 7 respectively, wherein the mouse exhibits fluorescence that is displayed by binding between the first fluorescence protein and the second fluorescence protein upon a fulllength tau expressed from the first vector and a full-length tau expressed from the second vector forming an oligomer the hippocampus, cortex and amygdale.

2. A mouse embryo comprising a vector pair, comprising: a first expression vector comprising a first tau gene, a first fluorescence protein gene under control of a first neuron-specific thy-1 promoter; and a second expression vector comprising a second tau gene, a second fluorescence protein gene under control of a second neuron-specific thy-1 promoter, wherein a protein expressed from the first fluorescence protein gene and a protein expressed from the second fluorescence protein gene bind to each other to display fluorescence, by association between a protein expressed from the first tau gene and a protein expressed from the second tau gene, wherein the first tau gene and the first fluorescence protein gene are operably linked to each other, and the second tau gene and the second fluorescence protein gene are operably linked to each other, wherein the first expression vector and the second expression vector comprise the nucleotide sequence as set forth in SEQ ID NO: 6 and 7 respectively; and wherein said mouse embryo is capable of producing transgenic mouse of claim 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1A and 1B are schematic views showing the structures of pTSC21K-TauP301L-VN173 and pTSC21K-TauP301L-VC155 recombinant plasmids, respectively, used in an example of the present invention.

(2) FIGS. 2A and 2B are schematic views showing the results of sequencing of pTSC21K-TauP301L-VN173 and pTSC21K-TauP301L-VC155 recombinant plasmids, respectively, used in an example of the present invention.

(3) FIG. 3 is an image showing the results of analyzing BiFC fluorescence displayed by tau oligomer formation in SH-SY5Y cells introduced with pTSC21K-TauP301L-VN173 and pTSC21K-TauP301L-VC155 recombinant plasmids in an example of the present invention.

(4) FIG. 4 is an image showing the results of electrophoresis performed after linearization of each of pTSC21K-TauP301L-VN173 and pTSC21K-TauP301L-VC155 recombinant plasmids constricted in an example of the present invention.

(5) FIG. 5 is a schematic view showing a method for constructing a transgenic mouse according to an embodiment of the present invention.

(6) FIG. 6 shows the results of Western blot analysis performed to determine whether or not TauP301L-VN173 and TauP301L-VC155 proteins in transgenic mice constructed in an example of the present invention would be normally expressed.

(7) FIG. 7 depicts images showing BiFC fluorescence resulting from tau oligomer formation in the brain tissue of transgenic mice constructed in an example of the present invention.

(8) FIG. 8 depicts staining images comparing AT8 immunofluorescence with BiFC fluorescence resulting from tau oligomer formation in the brain tissue of transgenic mice constructed according to an example of the present invention.

(9) FIG. 9 depicts images showing the results of observing BiFC fluorescence in the brain tissue of a transgenic mouse injected with a tau oligomer formation inducer in an example of the present invention.

DETAILED DESCRIPTION OF THE INVENTION

(10) Hereinafter, the present invention will be described in further detail with reference to examples. It is to be understood, however, that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention as defined in the appended claims.

EXAMPLES

(11) 1. Construction of Neuron-Specific Vectors for Screening Tau Oligomer Formation

(12) To express tau protein specifically in mouse neurons, two bimolecular fluorescence complementation (BiFC) constructs (tau-VN173 and tau-VC155) were cloned into 323-pTSC21K vectors including a Thy1 promoter.

(13) Particularly, in the present invention, vectors were constructed using a Venus-based BiFC system. To this end, the mammalian expression vector pCMV6-hTau40-GFP was purchased from OriGene Technologies Inc. (Rockville, Md., USA), and the amino acid proline at position 301 was replaced with leucine, thereby constructing pCMV6-hTau40P301 L-GFP. The forward and reverse primer sequences used herein are shown in Table 1 below.

(14) TABLE-US-00001 TABLE1 P301L-F 5 -AATATCAAACACGTCCTGGGAGGCGGC AGTG-3 (SEQIDNO:8) P301L-R 5-CACACTGCCGCCTCCCAGGACGTGTTT- 3 (SEQIDNO:9)

(15) To replace GFP with a Venus fluorescence protein fragment, pBiFC-VN173 and pBiFC-VC155 were purchased from Addgene (Cambridge, Mass.), and then amplified using PCR primers having XhoI/PmeI restriction enzyme sequences. Next, a substituted human full-length tau (441 amino acids) was fused to the N-terminal fragment (1-172, VN173) (first fluorescence protein) and C-terminal fragment (155-238, VC155) (second fluorescence protein) of the fluorescence protein Venus.

