SPLIT INTEIN COMPOSITIONS
20200024370 ยท 2020-01-23
Inventors
Cpc classification
C07K1/22
CHEMISTRY; METALLURGY
C07K14/535
CHEMISTRY; METALLURGY
International classification
C07K14/535
CHEMISTRY; METALLURGY
C07K1/22
CHEMISTRY; METALLURGY
Abstract
Disclosed herein is a protein purification system and methods of using the system. In particular, disclosed is a split intein comprising an N-terminal intein segment, which can be immobilized, and a C-terminal intein segment, which has the property of being self-cleaving, and which can be attached to a protein of interest. Through the self-cleaving mechanism of the intein, the protein of interest can be purified.
Claims
1. A split intein comprising two separate peptides: an N-terminal intein segment and a C-terminal intein segment, wherein the N-terminal intein segment comprises one or more amino acids at its C-terminus which allow for covalent immobilization of the N-terminal intein segment to a solid support, and wherein cleaving of the C-terminal intein segment is more sensitive to extrinsic conditions when compared to a native intein.
2. The split intein of claim 1, wherein the split intein has been derived from a native intein.
3. The split intein of claim 2, wherein the intein is derived from an Npu DnaE intein.
4. The split intein of claim 2, wherein the N-terminal intein segment has been modified so as not to comprise any internal cysteine residues.
5. The split intein of claim 4, wherein at least one of the internal cysteine residues have been mutated to serine residues.
6. The split intein of claim 1, wherein a purification tag is attached to the N-terminal intein segment at its C-terminus.
7. The split intein of claim 6, wherein the purification tag comprises one or more histidine residues.
8. The split intein of claim 1, wherein the one or more amino acids at the C-terminus are cysteine residues.
9. The split intein of claim 1, wherein the N-terminal intein segment is immobilized on a solid chromatographic resin backbone.
10. The split intein of claim 1, wherein the N-terminal intein segment further comprises a sensitivity-enhancing motif, which renders it more sensitive to extrinsic conditions.
11. The split intein of claim 10, wherein the sensitivity-enhancing motif is on the N-terminus of the N-terminal intein segment.
12. The split intein of claim 10, wherein the extrinsic condition is pH, temperature, or both.
13. The split intein of claim 1, wherein the N-terminal intein segment comprises SEQ ID NO: 2.
14. The split intein of claim 1, wherein the N-terminal intein segment comprises SEQ ID NO: 3
15. The split intein of claim 1, wherein the N-terminal intein segment comprises SEQ ID NO: 4.
16. The split intein of claim 1, wherein the N-terminal intein segment comprises SEQ ID NO: 5
17. The split intein of claim 1, wherein the N-terminal intein segment comprises SEQ ID NO: 6.
18. The split intein of claim 1, wherein the C-terminal intein segment comprises SEQ ID NO: 9.
19. The split intein of claim 10, wherein the sensitivity enhancing motif comprises one or more amino acids that render an intein cleaving reaction more sensitive to pH.
20. The split intein of claim 10, wherein the sensitivity enhancing motif allows for slower or faster cleaving of the C-terminal intein segment under specific conditions compared to a split intein with no sensitivity enhancing motif.
21. The split intein of claim 10, wherein the specific conditions are pH and/or temperature.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0016] The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects and together with the description serve to explain the principles of the invention.
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050] Additional advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or can be learned by practice of the invention. The advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.
DESCRIPTION
[0051] The present invention can be understood more readily by reference to the following detailed description of the invention and the Examples included therein.
[0052] Before the present compounds, compositions, articles, systems, devices, and/or methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, example methods and materials are now described.
[0053] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided herein can be different from the actual publication dates, which can require independent confirmation.
A. DEFINITIONS
[0054] As used in the specification and the appended claims, the singular forms a, an and the include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a functional group, an alkyl, or a residue includes mixtures of two or more such functional groups, alkyls, or residues, and the like.
[0055] Ranges can be expressed herein as from about one particular value, and/or to about another particular value. When such a range is expressed, a further aspect includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent about, it will be understood that the particular value forms a further aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as about that particular value in addition to the value itself. For example, if the value 10 is disclosed, then about 10 is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
[0056] A weight percent (wt. %) of a component, unless specifically stated to the contrary, is based on the total weight of the formulation or composition in which the component is included.
[0057] As used herein, the terms optional or optionally means that the subsequently described event or circumstance can or can not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
[0058] The term contacting as used herein refers to bringing two biological entities together in such a manner that the compound can affect the activity of the target, either directly; i.e., by interacting with the target itself, or indirectly; i.e., by interacting with another molecule, co-factor, factor, or protein on which the activity of the target is dependent. Contacting can also mean facilitating the interaction of two biological entities, such as peptides, to bond covalently or otherwise.
[0059] As used herein, kit means a collection of at least two components constituting the kit. Together, the components constitute a functional unit for a given purpose. Individual member components may be physically packaged together or separately. For example, a kit comprising an instruction for using the kit may or may not physically include the instruction with other individual member components. Instead, the instruction can be supplied as a separate member component, either in a paper form or an electronic form which may be supplied on computer readable memory device or downloaded from an internet website, or as recorded presentation.
[0060] As used herein, instruction(s) means documents describing relevant materials or methodologies pertaining to a kit. These materials may include any combination of the following: background information, list of components and their availability information (purchase information, etc.), brief or detailed protocols for using the kit, trouble-shooting, references, technical support, and any other related documents. Instructions can be supplied with the kit or as a separate member component, either as a paper form or an electronic form which may be supplied on computer readable memory device or downloaded from an internet website, or as recorded presentation. Instructions can comprise one or multiple documents, and are meant to include future updates.
[0061] As used herein, the terms target protein, protein of interest and therapeutic agent include any synthetic or naturally occurring protein or peptide. The term therefore encompasses those compounds traditionally regarded as drugs, vaccines, and biopharmaceuticals including molecules such as proteins, peptides, and the like. Examples of therapeutic agents are described in well-known literature references such as the Merck Index (14th edition), the Physicians' Desk Reference (64th edition), and The Pharmacological Basis of Therapeutics (1st edition), and they include, without limitation, medicaments; substances used for the treatment, prevention, diagnosis, cure or mitigation of a disease or illness; substances that affect the structure or function of the body, or pro-drugs, which become biologically active or more active after they have been placed in a physiological environment.
[0062] As used herein, variant refers to a molecule that retains a biological activity that is the same or substantially similar to that of the original sequence. The variant may be from the same or different species or be a synthetic sequence based on a natural or prior molecule. Moreover, as used herein, variant refers to a molecule having a structure attained from the structure of a parent molecule (e.g., a protein or peptide disclosed herein) and whose structure or sequence is sufficiently similar to those disclosed herein that based upon that similarity, would be expected by one skilled in the art to exhibit the same or similar activities and utilities compared to the parent molecule. For example, substituting specific amino acids in a given peptide can yield a variant peptide with similar activity to the parent.
[0063] As used herein, the term amino acid sequence refers to a list of abbreviations, letters, characters or words representing amino acid residues. The amino acid abbreviations used herein are conventional one letter codes for the amino acids and are expressed as follows: A, alanine; C, cysteine; D aspartic acid; E, glutamic acid; F, phenylalanine; G, glycine; I-histidine; I isoleucine; K, lysine; L, leucine; M, methionine; N, asparagine; P, proline; Q, glutamine; R, arginine; S, serine; T, threonine; V, valine; W, tryptophan; Y, tyrosine.
[0064] Peptide as used herein refers to any peptide, oligopeptide, polypeptide, gene product, expression product, or protein. A peptide is comprised of consecutive amino acids. The term peptide encompasses naturally occurring or synthetic molecules.
[0065] In addition, as used herein, the term peptide refers to amino acids joined to each other by peptide bonds or modified peptide bonds, e.g., peptide isosteres, etc. and may contain modified amino acids other than the 20 gene-encoded amino acids. The peptides can be modified by either natural processes, such as post-translational processing, or by chemical modification techniques which are well known in the art. Modifications can occur anywhere in the peptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. The same type of modification can be present in the same or varying degrees at several sites in a given polypeptide. Also, a given peptide can have many types of modifications. Modifications include, without limitation, linkage of distinct domains or motifs, acetylation, acylation, ADP-ribosylation, amidation, covalent cross-linking or cyclization, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of a phosphytidylinositol, disulfide bond formation, demethylation, formation of cysteine or pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristolyation, oxidation, pergylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, and transfer-RNA mediated addition of amino acids to protein such as arginylation. (See Proteins-Structure and Molecular Properties 2nd Ed., T. E. Creighton, W.H. Freeman and Company, New York (1993); Postranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York, pp. 1-12 (1983)).
[0066] As used herein, isolated peptide or purified peptide is meant to mean a peptide (or a fragment thereof) that is substantially free from the materials with which the peptide is normally associated in nature, or from the materials with which the peptide is associated in an artificial expression or production system, including but not limited to an expression host cell lysate, growth medium components, buffer components, cell culture supernatant, or components of a synthetic in vitro translation system. The peptides disclosed herein, or fragments thereof, can be obtained, for example, by extraction from a natural source (for example, a mammalian cell), by expression of a recombinant nucleic acid encoding the peptide (for example, in a cell or in a cell-free translation system), or by chemically synthesizing the peptide. In addition, peptide fragments may be obtained by any of these methods, or by cleaving full length proteins and/or peptides.
[0067] The word or as used herein means any one member of a particular list and also includes any combination of members of that list.
[0068] The phrase nucleic acid as used herein refers to a naturally occurring or synthetic oligonucleotide or polynucleotide, whether DNA or RNA or DNA-RNA hybrid, single-stranded or double-stranded, sense or antisense, which is capable of hybridization to a complementary nucleic acid by Watson-Crick base-pairing. Nucleic acids of the invention can also include nucleotide analogs (e.g., BrdU), and non-phosphodiester internucleoside linkages (e.g., peptide nucleic acid (PNA) or thiodiester linkages). In particular, nucleic acids can include, without limitation, DNA, RNA, cDNA, gDNA, ssDNA, dsDNA or any combination thereof.
[0069] As used herein, isolated nucleic acid or purified nucleic acid is meant to mean DNA that is free of the genes that, in the naturally-occurring genome of the organism from which the DNA of the invention is derived, flank the gene. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector, such as an autonomously replicating plasmid or virus; or incorporated into the genomic DNA of a prokaryote or eukaryote (e.g., a transgene); or which exists as a separate molecule (for example, a cDNA or a genomic or cDNA fragment produced by PCR, restriction endonuclease digestion, or chemical or in vitro synthesis). It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequences. The term isolated nucleic acid also refers to RNA, e.g., an mRNA molecule that is encoded by an isolated DNA molecule, or that is chemically synthesized, or that is separated or substantially free from at least some cellular components, for example, other types of RNA molecules or peptide molecules.
[0070] As used herein, extein refers to the portion of an intein-modified protein that is not part of the intein and which can be spliced or cleaved upon excision of the intein.
[0071] Intein refers to an in-frame intervening sequence in a protein. An intein can catalyze its own excision from the protein through a post-translational protein splicing process to yield the free intein and a mature protein. An intein can also catalyze the cleavage of the intein-extein bond at either the intein N-terminus, or the intein C-terminus, or both of the intein-extein termini. As used herein, intein encompasses mini-inteins, modified or mutated inteins, and split inteins.
[0072] A split intein is an intein that is comprised of two or more separate components not fused to one another. Split inteins can occur naturally, or can be engineered by splitting contiguous inteins.
[0073] As used herein, the term splice or splices means to excise a central portion of a polypeptide to form two or more smaller polypeptide molecules. In some cases, splicing also includes the step of fusing together two or more of the smaller polypeptides to form a new polypeptide. Splicing can also refer to the joining of two polypeptides encoded on two separate gene products through the action of a split intein.
[0074] As used herein, the term cleave or cleaves means to divide a single polypeptide to form two or more smaller polypeptide molecules. In some cases, cleavage is mediated by the addition ofan extrinsic endopeptidase, which is often referred to as proteolytic cleavage. In other cases, cleaving can be mediated by the intrinsic activity of one or both of the cleaved peptide sequences, which is often referred to as self-cleavage. Cleavage can also refer to the self-cleavage of two polypeptides that is induced by the addition of a non-proteolytic third peptide, as in the action of split intein system described herein.
[0075] By the term fused is meant covalently bonded to. For example, a first peptide is fused to a second peptide when the two peptides are covalently bonded to each other (e.g., via a peptide bond).
[0076] As used herein an isolated or substantially pure substance is one that has been separated from components which naturally accompany it. Typically, a polypeptide is substantially pure when it is at least 50% (e.g., 60%, 70%, 80%, 90%, 95%, and 99%) by weight free from the other proteins and naturally-occurring organic molecules with which it is naturally associated.
[0077] Herein, bind or binds means that one molecule recognizes and adheres to another molecule in a sample, but does not substantially recognize or adhere to other molecules in the sample. One molecule specifically binds another molecule if it has a binding affinity greater than about 10.sup.5 to 10.sup.6 liters/mole for the other molecule.
[0078] Nucleic acids, nucleotide sequences, proteins or amino acid sequences referred to herein can be isolated, purified, synthesized chemically, or produced through recombinant DNA technology. All of these methods are well known in the art.
[0079] As used herein, the terms modified or mutated, as in modified intein or mutated intein, refer to one or more modifications in either the nucleic acid or amino acid sequence being referred to, such as an intein, when compared to the native, or naturally occurring structure. Such modification can be a substitution, addition, or deletion. The modification can occur in one or more amino acid residues or one or more nucleotides of the structure being referred to, such as an intein.
[0080] As used herein, the term modified peptide, modified protein or modified protein of interest or modified target protein refers to a protein which has been modified.
[0081] As used herein, operably linked refers to the association of two or more biomolecules in a configuration relative to one another such that the normal function of the biomolecules can be performed. In relation to nucleotide sequences, operably linked refers to the association of two or more nucleic acid sequences, by means of enzymatic ligation or otherwise, in a configuration relative to one another such that the normal function of the sequences can be performed. For example, the nucleotide sequence encoding a pre-sequence or secretory leader is operably linked to a nucleotide sequence for a polypeptide if it is expressed as a pre-protein that participates in the secretion of the polypeptide: a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence; and a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation of the sequence.
[0082] Sequence homology can refer to the situation where nucleic acid or protein sequences are similar because they have a common evolutionary origin. Sequence homology can indicate that sequences are very similar. Sequence similarity is observable; homology can be based on the observation. Very similar can mean at least 70% identity, homology or similarity; at least 75% identity, homology or similarity; at least 80%/o identity, homology or similarity; at least 85% identity, homology or similarity; at least 90% identity, homology or similarity; such as at least 93% or at least 95% or even at least 97% identity, homology or similarity. The nucleotide sequence similarity or homology or identity can be determined using the Align program of Myers et al. (1988) CABIOS 4:11-17 and available at NCBI. Additionally or alternatively, amino acid sequence similarity or identity or homology can be determined using the BlastP program (Altschul et al. Nucl. Acids Res. 25:3389-3402), and available at NCBI. Alternatively or additionally, the terms similarity or identity or homology. for instance, with respect to a nucleotide sequence, are intended to indicate a quantitative measure of homology between two sequences.
[0083] Alternatively or additionally, similarity with respect to sequences refers to the number of positions with identical nucleotides divided by the number of nucleotides in the shorter of the two sequences wherein alignment of the two sequences can be determined in accordance with the Wilbur and Lipman algorithm. (1983) Proc. Natl. Acad. Sci. USA 80:726. For example, using a window size of 20 nucleotides, a word length of 4 nucleotides, and a gap penalty of 4, and computer-assisted analysis and interpretation of the sequence data including alignment can be conveniently performed using commercially available programs (e.g., Intelligenetics Suite, Intelligenetics Inc. CA). When RNA sequences are said to be similar, or have a degree of sequence identity with DNA sequences, thymidine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence. The following references also provide algorithms for comparing the relative identity or homology or similarity of amino acid residues of two proteins, and additionally or alternatively with respect to the foregoing, the references can be used for determining percent homology or identity or similarity. Needleman et at. (1970) J. Mol. Biol. 48:444-453; Smith et al. (1983) Advances App. Math. 2:482-489; Smith et al. (1981) Nuc. Acids Res. 11:2205-2220; Feng et al. (1987) J. Molec. Evol. 25:351-360; Higgins et al. (1989) CABIOS 5:151-153; Thompson et al. (1994) Nuc. Acids Res. 22:4673-480; and Devereux et al. (1984) 12:387-395. Stringent hybridization conditions is a term which is well known in the art; see, for example, Sambrook, Molecular Cloning, A Laboratory Manual second ed., CSH Press, Cold Spring Harbor, 1989; Nucleic Acid Hybridization, A Practical Approach, Hames and Higgins eds., IRL Press, Oxford, 1985; see also
[0084] The terms plasmid and vector and cassette refer to an extrachromosomal element often carrying genes which are not part of the central metabolism of the cell and usually in the form of circular double-stranded DNA molecules. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3 untranslated sequence into a cell. Typically, a vector is a modified plasmid that contains additional multiple insertion sites for cloning and an expression cassette that contains a DNA sequence for a selected gene product (i.e., a transgene) for expression in the host cell. This expression cassette typically includes a 5 promoter region, the transgene ORF, and a 3 terminator region, with all necessary regulatory sequences required for transcription and translation of the ORF. Thus, integration of the expression cassette into the host permits expression of the transgene ORF in the cassette.
[0085] The term buffer or buffered solution refers to solutions which resist changes in pH by the action of its conjugate acid-base range.
[0086] The term loading buffer or equilibrium buffer refers to the buffer containing the salt or salts which is mixed with the protein preparation for loading the protein preparation onto a column. This buffer is also used to equilibrate the column before loading, and to wash to column after loading the protein.
[0087] The term wash buffer is used herein to refer to the buffer that is passed over a column (for example) following loading of a protein of interest (such as one coupled to a C-terminal intein fragment, for example) and prior to elution of the protein of interest. The wash buffer may serve to remove one or more contaminants without substantial elution of the desired protein.
[0088] The term elution buffer refers to the buffer used to elute the desired protein from the column. As used herein, the term solution refers to either a buffered or a non-buffered solution, including water.
[0089] The term washing means passing an appropriate buffer through or over a solid support, such as a chromatographic resin.
[0090] The term eluting a molecule (e.g. a desired protein or contaminant) from a solid support means removing the molecule from such material.
[0091] The term contaminant or impurity refers to any foreign or objectionable molecule, particularly a biological macromolecule such as a DNA, an RNA, or a protein, other than the protein being purified, that is present in a sample of a protein being purified. Contaminants include, for example, other proteins from cells that express and/or secrete the protein being purified.
[0092] The term separate or isolate as used in connection with protein purification refers to the separation of a desired protein from a second protein or other contaminant or mixture of impurities in a mixture comprising both the desired protein and a second protein or other contaminant or impurity mixture, such that at least the majority of the molecules of the desired protein are removed from that portion of the mixture that comprises at least the majority of the molecules of the second protein or other contaminant or mixture of impurities.
[0093] The term purify or purifying a desired protein from a composition or solution comprising the desired protein and one or more contaminants means increasing the degree of purity of the desired protein in the composition or solution by removing (completely or partially) at least one contaminant from the composition or solution.
[0094] Disclosed are the components to be used to prepare the compositions of the invention as well as the compositions themselves to be used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds can not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular compound is disclosed and discussed and a number of modifications that can be made to a number of molecules including the compounds are discussed, specifically contemplated is each and every combination and permutation of the compound and the modifications that are possible unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and CF are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the compositions of the invention. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the methods of the invention.
[0095] It is understood that the compositions disclosed herein have certain functions. Disclosed herein are certain structural requirements for performing the disclosed functions, and it is understood that there are a variety of structures that can perform the same function that are related to the disclosed structures, and that these structures will typically achieve the same result. For example, compounds used to control pH in the examples shown can be substituted with other buffering compounds to control pH, since pH is the critical variable to be controlled and the specific buffering compounds can vary.
B. PROTEIN PURIFICATION SYSTEMS
[0096] Disclosed herein is a protein purification system, wherein the system comprises a split intein comprising two separate peptides: an N-terminal intein segment and a C-terminal intein segment, wherein the N-terminal intein segment can be linked to a solid support, and wherein the C-terminal intein segment DNA is genetically fused to a desired target protein DNA such that the expressed target protein is tagged with the C-terminal intein segment, and wherein cleaving of the C-terminal intein segment is suppressed in the absence of the N-terminal intein segment, and wherein the N-terminal intein segment and C-terminal intein segment associate strongly to form an immobilized complex when contacted to each other on the solid support, and wherein the C-terminal cleaving activity of the C-terminal intein segment in the assembled N-terminal and C-terminal intein segment complex is highly sensitive to extrinsic conditions when compared to a native intein complex, and wherein the immobilized intein complex with the fused target protein can be purified through washing away of unimmobilized contaminants, and wherein the C-terminal intein segment can be induced to cleave and thereby release the untagged and substantially purified target protein from the immobilized intein complex through a controlled change in extrinsic conditions.
[0097] Intein-based methods of protein modification and ligation have been developed. An intein is an internal protein sequence capable of catalyzing a protein splicing reaction that excises the intein sequence from a precursor protein and joins the flanking sequences (N- and C-exteins) with a peptide bond (Perler et al. (1994)). Hundreds of intein and intein-like sequences have been found in a wide variety of organisms and proteins (Perler et al. (2002); Liu et al. (2003)), they are typically 350-550 amino acids in size and also contain a homing endonuclease domain, but natural and engineered mini-inteins having only the 140-aa splicing domain are sufficient for protein splicing (Lie et al. (2003); Yang et al. (2004); Telenti et al. (1997); Wu et al. (1998); Derbyshire et al. (1997)). The conserved crystal structure of mini-inteins (or the protein splicing domain) consists of 12 beta-strands that form a disk-like structure with the two splicing junctions located in a central cleft (Duan et al. (1997); lchiyanagi et al. (2000); Klabunde et al. (1998); Ding et al. (2003); Xu et al. (1996)).
[0098] As used herein, the term split intein refers to any intein in which one or more peptide bond breaks exists between the N-terminal intein segment and the C-terminal intein segment such that the N-terminal and C-terminal intein segments become separate molecules that can non-covalently reassociate, or reconstitute, into an intein that is functional for splicing or cleaving reactions. Any catalytically active intein, or fragment thereof, may be used to derive a split intein for use in the systems and methods disclosed herein. For example, in one aspect the split intein may be derived from a eukaryotic intein. In another aspect, the split intein may be derived from a bacterial intein. In another aspect, the split intein may be derived from an archaeal intein. Preferably, the split intein so-derived will possess only the amino acid sequences essential for catalyzing splicing reactions. Examples of inteins which can be used with the methods and systems disclosed herein can be found in Table 2.
[0099] As used herein, the N-terminal intein segment refers to any intein sequence that comprises an N-terminal amino acid sequence that is functional for splicing and/or cleaving reactions when combined with a corresponding C-terminal intein segment. An N-terminal intein segment thus also comprises a sequence that is spliced out when splicing occurs. An N-terminal intein segment can comprise a sequence that is a modification of the N-terminal portion of a naturally occurring (native) intein sequence. For example, an N-terminal intein segment can comprise additional amino acid residues and/or mutated residues so long as the inclusion of such additional and/or mutated residues does not render the intein non-functional for splicing or cleaving. Such modifications are discussed in more detail below. Preferably, the inclusion of the additional and/or mutated residues improves or enhances the splicing activity and/or controllability of the intein. Non-intein residues can also be genetically fused to intein segments to provide additional functionality, such as the ability to be affinity purified or to be covalently immobilized.
[0100] As used herein, the C-terminal intein segment refers to any intein sequence that comprises a C-terminal amino acid sequence that is functional for splicing or cleaving reactions when combined with a corresponding N-terminal intein segment. In one aspect, the C-terminal intein segment comprises a sequence that is spliced out when splicing occurs. In another aspect, the C-terminal intein segment is cleaved from a peptide sequence fused to its C-terminus. The sequence which is cleaved from the C-terminal intein's C-terminus is referred to herein as a protein of interest or target protein and is discussed in more detail below. A C-terminal intein segment can comprise a sequence that is a modification of the C-terminal portion of a naturally occurring (native) intein sequence. For example, a C terminal intein segment can comprise additional amino acid residues and/or mutated residues so long as the inclusion of such additional and/or mutated residues does not render the C-terminal intein segment non-functional for splicing or cleaving. Preferably, the inclusion of the additional and/or mutated residues improves or enhances the splicing and/or cleaving activity of the intein.
[0101] Split inteins have many practical uses including the production of recombinant proteins from fragments, the circularization of recombinant proteins, and the fixation of proteins on protein chips (Scott et al., (1999); Xu et al. (2001); Evans et al. (2000); Kwon et al., (2006)). Advantages of intein-based protein cleavage methods, compared to others such as protease-based methods, have been noted previously (Xu et al. (2001)). The intein-based N- and C-cleavage methods can also be used together on a single target protein to produce precise and tag-free ends at both the N- and the C-termini, or to achieve cyclization of the target protein (ligation of the N- and C-termini) using the expressed protein ligation approach.
[0102] The intein can be derived, for example, from an Npu DnaE intein, as shown in
[0103] The N-terminal intein segment can be been modified from a native intein (such as Npu DnaE, for example) so that the N-terminal intein segment does not comprise any internal cysteine residues. This is desirous so as to eliminate side reactions associated with immobilization of the Npu.sub.N intein segment onto a solid support using the scheme shown in
[0104] The N-terminal intein segment can also comprise a purification, or affinity tag, attached to its C-terminus. This can include an affinity resin reagent. The purification tag can comprise, for example, one or more histidine residues. The purification tag can comprise, for example, a chitin binding domain protein with highly specific affinity for chitin. The purification tag can further comprise, for example, a reversibly precipitating elastin-like peptide tag, which can be induced to selectively precipitate under known conditions of buffer composition and temperature. Affinity tags are discussed in more detail below. The N-terminal intein segment can also comprise amino acids at its C-terminus which allow for covalent immobilization. For example, one or more amino acids at the C-terminus can be cysteine residues.
[0105] The N-terminal intein segment can be immobilized onto a solid support. A variety of supports can be used. For example, the solid support can a polymer or substance that allows for immobilization of the N-terminal intein fragment, which can occur covalently or via an affinity tag with or without an appropriate linker. When a linker is used, the linker can be additional amino acid residues engineered to the C-terminus of the N-terminal intein segment, or can be other known linkers for attachment of a peptide to a support.
[0106] The N-terminal intein segment disclosed herein can be attached to an affinity tag through a linker sequence. The linker sequence can be designed to create distance between the intein and affinity tag, while providing minimal steric interference to the intein cleaving active site. It is generally accepted that linkers involve a relatively unstructured amino acid sequence, and the design and use of linkers are common in the art of designing fusion peptides. There is a variety of protein linker databases which one of skill in the art will recognize. This includes those found in Argos et al. J Mol Biol 1990 Feb. 20; 211(4) 943-58; Crasto et al. Protein Eng 2000 May; 13(5) 309-12; George et al. Protein Eng 2002 November; 15(11) 871-9; Arai et al. Protein Eng 2001 August; 14(8) 529-32; and Robinson et al. PNAS May 26, 1998 vol. 95 no. 11 5929-5934, hereby incorporated by reference in their entirety for their teaching of examples of linkers.
[0107] Table 1 shows exemplary sequences of the N-terminal intein segment and the C-terminal intein segment:
TABLE-US-00001 SEQIDNO:1 NATIVEDNAENPUN-TERMINAL CLSYETEILTVEYGLLPIGKIVEKRIECT INTEINSEGMENT VYSVDNNGNIYTQPVAQWHDRGEQEV FEYCLEDGSLIRATKDHKFMTVDGQML PIDEIFERELDLMRVDNLPN SEQIDNO:2 DNAENPUN-TERMINALINTEIN XLSYETEILTVEYGLLPIGKIVEKRIESTV SEGMENTWITHCYSTEINES YSVDNNGNIYTQPVAQWHDRGEQEVF REPLACED(X REPRESENTRSA EYSLEDGSLIRATKDHKFMTVDGQMLP ORGREPLACEMENT) IDEIFERELDLMRVDNLPN SEQIDNO:3 N-TEMINALINTEINSEGMENT XLSYETEILTVEYGLLPIGKIVEKRIESTV WITHINTERNALHISTAGAND YSVDNNGNIYTQPVAQWHDRGEQEVF CYSTEINERESIDUESATTHE EYSLEDGSLIRATKDHKFMTVDGQMLP C-TERMINUS IDEIFERELDLMRVDNLPNGGGGSHHH HHHCCC SEQIDNO:4 N-TEMINALINTEINSEGMENT MGDGHGXLSYETEILTVEYGLLPIGKIV WITHSENSITIVITYENHANCING EKRIESTVYSVDNNGNIYTQPVAQWHD MOTIFONTHEN-TERMINUS RGEQEVFEYSLEDGSLIRATKDHKFMT VDGQMLPIDEIFERELDLMRVDNLPN SEQIDNO:5 N-TERMINAL,INTEINSEGMENT MGDGHGXLSYETEILTVEYGLLPIGKIV WITHCYSREPLACEMENTS, EKRIESTVYSVDNNGNIYTQPVAQWHD SENSITIVITYENHANCINGMOTIF RGEQEVFEYSLEDGSLIRATKDHKFMT ONC-TERMINUS,ANDHISTAG VDGQMLPIDEIFERELDLMRVDNLPNG ANDCYSTEINERESIDUES GGGSHHHHHHCCC N-TERMINUS SEQIDNO:6 N-TERMINALINTEINSEGMENT MGDGHGXLSYETEILTVEYGLLPIGKIV WITHALINKERANDACHITIN EKRIESTVYSVDNNGNIYTQPVAQWHD BINDINGDOMAIN(CBD) RGEQEVFEYSLEDGSLIRATKDHKFMT AFFINITYTAGATC-TERMINUS VDGQMLPIDEIFERELDLMRVDNLPNG GGGSGGGGSMTTNPGVSAWQVNTAYT AGQLVTYNGKTYKCLQPHTSLAGWEPS NVPALWQLW SEQIDNO:7 N-TERMINALINTEINSEGMENT MGHGVGVPGVGVPGGGVPGAGVPGV WITHANELASTIN-LIKEPROTEIN GVPGVGVPGVVGPGGGVPGAGVPGGG (ELP)TAG,ALINKERANDA VPGVGVPGVGVPGGGVPGAGVPGVGV SENSITIVITYENHANCINGMOTIF PGVGVPGVGVPGGGVPGAGVPGGGVP ATN-TERMINUS GVGVPGVGVPGGGVPGAGVPGVGVPG VGVPGVGVPGGGVPGAGVPGGGVPGV GVPGVGVPGGGVPGAGVPGVGVPGVG VPGVGVPGGGVPGAGVPGGGVPGVGV PGVGVPGGGVPGAGVPGVGVPGVGVP GVGVPGGGVPGAGVPGGGVGPVGVPG VGVPGGGVPGAGVPGVGVPGVGVPGV GVPGGGVPGAGVPGGGVPGVGVPGVG VPGGGVPGAGVPGVGVPGVGVPGVGV PGGGVPGAGVPGGGVPGVGVPGVGVP GGGVPGAGVPGVGVPGVGVPGVGVPG GGVPGAGVPGGGVPGVGVPGVGVPGG GVPGAGVPGVGVPGVGVPGVGVPGGG VPGAGVPGGGVPGVGVPGVGVPGGGV PGAGVPGVGVPGVGVPGVGVPGGGVP GAGVPGGGVPGVGVPGVGVPGGGVPG AGVPGVGVPGVGVPGVGVPGGGVPGA GVPGGGVPGGLVSSNNNNNNNNNNLGI EGRISEFGDGHGALSYETEILTVEYGLLP IGKIVEKRIESTVYSVDNNGNIYTQPVA QWHDRGEQEVFEYSSLEDGSLIRATKDH KFMTVDGQMLPIDEIFERELDLMRVDN LPN SEQIDNO:8 NATIVEDNAENPUC-TERMINAL IKIATRKYLGKQNVYDIGVERDHNFAL INTEINSEGMENT(BUTWITHD KNGFIASN TOGMUTATIONINCLUDEDIN ALLEXAMPLESHEREIN) SEQIDNO:9 C-TERMINALINTEINSEGMENT IKIATRKYLGKQNVYGIGVERDHNFAL WITHSERINETOHISTIDINE KNGFIAHN REPLACEMENTTPOSITION34 SEQIDNO:10 THESEQUENCEOFSKC(+C) CIAGPEWLLDRPSVNNSQLVVSVAGTV EGTNQDISLKFFEIDLTSRPAHGGKTEQ GLSPKSKPFATDSGAMSHKLEKADLLK AIQEQLIANVHSNDDYFEVIDFASDATIT DRNGKVYFADKDGSVTLPTQPVQEFLL SGHVRVRPYKEKPIQNQAKSVDVEYTV QFTPLNDDDFRPGLKDTKLLKTLAIGD TTTSQELLAQAQSILNKNHPGYTIYERDS SIVTHDNDIFRTILPMDQEFTYRVKNRE QAYRINKKSGLNEEINNTDLISEKYYVL KKGEKPYDPFDRSHLKLFTIKYVDVDT NELLKSEQLLTASERNLDFRDLYDPRD KAKLLYNNLDAFGIMDYTLTGKVEDN HDDTNRIITVYMGKRPEGENASYHLAY DKDRYTEEEREVYSYLRYTGTPIPDNPN DK SEQIDNO:11 THESEQUENCEOFB-LAC(+1M) MHPETLVKVKDAEDQLGARVGYIELDL NSGKILESFRPEERFPMMSTFKVLLCGA VLSRIDAGQEQRRIHYSQNDLVEYSP VTEKHLTDGMTVRELCSAAITMSDNTA ANLLLTTIGGPKELTAFLHNMGDHVTR LDRWEPELNEAIPNDERDTTMPVAMAT TLRKLLTGELLTLASRQQLIDWMEADK VAGPLLRSALPAGWFIADKSGAGERGS RGIIAALGPDGKPSRIVVIYTTGSQATM DERNRQIAEIGASLIKHW SEQIDNO:12 THESEQUENCEOFeGFP(+1C) CFNVSKGEELFTGVVPILVELDGDVNG HKFSVSGEGEGDATYGKLTLKFICTTGK LPVPWPTLVTTLTYGVQCFSRYPDHMK QHDFFKSAMPEGYVQERTIFFKDDGNY KTRAEVKFEGDTLVNRIELKGIDFKEDG NILGHKLEYNYNSHNVYIMADKQKNGI KVNFKIRHNIEDGSVQLADHYQQNTPIG DGPVLLPDNHYLSTQSALSKDPNEKRD HMVLLEFVTAAGITLGMDELYK SEQIDNO:13 THESEQUENCEOFMBP(+1M) MKIEEGKLVIWINGDKGYNGLAEVGKK FEKDTGIKVTVEHPDKLEEKFPQVAAT GDGPDIIFWAHDRFGGYAQSGLLAEITP DKAFQDKLYPFTWDAVRYNGKLIAYPI AVEALSLIYNKDLLPNPPKTWEEIPALD KELKAKGKSALMFNLQEPYFTWPLIAA DGGYAFKYENGKYDIKDVGVDNAGAK AGLTFLVDLIKNKHMNADTDYSIAEAA FNKGETAMTINGPWAWSNIDTSKVNYG VTVLPTFKGQPSKPFVGVLSAGINAASP NKELAKEFLENYLLTDEGLEAVNKDKP LGAVALKSYEEELAKDPRIAATMENAQ KGEIMPNIPQMSAFWYAVRTAVINAAS GRQTVDEALKDAQTNSSS
[0108] Examples of linkers include, but are not limited to: (1) poly-asparagine linker consisting of 4 to 15 asparagine residues, and (2) glycine-serine linker, consisting of various combinations and lengths of polypeptides consisting of glycine and serine. One of skill in the art can easily identify and use any linker that will successfully link the CIPS with an affinity tag.
[0109] In one example, the solid support can be a solid chromatographic resin backbone, such as a crosslinked agarose. The term solid support matrix or solid matrix refers to the solid backbone material of the resin which material contains reactive functionality permitting the covalent attachment of ligand (such as N-terminal intein segments) thereto. The backbone material can be inorganic (e.g., silica) or organic. When the backbone material is organic, it is preferably a solid polymer and suitable organic polymers are well known in the art. Solid support matrices suitable for use in the resins described herein include, by way of example, cellulose, regenerated cellulose, agarose, silica, coated silica, dextran, polymers (such as polyacrylates, polystyrene, polyacrylamide, polymethacrylamide including commercially available polymers such as Fractogel, Enzacryl, and Azlactone), copolymers (such as copolymers of styrene and divinyl-benzene), mixtures thereof and the like. Also, co-, ter- and higher polymers can be used provided that at least one of the monomers contains or can be derivatized to contain a reactive functionality in the resulting polymer. In an additional embodiment, the solid support matrix can contain ionizable functionality incorporated into the backbone thereof.
[0110] Reactive functionalities of the solid support matrix permitting covalent attachment of the N-terminal intein segments are well known in the art. Such groups include hydroxyl (e.g., Si-OH), carboxyl, thiol, amino, and the like. Conventional chemistry permits use of these functional groups to covalently attach ligands, such as N-terminal intein segments, thereto. Additionally, conventional chemistry permits the inclusion of such groups on the solid support matrix. For example, carboxy groups can be incorporated directly by employing acrylic acid or an ester thereof in the polymerization process. Upon polymerization, carboxyl groups are present if acrylic acid is employed or the polymer can be derivatized to contain carboxyl groups if an acrylate ester is employed.
[0111] Affinity tags can be peptide or protein sequences cloned in frame with protein coding sequences that change the protein's behavior. Affinity tags can be appended to the N- or C-terminus of proteins which can be used in methods of purifying a protein from cells. Cells expressing a peptide comprising an affinity tag can be pelleted, lysed, and the cell lysate applied to a column, resin or other solid support that displays a ligand to the affinity tags. The affinity tag and any fused peptides are bound to the solid support, which can also be washed several times with buffer to eliminate unbound (contaminant) proteins. A protein of interest, if attached to an affinity tag, can be eluted from the solid support via a buffer that causes the affinity tag to dissociate from the ligand resulting in a purified protein, or can be cleaved from the bound affinity tag using a soluble protease. As disclosed herein, the affinity tag is cleaved through the self-cleaving action of the Npu.sub.C intein segment in the active intein complex.
[0112] Examples of affinity tags can be found in Kimple et al. Curr Protoc Protein Sci 2004 September; Arnau et al. Protein Expr Purif 2006 July; 48(1) 1-13; Azarkan et al. J Chromatogr B Analyt Technol Biomed Life Sci 2007 Apr. 15; 849(1-2) 81-90; and Waugh et al. Trends Biotechnol 2005 June; 23(6) 316-20, all hereby incorporated by reference in their entirety for their teaching of examples of affinity tags.
[0113] Examples of affinity include, but are not limited to, maltose binding protein, which can bind to immobilized maltose to facilitate purification of the fused target protein; Chitin binding protein, which can bind to immobilized chitin; Glutathione S transferase, which can bind to immobilized chitin; Poly-histidine, which can bind to immobilized chelated metals; FLAG octapeptide, which can bind to immobilized anti-FLAG antibodies.
[0114] Affinity tags can also be used to facilitate the purification of a protein of interest using the disclosed modified peptides through a variety of methods, including, but not limited to, selective precipitation, ion exchange chromatography, binding to precipitation-capable ligands, dialysis (by changing the size and/or charge of the target protein) and other highly selective separation methods.
[0115] In some aspects, affinity tags can be used that do not actually bind to a ligand, but instead either selectively precipitate or act as ligands for immobilized corresponding binding domains. In these instances, the tags are more generally referred to as purification tags. For example, the ELP tag selectively precipitates under specific salt and temperature conditions, allowing fused peptides to be purified by centrifugation. Another example is the antibody Fc domain, which serves as a ligand for immobilized protein A or Protein G-binding domains.
[0116] As disclosed herein, a protein of interest (POI), or target protein can attached to the C-terminal intein segment at its C-terminus. The C-terminal segment can be genetically fused to the protein of interest, for example. Methods of recombinant protein production are known to those of skill in the art. The C-terminal intein segment can comprise modifications when compared to a native Npu DnaE C-terminal intein segment. An example of such a modification includes, but is not limited to, a mutation of a highly conserved serine residue to a histidine residue. An example of such a mutation can be found in SEQ ID NO: 9, which also includes a mutation of a highly conserved aspartic acid to glycine. By highly conserved is meant identical amino acids or sequences that occur within aligned protein sequences across species.
[0117] The N-terminal intein segment can further comprise a sensitivity-enhancing motif (SEM), which renders the splicing or cleaving activity of the assembled intein complex highly sensitive to extrinsic conditions. This sensitivity-enhancing motif can render the split intein, when assembled (meaning the C-terminal intein segment comprising the protein of interest and the N-terminal intein segment are non-covalently associated, or covalently linked), more likely to cleave under certain conditions. Therefore, the sensitivity-enhancing motif can render the split intein more sensitive to extrinsic conditions when compared to a native, or naturally occurring, intein. For example, the split intein disclosed herein can be 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% or more sensitive to extrinsic conditions when compared to a native intein, where the sensitivity is defined as the percent cleavage under non-permissive conditions subtracted from the percent cleavage under permissive conditions. For example, if an intein shows no cleavage at pH 8.5 and 5 hours incubation, but 100% cleavage at pH 6.2 and 5 hours incubation, then the intein would show 100% sensitivity to this pH change under these conditions. Specifically, the Npu DnaE mutated intein disclosed herein (in SEQ ID NOS: 5, for example) can be more sensitive, and thus more likely to cleave the protein of interest, when certain conditions are present. These extrinsic conditions can be, for example, pH, temperature, or exposure to a certain compound or element, such as a chelating agent. Cleaving can occur at a greater rate, for example, at a pH of 6.2, when the sensitivity enhancing motif is present on the N-terminal intein segment, as compared to either an N-terminal intein segment which doesn't comprise the sensitivity enhancing motif, or a native or naturally occurring N-terminal intein segment. In another example, sensitivity can occur at a temperature of 0 C. to 45 C. when the sensitivity enhancing motif is present on the N-terminal intein segment, as compared to either an N-terminal intein segment which doesn't comprise the sensitivity enhancing motif, or a native or naturally occurring N-terminal intein segment.
[0118] The sensitivity enhancing motif (SEM) can be on the N-terminus of the N-terminal intein segment, for example. The SEM can be reversible. By reversible it is meant that the cleaving behavior of the split intein can be altered under a given extrinsic condition. This behavior of the intein, however, is reversible when the extrinsic condition is removed. For example, an intein may cleave or splice when at a pH of 6.2, but may not cleave or splice at a pH of 8.5. The SEMs disclosed herein can be designed such that when appended to, for example, the N-terminus of the N-terminal intein segment, they introduce a sensitivity enhancing element that allows for more precise control of cleavage of the protein of interest. This sensitivity has enabled the successful use of the inteins under conditions that are compatible with commercially relevant cell culture expression platforms.
[0119] In one example, a SEM can comprise the structure: aa1-aa2-aa3-aa4, wherein aa1 is a non-polar amino acid, aa2 is a negatively-charged amino acid, aa3 is a non-polar amino acid and aa4 is a positively charged amino acid. For example, aa1 can be glycine, alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, or valine; aa2 can be aspartic acid or glutamic acid; aa3 can be glycine, alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, or valine; and aa4 can be arginine or lysine.
[0120] Also disclosed herein is a SEM, wherein the SEM comprises the structure: aa1-aa2-aa3-aa4-aa5, wherein aa1 is a non-polar amino acid, aa2 is a negatively-charged amino acid, aa3 is a non-polar amino acid, aa4 is a positively charged amino acid and aa5 is a non-polar amino acid. For example, aa1 can be glycine, alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, or valine; aa2 can be aspartic acid or glutamic acid or cysteine; aa3 can be glycine, alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, or valine; aa4 can be arginine or lysine; and aa5 can be glycine, alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, or valine.
[0121] Disclosed herein are SEMS, wherein the reversible SEM comprises the sequence G-E-G-H-H (SEQ ID NO: 14), G-E-G-H-G (SEQ ID NO: 15), G-D-G-H-H (SEQ ID NO: 16), or G-D-G-H-G (SEQ ID NO: 17). Also disclosed are SEQ ID NOS: 4-5, which is an N-terminal fusion segment comprising the above SEMs.
[0122] Disclosed herein is a method of purifying a protein of interest, the method comprising: utilizing a split intein comprising two separate peptides: an N-terminal intein segment and a C-terminal intein segment; immobilizing the N-terminal intein segment to a solid support; attaching a protein of interest to the C-terminal intein segment, wherein cleaving of the C-terminal intein segment is highly sensitive to extrinsic conditions when compared to a native intein; exposing the N-terminal intein segment and the C-terminal intein segment to each other so that they associate; washing the solid support to remove non-bound material; placing the associated the N-terminal intein segment and the C-terminal intein segment under conditions that allow for the intein to self-cleave; and isolating the protein of interest.
[0123] A database of inteins can be found at http://www.inteins.com. This database also includes split inteins. A list of inteins is found below in Table 2. All inteins have the potential to be made into split inteins, while some inteins naturally exist in a split form. All of the inteins found in Table 2 either exist as split inteins, or have the potential to be made into split inteins.
TABLE-US-00002 TABLE 2 Naturally Occurring Inteins Intein Name Organism Name Organism Description Eucarya APMV Pol Acanthomoeba polyphaga Mimivirus isolate = Rowbotham- Bradford, Virus, infects Amoebae, taxon: 212035 Abr PRP8 Aspergillus brevipes FRR2439 Fungi, ATCC 16899, taxon: 75551 Aca-G186AR PRP8 Ajellomyces capsulatus G186AR Taxon: 447093, strain G186AR Aca-H143 PRP8 Ajellomyces capsulatus H143 Taxon: 544712 Aca-JER2004 PRP8 Ajellomyces capsulatus (anamorph: strain = JER2004, taxon: 5037, Histoplasma capsulatum) Fungi Aca-NAm1 PRP8 Ajellomyces capsulatus NAm1 strain = NAm1, taxon: 339724 Ade-ER3 PRP8 Ajellomyces dermatitidis ER-3 Human fungal pathogen. taxon: 559297 Ade-SLH14081 PRP8 Ajellomyces dermatitidis SLH14081, Human fungal pathogen Afu-Af293 PRP8 Aspergillus fumigatus var. ellipticus, Human pathogenic fungus, strain Af293 taxon: 330879 Afu-FRR0163 PRP8 Aspergillus fumigatus strain Human pathogenic fungus, FRR0163 taxon: 5085 Afu-NRRL5109 PRP8 Aspergillus fumigatus var. ellipticus, Human pathogenic fungus, strain NRRL 5109 taxon: 41121 Agi-NRRL6136 PRP8 Aspergillus giganteus Strain NRRL Fungus, taxon: 5060 6136 Ani-FGSCA4 PRP8 Aspergillus nidulans FGSC A Filamentous fungus, taxon: 227321 Avi PRP8 Aspergillus viridinutans strain Fungi, ATCC 16902, FRR0577 taxon: 75553 Bci PRP8 Botrytis cinerea (teleomorph of Plant fungal pathogen Botryotinia fuckeliana B05.10) Bde-JEL197 RPB2 Batrachochytrium dendrobatidis Chytrid fungus, JEL197 isolate = AFTOL-ID 21, taxon: 109871 Bde-JEL423 PRP8-1 Batrachochytrium dendrobatidis Chytrid fungus, isolate JEL423 JEL423, taxon 403673 Bde-JEL423 PRP8-2 Batrachochytrium dendrobatidis Chytrid fungus, isolate JEL423 JEL423, taxon 403673 Bde-JEL423 RPC2 Batrachochytrium dendrobatidis Chytrid fungus, isolate JEL423 JEL423, taxon 403673 Bde-JEL423 eIF-5B Batrachochytrium dendrobatidis Chytrid fungus, isolate JEL423 JEL423, taxon 403673 Bfu-B05 PRP8 Botryotinia fuckeliana B05.10 Taxon: 332648 CIV RIR1 Chilo iridescent virus dsDNA eucaryotic virus, taxon: 10488 CV-NY2A ORF212392 Chlorella virus NY2A infects dsDNA eucaryotic Chlorella NC64A, which infects virus, taxon: 46021, Family Paramecium bursaria Phycodnaviridae CV-NY2A RIR1 Chlorella virus NY2A infects dsDNA eucaryotic Chlorella NC64A, which infects virus, taxon: 46021, Family Paramecium bursaria Phycodnaviridae CZIV RIR1 Costelytra zealandica iridescent virus dsDNA eucaryotic virus, Taxon: 68348 Cba-WM02.98 PRP8 Cryptococcus bacillisporus strain Yeast, human pathogen, WM02.98 (aka Cryptococcus taxon: 37769 neoformans gattii) Cba-WM728 PRP8 Cryptococcus bacillisporus strain Yeast, human pathogen, WM728 taxon: 37769 Ceu ClpP Chlamydomonas eugametos Green alga, taxon: 3053 (chloroplast) Cga PRP8 Cryptococcus gattii (aka Yeast, human pathogen Cryptococcus bacillisporus) Cgl VMA Candida glabrata Yeast, taxon: 5478 Cla PRP8 Cryptococcus laurentii strain Fungi, Basidiomycete yeast, CBS139 taxon: 5418 Cmo ClpP Chlamydomonas moewusii, strain Green alga, chloroplast gene, UTEX 97 taxon: 3054 Cmo RPB2 (RpoBb) Chlamydomonas moewusii, strain Green alga, chloroplast gene, UTEX 97 taxon: 3054 Cne-A PRP8 (Fne-A Filobasidiella neoformans Yeast, human pathogen PRP8) (Cryptococcus neoformans) Serotype A, PHLS_8104 Cne-AD PRP8 (Fne- Cryptococcus neoformans Yeast, human pathogen, AD PRP8) (Filobasidiella neoformans), ATCC32045, taxon: 5207 Serotype AD, CBS132). Cne-JEC21 PRP8 Cryptococcus neoformans var. Yeast, human pathogen, neoformans JEC21 serotype = D taxon: 214684 Cpa ThrRS Candida parapsilosis, strain CLIB214 Yeast, Fungus, taxon: 5480 Cre RPB2 Chlamydomonas reinhardtii Green algae, taxon: 3055 (nucleus) CroV Pol Cafeteria roenbergensis virus BV- taxon: 693272, Giant virus PW1 infecting marine heterotrophic nanoflagellate CroV RIR1 Cafeteria roenbergensis virus BV- taxon: 693272, Giant virus PW1 infecting marine heterotrophic nanoflagellate CroV RPB2 Cafeteria roenbergensis virus BV- taxon: 693272, Giant virus PW1 infecting marine heterotrophic nanoflagellate CroV Top2 Cafeteria roenbergensis virus BV- taxon: 693272, Giant virus PW1 infecting marine heterotrophic nanoflagellate Cst RPB2 Coelomomyces stegomyiae Chytrid fungus, isolate = AFTOL-ID 18, taxon: 143960 Ctr ThrRS Candida tropicalis ATCC750 Yeast Ctr VMA Candida tropicalis (nucleus) Yeast Ctr-MYA3404 VMA Candida tropicalis MYA-3404 Taxon: 294747 Ddi RPC2 Dictyostelium discoideum strain Mycetozoa (a social amoeba) AX4 (nucleus) Dhan GLT1 Debaryomyces hansenii CBS767 Fungi, Anamorph: Candida famata, taxon: 4959 Dhan VMA Debaryomyces hansenii CBS767 Fungi, taxon: 284592 Eni PRP8 Emericella nidulans R20 (anamorph: taxon: 162425 Aspergillus nidulans) Eni-FGSCA4 PRP8 Emericella nidulans (anamorph: Filamentous fungus, Aspergillus nidulans) FGSC A4 taxon: 162425 Fte RPB2 (RpoB) Floydiella terrestris, strain UTEX Green alga, chloroplast gene, 1709 taxon: 51328 Gth DnaB Guillardia theta (plastid) Cryptophyte Algae HaV01 Pol Heterosigma akashiwo virus 01 Algal virus, taxon: 97195, strain HaV01 Hca PRP8 Histoplasma capsulatum (anamorph: Fungi, human pathogen Ajellomyces capsulatus) IIV6 RIR1 Invertebrate iridescent virus 6 dsDNA eucaryotic virus, taxon: 176652 Kex-CBS379 VMA Kazachstania exigua, formerly Yeast, taxon: 34358 Saccharomyces exiguus, strain CBS379 Kla-CBS683 VMA Kluyveromyces lactis, strain CBS683 Yeast, taxon: 28985 Kla-IFO1267 VMA Kluyveromyces lactis IFO1267 Fungi, taxon: 28985 Kla-NRRLY1140 Kluyveromyces lactis NRRL Y-1140 Fungi, taxon: 284590 VMA Lel VMA Lodderomyces elongisporus Yeast Mca-CBS113480 PRP8 Microsporum canis CBS 113480 Taxon: 554155 Nau PRP8 Neosartorya aurata NRRL 4378 Fungus, taxon: 41051 Nfe-NRRL5534 PRP8 Neosartorya fennelliae NRRL 5534 Fungus, taxon: 41048 Nfi PRP8 Neosartorya fischeri Fungi Ngl-FR2163 PRP8 Neosartorya glabra FRR2163 Fungi, ATCC 16909, taxon: 41049 Ngl-FRR1833 PRP8 Neosartorya glabra FRR1833 Fungi, taxon: 41049, (preliminary identification) Nqu PRP8 Neosartorya quadricincta, strain taxon: 41053 NRRL 4175 Nspi PRP8 Neosartorya spinosa FRR4595 Fungi, taxon: 36631 Pabr-Pb01 PRP8 Paracoccidioides brasiliensis Pb01 Taxon: 502779 Pabr-Pb03 PRP8 Paracoccidioides brasiliensis Pb03 Taxon: 482561 Pan CHS2 Podospora anserina Fungi, Taxon 5145 Pan GLT1 Podospora anserina Fungi, Taxon 5145 Pbl PRP8-a Phycomyces blakesleeanus Zygomycete fungus, strain NRRL155 Pbl PRP8-b Phycomyces blakesleeanus Zygomycete fungus, strain NRRL155 Pbr-Pb18 PRP8 Paracoccidioides brasiliensis Pb18 Fungi, taxon: 121759 Pch PRP8 Penicillium chrysogenum Fungus, taxon: 5076 Pex PRP8 Penicillium expansum Fungus, taxon27334 Pgu GLT1 Pichia (Candida) guilliermondii Fungi, Taxon 294746 Pgu-alt GLT1 Pichia (Candida) guilliermondii Fungi Pno GLT1 Phaeosphaeria nodorum SN15 Fungi, taxon: 321614 Pno RPA2 Phaeosphaeria nodorum SN15 Fungi, taxon: 321614 Ppu DnaB Porphyra purpurea (chloroplast) Red Alga Pst VMA Pichia stipitis CBS 6054, Yeast taxon: 322104 Ptr PRP8 Pyrenophora tritici-repentis Pt-1C- Ascomycete BF fungus, taxon: 426418 Pvu PRP8 Penicillium vulpinum (formerly Fungus P. claviforme) Pye DnaB Porphyra yezoensis chloroplast, Red alga, cultivar U-51 organelle = plastid: chloroplast, taxon: 2788 Sas RPB2 Spiromyces aspiralis NRRL 22631 Zygomycete fungus, isolate = AFTOL-ID 185, taxon: 68401 Sca-CBS4309 VMA Saccharomyces castellii, strain Yeast, taxon: 27288 CBS4309 Sca-IFO1992 VMA Saccharomyces castellii, strain Yeast, taxon: 27288 IFO1992 Scar VMA Saccharomyces cariocanus, Yeast, taxon: 114526 strain = UFRJ 50791 Sce VMA Saccharomyces cerevisiae (nucleus) Yeast, also in Sce strains OUT7163, OUT7045, OUT7163, IFO1992 Sce-DH1-1A VMA Saccharomyces cerevisiae strain Yeast, taxon: 173900, also in DH1-1A Sce strains OUT7900, OUT7903, OUT7112 Sce-JAY291 VMA Saccharomyces cerevisiae JAY291 Taxon: 574961 Sce-OUT7091 VMA Saccharomyces cerevisiae OUT7091 Yeast, taxon: 4932, also in Sce strains OUT7043, OUT7064 Sce-OUT7112 VMA Saccharomyces cerevisiae OUT7112 Yeast, taxon: 4932, also in Sce strains OUT7900, OUT7903 Sce-YJM789 VMA Saccharomyces cerevisiae strain Yeast, taxon: 307796 YJM789 Sda VMA Saccharomyces dairenensis, strain Yeast, taxon: 27289, Also in CBS 421 Sda strain IFO0211 Sex-IFO1128 VMA Saccharomyces exiguus, Yeast, taxon: 34358 strain = IFO1128 She RPB2 (RpoB) Stigeoclonium helveticum, strain Green alga, chloroplast gene, UTEX 441 taxon: 55999 Sja VMA Schizosaccharomyces japonicus Ascomycete fungus, yFS275 taxon: 402676 Spa VMA Saccharomyces pastorianus Yeast, taxon: 27292 IFO11023 Spu PRP8 Spizellomyces punctatus Chytrid fungus, Sun VMA Saccharomyces unisporus, strain Yeast, taxon: 27294 CBS 398 Tgl VMA Torulaspora globosa, strain CBS 764 Yeast, taxon: 48254 Tpr VMA Torulaspora pretoriensis, strain CBS Yeast, taxon: 35629 5080 Ure-1704 PRP8 Uncinocarpus reesii Filamentous fungus Vpo VMA Vanderwaltozyma polyspora, Yeast, taxon: 36033 formerly Kluyveromyces polysporus, strain CBS 2163 WIV RIR1 Wiseana iridescent virus dsDNA eucaryotic virus, taxon: 68347 Zba VMA Zygosaccharomyces bailii, strain Yeast, taxon: 4954 CBS 685 Zbi VMA Zygosaccharomyces bisporus, strain Yeast, taxon: 4957 CBS 702 Zro VMA Zygosaccharomyces rouxii, strain Yeast, taxon: 4956 CBS 688 Eubacteria AP-APSE1 dpol Acyrthosiphon pisum secondary Bacteriophage, taxon: 67571 endosymbiot phage 1 AP-APSE2 dpol Bacteriophage APSE-2, isolate = T5A Bacteriophage of Candidatus Hamiltonella defensa, endosymbiot of Acyrthosiphon pisum, taxon: 340054 AP-APSE4 dpol Bacteriophage of Candidatus Bacteriophage, taxon: 568990 Hamiltonella defensa strain 5ATac, endosymbiot of Acyrthosiphon pisum AP-APSE5 dpol Bacteriophage APSE-5 Bacteriophage of Candidatus Hamiltonella defensa, endosymbiot of Uroleucon rudbeckiae, taxon: 568991 AP-Aaphi23 MupF Bacteriophage Aaphi23, Actinobacillus Haemophilus phage Aaphi23 actinomycetemcomitans Bacteriophage, taxon: 230158 Aae RIR2 Aquifex aeolicus strain VF5 Thermophilic chemolithoautotroph, taxon: 63363 Aave-AAC001 Acidovorax avenae subsp. citrulli taxon: 397945 Aave1721 AAC00-1 Aave-AAC001 RIR1 Acidovorax avenae subsp. citrulli taxon: 397945 AAC00-1 Aave-ATCC19860 Acidovorax avenae subsp. avenae Taxon: 643561 RIR1 ATCC 19860 Aba Hyp-02185 Acinetobacter baumannii ACICU taxon: 405416 Ace RIR1 Acidothermus cellulolyticus 11B taxon: 351607 Aeh DnaB-1 Alkalilimnicola ehrlichei MLHE-1 taxon: 187272 Aeh DnaB-2 Alkalilimnicola ehrlichei MLHE-1 taxon: 187272 Aeh RIR1 Alkalilimnicola ehrlichei MLHE-1 taxon: 187272 AgP-S1249 MupF Aggregatibacter phage S1249 Taxon: 683735 Aha DnaE-c Aphanothece halophytica Cyanobacterium, taxon: 72020 Aha DnaE-n Aphanothece halophytica Cyanobacterium, taxon: 72020 Alvi-DSM180 GyrA Allochromatium vinosum DSM 180 Taxon: 572477 Ama MADE823 phage uncharacterized protein Probably prophage gene, [Alteromonas macleodii Deep taxon: 314275 ecotype] Amax-CS328 DnaX Arthrospira maxima CS-328 Taxon: 513049 Aov DnaE-c Aphanizomenon ovalisporum Cyanobacterium, taxon: 75695 Aov DnaE-n Aphanizomenon ovalisporum Cyanobacterium, taxon: 75695 Apl-C1 DnaX Arthrospira platensis Taxon: 118562, strain C1 Arsp-FB24 DnaB Arthrobacter species FB24 taxon: 290399 Asp DnaE-c Anabaena species PCC7120, (Nostoc Cyanobacterium, Nitrogen- sp. PCC7120) fixing, taxon: 103690 Asp DnaE-n Anabaena species PCC7120, (Nostoc Cyanobacterium, Nitrogen- sp. PCC7120) fixing, taxon: 103690 Ava DnaE-c Anabaena variabilis ATCC29413 Cyanobacterium, taxon: 240292 Ava DnaE-n Anabaena variabilis ATCC29413 Cyanobacterium, taxon: 240292 Avin RIR1 BIL Azotobacter vinelandii taxon: 354 Bce-MCO3 DnaB Burkholderia cenocepacia MC0-3 taxon: 406425 Bce-PC184 DnaB Burkholderia cenocepacia PC184 taxon: 350702 Bse-MLS10 TerA Bacillus selenitireducens MLS10 Probably prophage gene, Taxon: 439292 BsuP-M1918 RIR1 B. subtilis M1918 (prophage) Prophage in B. subtilis M1918. taxon: 157928 BsuP-SPBc2 RIR1 B. subtilis strain 168 Sp beta c2 B. subtilis taxon 1423. SPbeta prophage c2 phage, taxon: 66797 Bvi IcmO Burkholderia vietnamiensis G4 plasmid = pBVIE03. taxon: 269482 CP-P1201 Thy1 Corynebacterium phage P1201 lytic bacteriophage P1201 from Corynebacterium glutamicum NCHU 87078. Viruses; dsDNA viruses, taxon: 384848 Cag RIR1 Chlorochromatium aggregatum Motile, phototrophic consortia Cau SpoVR Chloroflexus aurantiacus J-10-fl Anoxygenic phototroph, taxon: 324602 CbP-C-St RNR Clostridium botulinum phage C-St Phage, specific_host = Clostridium botulinum type C strain C-Stockholm, taxon: 12336 CbP-D1873 RNR Clostridium botulinum phage D Ssp. phage from Clostridium botulinum type D strain, 1873, taxon: 29342 Cbu-Dugway DnaB Coxiella burnetii Dugway 5J108-111 Proteobacteria; Legionellales; taxon: 434922 Cbu-Goat DnaB Coxiella burnetii MSU Goat Q177 Proteobacteria; Legionellales; taxon: 360116 Cbu-RSA334 DnaB Coxiella burnetii RSA 334 Proteobacteria; Legionellales; taxon: 360117 Cbu-RSA493 DnaB Coxiella burnetii RSA 493 Proteobacteria; Legionellales; taxon: 227377 Cce Hyp1-Csp-2 Cyanothece sp. ATCC 51142 Marine unicellular diazotrophic cyanobacterium, taxon: 43989 Cch RIR1 Chlorobium chlorochromatii CaD3 taxon: 340177 Ccy Hyp1-Csp-1 Cyanothece sp. CCY0110 Cyanobacterium, taxon: 391612 Ccy Hyp1-Csp-2 Cyanothece sp. CCY0110 Cyanobacterium, taxon: 391612 Cfl-DSM20109 DnaB Cellulomonas flavigena DSM 20109 Taxon: 446466 Chy RIR1 Carboxydothermus Thermophile, taxon = 246194 hydrogenoformans Z-2901 Ckl PTerm Clostridium kluyveri DSM 555 plasmid = pCKL555A, taxon: 431943 Cra-CS505 DnaE-c Cylindrospermopsis raciborskii CS-505 Taxon: 533240 Cra-CS505 DnaE-n Cylindrospermopsis raciborskii CS-505 Taxon: 533240 Cra-CS505 GyrB Cylindrospermopsis raciborskii CS-505 Taxon: 533240 Csp-CCY0110 DnaE-c Cyanothece sp. CCY0110 Taxon: 391612 Csp-CCY0110 DnaE-n Cyanothece sp. CCY0110 Taxon: 391612 Csp-PCC7424 DnaE-c Cyanothece sp. PCC 7424 Cyanobacterium, taxon: 65393 Csp-PCC7424 DnaE-n Cyanothece sp. PCC7424 Cyanobacterium, taxon: 65393 Csp-PCC7425 DnaB Cyanothece sp. PCC 7425 Taxon: 395961 Csp-PCC7822 DnaE-n Cyanothece sp. PCC 7822 Taxon: 497965 Csp-PCC8801 DnaE-c Cyanothece sp. PCC 8801 Taxon: 41431 Csp-PCC8801 DnaE-n Cyanothece sp. PCC 8801 Taxon: 41431 Cth ATPase BIL Clostridium thermocellum ATCC27405, taxon: 203119 Cth-ATCC27405 TerA Clostridium thermocellum Probable prophage, ATCC27405 ATCC27405, taxon: 203119 Cth-DSM2360 TerA Clostridium thermocellum DSM Probably prophage 2360 gene, Taxon: 572545 Cwa DnaB Crocosphaera watsonii WH 8501 taxon: 165597 (Synechocystis sp. WH 8501) Cwa DnaE-c Crocosphaera watsonii WH 8501 Cyanobacterium, (Synechocystis sp. WH 8501) taxon: 165597 Cwa DnaE-n Crocosphaera watsonii WH 8501 Cyanobacterium, (Synechocystis sp. WH 8501) taxon: 165597 Cwa PEP Crocosphaera watsonii WH 8501 taxon: 165597 (Synechocystis sp. WH 8501) Cwa RIR1 Crocosphaera watsonii WH 8501 taxon: 165597 (Synechocystis sp. WH 8501) Daud RIR1 Candidatus Desulforudis audaxviator taxon: 477974 MP104C Dge DnaB Deinococcus geothermalis Thermophilic, radiation DSM11300 resistant Dha-DCB2 RIR1 Desulfitobacterium hafniense DCB-2 Anaerobic dehalogenating bacteria, taxon: 49338 Dha-Y51 RIR1 Desulfitobacterium hafniense Y51 Anaerobic dehalogenating bacteria, taxon: 138119 Dpr-MLMSl RIR1 delta proteobacterium MLMS-1 Taxon: 262489 Dra RIR1 Deinococcus radiodurans R1, TIGR Radiation resistant, strain taxon: 1299 Dra Snf2-c Deinococcus radiodurans R1, TIGR Radiation and DNA damage strain resistent, taxon: 1299 Dra Snf2-n Deinococcus radiodurans R1, TIGR Radiation and DNA damage strain resistent, taxon: 1299 Dra-ATCC13939 Snf2 Deinococcus radiodurans R1, Radiation and DNA damage ATCC13939/Brooks & Murray strain resistent, taxon: 1299 Dth UDP GD Dictyoglomus thermophilum H-6-12 strain = H-6-12; ATCC 35947, taxon: 309799 Dvul ParB Desulfovibrio vulgaris subsp. taxon: 391774 vulgaris DP4 EP-Min27 Primase Enterobacteria phage Min27 bacteriphage of host = Escherichia coli O157: H7 str. Min27 Fal DnaB Frankia alni ACN14a Plant symbiot, taxon: 326424 Fsp-CcI3 RIR1 Frankia species CcI3 taxon: 106370 Gob DnaE Gemmata obscuriglobus UQM2246 Taxon 114, TIGR genome strain, budding bacteria Gob Hyp Gemmata obscuriglobus UQM2246 Taxon 114, TIGR genome strain, budding bacteria Gvi DnaB Gloeobacter violaceus, PCC 7421 taxon: 33072 Gvi RIR1-1 Gloeobacter violaceus, PCC 7421 taxon: 33072 Gvi RIR1-2 Gloeobacter violaceus, PCC 7421 taxon: 33072 Hhal DnaB Halorhodospira halophila SL1 taxon: 349124 Kfl-DSM17836 DnaB Kribbella flavida DSM 17836 Taxon: 479435 Kra DnaB Kineococcus radiotolerans Radiation resistant SRS30216 LLP-KSY1 PolA Lactococcus phage KSY1 Bacteriophage, taxon: 388452 LP-phiHSIC Helicase Listonella pelagia phage phiHSIC taxon: 310539, a pseudotemperate marine phage of Listonella pelagia Lsp-PCC8106 GyrB Lyngbya sp. PCC 8106 Taxon: 313612 MP-Be DnaB Mycobacteriophage Bethlehem Bacteriophage, taxon: 260121 MP-Be gp51 Mycobacteriophage Bethlehem Bacteriophage, taxon: 260121 MP-Catera gp206 Mycobacteriophage Catera Mycobacteriophage, taxon: 373404 MP-KBG gp53 Mycobacterium phage KBG Taxon: 540066 MP-Mcjw1 DnaB Mycobacteriophage CJW1 Bacteriophage, taxon: 205869 MP-Omega DnaB Mycobacteriophage Omega Bacteriophage, taxon: 205879 MP-U2 gp50 Mycobacteriophage U2 Bacteriophage, taxon: 260120 Maer-NIES843 DnaB Microcystis aeruginosa NIES-843 Bloom-forming toxic cyanobacterium, taxon: 449447 Maer-NIES843 DnaE-c Microcystis aeruginosa NIES-843 Bloom-forming toxic cyanobacterium, taxon: 449447 Maer-NIES843 DnaE-n Microcystis aeruginosa NIES-843 Bloom-forming toxic cyanobacterium, taxon: 449447 Mau-ATCC27029 Micromonospora aurantiaca ATCC Taxon: 644283 GyrA 27029 Mav-104 DnaB Mycobacterium avium 104 taxon: 243243 Mav-ATCC25291 Mycobacterium avium subsp. avium Taxon: 553481 DnaB ATCC 25291 Mav-ATCC35712 Mycobacterium avium ATCC35712, taxon 1764 DnaB Mav-PT DnaB Mycobacterium avium subsp. taxon: 262316 paratuberculosis str. k10 Mbo Pps1 Mycobacterium bovis subsp. bovis strain = AF2122/97, AF2122/97 taxon: 233413 Mbo RecA Mycobacterium bovis subsp. bovis taxon: 233413 AF2122/97 Mbo SufB (Mbo Pps1) Mycobacterium bovis subsp. bovis taxon: 233413 AF2122/97 Mbo-1173P DnaB Mycobacterium bovis BCG Pasteur strain = BCG Pasteur 1173P 1173P2,, taxon: 410289 Mbo-AF2122 DnaB Mycobacterium bovis subsp. bovis strain = AF2122/97, AF2122/97 taxon: 233413 Mca MupF Methylococcus capsulatus Bath, prophage MuMc02, prophage MuMc02 taxon: 243233 Mca RIR1 Methylococcus capsulatus Bath taxon: 243233 Mch RecA Mycobacterium chitae IP14116003, taxon: 1792 Mcht-PCC7420 DnaE-1 Microcoleus chthonoplastes Cyanobacterium, PCC7420 taxon: 118168 Mcht-PCC7420 DnaE-2c Microcoleus chthonoplastes Cyanobacterium, PCC7420 taxon: 118168 Mcht-PCC7420 DnaE-2n Microcoleus chthonoplastes Cyanobacterium, PCC7420 taxon: 118168 Mcht-PCC7420 GyrB Microcoleus chthonoplastes PCC Taxon: 118168 7420 Mcht-PCC7420 RIR1-1 Microcoleus chthonoplastes PCC Taxon: 118168 7420 Mcht-PCC7420 RIR1-2 Microcoleus chthonoplastes PCC Taxon: 118168 7420 Mex Helicase Methylobacterium extorquens AM1 Alphaproteobacteria Mex TrbC Methylobacterium extorquens AM1 Alphaproteobacteria Mfa RecA Mycobacterium fallax CITP8139, taxon: 1793 Mfl GyrA Mycobacterium flavescens Fla0 taxon: 1776, reference #930991 Mfl RecA Mycobacterium flavescens Fla0 strain = Fla0, taxon: 1776, ref. #930991 Mfl-ATCC14474 RecA Mycobacterium flavescens, strain = ATCC14474, taxon: 1776, ATCC14474 ref #930991 Mfl-PYR-GCK DnaB Mycobacterium flavescens PYR- taxon: 350054 GCK Mga GyrA Mycobacterium gastri HP4389, taxon: 1777 Mga RecA Mycobacterium gastri HP4389, taxon: 1777 Mga SufB (Mga Pps1) Mycobacterium gastri HP4389, taxon: 1777 Mgi-PYR-GCK DnaB Mycobacterium gilvum PYR-GCK taxon: 350054 Mgi-PYR-GCK GyrA Mycobacterium gilvum PYR-GCK taxon: 350054 Mgo GyrA Mycobacterium gordonae taxon: 1778, reference number 930835 Min-1442 DnaB Mycobacterium intracellulare strain 1442, taxon: 1767 Min-ATCC13950 Mycobacterium intracellulare ATCC Taxon: 487521 GyrA 13950 Mkas GyrA Mycobacterium kansasii taxon: 1768 Mkas-ATCC12478 Mycobacterium kansasii ATCC Taxon: 557599 GyrA 12478 Mle-Br4923 GyrA Mycobacterium leprae Br4923 Taxon: 561304 Mle-TN DnaB Mycobacterium leprae, strain TN Human pathogen, taxon: 1769 Mle-TN GyrA Mycobacterium leprae TN Human pathogen, STRAIN = TN, taxon: 1769 Mle-TN RecA Mycobacterium leprae, strain TN Human pathogen, taxon: 1769 Mle-TN SufB (Mle Mycobacterium leprae Human pathogen, taxon: 1769 Pps1) Mma GyrA Mycobacterium malmoense taxon: 1780 Mmag Magn8951 BIL Magnetospirillum magnetotacticum Gram negative, taxon: 272627 MS-1 Msh RecA Mycobacterium shimodei ATCC27962, taxon: 29313 Msm DnaB-1 Mycobacterium smegmatis MC2 155 MC2 155, taxon: 246196 Msm DnaB-2 Mycobacterium smegmatis MC2 155 MC2 155, taxon: 246196 Msp-KMS DnaB Mycobacterium species KMS taxon: 189918 Msp-KMS GyrA Mycobacterium species KMS taxon: 189918 Msp-MCS DnaB Mycobacterium species MCS taxon: 164756 Msp-MCS GyrA Mycobacterium species MCS taxon: 164756 Mthe RecA Mycobacterium thermoresistibile ATCC19527, taxon: 1797 Mtu SufB (Mtu Pps1) Mycobacterium tuberculosis strains Human pathogen, taxon: 83332 H37Rv & CDC1551 Mtu-C RecA Mycobacterium tuberculosis C Taxon: 348776 Mtu-CDC1551 DnaB Mycobacterium tuberculosis, Human pathogen, taxon: 83332 CDC1551 Mtu-CPHL RecA Mycobacterium tuberculosis Taxon: 611303 CPHL_A Mtu-Canetti RecA Mycobacterium tuberculosis/ Taxon: 1773 strain = Canetti Mtu-EAS054 RecA Mycobacterium tuberculosis EAS054 Taxon: 520140 Mtu-F11 DnaB Mycobacterium tuberculosis, strain taxon: 336982 F11 Mtu-H37Ra DnaB Mycobacterium tuberculosis H37Ra ATCC 25177, taxon: 419947 Mtu-H37Rv DnaB Mycobacterium tuberculosis H37Rv Human pathogen, taxon: 83332 Mtu-H37Rv RecA Mycobacterium tuberculosis Human pathogen, taxon: 83332 H37Rv, Also CDC1551 Mtu-Haarlem DnaB Mycobacterium tuberculosis str. Taxon: 395095 Haarlem Mtu-K85 RecA Mycobacterium tuberculosis K85 Taxon: 611304 Mtu-R604 RecA-n Mycobacterium tuberculosis 98- Taxon: 555461 R604 INH-RIF-EM Mtu-So93 RecA Mycobacterium tuberculosis Human pathogen, taxon: 1773 So93/sub_species = Canetti Mtu-T17 RecA-c Mycobacterium tuberculosis T17 Taxon: 537210 Mtu-T17 RecA-n Mycobacterium tuberculosis T17 Taxon: 537210 Mtu-T46 RecA Mycobacterium tuberculosis T46 Taxon: 611302 Mtu-T85 RecA Mycobacterium tuberculosis T85 Taxon: 520141 Mtu-T92 RecA Mycobacterium tuberculosis T92 Taxon: 515617 Mvan DnaB Mycobacterium vanbaalenii PYR-1 taxon: 350058 Mvan GyrA Mycobacterium vanbaalenii PYR-1 taxon: 350058 Mxa RAD25 Myxococcus xanthus DK1622 Deltaproteobacteria Mxe GyrA Mycobacterium xenopi strain taxon: 1789 IMM5024 Naz-0708 RIR1-1 Nostoc azollae 0708 Taxon: 551115 Naz-0708 RIR1-2 Nostoc azollae 0708 Taxon: 551115 Nfa DnaB Nocardia farcinica IFM 10152 taxon: 247156 Nfa Nfa15250 Nocardia farcinica IFM 10152 taxon: 247156 Nfa RIR1 Nocardia farcinica IFM 10152 taxon: 247156 Nosp-CCY9414 DnaE-n Nodularia spumigena CCY9414 Taxon: 313624 Npu DnaB Nostoc punctiforme Cyanobacterium, taxon: 63737 Npu GyrB Nostoc punctiforme Cyanobacterium, taxon: 63737 Npu-PCC73102 DnaE-c Nostoc punctiforme PCC73102 Cyanobacterium, taxon: 63737, ATCC29133 Npu-PCC73102 DnaE-n Nostoc punctiforme PCC73102 Cyanobacterium, taxon: 63737, ATCC29133 Nsp-JS614 DnaB Nocardioides species JS614 taxon: 196162 Nsp-JS614 TOPRIM Nocardioides species JS614 taxon: 196162 Nsp-PCC7120 DnaB Nostoc species PCC7120, (Anabaena Cyanobacterium, Nitrogen- sp. PCC7120) fixing, taxon: 103690 Nsp-PCC7120 DnaE-c Nostoc species PCC7120, (Anabaena Cyanobacterium, Nitrogen- sp. PCC7120) fixing, taxon: 103690 Nsp-PCC7120 DnaE-n Nostoc species PCC7120, (Anabaena Cyanobacterium, Nitrogen- sp. PCC7120) fixing, taxon: 103690 Nsp-PCC7120 RIR1 Nostoc species PCC7120, (Anabaena Cyanobacterium, Nitrogen- sp. PCC7120) fixing, taxon: 103690 Oli DnaE-c Oscillatoria limnetica str. Solar Lake Cyanobacterium, taxon: 262926 Oli DnaE-n Oscillatoria limnetica str. Solar Lake Cyanobacterium, taxon: 262926 PP-PhiEL Helicase Pseudomonas aeruginosa phage Phage infects Pseudomonas phiEL aeruginosa, taxon: 273133 PP-PhiEL ORF11 Pseudomonas aeruginosa phage phage infects Pseudomonas phiEL aeruginosa, taxon: 273133 PP-PhiEL ORF39 Pseudomonas aeruginosa phage Phage infects Pseudomonas phiEL aeruginosa, taxon: 273133 PP-PhiEL ORF40 Pseudomonas aeruginosa phage phage infects Pseudomonas phiEL aeruginosa, taxon: 273133 Pfl Fha BIL Pseudomonas fluorescens Pf-5 Plant commensal organism, taxon: 220664 Plut RIR1 Pelodictyon luteolum DSM 273 Green sulfur bacteria, Taxon 319225 Pma-EXH1 GyrA Persephonella marina EX-H1 Taxon: 123214 Pma-ExH1 DnaE Persephonella marina EX-H1 Taxon: 123214 Pna RIR1 Polaromonas naphthalenivorans CJ2 taxon: 365044 Pnuc DnaB Polynucleobacter sp. QLW- taxon: 312153 P1DMWA-1 Posp-JS666 DnaB Polaromonas species JS666 taxon: 296591 Posp-JS666 RIR1 Polaromonas species JS666 taxon: 296591 Pssp-A1-1 Fha Pseudomonas species A1-1 Psy Fha Pseudomonas syringae pv. tomato Plant (tomato) pathogen, str. DC3000 taxon: 223283 Rbr-D9 GyrB Raphidiopsis brookii D9 Taxon: 533247 Rce RIR1 Rhodospirillum centenum SW taxon: 414684, ATCC 51521 Rer-SK121 DnaB Rhodococcus erythropolis SK121 Taxon: 596309 Rma DnaB Rhodothermus marinus Thermophile, taxon: 29549 Rma-DSM4252 DnaB Rhodothermus marinus DSM 4252 Taxon: 518766 Rma-DSM4252 DnaE Rhodothermus marinus DSM 4252 Thermophile, taxon: 518766 Rsp RIR1 Roseovarius species 217 taxon: 314264 SaP-SETP12 dpol Salmonella phage SETP12 Phage, taxon: 424946 SaP-SETP3 Helicase Salmonella phage SETP3 Phage, taxon: 424944 SaP-SETP3 dpol Salmonella phage SETP3 Phage, taxon: 424944 SaP-SETP5 dpol Salmonella phage SETP5 Phage, taxon: 424945 Sare DnaB Salinispora arenicola CNS-205 taxon: 391037 Sav RecG Helicase Streptomyces avermitilis MA-4680 taxon: 227882, ATCC 31267 Sel-PC6301 RIR1 Synechococcus elongatus PCC 6301 taxon: 269084 Berkely strain 6301~equivalent name: Ssp PCC 6301~synonym: Anacystis nudulans Sel-PC7942 DnaE-c Synechococcus elongatus PC7942 taxon: 1140 Sel-PC7942 DnaE-n Synechococcus elongatus PC7942 taxon: 1140 Sel-PC7942 RIR1 Synechococcus elongatus PC7942 taxon: 1140 Sel-PCC6301 DnaE-c Synechococcus elongatus PCC 6301 Cyanobacterium, and PCC7942 taxon: 269084, Berkely strain 6301~equivalent name: Synechococcus sp. PCC 6301~synonym: Anacystis nudulans Sel-PCC6301 DnaE-n Synechococcus elongatus PCC 6301 Cyanobacterium, taxon: 269084 Berkely strain 6301~equivalent name: Synechococcus sp. PCC 6301~synonym: Anacystis nudulans Sep RIR1 Staphylococcus epidermidis RP62A taxon: 176279 ShP-Sfv-2a-2457T-n Shigella flexneri 2a str. 2457T Putative bacteriphage Primase ShP-Sfv-2a-301-n Shigella flexneri 2a str. 301 Putative bacteriphage Primase ShP-Sfv-5 Primase Shigella flexneri 5 str. 8401 Bacteriphage, isolation_source_epidemic, taxon: 373384 SoP-SO1 dpol Sodalis phage SO-1 Phage/isolation_source = Sodalis glossinidius strain GA-SG, secondary symbiont of Glossina austeni (Newstead) Spl DnaX Spirulina platensis, strain C1 Cyanobacterium, taxon: 1156 Sru DnaB Salinibacter ruber DSM 13855 taxon: 309807, strain = DSM 13855; M31 Sru PolBc Salinibacter ruber DSM 13855 taxon: 309807, strain = DSM 13855; M31 Sru RIR1 Salinibacter ruber DSM 13855 taxon: 309807, strain = DSM 13855; M31 Ssp DnaB Synechocystis species, strain Cyanobacterium, taxon: 1148 PCC6803 Ssp DnaE-c Synechocystis species, strain Cyanobacterium, taxon: 1148 PCC6803 Ssp DnaE-n Synechocystis species, strain Cyanobacterium, taxon: 1148 PCC6803 Ssp DnaX Synechocystis species, strain Cyanobacterium, taxon: 1148 PCC6803 Ssp GyrB Synechocystis species, strain Cyanobacterium, taxon: 1148 PCC6803 Ssp-JA2 DnaB Synechococcus species JA-2-3Ba(2-13) Cyanobacterium, Taxon: 321332 Ssp-JA2 RIR1 Synechococcus species JA-2-3Ba(2-13) Cyanobacterium, Taxon: 321332 Ssp-JA3 DnaB Synechococcus species JA-3-3Ab Cyanobacterium, Taxon: 321327 Ssp-JA3 RIR1 Synechococcus species JA-3-3Ab Cyanobacterium, Taxon: 321327 Ssp-PCC7002 DnaE-c Synechocystis species, strain PCC Cyanobacterium, taxon: 32049 7002 Ssp-PCC7002 DnaE-n Synechocystis species, strain PCC Cyanobacterium, taxon: 32049 7002 Ssp-PCC7335 RIR1 Synechococcus sp. PCC 7335 Taxon: 91464 StP-Twort ORF6 Staphylococcus phage Twort Phage, taxon 55510 Susp-NBC371 DnaB Sulfurovum sp. NBC37-1 taxon: 387093 intein Taq-Y51MC23 DnaE Thermus aquaticus Y51MC23 Taxon: 498848 Taq-Y51MC23 RIR1 Thermus aquaticus Y51MC23 Taxon: 498848 Tcu-DSM43183 RecA Thermomonospora curvata DSM Taxon: 471852 43183 Tel DnaE-c Thermosynechococcus elongatus BP-1 Cyanobacterium, taxon: 197221 Tel DnaE-n Thermosynechococcus elongatus BP-1 Cyanobacterium, Ter DnaB-1 Trichodesmium erythraeum IMS101 Cyanobacterium, taxon: 203124 Ter DnaB-2 Trichodesmium erythraeum IMS101 Cyanobacterium, taxon: 203124 Ter DnaE-1 Trichodesmium erythraeum IMS101 Cyanobacterium, taxon: 203124 Ter DnaE-2 Trichodesmium erythraeum IMS101 Cyanobacterium, taxon: 203124 Ter DnaE-3c Trichodesmium erythraeum IMS101 Cyanobacterium, taxon: 203124 Ter DnaE-3n Trichodesmium erythraeum IMS101 Cyanobacterium, taxon: 203124 Ter GyrB Trichodesmium erythraeum IMS101 Cyanobacterium, taxon: 203124 Ter Ndse-1 Trichodesmium erythraeum IMS101 Cyanobacterium, taxon: 203124 Ter Ndse-2 Trichodesmium erythraeum IMS101 Cyanobacterium, taxon: 203124 Ter RIR1-1 Trichodesmium erythraeum IMS101 Cyanobacterium, taxon: 203124 Ter RIR1-2 Trichodesmium erythraeum IMS101 Cyanobacterium, taxon: 203124 Ter RIR1-3 Trichodesmium erythraeum IMS101 Cyanobacterium, taxon: 203124 Ter RIR1-4 Trichodesmium erythraeum IMS101 Cyanobacterium, taxon: 203124 Ter Snf2 Trichodesmium erythraeum IMS101 Cyanobacterium, taxon: 203124 Ter ThyX Trichodesmium erythraeum IMS101 Cyanobacterium, taxon: 203124 Tfus RecA-1 Thermobifida fusca YX Thermophile, taxon: 269800 Tfus RecA-2 Thermobifida fusca YX Thermophile, taxon: 269800 Tfus Tfu2914 Thermobifida fusca YX Thermophile, taxon: 269800 Thsp-K90 RIR1 Thioalkalivibrio sp. K90mix Taxon: 396595 Tth-DSM571 RIR1 Thermoanaerobacterium Taxon: 580327 thermosaccharolyticum DSM 571 Tth-HB27 DnaE-1 Thermus thermophilus HB27 thermophile, taxon: 262724 Tth-HB27 DnaE-2 Thermus thermophilus HB27 thermophile, taxon: 262724 Tth-HB27 RIR1-1 Thermus thermophilus HB27 thermophile, taxon: 262724 Tth-HB27 RIR1-2 Thermus thermophilus HB27 thermophile, taxon: 262724 Tth-HB8 DnaE-1 Thermus thermophilus HB8 thermophile, taxon: 300852 Tth-HB8 DnaE-2 Thermus thermophilus HB8 thermophile, taxon: 300852 Tth-HB8 RIR1-1 Thermus thermophilus HB8 thermophile, taxon: 300852 Tth-HB8 RIR1-2 Thermus thermophilus HB8 thermophile, taxon: 300852 Tvu DnaE-c Thermosynechococcus vulcanus Cyanobacterium, taxon: 32053 Tvu DnaE-n Thermosynechococcus vulcanus Cyanobacterium, taxon: 32053 Tye RNR-1 Thermodesulfovibrio yellowstonii taxon: 289376 DSM 11347 Tye RNR-2 Thermodesulfovibrio yellowstonii taxon: 289376 DSM 11347 Archaea Ape APE0745 Aeropyrum pernix K1 Thermophile, taxon: 56636 Cme-boo Pol-II Candidatus Methanoregula boonei taxon: 456442 6A8 Fac-Fer1 RIR1 Ferroplasma acidarmanus, strain Fer1, eats iron taxon: 97393 and taxon 261390 Fac-Fer1 SufB (Fac Ferroplasma acidarmanus strain fer1, eats Pps1) iron, taxon: 97393 Fac-TypeI RIR1 Ferroplasma acidarmanus type I, Eats iron, taxon 261390 Fac-typeI SufB (Fac Ferroplasma acidarmanus Eats iron, taxon: 261390 Pps1) Hma CDC21 Haloarcula marismortui ATCC taxon: 272569, 43049 Hma Pol-II Haloarcula marismortui ATCC taxon: 272569, 43049 Hma PolB Haloarcula marismortui ATCC taxon: 272569, 43049 Hma TopA Haloarcula marismortui ATCC taxon: 272569 43049 Hmu-DSM12286 Halomicrobium mukohataei DSM taxon: 485914 (Halobacteria) MCM 12286 Hmu-DSM12286 PolB Halomicrobium mukohataei DSM Taxon: 485914 12286 Hsa-R1 MCM Halobacterium salinarum R-1 Halophile, taxon: 478009, strain = R1; DSM 671 Hsp-NRC1 CDC21 Halobacterium species NRC-1 Halophile, taxon: 64091 Hsp-NRC1 Pol-II Halobacterium salinarum NRC-1 Halophile, taxon: 64091 Hut MCM-2 Halorhabdus utahensis DSM 12940 taxon: 519442 Hut-DSM12940 MCM- Halorhabdus utahensis DSM 12940 taxon: 519442 1 Hvo PolB Haloferax volcanii DS70 taxon: 2246 Hwa GyrB Haloquadratum walsbyi DSM 16790 Halophile, taxon: 362976, strain: DSM 16790 = HBSQ001 Hwa MCM-1 Haloquadratum walsbyi DSM 16790 Halophile, taxon: 362976, strain: DSM 16790 = HBSQ001 Hwa MCM-2 Haloquadratum walsbyi DSM 16790 Halophile, taxon: 362976, strain: DSM 16790 = HBSQ001 Hwa MCM-3 Haloquadratum walsbyi DSM 16790 Halophile, taxon: 362976, strain: DSM 16790 = HBSQ001 Hwa MCM-4 Haloquadratum walsbyi DSM 16790 Halophile, taxon: 362976, strain: DSM 16790 = HBSQ001 Hwa Pol-II-1 Haloquadratum walsbyi DSM 16790 Halophile, taxon: 362976, strain: DSM 16790 = HBSQ001 Hwa Pol-II-2 Haloquadratum walsbyi DSM 16790 Halophile, taxon: 362976, strain: DSM 16790 = HBSQ001 Hwa PolB-1 Haloquadratum walsbyi DSM 16790 Halophile, taxon: 362976, strain: DSM 16790 = HBSQ001 Hwa PolB-2 Haloquadratum walsbyi DSM 16790 Halophile, taxon: 362976, strain: DSM 16790 = HBSQ001 Hwa PolB-3 Haloquadratum walsbyi DSM 16790 Halophile, taxon: 362976, strain: DSM 16790 = HBSQ001 Hwa RCF Haloquadratum walsbyi DSM 16790 Halophile, taxon: 362976, strain: DSM 16790 = HBSQ001 Hwa RIR1-1 Haloquadratum walsbyi DSM 16790 Halophile, taxon: 362976, strain: DSM 16790 = HBSQ001 Hwa RIR1-2 Haloquadratum walsbyi DSM 16790 Halophile, taxon: 362976, strain: DSM 16790 = HBSQ001 Hwa Top6B Haloquadratum walsbyi DSM 16790 Halophile, taxon: 362976, strain: DSM 16790 = HBSQ001 Hwa rPol A Haloquadratum walsbyi DSM 16790 Halophile, taxon: 362976, strain: DSM 16790 = HBSQ001 Maeo Pol-II Methanococcus aeolicus Nankai-3 taxon: 419665 Maeo RFC Methanococcus aeolicus Nankai-3 taxon: 419665 Maeo RNR Methanococcus aeolicus Nankai-3 taxon: 419665 Maeo-N3 Helicase Methanococcus aeolicus Nankai-3 taxon: 419665 Maeo-N3 RtcB Methanococcus aeolicus Nankai-3 taxon: 419665 Maeo-N3 UDP GD Methanococcus aeolicus Nankai-3 taxon: 419665 Mein-ME PEP Methanocaldococcus infernus ME thermophile, Taxon: 573063 Mein-ME RFC Methanocaldococcus infernus ME Taxon: 573063 Memar MCM2 Methanoculleus marisnigri JR1 taxon: 368407 Memar Pol-II Methanoculleus marisnigri JR1 taxon: 368407 Mesp-FS406 PolB-1 Methanocaldococcus sp. FS406-22 Taxon: 644281 Mesp-FS406 PolB-2 Methanocaldococcus sp. FS406-22 Taxon: 644281 Mesp-FS406 PolB-3 Methanocaldococcus sp. FS406-22 Taxon: 644281 Mesp-FS406-22 LHR Methanocaldococcus sp. FS406-22 Taxon: 644281 Mfe-AG86 Pol-1 Methanocaldococcus fervens AG86 Taxon: 573064 Mfe-AG86 Pol-2 Methanocaldococcus fervens AG86 Taxon: 573064 Mhu Pol-II Methanospirillum hungateii JF-1 taxon 323259 Mja GF-6P Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja Helicase Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja Hyp-1 Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja IF2 Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja KlbA Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja PEP Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja Pol-1 Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja Pol-2 Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja RFC-1 Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja RFC-2 Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja RFC-3 Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja RNR-1 Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja RNR-2 Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja RtcB (Mja Hyp-2) Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja TFIIB Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja UDP GD Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja r-Gyr Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja rPol A Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mja rPol A Methanococcus jannaschii Thermophile, DSM 2661, (Methanocaldococcus jannaschii taxon: 2190 DSM 2661) Mka CDC48 Methanopyrus kandleri AV19 Thermophile, taxon: 190192 Mka EF2 Methanopyrus kandleri AV19 Thermophile, taxon: 190192 Mka RFC Methanopyrus kandleri AV19 Thermophile, taxon: 190192 Mka RtcB Methanopyrus kandleri AV19 Thermophile, taxon: 190192 Mka VatB Methanopyrus kandleri AV19 Thermophile, taxon: 190192 Mth RIR1 Methanothermobacter Thermophile, delta H strain thermautotrophicus (Methanobacterium thermoautotrophicum) Mvu-M7 Helicase Methanocaldococcus vulcanius M7 Taxon: 579137 Mvu-M7 Pol-1 Methanocaldococcus vulcanius M7 Taxon: 579137 Mvu-M7 Pol-2 Methanocaldococcus vulcanius M7 Taxon: 579137 Mvu-M7 Pol-3 Methanocaldococcus vulcanius M7 Taxon: 579137 Mvu-M7 UDP GD Methanocaldococcus vulcanius M7 Taxon: 579137 Neq Pol-c Nanoarchaeum equitans Kin4-M Thermophile, taxon: 228908 Neq Pol-n Nanoarchaeum equitans Kin4-M Thermophile, taxon: 228908 Nma-ATCC43099 Natrialba magadii ATCC 43099 Taxon: 547559 MCM Nma-ATCC43099 Natrialba magadii ATCC 43099 Taxon: 547559 PolB-1 Nma-ATCC43099 Natrialba magadii ATCC 43099 Taxon: 547559 PolB-2 Nph CDC21 Natronomonas pharaonis DSM 2160 taxon: 348780 Nph PolB-1 Natronomonas pharaonis DSM 2160 taxon: 348780 Nph PolB-2 Natronomonas pharaonis DSM 2160 taxon: 348780 Nph rPol A Natronomonas pharaonis DSM 2160 taxon: 348780 Pab CDC21-1 Pyrococcus abyssi Thermophile, strain Orsay, taxon: 29292 Pab CDC21-2 Pyrococcus abyssi Thermophile, strain Orsay, taxon: 29292 Pab IF2 Pyrococcus abyssi Thermophile, strain Orsay, taxon: 29292 Pab KlbA Pyrococcus abyssi Thermophile, strain Orsay, taxon: 29292 Pab Lon Pyrococcus abyssi Thermophile, strain Orsay, taxon: 29292 Pab Moaa Pyrococcus abyssi Thermophile, strain Orsay, taxon: 29292 Pab Pol-II Pyrococcus abyssi Thermophile, strain Orsay, taxon: 29292 Pab RFC-1 Pyrococcus abyssi Thermophile, strain Orsay, taxon: 29292 Pab RFC-2 Pyrococcus abyssi Thermophile, strain Orsay, taxon: 29292 Pab RIR1-1 Pyrococcus abyssi Thermophile, strain Orsay, taxon: 29292 Pab RIR1-2 Pyrococcus abyssi Thermophile, strain Orsay, taxon: 29292 Pab RIR1-3 Pyrococcus abyssi Thermophile, strain Orsay, taxon: 29292 Pab RtcB (Pab Hyp-2) Pyrococcus abyssi Thermophile, strain Orsay, taxon: 29292 Pab VMA Pyrococcus abyssi Thermophile, strain Orsay, taxon: 29292 Par RIR1 Pyrobaculum arsenaticum DSM taxon: 340102 13514 Pfu CDC21 Pyrococcus furiosus Thermophile, taxon: 186497, DSM3638 Pfu IF2 Pyrococcus furiosus Thermophile, taxon: 186497, DSM3638 Pfu KlbA Pyrococcus furiosus Thermophile, taxon: 186497, DSM3638 Pfu Lon Pyrococcus furiosus Thermophile, taxon: 186497, DSM3638 Pfu RFC Pyrococcus furiosus Thermophile, DSM3638, taxon: 186497 Pfu RIR1-1 Pyrococcus furiosus Thermophile, taxon: 186497, DSM3638 Pfu RIR1-2 Pyrococcus furiosus Thermophile, taxon: 186497, DSM3638 Pfu RtcB (Pfu Hyp-2) Pyrococcus furiosus Thermophile, taxon: 186497, DSM3638 Pfu TopA Pyrococcus furiosus Thermophile, taxon: 186497, DSM3638 Pfu VMA Pyrococcus furiosus Thermophile, taxon: 186497, DSM3638 Pho CDC21-1 Pyrococcus horikoshii OT3 Thermophile, taxon: 53953 Pho CDC21-2 Pyrococcus horikoshii OT3 Thermophile, taxon: 53953 Pho IF2 Pyrococcus horikoshii OT3 Thermophile, taxon: 53953 Pho KlbA Pyrococcus horikoshii OT3 Thermophile, taxon: 53953 Pho LHR Pyrococcus horikoshii OT3 Thermophile, taxon: 53953 Pho Lon Pyrococcus horikoshii OT3 Thermophile, taxon: 53953 Pho Pol I Pyrococcus horikoshii OT3 Thermophile, taxon: 53953 Pho Pol-II Pyrococcus horikoshii OT3 Thermophile, taxon: 53953 Pho RFC Pyrococcus horikoshii OT3 Thermophile, taxon: 53953 Pho RIR1 Pyrococcus horikoshii OT3 Thermophile, taxon: 53953 Pho RadA Pyrococcus horikoshii OT3 Thermophile, taxon: 53953 Pho RtcB (Pho Hyp-2) Pyrococcus horikoshii OT3 Thermophile, taxon: 53953 Pho VMA Pyrococcus horikoshii OT3 Thermophile, taxon: 53953 Pho r-Gyr Pyrococcus horikoshii OT3 Thermophile, taxon: 53953 Psp-GBD Pol Pyrococcus species GB-D Thermophile Pto VMA Picrophilus torridus, DSM 9790 DSM 9790, taxon: 263820, Thermoacidophile Smar 1471 Staphylothermus marinus F1 taxon: 399550 Smar MCM2 Staphylothermus marinus F1 taxon: 399550 Tac-ATCC25905 VMA Thermoplasma acidophilum, ATCC Thermophile, taxon: 2303 25905 Tac-DSM1728 VMA Thermoplasma acidophilum, Thermophile, taxon: 2303 DSM1728 Tag Pol-1 (Tsp-TY Pol-1) Thermococcus aggregans Thermophile, taxon: 110163 Tag Pol-2 (Tsp-TY Pol-2) Thermococcus aggregans Thermophile, taxon: 110163 Tag Pol-3 (Tsp-TY Pol-3) Thermococcus aggregans Thermophile, taxon: 110163 Tba Pol-II Thermococcus barophilus MP taxon: 391623 Tfu Pol-1 Thermococcus fumicolans Thermophilem, taxon: 46540 Tfu Pol-2 Thermococcus fumicolans Thermophile, taxon: 46540 Thy Pol-1 Thermococcus hydrothermalis Thermophile, taxon: 46539 Thy Pol-2 Thermococcus hydrothermalis Thermophile, taxon: 46539 Tko CDC21-1 Thermococcus kodakaraensis KOD1 Thermophile, taxon: 69014 Tko CDC21-2 Thermococcus kodakaraensis KOD1 Thermophile, taxon: 69014 Tko Helicase Thermococcus kodakaraensis KOD1 Thermophile, taxon: 69014 Tko IF2 Thermococcus kodakaraensis KOD1 Thermophile, taxon: 69014 Tko KlbA Thermococcus kodakaraensis KOD1 Thermophile, taxon: 69014 Tko LHR Thermococcus kodakaraensis KOD1 Thermophile, taxon: 69014 Tko Pol-1 (Pko Pol-1) Pyrococcus/Thermococcus Thermophile, taxon: 69014 kodakaraensis KOD1 Tko Pol-2 (Pko Pol-2) Pyrococcus/Thermococcus Thermophile, taxon: 69014 kodakaraensis KOD1 Tko Pol-II Thermococcus kodakaraensis KOD1 Thermophile, taxon: 69014 Tko RFC Thermococcus kodakaraensis KOD1 Thermophile, taxon: 69014 Tko RIR1-1 Thermococcus kodakaraensis KOD1 Thermophile, taxon: 69014 Tko RIR1-2 Thermococcus kodakaraensis KOD1 Thermophile, taxon: 69014 Tko RadA Thermococcus kodakaraensis KOD1 Thermophile, taxon: 69014 Tko TopA Thermococcus kodakaraensis KOD1 Thermophile, taxon: 69014 Tko r-Gyr Thermococcus kodakaraensis KOD1 Thermophile, taxon: 69014 Tli Pol-1 Thermococcus litoralis Thermophile, taxon: 2265 Tli Pol-2 Thermococcus litoralis Thermophile, taxon: 2265 Tma Pol Thermococcus marinus taxon: 187879 Ton-NA1 LHR Thermococcus onnurineus NA1 Taxon: 523850 Ton-NA1 Pol Thermococcus onnurineus NA1 taxon: 342948 Tpe Pol Thermococcus peptonophilus strain taxon: 32644 SM2 Tsi-MM739 Lon Thermococcus sibiricus MM 739 Thermophile, Taxon: 604354 Tsi-MM739 Pol-1 Thermococcus sibiricus MM 739 Taxon: 604354 Tsi-MM739 Pol-2 Thermococcus sibiricus MM 739 Taxon: 604354 Tsi-MM739 RFC Thermococcus sibiricus MM 739 Taxon: 604354 Tsp AM4 RtcB Thermococcus sp. AM4 Taxon: 246969 Tsp-AM4 LHR Thermococcus sp. AM4 Taxon: 246969 Tsp-AM4 Lon Thermococcus sp. AM4 Taxon: 246969 Tsp-AM4 RIR1 Thermococcus sp. AM4 Taxon: 246969 Tsp-GE8 Pol-1 Thermococcus species GE8 Thermophile, taxon: 105583 Tsp-GE8 Pol-2 Thermococcus species GE8 Thermophile, taxon: 105583 Tsp-GT Pol-1 Thermococcus species GT taxon: 370106 Tsp-GT Pol-2 Thermococcus species GT taxon: 370106 Tsp-OGL-20P Pol Thermococcus sp. OGL-20P taxon: 277988 Tthi Pol Thermococcus thioreducens Hyperthermophile Tvo VMA Thermoplasma volcanium GSS1 Thermophile, taxon: 50339 Tzi Pol Thermococcus zilligii taxon: 54076 Unc-ERS PFL uncultured archaeon Gzfos13E1 isolation_source = Eel River sediment, clone = GZfos13E1, taxon: 285397 Unc-ERS RIR1 uncultured archaeon GZfos9C4 isolation_source = Eel River sediment, taxon: 285366, clone = GZfos9C4 Unc-ERS RNR uncultured archaeon GZfos10C7 isolation_source = Eel River sediment, clone = GZfos10C7, taxon: 285400 Unc-MetRFS MCM2 uncultured archaeon (Rice Cluster I) Enriched methanogenic consortium from rice field soil, taxon: 198240
[0124] The split inteins of the disclosed compositions or that can be used in the disclosed methods can be modified, or mutated, inteins. A modified intein can comprise modifications to the N-terminal intein segment, the C-terminal intein segment, or both. The modifications can include additional amino acids at the N-terminus the C-terminus of either portion of the split intein, or can be within the either portion of the split intein. Table 3 shows a list of amino acids, their abbreviations, polarity, and charge.
TABLE-US-00003 TABLE 3 Amino Acids 3-Letter 1-Letter Amino Acid Code Code Polarity Charge Alanine Ala A nonpolar neutral Arginine Arg R Basic positive polar Asparagine Asn N polar neutral Aspartic acid Asp D acidic negative polar Cysteine Cys C nonpolar neutral Glutamic acid Glu E acidic negative polar Glutamine Gln Q polar neutral Glycine Gly G nonpolar neutral Histidine His H Basic Positive (10%) polar Neutral (90%) Isoleucine Ile I nonpolar neutral Leucine Leu L nonpolar neutral Lysine Lys K Basic positive polar Methionine Met M nonpolar neutral Phenylalanine Phe F nonpolar neutral Proline Pro P nonpolar neutral Serine Ser S polar neutral Threonine Thr T polar neutral Tryptophan Trp W nonpolar neutral Tyrosine Tyr Y polar neutral Valine Val V nonpolar neutral
[0125] Disclosed herein are vectors comprising nucleic acids encoding the C-terminal intein segment as disclosed herein, as well as cell lines comprising said vectors. As used herein, plasmid or viral vectors are agents that transport the disclosed nucleic acids, such as those encoding a C-terminal intein segment and a peptide of interest, into a cell without degradation and include a promoter yielding expression of the gene in the cells into which they can be delivered. In one example, a C-terminal intein segment and peptide of interest are derived from either a virus or a retrovirus. Retroviral vectors are able to carry a larger genetic payload, i.e., a transgene or marker gene, than other viral vectors and for this reason are a commonly used vector. However, they are not as useful in non-proliferating cells. Adenovirus vectors are relatively stable and easy to work with, have high titers, and can be delivered in aerosol formulation, and can transfect non-dividing cells. Pox viral vectors are large and have several sites for inserting genes: they are thermostable and can be stored at room temperature. Disclosed herein is a viral vector which has been engineered so as to suppress the immune response of a host organism, elicited by the viral antigens. Vectors of this type can carry coding regions for Interleukin 8 or 10.
[0126] Viral vectors can have higher transfection (ability to introduce genes) abilities than chemical or physical methods to introduce genes into cells. Typically, viral vectors contain nonstructural early genes, structural late genes, an RNA polymerase Ill transcript, inverted terminal repeats necessary for replication and encapsidation, and promoters to control the transcription and replication of the viral genome. When engineered as vectors, viruses typically have one or more of the early genes removed and a gene or gene/promoter cassette is inserted into the viral genome in place of the removed viral DNA. Constructs of this type can carry up to about 8 kb of foreign genetic material. The necessary functions of the removed early genes are typically supplied by cell lines which have been engineered to express the gene products of the early genes in trans.
[0127] The fusion DNA encoding a modified peptide can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence. Depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements can be used. For instance, when expressing a modified eukaryotic protein, it can be advantageous to use appropriate eukaryotic vectors and host cells. Expression of the fusion DNA results in the production of a modified protein.
[0128] Also disclosed herein are cell lines comprising the vectors or peptides disclosed herein. A variety of cells can be used with the vectors and plasmids disclosed herein. Non-limiting examples of such cells include somatic cells such as blood cells (erythrocytes and leukocytes), endothelial cells, epithelial cells, neuronal cells (from the central or peripheral nervous systems), muscle cells (including myocytes and myoblasts from skeletal, smooth or cardiac muscle), connective tissue cells (including fibroblasts, adipocytes, chondrocytes, chondroblasts, osteocytes and osteoblasts) and other stromal cells (e.g., macrophages, dendritic cells, thymic nurse cells, Schwann cells, etc.). Eukaryotic germ cells (spermatocytes and oocytes) can also be used, as can the progenitors, precursors and stem cells that give rise to the above-described somatic and germ cells. These cells, tissues and organs can be normal, or they can be pathological such as those involved in diseases or physical disorders, including, but not limited to, infectious diseases (caused by bacteria, fungi yeast, viruses (including HIV, or parasites); in genetic or biochemical pathologies (e.g., cystic fibrosis, hemophilia, Alzheimer's disease, schizophrenia, muscular dystrophy, multiple sclerosis, etc.); or in carcinogenesis and other cancer-related processes.
[0129] The eukaryotic cell lines disclosed herein can be animal cells, plant cells (monocot or dicot plants) or fungal cells, such as yeast. Animal cells include those of vertebrate or invertebrate origin. Vertebrate cells, especially mammalian cells (including, but not limited to, cells obtained or derived from human, simian or other non-human primate, mouse, rat, avian, bovine, porcine, ovine, canine, feline and the like), avian cells, fish cells (including zebrafish cells), insect cells (including, but not limited to, cells obtained or derived from Drosophila species, from Spodoptera species (e.g., Sf9 obtained or derived from S. frugiperida, or HIGH FIVE cells) or from Trichoplusa species (e.g., MG1, derived from T. ni)), worm cells (e.g., those obtained or derived from C. elegans), and the like. It will be appreciated by one of skill in the art, however, that cells from any species besides those specifically disclosed herein can be advantageously used in accordance with the vectors, plasmids, and methods disclosed herein, without the need for undue experimentation.
[0130] Examples of useful cell lines include, but are not limited to, HT1080 cells (ATCC CCL 121), HeLa cells and derivatives of HeLa cells (ATCC CCL 2, 2.1 and 2.2), MCF-7 breast cancer cells (ATCC BTH 22), K-562 leukemia cells (ATCC CCL 243), KB carcinoma cells (ATCC CCL 17), 2780AD ovarian carcinoma cells (see Van der Buick, A. M. et al., Cancer Res. 48:5927-5932 (1988), Raji cells (ATCC CCL 86), Jurkat cells (ATCC TIB 152), Namalwa cells (ATCC CRL 1432), HL-60 cells (ATCC CCL 240), Daudi cells (ATCC CCL 213), RPMI 8226 cells (ATCC CCL 155), U-937 cells (ATCC CRL 1593), Bowes Melanoma cells (ATCC CRL 9607), WI-38VA13 subline 2R4 cells (ATCC CLL 75.1), and MOLT-4 cells (ATCC CRL 1582), as well as heterohybridoma cells produced by fusion of human cells and cells of another species. Secondary human fibroblast strains, such as WI-38 (ATCC CCL 75) and MRC-5 (ATCC CCL 171 can also be used. Other mammalian cells and cell lines can be used in accordance with the present invention, including, but not limited to CHO cells, COS cells, VERO cells. 293 cells, PER-C6 cells, MI cells, NS-1 cells, COS-7 cells, MDBK cells, MDCK cells, MRC-5 cells, WI-38 cells, WEHI cells, SP2/0 cells, BHK cells (including BHK-21 cells); these and other cells and cell lines are available commercially, for example from the American Type Culture Collection (P.O. Box 1549, Manassas, Va. 20108 USA). Many other cell lines are known in the art and will be familiar to the ordinarily skilled artisan: such cell lines therefore can be used equally well.
[0131] Once obtained, the proteins of interest can be separated and purified by appropriate combination of known techniques. These methods include, for example, methods utilizing solubility such as salt precipitation and solvent precipitation; methods utilizing the difference in molecular weight such as dialysis, ultra-filtration, gel-filtration, and SDS-polyacrylamide gel electrophoresis; methods utilizing a difference in electrical charge such as ion-exchange column chromatography; methods utilizing specific affinity such as affinity chromatography; methods utilizing a difference in hydrophobicity such as reverse-phase high performance liquid chromatography; and methods utilizing a difference in isoelectric point, such as isoelectric focusing electrophoresis. These are discussed in more detail below.
[0132] Disclosed is a method of purifying a protein of interest, the method comprising: utilizing a split intein comprising two separate peptides: an N-terminal intein segment and a C-terminal intein segment, immobilizing the N-terminal intein segment to a solid support; attaching a protein of interest to the C-terminal intein segment, wherein cleaving of the C-terminal intein segment is highly sensitive to extrinsic conditions when compared to a native intein. exposing the N-terminal intein segment and the C-terminal intein segment to each other so that they associate; washing the solid support to remove non-bound material; placing the associated the N-terminal intein segment and the C-terminal intein segment under conditions that allow for the intein to self-cleave; and isolating the protein of interest.
[0133] Also disclosed herein are kits. A kit, for example, can include the split intein disclosed herein (an N-terminal intein segment and a C-terminal intein segment) as well as a protein of interest, optionally. The kit can also include instructions for use.
C. EXPERIMENTAL
[0134] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and/or methods claimed herein are made and evaluated, and are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in C. or is at ambient temperature, and pressure is at or near atmospheric.
1. Example 1: Modifications to Control the Npu Split Intein C-Terminal Cleaving Reaction
[0135] To efficiently control C-terminal cleavage of the Npu.sub.C intein segment, the highly conserved penultimate Serine of Npu.sub.C was modified into Histidine, which is the residue found at this position in most inteins. The penultimate Histidine can stabilize the cyclization of the C-terminal intein Asparagine through hydrogen bonding, and can contribute to the pH sensitivity of some contiguous inteins. The resulting S34H Npu.sub.C-mutant, Npu.sub.C.sup.HN was fused with Streptokinase as the test target protein for testing its cleaving behavior under various conditions. Furthermore, a modification of the +1 residue of Streptokinase was also investigated. The native +1 residue of Streptokinase is a Cysteine, which is a typical +1 extein residue that facilitates intein splicing or cleaving reactions. Since most recombinant proteins, especially the therapeutic proteins that are manufactured in mammalian cells usually start with a methionine as their +1 residue, we made a C1M mutant, namely SK.sup.M for testing the intein cleaving reaction adaptability.
[0136] The cleaving kinetics of the different mutants were initially studied in solution. The Npu.sub.N and the Npu.sub.C.sup.HN mutants were expressed in E. coli and first purified using Ni-NTA affinity methods. To ensure a complete cleaving reaction of Npu.sub.C.sup.HN, a 2:1 molar ratio of Npu.sub.N:Npu.sub.C.sup.HN was used for all reactions. The cleaving reaction was carried out at room temperature at either pH 8.5 or pH 6.2. The mixture was sampled over 16 hours and the reaction was terminated by adding SDS-PAGE protein loading dye (375 mM Tri-HCl, 9% SDS, 50% Glycerol, 0.03% Bromophenol blue and 5% -mercaptoethanol). The results shown in
[0137] To enhance the sensitivity of the cleaving reaction to zinc ion and pH, the 04b Zinc-Binding Motif sequence (also referred to herein as a Sensitivity Enhancing Motif) (GDGHG, SEQ ID NO: 17) was engineered onto N-terminus of the Npu.sub.N (C.F.) intein segment as a sensitivity enhancing motif, resulting in the intein referred to as Zn-Npu.sub.N. Hypothetically, the Zinc-Binding Motif should largely enhance the sensitivity of the split intein system to zinc. Therefore, to obtain inhibition of cleaving small amounts of zinc ion would be required. To demonstrate this idea, the same cleaving kinetic study with zinc titration at pH 8.5 and 6.2 was carried out using Zn-Npu.sub.N at room temperature.
[0138]
[0139] A more detailed analysis is shown in
[0140] A noteworthy point was that the Npuc.sup.HN-SK.sup.M tended to cleave faster than the Npuc.sup.HN-SK.sup.C. This can imply that the Zinc-Binding Motif not only contributed to the pH sensitivity but also affected the nucleophilic attack at the +1 extein residue. Nevertheless, Methionine is the main beginning residue of most recombinant proteins, so the success with the SK.sup.M mutant is encouraging for the application of this strategy to other target proteins.
[0141] a. Materials and Methods
[0142] (a) Plasmid Construction of Npu.sub.N (Cysteine-Free) and Zn-Npu.sub.N
[0143] To silence the native cysteine residues of the Npu.sub.N intein segment, Cys29 and Cys60 were both mutated into serine, while Cys1 was mutated into Ala, resulting in the Npu.sub.N (cysteine-free, or C.F.). A zinc binding motif (GDGHG, SEQ ID NO: 17) was encoded directly onto a PCR primer to PCR-amplify the Npu.sub.N (cysteine-free) gene, resulting in the Zn-Npu.sub.N intein segment. Two unique restriction enzyme sites: NdeI and XhoI were designed at the 5 and 3 end, respectively, of Npu.sub.N (C.F.) and Zn-Npu.sub.N. The PCR products were digested with the two unique enzymes and then ligated into a pET vector for protein expression in E. coli.
[0144] (b) Plasmid Construction of Npuc or Npuc.sup.HN Tagged Target Protein for E. Coli and IVT Expression
[0145] The Npu.sub.C or Npu.sub.C.sup.HN split intein segment and the SK.sup.M and SK.sup.C target protein genes were fused through overlap PCR. Two unique restriction enzymes: NdeI and XhoI were designed at 5- and 3-end of the PCR product, respectively. The PCR-amplified fusion protein genes were digested with NdeI and XhoI and ligated into a pET expression vector for E. coli expression.
[0146] (c) Recombinant Protein Expression in E. coli
[0147] The constructed intein segment fusion plasmids were transformed into the Escherichia coli strain BLR(DE3) (F-ompT hsdSB(rB-,mB-) gal dcm (DE3)). Transformed cells were cultured in 5 ml Luria Broth media (10 g NaCl, 5 g Yeast extract, 10 g Tryptone per liter) supplemented with 100 g/ml ampicillin, vigorously shaken at 37 C., 200 rpm for 16-18 hours. Overnight cultures were then diluted at a ratio of 1:100 (v/v) into 2 Luria Broth media (10 g NaCl, 10 g Yeast extract, 20 g Tryptone per liter) supplemented with 100 g/ml ampicillin, and shaken at 37 C., 200 rpm until reaching the OD.sub.600 of 0.6-0.8. The cells were then induced for protein expression by adding isopropyl -D-1-thiogalactopyranoside (IPTG) at a final concentration 0.4 mM. The expression was carried out at 16 C. for 24 hours.
2. Example 2: Covalent Immobilization of Npu.SUB.N .(Cysteine-Free)
[0148] To create an Npu.sub.N intein that exhibits uniform orientation upon immobilization, the three cysteine residues in Npu.sub.N were first mutated to serine or alanine at Cys 29, Cys 60 and Cys 1. Since the potential impacts of theses mutations on the cleaving activity was unknown, the cleaving behavior of the individual mutants were investigated, and the results were compared to the wild type Npu.sub.N. In
[0149] The Npu.sub.N (C.F.) was immobilized to an agarose-based SulfoLink resin through a thiol-ether bonding, as described in the materials and methods session. The pre-purified Npu.sub.N was quantified using Bradford assay before immobilization. To evaluate the efficiency and capacity of the covalent immobilization, various amounts of Npu.sub.N were loaded to multiple chromatographic columns, where 1 ml of SulfoLink resin was packed individually. The unbound proteins in the flow-through sample and washes were collected and quantified using Bradford assays. An estimation of the immobilization efficiency could thus be calculated using the amount of loaded protein and subtracting the amount of proteins in the flow-through and wash. As shown in Table 4, the approximate average amount of immobilized Npu.sub.N on SulfoLink resin was 2.88 mg/ml.
TABLE-US-00004 TABLE 4 Npu.sub.N (C.F.) immobilization test Table 4. The immobilization efficiency calculation. All protein samples were quantified using Bradford assay. Loaded (mg) 15.0 10.0 5.0 2.5 Flow-through and 11.2 7.2 2.2 0.4 Wash (mg) Binding (mg/ml) 3.8 2.8 2.8 2.1 Average of Immobilized NpuN (C.F.) on SulfoLink Resin: 2.88 mg/ml
[0150] The immobilized Npu.sub.N resin was then tested for its binding capacity. Npu.sub.C-SK.sup.M was used as the model protein for examining the purification module. E. coli expressed Npuc-SK.sup.M was pre-purified using Ni-NTA and quantified using Bradford assay. Various amounts of Npu.sub.C-SK.sup.M were loaded to the Npu.sub.N resin-packed columns, which allowed the binding of Npu.sub.C-SK.sup.M. The unbound proteins in the flow-through sample and the wash sample were collected and quantified using Bradford assay. The result showed an approximate 2.3 mg/ml of binding capacity of the Npu.sub.N resin (Table 5).
TABLE-US-00005 TABLE 5 Npu.sub.N (C.F.) Resin Capacity test The binding capacity of Npu.sub.N-SulfoLink resin. Various amounts of Npu.sub.C- SK.sup.M were loaded to multiple chromatographic columns where 0.2 ml of Npu.sub.N-SulfoLink resin was packed individually. The residuals collected in flow-through and wash samples were quantified by Bradford assay. Loaded (g) 1200 600 400 100 50 Flow-through 628.1 147.8 29.5 2.2 Undetectable and Wash (g) Binding 47.6% 75.4% 92.7% 97.8% 100% Percentage (%) Binding (mg/ml) 2.86 2.26 1.85 N/A N/A Average Capacity of NpuN (C.F.)-SulfoLink Resin: 2.32 0.5 mg/ml
[0151] a. Materials and Methods
[0152] (a) Plasmid Construction of Npu.sub.N (Cysteine-Free) and Zn-Npu.sub.N
[0153] To silence the native cysteine residues of the Npu.sub.N intein segment, Cys29 and Cys60 were both mutated into serine, while Cyst was mutated into Ala, resulting in the Npu.sub.N (cysteine-free, or C.F.). A zinc binding motif (GDGHG, SEQ ID NO: 17) was encoded directly onto a PCR primer to PCR-amplify the Npu.sub.N (cysteine-free) genes, resulting in the Zn-Npu.sub.N intein segment. To add an additional His tag and cysteine residues to the C-terminus of Npu.sub.N, overlap PCR was used according to conventional methods. Two unique restriction enzyme sites: NdeI and XhoI were designed at the 5 and 3 end, respectively, of Npu.sub.N (C.F.) and Zn-Npu.sub.N. The PCR products were digested with the two unique enzymes and then ligated into a pET vector for protein expression in E. coli. The expressed Npu.sub.N intein segment is shown as SEQ ID #3.
[0154] (b) Recombinant Protein Expression in E. Coli
[0155] The constructed intein segment fusion plasmids were transformed into the Escherichia coli strain BLR(DE3) (F-ompT hsdSB(rB-,mB-) gal dcm (DE3)). Transformed cells were cultured in 5 ml Luria Broth media (10 g NaCl, 5 g Yeast extract, 10 g Tryptone per liter) supplemented with 100 g/ml ampicillin, vigorously shaken at 37 C., 2(00 rpm for 16-18 hours. Overnight cultures were then diluted at a ratio of 1:100 (v/v) into 2 Luria Broth media (10 g NaCl, 10 g Yeast extract, 20 g Tryptone per liter) supplemented with 100 g/ml ampicillin, and shaken at 37 C., 200 rpm until reaching the OD.sub.600 of 0.6-0.8. The cells were then induced for protein expression by adding isopropyl -D-1-thiogalactopyranoside (IPTG) at a final concentration 0.4 mM. The expression was carried out at 16 C. for 24 hours.
[0156] (c) Covalent Immobilization of Npu.sub.N (Cysteine-Free)
[0157] The Npu.sub.N was immobilized through the interaction between the sulfhydryl group of the engineered cysteine at the C-terminus of Npu.sub.N (SEQ ID NO: 3) and the Iodoacetyl group on a beaded agarose support. The agarose coupling bead was purchased from Thermo Scientific (SulfoLink Coupling Resin, #20401). The Iodoacetyl groups on the SulfoLink Coupling Resin react specifically with free sulfhydryls, as shown in the
[0158] To make a 1 ml of Npu.sub.N-SulfoLink resin, about 50-60 ml of E. coli expressed Npu.sub.N (cysteine-free) was pre-purified using Ni-NTA and dissolved in 1 ml of Coupling Buffer (50 mM Tris, 5 mM EDTA-Na; pH 8.5). A final concentration 25 mM of Tris (2-carboxyethyl) phosphine (TCEP, Thermo Product No. 77720), was added to the Npu.sub.N (cysteine-free) to remove the excess disulfide bonds. The SulfoLink resin slurry was first transferred to a chromatographic column and allowed to settle to obtain a 1 ml bed volume. The column was then equilibrated with 10 column-volume of Coupling Buffer before immobilization. To couple the Npu.sub.N, 1 ml of dissolved protein was added to 1 ml SulfoLink resin and mixed by gently shaking for at least an hour at room temperature or for 16 hours at 4 C. After the covalent immobilization, the resin was washed with another 10 column-volumes of Coupling Buffer to remove the unbound Npu.sub.N. The coupling resin was then incubated in a 50 mM L-Cysteine-HCl in Coupling Buffer for an hour to block the nonspecific binding sites on the agarose beads. Lastly, 1M NaCl was used to rinse out the residual contaminants on the resin. The final Npu.sub.N-coupling resin was stored in 20% ethanol at 4 C.
3. Example 3: Recombinant Protein Purification Using Zn-Npu.SUB.N .Resin with pH-Controlled Cleavage
[0159] Given the promising pH sensitivity property of using Zn-Npu.sub.N and Npuc.sup.HN as a purification module (Example 1), the applicability of this split intein system was evaluated for on-column purification of several target proteins. The Zn-Npu.sub.N segment was immobilized onto the agarose-based SulfoLink resin as described previously (Example 2). The purification scheme relies on a pH 8.5 buffer for inhibiting C-terminal cleavage during purification, and a pH 6.2 buffer for induction of cleaving after purification. On-column purification of proteins expressed in three different host cell systems: E. coli, an IVT system, and a mammalian cell expression system was used.
[0160]
[0161] To investigate the feasibility of using the Zn-Npu.sub.N/Npuc.sup.HN split intein in other expression systems, the Npuc.sup.HN-SK.sup.M and Npuc.sup.HN-sfGFP fusion protein genes were recloned for CHO-IVT expression. To produce the tagged target proteins, 400 L of CHO-IVT expression was carried out at 30 C. for 16 hours. The harvested expression reactions were first clarified by centrifugation and then the supernatant was transferred to the Zn-Npu.sub.N column, where 200 L of Zn-Npu.sub.N resin was packed. The purification results were analyzed using SDS-PAGE silver staining, which is more sensitive than Coomassie stain for detecting protein bands on the gel. The results are shown in
[0162] a. Recovery Analysis Using Streptokinase Activity Assay
[0163] A SK activity assay allowed us to quantitatively analyze how much SK target protein could be recovered after the purification process. The specific chemical conversion of plasminogen to plasmin by active Streptokinase results in a yellow end-product that can be detected by optical absorbance at 405 nm. The activity assay was validated to show that no signal would be generated by host cell proteins or any other impurities in the expression system. Consequently, the signal detected at 405 nm would only come from either the precursor protein (Npu.sub.C.sup.HN-SK.sup.M) or the cleaved product (SK.sup.M).
[0164] A standard Streptokinase purchased from Sigma (Cat. # S3134) was first analyzed for generating the standard activity curve, as shown in
[0165] The calculation of protein recovery was based on the total amount of Streptokinase in the final purified product divided by the total amount of precursor proteins in the CHO-IVT mixture:
[0166] For comparison, two conventional affinity tag-based purification methods, His tag and GST tag, were also examined for their protein recovery, Table 6 and
TABLE-US-00006 TABLE 6 The comparison of protein recovery using different purification schemes. The standard deviation was derived from three independent experiments. Affinity Tag Expression (total Units) Elution (total Units) Recovery (%) His tag 988.8 100.4 518.8 95.7 52.5% GST tag 577.1 22.7 248.8 75.4 43.1% Npu 904.3 113.4 778.1 16.3 .sup.86% Intein
4. Example 4: Recombinant Protein Purification Using Zn-Npu.SUB.N .Resin for Proteins Expressed in Mammalian Cell Systems
[0167] The incentive of developing the split intein system for recombinant protein purification was to resolve the issue of in vivo premature cleavage, which has been particularly problematic for proteins expressed in conventional mammalian cell hosts. Given all the successful demonstrations in E. coli and the IVT system, the ultimate goal is to apply the Npu split intein technology to mammalian cell systems. Here the results of mammalian cell expression Npu.sub.C.sup.HN-tagged glycoproteins and their purification using Zn-Npu.sub.N are shown. Secreted Alkaline Phosphatase (SEAP) was selected as the target protein. This target was selected because SEAP is a disulfide-bonded glycoprotein that catalyzes the hydrolysis of p-Nitrophenyl phosphate, producing a yellow product. Thus, SEAP has many of the features of complex mammalian glycoproteins, along with a simple activity assay. The quantification of SEAP is based on the detection of the yellow end-product using a spectrophotometer at 405 nm.
[0168] The Npu.sub.C.sup.HN-SEAP precursor protein was transiently expressed in 50 ml of HEK293 or CHO-K1 cell culture. A signal peptide derived from immunoglobulin kappa-chain was fused to the N-terminus of the tagged SEAP protein to target the SEAP for glycosylation and secretion. Since the Npu.sub.C.sup.HN split intein fragment has no splicing or cleaving activity, the possibility of in vivo premature cleavage has been completely eliminated. The clarified cell culture media with the secreted precursor proteins was harvested from the cell culture reactor, and then loaded onto the chromatographic column containing 200 L of Zn-Npu.sub.N resin. The purification results are shown in
[0169]
[0170] The biological activity of the purified SEAP to hydrolyze p-nitrophenyl phosphate and quantified the amount based on the colorimetric assay was also assayed. The obtained O.D. 405 nm data was converted into the actual yield through the calibration curve that generated using standard SEAP. The yield was defined as:
[0171] As summarized in
TABLE-US-00007 TABLE 7 The quantified yield of the final purified SEAP from mammalian cell culture. The standard deviation referred to three independent experiments. Host Cell Yield (g/L) HEK293 5.33 0.40 CHO-K1 3.39 0.87
[0172] a. Materials and Methods
[0173] (a) