Corynebacterium Constitutive Expression Vector Promoter Screened On The Basis Of Transcriptome Sequencing, Screening Method Thereof, And Applications Thereof
20200024625 ยท 2020-01-23
Inventors
- Panpan Xing (Wuhan, CN)
- Haixia Su (Wuhan, CN)
- Jiong Wang (Wuhan, CN)
- Xuechen Mei (Wuhan, CN)
- Kun Wan (Wuhan, CN)
- Mengjun Song (Wuhan, CN)
- Jing Li (Wuhan, CN)
- Aifu Liu (Wuhan, CN)
Cpc classification
C12N15/113
CHEMISTRY; METALLURGY
C12N15/1089
CHEMISTRY; METALLURGY
C12N15/1034
CHEMISTRY; METALLURGY
C12N15/1086
CHEMISTRY; METALLURGY
C12N2830/00
CHEMISTRY; METALLURGY
C12Q1/6897
CHEMISTRY; METALLURGY
C12N2800/60
CHEMISTRY; METALLURGY
C12P13/06
CHEMISTRY; METALLURGY
C12N2800/24
CHEMISTRY; METALLURGY
International classification
C12P13/06
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Provided is a method for screening a corynebacterium constitutive expression vector promoter on the basis of transcriptome sequencing; and further provided are the corynebacterium constitutive expression vector promoter screened on the basis of transcriptome sequencing, an expression vector comprising the promoter, a recombination strain obtained by transforming a host cell Corynebacterium glutamicum using the expression vector, and applications thereof.
Claims
1. A method for screening a Corynebacterium constitutive expression vector promoter on the basis of transcriptome sequencing, comprising: analyzing the transcription level of each gene of the Corynebacterium in logarithmic phase and stationary phase, and screening a class of genes with low transcription levels in the logarithmic phase and high transcription levels in the stationary phase are screened by analyzing the transcription abundance of each gene in two phases; amplifying the promoter fragments of genes and incorporating the DNA fragment of the promoter and marker gene into an expression vector to construct a promoter probe vector; transforming the probe vector into host cells, and carrying out continuous passage under an antibiotic-stress free condition; selecting host cells having low expression level of marker gene in the logarithmic phase and high expression level in the stationary phase, and continuously passaged for 50 generations without losing probe vector, thus the promotor transformed by the host cells is the Corynebacterium constitutive expression vector promoter.
2. A Corynebacterium constitutive expression vector promoter screened by the method of claim 1, wherein the nucleotide sequence of the promoter is set forth in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.
3. A Corynebacterium constitutive expression vector comprising the Corynebacterium constitutive expression vector promoter of claim 2.
4. The Corynebacterium constitutive expression vector of claim 3, wherein it is constructed by inserting a gene of interest and the Corynebacterium constitutive expression vector promoter of claim 2 at the restriction site of the plasmid HY-P19, wherein the nucleotide sequence of the plasmid HY-P19 is shown in SEQ ID NO: 4, and the nucleotide sequence of the gene of interest is set forth in SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7.
5. The Corynebacterium constitutive expression vector of claim 4, wherein, the nucleotide sequence of the gene of interest is set forth in SEQ ID NO: 5, provided that the nucleotide sequence of the Corynebacterium constitutive expression vector promoter of claim 2 is set forth in SEQ ID NO: 1; the nucleotide sequence of the gene of interest is set forth in SEQ ID NO: 6, provided that the nucleotide sequence of the Corynebacterium constitutive expression vector promoter of claim 2 is set forth in SEQ ID NO: 2; the nucleotide sequence of the gene of interest is set forth in SEQ ID NO: 7, provided that the nucleotide sequence of the Corynebacterium constitutive expression vector promoter of claim 2 is set forth in SEQ ID NO: 3.
6. A recombinant strain obtained by electroporating the host cells C. glutamicum with the expression vector of claim 3.
7. The strain of claim 6, wherein the accession number of the deposited host cells C. glutamicum is CCTCC NO: M2016609.
8. Use of the recombinant strain of claim 6 in the production of isoleucine.
9. The method of claim 1, wherein the promoter regions of genes that have been screened are analyzed by promotor prediction software, and the promotor regions of said genes are amplified by PCR.
10. The method of claim 1, wherein the method for transforming the probe vector to the host cells is electroporation.
11. The method of claim 1, wherein the OD value indicating growth of the host cells is detected by a multifunctional plate reader after the probe vector being transformed into the host cells, and the host cells are cultured to a logarithmic phase and a stationary phase and the expression of the marker gene in two phases is detected respectively.
12. The method of claim 1, wherein the marker gene is a gene encoding green fluorescent protein.
13. The method of claim 1, wherein host cells which have been selected are the host cells that have been continuously passaged for 50 generations without losing the probe vector.
14. The method of claim 1, wherein the accession number given to Corynebacterium is CCTCC NO: M2016609.
15. The method of claim 1, wherein the transcription level of each gene is analyzed by following steps: (1); sample preparation, (2) transcriptome sequencing; and (3) bioinformatics analysis.
16. The method of claim 15, wherein the sample preparation comprises bacteria culturing and RNA extraction, the bacteria is C. glutamicum; and/or, the reference species of bioinformatics analysis is C. glutamicum ATCC13032.
17. The method of claim 1, wherein low transcription levels in the logarithmic phase and high transcription levels in the stationary phase means that the transcription level in the stationary phase is higher than that in logarithmic phase.
18. The method of claim 17, wherein the transcription level in the stationary phase is 15 times, 45 times, 100 times, 200 times and 300 times higher than that in logarithmic phase.
19. The method of claim 1, wherein the promoter probe vector further comprises a gene encoding green fluorescent protein.
20. The method of claim 1, wherein the initial plasmid used to construct the promoter probe vector is PXMJ19.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0016]
[0017]
[0018]
[0019]
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
[0020] The present invention will now be illustrated in detail by way of embodiments.
Embodiment 1
1. Preparation of Transcriptome Sequencing Sample and Analysis of Transcription Information:
[0021] Bacterial culture: The L-isoleucine-producing Corynebacterium glutamicum without plasmid (Corynebacterium glutamicum H5 strain, deposited at the China Center for Type Culture Collection on Nov. 1, 2016, and the accession number of which is CCTCC NO: M2016609) was picked and inoculated to LB medium, and cultured overnight at 31 C. The obtained bacterial liquid was centrifuged and resuspended in an equal volume of sterile water, then inoculated to LBG fresh sterile medium at a percentage of 5%, and cultured at 31 C. and 200 rpm until the mid-log phase and the early stationary phase. The fermentation broth was taken out, and mixed immediately with an equal volume of RNA Protect Bacteria Reagent (QIAGEN). After centrifugation at 5000 rpm for 10 min, 100 mg of wet bacteria were weighed and quickly stored in liquid nitrogen.
[0022] RNA extraction: The sample stored in liquid nitrogen was placed in a mortar precooled with liquid nitrogen, and an appropriate amount of liquid nitrogen was added to ensure that the mortar always contains a certain amount of liquid nitrogen. The sample was ground into powder, and then RNA of which was extracted according to the experimental procedure provided by QIAGEN RNeasy Plant Mini Kit. The extracted sample was tested by 1% agarose gel, which requires that the sample cannot be contaminated with protein, i.e. there was no obvious bright bands in the pores of agarose gel. The concentration of nucleic acid was measured by NanoDrop Spectrophotometer. The concentration of the sample in mid-log phase was 421 ng/l, and that in stationary phase was 237 ng/l, and the requirements of no obvious protein contamination and nucleic acid concentration reaching >60 ng/l were met.
2. Transcriptome sequencing: extracted RNA samples were sequenced by Beijing Novogene Corporation. The sequencing process was as follows: After the sample was qualified, rRNA was removed by Ribo-zero kit to enrich the mRNA. Subsequently, the fragmentation buffer was added to break the mRNA into short fragments. mRNA was used as a template to synthesize a single stranded cDNA with random hexamers. Then, buffer, dNTPs (dTTP in dNTP was replaced with dUTP), DNA polymerase I and RNase H polymerase were added to synthesize the double-stranded cDNA. Then, the double-stranded cDNA was purified with AMPure XP beads, and the second strand of the cDNA containing U was degraded with USER enzyme. The purified double-stranded cDNA was firstly end-repaired, A-tailed and ligated to sequencing adaptor, and then the fragment size was selected using AMPure XP beads. Finally, PCR amplification was performed and the PCR products were purified with AMPure XP beads to obtain a final library. After the library was constructed, preliminary quantification was performed using Qubit 2.0, and the library was diluted to 1 ng/l. Then, the insert size of the library was detected using Agilent 2100. After the insert size met the expectation, the effective concentration of the library was accurately quantified (effective library concentration >2 nM) by using Q-PCR method to ensure the quality of the library. Once the library was qualified, different libraries were pooled according to the requirement of the effective concentration and target raw data volume, and HiSeq/MiSeq sequencing was performed.
3. Bioinformatics analysis process: The sequencing results were analysed by Beijing Novogene Corporation. After the original Sequenced Reads were obtained, bioinformatics analysis was performed by using reference sequence or reference genome of the relevant species. The main processes of bioinformatics analysis were as follows:
Original sequence data.fwdarw.Quality assessment of sequencing data.fwdarw.Alignment analysis with reference sequence.fwdarw.Gene expression level analysis.fwdarw.Overall quality assessment of RNA-seq.fwdarw.Gene differential expression analysis.fwdarw.GO enrichment analysis of differential gene or KEGG enrichment analysis of differential gene.
[0023] The bioinformatics reference species of the sample of the present invention is Corynebacterium glutamicum ATCC 13032 (purchased from Shanghai Fuxiang Biotechnology Co., Ltd.), and the reference genome is linked to ncbi as https://www.ncbi.nlm.nih.gov/Nuccore/NC_006958.1. According to the table of the information analysis data finally provided, the expression abundance of each gene in the logarithmic phase and the stationary phase was analyzed, and 10 genes and transcription analysis information in Table 1 were screened. The consistent characteristics of the 10 genes were: the transcription level was low in the logarithmic phase, while the transcription level was high in the stationary phase. By prediction of the operon, the genes CGTRNA_RS10085 and CGTRNA_RS10080 belong to the same operon, CGTRNA_RS07920, CGTRNA_RS07925, CGTRNA_RS07930 belong to the same operon, CGTRNA_RS00965, CGTRNA_RS00970 belong to the same operon, and the same operon shares one promoter.
TABLE-US-00001 TABLE 1 The Corynebacterium glutamate transcriptome analysis of gene with high transcript abundance in S phase and low transcript abundance in L phase Gene Name Strand start end length S1_fpkm L1_fpkm CGTRNA_RS10085 2142201 2143517 1317 27347.52 148.9929 CGTRNA_RS10080 2141798 2142136 339 24497.2 543.2887 CGTRNA_RS10840 + 2320501 2321934 1434 13058.69 838.0642 CGTRNA_RS07910 1672737 1673144 408 7453.836 37.12523 CGTRNA_RS07920 1674757 1675572 816 3383.739 15.18759 CGTRNA_RS07925 1675587 1676735 1149 2442.069 7.789865 CGTRNA_RS07930 1676732 1678090 1359 5493.98 22.03821 CGTRNA_RS00965 + 195241 199773 4533 6137.992 54.29964 CGTRNA_RS00970 + 199773 201293 1521 4023.859 33.94991 CGTRNA_RS04670 + 988209 989480 1272 2037.631 8.931068
4. Promoter region screening: by means of NCBI blast, the predicted gene fragments were aligned with the genome of the C. glutamicum sequenced in the laboratory to find the corresponding gene sequence. The promoter region of each gene was predicted by searching literature or applying promoter prediction software, and 2-3 fragments from the promoter region of each gene were selected according to the predicted functional region for promoter activity detection.
TABLE-US-00002 (1) promoter region fragments of gene CGTRNA_RS10085: RS10085seq1: CTATTGAAATTAGTTTCTGTAGGTCTATAGTTAGAGCTGGTTCAAGGGGT GTCAATCCCAAAAGGCACTCCTTGAACTCATGAAAAAGCTTGACAAAACT TCAACGTCAAAGGAGGTCATCCACGCT RS10085seq2: CTATTCTATAGATCTATTGAAATTAGTTTCTGTAGGTCTATAGTTAGAGC TGGTTCAAGGGGTGTCAATCCCAAAAGGCACTCCTTGAACTCATGAAAAA GCTTGACAAAACTTCAACGTCAAAGGAGGTCATCCACGCT RS10085seq3: ACTTAACAATTCATTAAATTACCTGTTAAACTATAGAAAATATCCAAAAC CCTCCAAAACCTATTCTATAGATCTATTGAAATTAGTTTCTGTAGGTCTA TAGTTAGAGCTGGTTCAAGGGGTGTCAATCCCAAAAGGCACTCCTTGAAC TCATGAAAAAGCTTGACAAAACTTCAACGTCAAAGGAGGTCATCCACGCT (2) promoter region fragments of gene CGTRNA_RS10840 RS10840 seq1: TCAAAGGTCAGCAATTGTGAACAAAGCTACAAATAAACCGTTCCACCCAT GTCAATGAGGAGTCACC RS10840 seq2: GCAGTCAAAAGGCGTTGCTTTTCGACGTCGCAAAGCGCAATTTCCTACCT TTAAGATCCTAATCTGTTGAGGTCAGCCACAATTTTTCAGAAAAGTTTTG ATAGATCGACAGGTAATGCTTTATACTGACAACGTCGCAAGGACTACATT TGCAGCCAAGTCTACTACTTGATCTTCAAAGGTCAGCAATTGTGAACAAA GCTACAAATAAACCGTTCCACCCATGTCAATGAGGAGTCACC (3) promoter region fragments of gene CGTRNA_RS07910 RS07910 seq1: ACTTGGTTCCTGCCCAACAACCCAGTGGACTTCCAGCCGGAAAATCTGCC ATGCTTCATCCGTGACCGTG RS07910 seq2: GCGATCACGTAGTCATCCAAGCAGGCGAAGAAACCACAATCGTGGACCGC GTTATCGTCACCACCGGCAGCTGGACAAGCGAGCTCGTGCCCTCCATCGC GCCACTGCTTGAAGTGCGACGCCTAGTGCTCACTTGGTTCCTGCCCAACA ACCCAGTGGACTTCCAGCCGGAAAATCTGCCATGCTTCATCCGTGACCGT G (4) promoter region fragments of gene CGTRNA_RS07930 RS07930 seq1: CGGAATAGAAAATACTCCGCTCGACAGCATCACTTAGCTGAAAGGCCTTT AAC RS07930 seq2: GAAACTGGACTAGGTTTATCTATAGCGGAATAGAAAATACTCCGCTCGAC AGCATCACTTAGCTGAAAGGCCTTTAAC RS07930 seq3: GCAGGTTAAAACGCTGCCATAGGGGATTTTTCGGCTGGGGAGACGTGGTG TAAGTGCGGGTTAAAAACGTGACCTTCGTTATAAAAACAGAAATCTATAG AACGATAGGTAGAAACTGGACTAGGTTTATCTATAGCGGAATAGAAAATA CTCCGCTCGACAGCATCACTTAGCTGAAAGGCCTTTAAC (5) promoter region fragments of gene CGTRNA_RS00965 RS00965 seq1: CTTGCGTTGCAGGTAGTGCGCCTGATTTTCTTATTATCGAACGATTGATA GAAACAGGATTAAAGTGAGGTATCCCGC RS00965 seq2: TTTTATCTTCTTTCACGGGGTGGATAGGCGAACATCTTCTACCATATCCT GTGATGTGTAACACAGGAGCGTAATCTGACCTCCCGTTTTCCTATAGATT GATCGAAAGTAACCCTTTTGTTACTTGCGTTGCAGGTAGTGCGCCTGATT TTCTTATTATCGAACGATTGATAGAAACAGGATTAAAGTGAGGTATCCCG C (6) promoter region fragments of gene CGTRNA_RS04670 RS04670 seq1: AGGCTGACAGAAACTCTAAAAACTATAGAGCTATAGAAACCTTAACTTCG GAGGTATCC RS04670 seq2: GTGGGCGCTGGGCCATAGTCGCCCCAGCTCAGCGAAGTTGTACGCCGGCG TTGCCTGCTTGTCGACGTTTTTTGCCACTTCCCTTAATTCGGGGGTGGCT GAAATGTAAGACACGTCACTACATTTAAGCTCAAAAACAACTACCTATAG GCTGACAGAAACTCTAAAAACTATAGAGCTATAGAAACCTTAACTTCGGA GGTATCC
5. Construction of Promoter Probe Vector and Detection of Fluorescence:
[0024] (1) Primer synthesis: The primers were designed by snapgene software, and synthesized by Wuhan TianyiHuiyuan Corporation. The sequences of synthetic primer are shown in Table 2 below.
TABLE-US-00003 TABLE 2 primer sequences for the construction of the probe vector Primer Name Primer Sequence RS10085SEQ1FP TGCCTGCAGGTCGACTCTAGACTATTGAAATTAGTTTCTG RS10085SEQ2FP TGCCTGCAGGTCGACTCTAGACTATTCTATAGATCTATTG RS10085SEQ3FP TGCCTGCAGGTCGACTCTAGAACTTAACAATTCATTAAATTACC RS10085SEQ1RP CTCGCCCTTGCTCACCATAGCGTGGATGACCTCCTTTG RS10840SEQ1FP TGCCTGCAGGTCGACTCTAGATCAAAGGTCAGCAATTG RS10840SEQ2FP TGCCTGCAGGTCGACTCTAGAGCAGTCAAAAGGCGTTGC RS10840SEQ1RP CTCGCCCTTGCTCACCATGGTGACTCCTCATTGACATG RS07910SEQ1FP TGCCTGCAGGTCGACTCTAGAACTTGGTTCCTGCCCAAC RS07910SEQ2FP TGCCTGCAGGTCGACTCTAGAGCGATCACGTAGTCATCC RS07910SEQ1RP CTCGCCCTTGCTCACCATCACGGTCACGGATGAAGC RS07930SEQ1FP TGCCTGCAGGTCGACTCTAGACGGAATAGAAAATACTCC RS07930SEQ2FP TGCCTGCAGGTCGACTCTAGAGAAACTGGACTAGGTT RS07930SEQ3FP TGCCTGCAGGTCGACTCTAGAGCAGGTTAAAACGCTGC RS07930SEQ1RP CTCGCCCTTGCTCACCATGTTAAAGGCCTTTCAGCTAA RS00965SEQ1FP TGCCTGCAGGTCGACTCTAGACTTGCGTTGCAGGTAG RS00965SEQ2FP TGCCTGCAGGTCGACTCTAGATTTTATCTTCTTTCACGGGGTG RS00965SEQ1RP CTCGCCCTTGCTCACCATGCGGGATACCTCACTTTAATC RS04670SEQ1FP TGCCTGCAGGTCGACTCTAGAAGGCTGACAGAAACTC RS04670SEQ2FP TGCCTGCAGGTCGACTCTAGAGTGGGCGCTGGGCCA RS04670SEQ1RP CTCGCCCTTGCTCACCATGGATACCTCCGAAGTTAAG EGFP-FP ATGGTGAGCAAGGGCGAGGA EGFP-RP CAAAACAGCCAAGCTGAATTCTTACTTGTACAGCTCGTCCAT GCC
(2) Genomic extraction: Corynebacterium glutamicum H5 was picked and inoculated to LB medium, and incubated at 31 C. overnight. Removing the supernatant by centrifugation, the bacterial genome was extracted according to the protocol of the Tiangen Genome Extraction Kit. The concentration of the nucleic acid from the extracted genome was detected using a NanoDrop Spectrophotometer, and the concentration of the nucleic acid for PCR amplification was controlled between 100 and 200 ng/l.
(3) PCR amplification: each synthetic primer was diluted with water to a final concentration of 10 M, and the amplification was carried out using TransStart FastPfu Fly DNA Polymerase. The PCR system contained 1 l of genomic template, 1 l of forward primer (10 M), 1 l of reverse primer (10 M), 10 l of 5*TransStart FastPfu FlyBuffer, 4 l of 2.5 mM Dntps, 1 l of TransStart FastPfu Fly DNA Polymerase, and ddH.sub.2O 32 l. The PCR amplification process was 95 C. for 2 min, 32 cycles of 95 C. for 20 s, 55 C. for 20 s and 72 C. for 10 s-1 min, and 72 C. for 5 min. The amplified DNA fragments with recombinant adaptors RS10085seq1, RS10085seq2, RS10085seq3, RS10840seq1, RS10840seq2, RS07910seq1, RS07910seq2, RS07930seq1, RS07930seq2, RS07930seq3, RS00965seq1, RS00965seq2, RS04670seq1, RS04670seq2, and EGFP were then obtained.
(4) Plasmid digestion and DNA synthesis: the original plasmid PXMJ19 was double digested with NEB restriction endonuclease NarI and HindIII, the original lacIq and promoter Ptac were removed in a 50 l of enzyme digestion system containing 5-10 l of plasmid, 1 l of NarI, 1 l of HindIII, 5 l of cutsmart, and 33-38 l of ddH.sub.2O.
[0025] DNA sequence hy-dna1 shown below was synthesized by Wuhan Tianyi Huiyuan:
TABLE-US-00004 gcatccggggctgatccccggcgcctaactaactaactcgagcttaagag gcctaagcttgcatgcctgcaggtcgact
(5) DNA recovered by agarose electrophoresis: The PCR products and the digested products were aliquoted with 10*loading buffer and 50 l of which were loaded onto a 1.5% agarose gel, takara 2000 DL DNA marker was used as a control, and electrophoresis was carried out at 70 V for 40 min. According to the instruction of marker bands, PCR amplified bands were recovered using takara DNA recovery kit. The DNA fragments with recombinant adaptor RS10085seq1 (167 bp), RS10085seq2 (180 bp), RS10085seq3 (240 bp), RS10840seq1 (107 bp), RS10840seq2 (282 bp), and RS07910seq1 (110 bp), RS07910seq2 (241 bp), RS07930seq1 (93 bp), RS07930seq2 (118 bp), RS07930seq3 (229 bp), RS00965seq1 (118 bp), RS00965seq2 (241 bp), RS04670seq1 (99 bp), RS04670seq2 (247 bp), EGFP (760 bp) were then obtained.
(6) In vitro recombination: The digested products were in vitro recombined with the synthetic DNA fragment hydnal using Vazyme one Step Cloning Kit, and the recombinant products were directly transformed into E. coli.
(7) Preparation of E. coli competent cells: E. coli competent cells DH5a were prepared using Beyotime Supercompetent Cell Preparation Kit, and the prepared competent cells were stored in a refrigerator at 80 C. until use.
(8) Transformation: The DH5 competent cells were slowly thawed on ice, and the in vitro recombinant products were pipetted into the competent cell. The centrifuge tube was gently flicked with finger to mix the bacteria and the recombinant products, and placed in an ice bath or ice water bath for 30 minutes. Then the centrifuge tube was placed in a water bath at 42 C., and heated shock for 2 minutes. Immediately after heat shock, the centrifuge tube was placed in an ice water bath for 2 minutes. 900 ml of LB was aliquoted and incubated at 37 C. and 200 rpm for 1 hour. The supernatant was removed after centrifugation, and the obtained cells were spread on LB solid plate containing 25 g/ml chloramphenicol, and cultured overnight at 37 C.
(9) Transformants verification and plasmid extraction: transformants grown on the resistant plates after transformation were sent to Wuhan Tianyi Huiyuan for sequencing analysis, and the transformants with correct sequence were transferred into a tube with 5 ml LB containing a final concentration of 25 g/mol of chloramphenicol. The tube was cultured at 37 C. and 200 rpm overnight, and plasmid was extracted using Takara plasmid kit to make the concentration of which between 200-400 ng/l. The constructed plasmid was named HY-P19, the sequence of which is shown in SEQ ID NO: 4.
[0026] HY-P19 was digested with NEB restriction enzyme XbaI and EcoRI in a 37 C. water bath for 1 h, and the amount of the plasmid was 1 g in a 50 l of digestion system. The digestion system includes 5-10 l of plasmid, 1 l of XbaI, 1 l of EcoRI, 5 l of cutsmart, and 33-38 l of ddH.sub.2O. The digested products of HY-P19 were recovered, and recombined in vitro with each promoter fragment and EGFP fragment using Vazyme one Step Cloning Kit. The other experimental processes were the same as (7)-(9) mentioned-above.
TABLE-US-00005 DNA seq of green fluorescent protein EGFP fragment: 720 bp ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGT CGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGG GCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACC ACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTA CGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACT TCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTC TTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG ACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAC GTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAA GATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACC AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCAC TACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGA TCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCA TGGACGAGCTGTACAAGTAA
[0027] A series of plasmids HY-P19-promoter-EGFP containing probe vectors with different promoters were constructed, and the construction process is as follows: the original plasmid PXMJ19 shown in
(10) Preparation of electroporation competent C. glutamicum cells:
{circle around (1)} A single colony was picked from the fresh LB plate (cultured for about 12 h), and inoculated into a test tube containing 5 mL of LBG liquid, and cultured at 30 C., 220 rpm overnight.
{circle around (2)} 2 mL of bacterial culture from step {circle around (1)} was transferred into a 1 L conical flask containing 100 mL of EPO (comprising 5 g/L of yeast powder, 10 g/L of peptone, 10 g/L of Nacl, 25 g/L of glycine, and 1 g/L of Tween), and incubated at 30 C. until the OD value of which reached between 1.0 and 1.5 (approximately 4-5 h).
{circle around (3)} All the culture was transferred into a 50 mL centrifuge tube pre-cooled at 4 C. under sterile conditions, then the tube was placed on ice for 2 minutes.
{circle around (4)} After Centrifuging at 7000 rpm for 20 minutes at 4 C. and removing the supernatant, the centrifuge tube was inverted on a sterile filter paper to absorb the residual Epo medium.
{circle around (5)} The bacteria pellets were resuspended in 40 mL of 10% glycerol solution pre-cooled at 4 C. and shaken gently, centrifuged at 7000 rpm for 10 minutes. The supernatant was then removed.
{circle around (6)} Step 5 was repeated twice.
{circle around (7)} 1 mL of pre-cooled 10% glycerol solution was pipetted into the centrifuge tube and the bacteria pellet was resuspended by gently blowing.
{circle around (8)} Finally, the competent cells were aliquoted into 1.5 mL sterile EP tubes with 0.1 mL per tube. Stored in an ultra-low temperature freezer at 80 C.
(11) Electro-transformation of Corynebacterium glutamicum:
{circle around (1)} One tube of C. glutamicum competent cells stored at 80 C. was taken out and placed on ice until thawed.
{circle around (2)} The sample plasmid DNA was pipetted into the thawed competent cells and the EP tube was flicked with fingers to ensure that the DNA and competent cells were well mixed.
{circle around (3)} The competent cells containing DNA plasmid was pipetted into a pre-cooled electroporation cuvette (with a pore size of 2 mm) and the cuvette was quickly dried with absorbent paper.
{circle around (4)} The electroporation cuvette was placed into the electroporator, and electroporated under 1800V for 5 milliseconds.
{circle around (5)} The cell solution was quickly pipetted into an EP tube containing 5 mL of LBHIS pre-warmed at 46 C., and heat shock was carried out for exactly 6 minutes.
{circle around (6)} The EP tube was cultured by shaking at 30 C. and 200 rpm, and the cells were resuscitated for 60 minutes.
{circle around (7)} After centrifugation at 7,000 rpm for 2 minutes at room temperature and removing most of the supernatant, the cells were resuspended in the remaining medium and spread with a glass rod on LBCIS solid medium supplemented with 10 g/mL of chloramphenicol.
{circle around (8)} After standing at room temperature for about 1 hour, the liquid on the surface of the solid medium was fully absorbed, then the plate was inverted and cultured in a constant temperature incubator at 30 C. for 36 hours, and the grown transformants were the strain containing various probe vector.
(12) Fluorescence detection of Corynebacterium glutamicum transformants
[0028] The Corynebacterium glutamicum transformants containing different promoter fragments were transferred into a tube with 5 ml LBG medium and cultured at 30 C. to an OD600 of 2.0 (logarithmic phase) and 3.2 (stationary phase), respectively. After supernatant was removed by centrifugation, the cells were washed twice with PBS solution, and resuspended in the same volume of PBS. 200 l of the resuspended cells were aliquoted into a 96-well plate with black bottom and fluorescence value was detected using a multi-plate reader TECANM1000. The detected fluorescence values of the probe plasmids in the logarithmic phase and the stationary phase of the host bacteria are shown in Table 3. From the table we can see that when a same gene promoter has different promoter fragments, the data of different promoter activity can be obtained by the detection of fluorescence value, which is related to the regulation of promoter region of the gene. Promoter fragments with a low fluorescence value in the logarithmic phase and a high fluorescence value in the stationary phase are the ones we need. Promoter fragments RS10085seq2, RS10085seq3, RS10840seq2, RS07910seq2, RS07930seq3, RS00965seq2, RS04670seq2 showed our desired screening characteristics during the expression of the probe vector.
TABLE-US-00006 TABLE 3 Statistics of fluorescence detection and plasmid passage of each probe plasmid in two phases of host bacteria Fluorescence Fluorescence Number of stable Each probe value in value in passages of each vector logarithmic phase stationary phase plasmid Control, 2871 8024 plasmid-free PRS10085seq1 150352 231073 8 PRS10085seq2 6364 241445 50 PRS10085seq3 6191 225450 50 PRS10840seq1 102254 184533 6 PRS10840seq2 11022 177132 50 PRS07910seq1 9551 102310 6 PRS07910seq2 3564 98756 50 PRS07930seq1 12029 146021 5 PRS07930seq2 8211 133602 8 PRS07930seq3 3321 122564 50 PRS00965seq1 11083 85472 11 PRS00965seq2 5412 77450 50 PRS04670seq1 5441 35390 14 PRS04670seq2 3698 28428 50 Note: stable passages means that more than 90% of the bacteria contain plasmids, passaging for 50 times means after 50 passages, more than 90% of the bacteria still contain plasmid.
6. Plasmid passage stability of each promoter probe vector
[0029] The recombinant bacteria containing each promoter probe vector were inoculated into LBG medium and the inoculation amount for passaging was 5%. Without antibiotics pressure, the recombinant bacteria were cultured on a rotary shaker at 30 C. and 190 rpm for 24 h, i.e. one generation of passaging was done. Continuous passaging was carried out, each passage of bacteria was diluted and spread on the plates, and the bacteria with same diluted concentration were spread on chloramphenicol-containing plates and chloramphenicol-free plates. The loss rate of the plasmid=(the number of colonies grown on the chloramphenicol-containing platesthe number of colonies grown on the chloramphenicol-free plates)/the number of colonies grown on the chloramphenicol-containing plates100%. It is considered that the passaging of plasmids is stable while the loss rate of the plasmid is less than or equal to 10%, and it is considered that the passaging of plasmids is unstable when the loss rate of the plasmid is more than 10%. The number of stable passages of bacteria containing each probe plasmid is shown in Table 3.
[0030] From Table 3, we can conclude that when passaged to the 50th generation, loss rate of the plasmids PRS10085seq2, PRS10085seq3, PRS10840seq2, PRS07910seq2, PRS07930seq3, PRS00965seq2, and PRS04670seq2 was less than or equal to 10%, showing a good stability.
Embodiment 2 Expression Vector Constructed Using Promoter Fragment RS10085seq2 and Application Thereof
1. Construction of Expression Vector HY-P19-RS10085seq2-ilvA
[0031] The key gene for isoleucine metabolism of Corynebacterium glutamicum is threonine dehydratase, and the gene was name ilvA (the sequence of which is shown in SEQ ID NO: 5). Using the screened promoter fragment RS10085seq2 as a promoter and ilvA as a target gene, the expression vector HY-P19-RS10085seq2-ilvA was constructed.
[0032] DNA fragment amplification: plasmid PRS10085seq2 was used as a template, and the upstream and downstream primers were as follows:
TABLE-US-00007 RS10085seq2Fp: tgcctgcaggtcgactctagaCTATTCTATAGATCTATTG RS10085seq2Rp: AGCGTGGATGACCTCCTTTGA
[0033] The DNA fragment RS10085seq2 was amplified using TransStart FastPfu Fly DNA Polymerase. The PCR system comprised: 1 l of PRS10085seq2 template, 1 l of forward primer (10 M), 1 l of reverse primer (10 M), 10 l of 5*TransStart FastPfu FlyBuffer, 4 l of 2.5 mM Dntps, 1 l of TransStart FastPfu Fly DNA Polymerase, 32 l of ddH.sub.2O. The PCR amplification process was 95 C. for 2 min; 32 cycles of 95 C. for 20 s, 55 C. for 20 s, 72 C. for 10 smin; and 72 C. for 5 min.
[0034] The C. glutamicum H5 genome was used as a template, and the upstream and downstream primers were as follows:
TABLE-US-00008 ilvAFP: AAAGGAGGTCATCCACGCTATGAGTGAAACATACGTGTCTGAG ilvARP: caaaacagccaagctgaattcTTAGGTCAAGTATTCGTACTCAG
[0035] The DNA fragment ilvA was amplified using TransStart FastPfu Fly DNA Polymerase. The PCR system comprised: 1 l of genomic template, 1 l of forward primer (10 M), 1 l of reverse primer (10 M), 10 l of 5*TransStart FastPfu FlyBuffer, 4 l of 2.5 mM Dntps, 1 l of TransStart FastPfu Fly DNA Polymerase, 32 l of ddH.sub.2O. The PCR amplification process was 95 C. for 2 min; 32 cycles of 95 C. for 20 s, 58 C. for 20 s, 72 C. for 30 s; and 72 C. for 5 min.
[0036] Plasmid digestion: The plasmid HY-P19 which had been modified by removing the original lacIq and the promoter of PXMJ19 was used. HY-P19 was digested with NEB restriction enzyme XbaI and EcoRI in a 37 C. water bath for 1 h. The amount of plasmid was 1 and 50 l of enzyme digestion system contained 5 l plasmid, 1 l of XbaI, 1 l of EcoRI, 5 l of cutsmart, and 38 l of ddH.sub.2O.
[0037] DNA recovery by agarose electrophoresis: The PCR products and the digested products were added to a 10*loading buffer, respectively, and 50 l of which was loaded onto a 1.5% agarose gel. Takara 2000 DL DNA marker was used as a control, and electrophoresis was carried out at 70 V for 40 min. The 160 bp and 1347 bp bands amplified by PCR were recovered according to instruction of the bands of marker. Recovery was carried out using Takara DNA Recovery Kit.
[0038] In vitro recombination: In vitro recombination was performed using Vazyme one Step Cloning Kit, and the recombinant products were directly transformed into E. coli.
[0039] The preparation of E. coli competent cells is the same as that in the construction of promoter probe vectors.
[0040] Transformation: competent cells were slowly thawed on ice, 10 l of the in vitro recombinant products were pipetted into 100 l of the competent cells, and the centrifuge tube was gently flicked with a finger to mix the cells and recombinant products. The tube was placed in an ice bath or ice water bath for 30 minutes, and then placed in a water bath at 42 C., heating shock for 2 minutes. Immediately after heat shock, the centrifuge tube was placed in an ice water bath for 2 minutes. 900 microliters of LB was aliquoted to the tube and the tube was incubated at 37 C. for 200 hours at 200 rpm. The supernatant was removed after centrifugation, and the obtained cells were spread on an LB solid plate containing 25 g/ml chloramphenicol and cultured at 37 C. overnight.
[0041] Transformant verification and plasmid extraction: Transformants that were grown on the resistant plates after transformation were sent to Wuhan Tianyi Huiyuan for sequencing analysis, and transformants with correct sequence were picked and transferred into a tube with 5 ml LB supplemented with a final concentration of 25 g/ml chloramphenicol. After culturing by shaking at 37 C. and 200 rpm overnight, plasmid was extracted using Takara plasmid kit, and the concentration of the expression plasmid HY-P19-RS10085seq2-ilvA was 269 ng/l.
2. Construction of the Strain Containing Expression Vector HY-P19-RS10085seq2-ilvA
[0042] The preparation of electroporation competent Corynebacterium glutamicum cells is the same as that in the construction of promoter probe vectors.
[0043] The process of electroporating expression plasmid HY-P19-RS10085seq2-ilvA into host cells Corynebacterium glutamicum H5 is the same as the construction of promoter probe vectors.
[0044] The electrotransformed bacterial solution was concentrated by centrifugation, and spread on a LBCIS solid medium supplemented with 10 g/mL chloramphenicol by a glass rod, and cultured in a 30 C. incubator for 36 hours. The grown transformant was strain with plasmid HY-P19-RS10085seq2-ilvA, which was named H5-RS10085seq2-ilvA. 3. The fermentation of strain H5-RS10085seq2-ilvA and Corynebacterium glutamicum H5 to produce acid in 5 L fermenter.
[0045] Fermentation medium for the 5 L fermenter: 15 ml/L of corn syrup, 140 g/L of glucose (sterilize alone, moist heat sterilization at 0.075 MPa for 15 min), 5 g/L of ammonium sulfate, 0.4 g/L of potassium dihydrogen phosphate, 0.6 g/L of magnesium sulfate heptahydrate, 0.1 mg/L of biotin, 0.1 mg/L of VB1, 1 ml/L of corn oil, 1 g/L of Angel yeast powder, 1 ml/L of defoamer, moist heat sterilization at 0.01 MPa and 121 C. for 25 min; the initial glucose was then added, and the pH was adjusted to 7.0 with ammonia water.
[0046] Culture method: the strain was inoculated into a seed culture medium (seed medium formula: 17 g/L of glucose, 10 ml/L of corn steep liquor, 1 g/L of urea, 0.5 g/L of magnesium sulfate, 1 g/L of dipotassium hydrogen phosphate, 0.1 g/L of yeast paste, 0.1 mg/L of biotin, 10.1 mg/L of vitamin B, 0.1 g/100 ml of corn oil, 1 g/100 ml of calcium carbonate; adjusted pH to 7.0 with NaOH), cultured at 31 C. on a rotary shaker at 200 rpm, for 16 h. After that, the seed culture medium was inoculated to a 5 L automatic control fermenter containing fermentation medium at 10% inoculation amount, and appropriate amount of air was introduced and appropriate stirring speed was set. The dissolved oxygen was controlled by the staged oxygen supply mode: 30% for 0-8.sup.th hour, 25% for 8-24.sup.th hour, and 12% for 24-56th hour. The pH is controlled at 7.0 by automatic flow of 15% ammonia water, defoaming by fed-batch feeding an appropriate amount of defoamer polyether, and controlling the residual glucose at about 3% by feeding glucose solution with a concentration of 800 g/L. The fermentation ended at 56 h.
[0047] After emptying the fermenter, the fermentation broth was detected by HPLC (Ilite C18 column, 5 m, 4.6*250 mm, and the mobile phase was 0.015 mol/L of diammonium phosphate and 0.005 mol/L of a mixed aqueous solution with pH 7.20. The flow rate was 0.5. ml/min, and the column temperature was 23 C. The detector was an UV detector with a wavelength of 199 nm. The control strain of Corynebacterium glutamicum H5 was fermented and produced 22.0 g/L of acid, 6.3 g/L of heteroacid, and the conversion rate of glucose to acid was 12.83%. The engineering strain H5-RS10085seq2-ilvA was fermented and produced 41.2 g/L of acid, 6.8 g/L of heteroacid, and the conversion rate of glucose to acid was 18.79%.
4. Stability of Plasmid after Fermentation of Strain H5-RS10085seq2-ilvA in a 5 L Fermenter
[0048] The strains after fermenting for 56 h were diluted to gradient concentrations of 10.sup.6, 10.sup.7, 10.sup.8, and 10.sup.9 and spread on the plate. 50 l of strain solution with each concentration was pipetted to spread on chloramphenicol-containing plates and chloramphenicol-free plates, and the plates were then placed in an incubator at 31 C. for 36 h. The loss rate of plasmid was calculated based on the number of colonies growing on the non-resistant plates and the resistant plates. The loss rate of the plasmid=(the number of colonies grown on the chloramphenicol-free platesthe number of colonies grown on the chloramphenicol-containing plates)/the number of colonies grown on the chloramphenicol-free plates100%. On the plate with 10.sup.8 dilution gradient, 151 colonies were grown on the chloramphenicol-containing plate, and 167 colonies were grown on the chloramphenicol-free plate. The loss rate of plasmid was only 9.58%, which means the plasmid was stable during fermentation.
Embodiment 3 Expression Vector Constructed Using Promoter Fragment RS07910seq2 and Application Thereof
[0049] In the process of bacterial metabolism, not all genes can promote the metabolism of target products through their overexpression. Many enzymes produced after gene expression can play a role when they reach a balance point of moderate expression in metabolism. Studies have shown that the global regulatory protein Lrp (which is encoded by the target gene Lrp, and the nucleotide sequence of which is shown in SEQ ID NO: 6) in Corynebacterium glutamicum can increase the transcription level of L-isoleucine synthesis and transportation related genes of Corynebacterium glutamicum, and can also increase the transcription level of the self-encoding gene lrp. However, the overexpression of Lrp inhibits the growth of C. glutamicum. We used the promoter fragment PRS07910seq2 as promoter and lrp as gene of interest to construct the exogenous expression plasmid HY-P19-RS07910seq2-lrp, and the expression plasmid was electrotransformed into Corynebacterium glutamicum H5, an isoleucine-producing strain, to construct a new strain. The acid production capacity of the strain was evaluated by fermentation in a 5 L fermenter.
1. Construction of Expression Vector HY-P19-1607910Seq2-Lrp
[0050] The screened promoter fragment RS07910seq2 was used as promoter and lrp was used as gene of interest to construct an expression vector HY-P19-RS07910seq2-lrp.
[0051] DNA fragment amplification: plasmid PRS07910seq2 was used as a template, and the upstream and downstream primers were as follows:
TABLE-US-00009 RS07910seq2Fp: tgcctgcaggtcgactctagaGCGATCACGTAGTCATCCAAG RS07910seq2Rp: CACGGTCACGGATGAAGCAT
[0052] The DNA fragment RS07910seq2 was amplified using TransStart FastPfu Fly DNA Polymerase. The PCR system comprised: 1 l of P RS07910seq2 template, 1 l of forward primer (10 M), 1 l of reverse primer (10 M), 10 l of 5*TransStart FastPfu FlyBuffer, 4 l of 2.5 mM Dntps, 1 l of TransStart FastPfu Fly DNA Polymerase, and 32 l of ddH.sub.2O. The PCR amplification process was 95 C. for 2 min, and 32 cycles of 95 C. for 20 s, 55 C. for 20 s, 72 C. for 10 smin with a final 72 C. for 5 min. The C. glutamicum H5 genome was used as a template, and the upstream and downstream primers were as follows:
TABLE-US-00010 lrpFP: GCTTCATCCGTGACCGTGAtgaagctagattccattgatt lrpRP: caaaacagccaagctgaattctcacacctgggggcgagc
[0053] The DNA fragment lrp was amplified using TransStart FastPfu Fly DNA Polymerase. The PCR system was as follows: 1 l of genomic template, 1 l of forward primer (10 M), 1 l of reverse primer (10 M), 10 l of 5*TransStart FastPfu FlyBuffer, 4 l of 2.5 mM Dntps, 1 l of TransStart FastPfu Fly DNA Polymerase, and 32 l of ddH.sub.2O. The PCR amplification process was 95 C. for 2 min, and 32 cycles of 95 C. for 20 s, 55 C. for 20 s, 72 C. for 10 smin with a final 72 C. for 5 min.
[0054] Plasmid digestion: The plasmid HY-P19 modified by removing the original lacIq and the promoter of PXMJ19 was used. HY-P19 was digested with NEB restriction enzyme XbaI and EcoRI in a 37 C. water bath for 1 h, and the amount of plasmid was 1 g. The 50 l of enzyme digestion system comprised: 5 l of plasmid, 1 l of XbaI, 1 l of EcoRI, 5 l of cutsmart, and 38 l of ddH.sub.2O.
[0055] The subsequent steps of in vitro recombination, preparation of E. coli competent cells, transformation, and transformant verification and plasmid extraction were the same as those in Embodiment 2, and the finally obtained expression plasmid HY-P19-RS07910seq2-lrp had a concentration of 321 ng/l.
2. Construction of a Strain Containing the Expression Vector HY-P19-RS07910seq2-lrp
[0056] The preparation of electroporation competent Corynebacterium glutamicum cells is the same as the construction of the promoter probe vectors.
[0057] The electroporation of expression plasmid HY-P19-RS07910seq2-lrp into host cells Corynebacterium glutamicum is the same as the construction of promoter probe vectors.
[0058] The electrotransformed bacterial solution was concentrated by centrifugation, and spread on a LBCIS solid medium supplemented with 10 g/mL chloramphenicol by a glass rod, and cultured in a 30 C. incubator for 36 hours. The grown transformant was exactly the strain with plasmid HY-P19-RS07910seq2-lrp, which was named H5-RS07910seq2-lrp.
3. Strain H5-RS07910seq2-Lrp and Corynebacterium glutamicum H5 were Fermented to Produce Acid in 5 L Fermenter
[0059] The formulation of the fermentation medium in the 5 L fermenter, the culture method of the strain, and the detection method of the released fermentation broth were the same as those in the embodiment 2, and the results showed that the engineering strain H5-RS07910seq2-lrp produced 39.1 g/L of acid and 6.9. g/L of heteroacid, and the conversion rate of glucose to acid reached 17.88%.
4. Stability of Plasmid after Fermentation of Strain H5-RS07910seq2-Lrp in a 5 L Fermenter
[0060] The strains after fermenting for 56 h were diluted to gradient concentrations of 10.sup.6, 10.sup.7, 10.sup.8, and 10.sup.9 and spread on the plate. 50 l of strain solution with each concentration was pipetted to spread on chloramphenicol-containing plates and chloramphenicol-free plates, and the plates were then placed in an incubator at 31 C. for 36 h. The loss rate of plasmid was calculated based on the number of colonies growing on the non-resistant plates and the resistant plates. The loss rate of the plasmid=(the number of colonies grown on the chloramphenicol-free platesthe number of colonies grown on the chloramphenicol-containing plates)/the number of colonies grown on the chloramphenicol-free plates100%. On the plate with 10.sup.8 dilution gradient, 127 colonies were grown on the chloramphenicol-containing plate, and 135 colonies were grown on the chloramphenicol-free plate. The loss rate of plasmid was only 5.93%, which means the plasmid was stable during fermentation.
Embodiment 4 Expression Vector Constructed Using Promoter Fragment RS04670seq2 and Application Thereof
[0061] In the metabolic process of isoleucine production, 1 mol of isoleucine needs to consume 4 mol of cofactor NADPH. NADPH is mainly derived from the pentose phosphate pathway. The supply of NADPH in organism through this pathway need to consume other metabolites. Changing the carbon flux of the pathway may affect the accumulation of metabolites of interest. By transcriptome analysis, glucose-6-phosphate dehydrogenase in the pentose phosphate pathway is down-regulated in leucine-producing Corynebacterium glutamicum during the stationary phase. Therefore, in order to ensure the supply of the cofactor NADPH in the stationary phase during the metabolic process without affecting the accumulation of the product, the gene gnd of the glucose-6-phosphate dehydrogenase (the sequence is shown in SEQ ID NO: 7) was connected with a promoter to promote the expression of this gene.
1. Construction of Expression Vector HY-P19-RS04670seq2-Gnd
[0062] The screened promoter fragment RS04670seq2 was used as a promoter and gnd was used as target gene to construct the expression vector HY-P19-RS04670seq2-gnd.
[0063] DNA fragment amplification: plasmid PRS04670seq1 was used as a template, and the upstream and downstream primers were as follows:
TABLE-US-00011 RS04670seq2Fp: tgcctgcaggtcgactctagaAGGCTGACAGAAACTCTAAAAAC RS04670seq2Rp: GGATACCTCCGAAGTTAAGG
[0064] The DNA fragment RS04670seq1 was amplified using TransStart FastPfu Fly DNA Polymerase. The PCR system comprised: 1 l of PRS04670seq1 template, 1 l of forward primer (10 M), 1 l of reverse primer (10 M), 10 l of 5*TransStart FastPfu FlyBuffer, 4 l of 2.5 mM Dntps, 1 l of TransStart FastPfu Fly DNA Polymerase, and 32 l of ddH.sub.2O. The PCR amplification process was 95 C. for 2 min, and 32 cycles of 95 C. for 20 s, 55 C. for 20 s, 72 C. for 10 smin with a final 72 C. for 5 min. The C. glutamicum H5 genome was used as a template, and the upstream and downstream primers were as follows:
TABLE-US-00012 Gnd-FP: TTAACTTCGGAGGTATCCAtgaagctagattccattgattg gnd-RP: ccaaaacagccaagctgaattcTTAAGCTTCCACCTCGGAGCG
[0065] The DNA fragment gnd was amplified using TransStart FastPfu Fly DNA Polymerase. The PCR system comprised 1 l of genomic template, 1 l of forward primer (10 M), 1 l of reverse primer (10 M), 10 l of 5*TransStart FastPfu FlyBuffer, 4 l of 2.5 mM Dntps, 1 l of TransStart FastPfu Fly DNA Polymerase, and 32 l of ddH.sub.2O. The PCR amplification process was 95 C. for 2 min, and 32 cycles of 95 C. for 20 s, 55 C. for 20 s, 72 C. for 10 smin with a final 72 C. for 5 min.
[0066] Plasmid digestion: The plasmid HY-P19 modified by removing the original lacIq and the promoter of PXMJ19 was used. HY-P19 was digested with NEB restriction enzyme XbaI and EcoRI in a 37 C. water bath for 1 h, and the amount of plasmid was 1 g. The 50 l of enzyme digestion system comprised: 5 l of plasmid, 1 l of XbaI, 1 l of EcoRI, 5 l of cutsmart, and 38 l of ddH.sub.2O.
[0067] DNA recovery by agarose electrophoresis: the PCR products and the digested products were added to 10*loading buffer, respectively, and 50 l of which was loaded onto 3%, 1% agarose gel. Takara 2000 DL DNA marker was used as a control, and electrophoresis was carried out at 70 V for 40 min. The 77 bp and 1481 bp bands amplified by PCR were recovered according to the instruction of the bands of marker. Recovery was carried out using Takara DNA Recovery Kit.
[0068] The subsequent steps of in vitro recombination, preparation of E. coli competent cells, transformation, and transformant verification and plasmid extraction were the same as in Embodiment 2, and the concentration of the resulting expression plasmid HY-P19-RS04670seq2-gnd was 288 ng/l.
2. Construction of the Strain Containing the Expression Vector HY-P19-RS04670seq2-Gnd
[0069] The preparation of electroporation competent Corynebacterium glutamicum cells is the same as that in the construction of promoter probe vectors.
[0070] The process of electroporating expression plasmid HY-P19-RS04670seq2-gnd into host cells Corynebacterium glutamicum H5 is the same as the construction of promoter probe vectors.
[0071] The electrotransformed bacterial solution was concentrated by centrifugation, and spread on a LBCIS solid medium supplemented with 10 g/mL chloramphenicol by a glass rod, and cultured in a 30 C. incubator for 36 hours. The grown transformant was exactly the strain with plasmid HY-P19-RS04670seq2-gnd, which was named H5-RS04670seq2-gnd.
3. The Fermentation of Strain H5-RS04670seq2-Gnd and Corynebacterium glutamicum H5 to Produce Acid in a 5 L Fermenter.
[0072] The formulation of the fermentation medium in the 5 L fermenter, the culture method of the strain, and the detection method of the released fermentation broth were the same as those in the embodiment 2, and the results showed that the engineering strain H5-RS04670seq2-gnd produced 33.4 g/L of acid, 7.08 g/L of heteroacid, and the conversion rate of glucose to acid reached 15.31%.
4. Stability of Plasmid after Fermentation of Strain H5-RS04670seq2-Gnd in a 5 L Fermenter
[0073] The strains after fermenting for 56 h were diluted to gradient concentrations of 10, 10, 10.sup.8, and 10.sup.9 and spread on the plate. 50 l of strain solution with each concentration was pipetted to spread on chloramphenicol-containing plates and chloramphenicol-free plates, and the plates were then placed in an incubator at 31 C. for 36 h. The loss rate of plasmid was calculated based on the number of colonies growing on the non-resistant plates and the resistant plates. The loss rate of the plasmid=(the number of colonies grown on the chloramphenicol-free platesthe number of colonies grown on the chloramphenicol-containing plates)/the number of colonies grown on the chloramphenicol-free plates100%. On the plate with 10.sup.8 dilution gradient, 118 colonies were grown on the chloramphenicol-containing plate, and 121 colonies were grown on the chloramphenicol-free plate. The loss rate of plasmid was only 2.48%, which means the plasmid was stable during fermentation.
[0074] While only specific embodiments of the present invention have been described above, those skilled in the art should understood that these are merely provided for illustration, and many variations or modifications can be made to these embodiments without departing from the principle and spirit of the present invention. Accordingly, the protection scope of the present invention is defined by the appended claims.