(16) pCMV6-TauP301L-GFP and the PCR-amplified insert were digested with XhoI/PmeI and ligated with each other, thereby constructing pCMV6-TauP301L-VN173 and pCMV6-TauP301L-VC155 which are insertion genes. The linker peptide and fluorescence protein sequences used in construction of the insertion genes are shown in Tables 2 and 3 below.

(17) TABLE-US-00002 TABLE2 pCMV6-TauP301L-VN173 First ACGCGTACGCGGCCGCTCGAGTCTAGAAGATCC linker ATCGCCACC(SEQIDNO:2) peptide First ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGG fluorescence GTGGTGCCCATCCTGGTCGAGCTGGACGGCGAC protein GTAAACGGCCACAAGTTCAGCGTGTCCGGCGAG (VN173) GGCGAGGGCGATGCCACCTACGGCAAGCTGACC CTGAAGCTGATCTGCACCACCGGCAAGCTGCCC GTGCCCTGGCCCACCCTCGTGACCACCCTGGGC TACGGCCTGCAGTGCTTCGCCCGCTACCCCGAC CACATGAAGCAGCACGACTTCTTCAAGTCCGCC ATGCCCGAAGGCTACGTCCAGGAGCGCACCATC TTCTTCAAGGACGACGGCAACTACAAGACCCGC GCCGAGGTGAAGTTCGAGGGCGACACCCTGGTG AACCGCATCGAGCTGAAGGGCATCGACTTCAAG GAGGACGGCAACATCCTGGGGCACAAGCTGGAG TACAACTACAACAGCCACAACGTCTATATCACC GCCGACAAGCAGAAGAACGGCATCAAGGCCAAC TTCAAGATCCGCCACAACATCGAGTAG (SEQIDNO:3)

(18) TABLE-US-00003 TABLE3 pCMV6-TauP301L-VC155 Second ACGCGTACGCGGCCGCTCGAGAAG linker (SEQIDNO:4) peptide Second CAGAAGAACGGCATCAAGGCCAACTTCAAGATC fluorescence CGCCACAACATCGAGGACGGCGGCGTGCAGCTC protein GCCGACCACTACCAGCAGAACACCCCCATCGGC (VC155) GACGGCCCCGTGCTGCTGCCCGACAACCACTAC CTGAGCTACCAGTCCAAACTGAGCAAAGACCCC AACGAGAAGCGCGATCACATGGTCCTGCTGGAG TTCGTGACCGCCGCCGGGATCACTCTCGGCATG GACGAGCTGTACAAGTAA(SEQIDNO:5)

(19) The Thy1 promoter from mouse thy1.2 gene is a promoter that is expressed specifically in mouse brain neurons. Mouse Thy1 gene (mouse Thy-1.2 glycoprotein gene) is 5572 bp in total length and includes three exon regions and three intron regions. TauP301L-VN173 and Tau-P301L-VC155 were inserted into exon 3 of the Thy1 gene.

(20) Each of two tau-BiFC plasmids (i.e., pCMV6-TauP301L-VN173 and pCMV6-TauP301L-VC155) prepared as insertion genes was cloned into the Xho-1 site of a 323-pTSC21K vector. FIGS. 1A and 1B show the above-constructed pTSC21K-TauP301L-VN173 and pTSC21K-TauP301L-VC155 recombinant plasmids, respectively. After the re-cloning process, in order to confirm whether pTSC21K-TauP301L-VN173 and pTSC21KTauP301L-VC155 would be successfully constructed, the insert region and surrounding region of the two recombinant plasmids were sequenced. FIGS. 2A and 2B show the sequences of the recombinant plasmids. Then, in order to examine expression of TauP301L-BiFC under the control of the Thy1 promoter, the recombinant plasmids were transduced into SH-SY5Y cells, and 24 hours, normal expression of TauP301L-BiFC in the neuronal cells was observed. FIG. 3 shows a fluorescence microscopic image of the SH-SY5Y cells expressing TauP301L-BiFC.

(21) 2. Construction of Transgenic Model Mice

(22) For injection into mouse embryos, the Thy1-TauP301L-VN173 and Thy1-Tau-P301L-VC155 recombinant plasmids were linearized with the restriction enzyme EcoRI. FIG. 4 shows the results of electrophoresis of the plasmids linearized with EcoRI. To construct transgenic mice, the confirmed plasmids were injected into embryos. To obtain embryos, pregnant mare serum gonadotropin and human chorionic gonadotropin were injected into C57BL/6N female mice to induce superovulation. The superovulation-induced C57BL/6N female mice were mated with C57BL/6N male mice, and after mating, embryos were obtained from pregnant C57BL/6N female mice. Then, the vectors expressing Thy1-TauP301L-VN173 and Thy1-Tau-P301L-VC155 were injected into the male pronucleus of zygote of the obtained embryos, and the injected embryos were transferred into ICR surrogate mothers. Next, genotyping was performed to select mice having both TauP301L-VN173 and TauP301L-VC155 (FIG. 5). Next, in order to examine whether both the TauP301L-VN173 and TauP301L-VC155 proteins would be normally expressed by introduction of the genes, Western blotting analysis was performed. First, 3-month-old genetically modified mice were anesthetized, and the brain was extracted from each of the mice. The extracted brain was lysed in RIPA containing phosphatase and protease to prepare a brain lysate sample. 40 g of the sample was loaded, and antigen-antibody reactions with tau antibodies (pS199 and pS396) targeting phosphorylated tau were analyzed. As a result, it was shown that TauP301L-VN173 and TauP301L-VC155 in the mice obtained from the mouse embryos injected with the vectors were normally expressed, unlike those in normal control mice (FIG. 6).

(23) 3. Observation of Tauopathy in Transgenic Mice

(24) The constructed Tau-P301L BiFC transgenic mice display fluorescence when tau protein formed oligomers in the brain. In order to actually confirm whether fluorescence would be observed by tau oligomer formation in the brain tissue of the Tau-P301L BiFC transgenic mice, the brain of 7-month-old mice was purfused, fixed, and extracted, and the extracted brain was sectioned to a thickness of 40 m. The brain tissue sections of various regions were imaged without immunofluorescence staining, and as a result, BiFC fluorescence was observed. Specifically, BiFC fluorescence could be observed in the hippocampus, cortex, amygdale and the like of tau-expressing animal models known to show tau aggregation. FIG. 7 shows an image of BiFC fluorescence displayed in the brain tissue section. In order to verify that BiFC fluorescence displayed in the mouse brain tissue results from tau oligomer formation, immunofluorescence staining of the same brain tissue section with the tau antibody AT8 targeting phosphorylated tau was performed. As a result, it was shown that the BiFC fluorescence displayed was consistent with fluorescence labeled with AT8 (FIG. 8).

(25) 4. Observation of Induction of Tau Oligomer Formation in Transgenic Mice

(26) Using 4-month-old Tau-P301L BiFC transgenic mice which have not yet shown tau aggregation, whether tau oligomer BiFC fluorescence would be observed following injection of a tau aggregation inducer was examined. The tau aggregation inducing drug forskolin was filled in a drug injection kit, and then the drug was allowed to flow into a ventricle in the brain of about 5-month-old Tau-P301L BiFC transgenic mice (FIG. 9). After about 10 days of drug injection, brain section samples were made for observation of BiFC fluorescence. As a result, in the brain of the Tau-P301L BiFC transgenic mice injected with forskolin, BiFC fluorescence was observed in a portion surrounding the injected region, unlike mice injected with DMSO as a control. This result suggests that tau oligomer formation in the mouse brain was accelerated by injection of the forskolin drug. In addition, it was demonstrated that the level of tau oligomer formation could be directly observed without using a separate antibody.

(27) As described above, according to the present invention, tau oligomer formation occurring in the brain of mice can be visualized directly by fluorescence, thereby monitoring and quantifying the tau oligomerization process in the brain. The use of this technology makes it possible to investigate diseases such as dementia in which tau protein is involved, and to screen a tau oligomer formation inhibitor candidate. Thus, the present invention may be used as a useful tool in development of dementia therapeutic agents.

(28) While the present invention has been described with reference to the particular illustrative embodiments, it will be understood by those skilled in the art to which the present invention pertains that the present invention may be embodied in other specific forms without departing from the technical spirit or essential characteristics of the present invention. Therefore, the embodiments described above should be considered in a descriptive sense only and not for purposes of limitation. For example, each component described in a single form may be carried out in a distributed fashion, and likewise, components described in a distributed form may be carried out in a combined fashion.

(29) Therefore, the scope of the present invention is defined not by the detailed description, but by the claims and their equivalents, and all variations within the scope of the claims and their equivalents are to be construed as being included in the scope of the present invention.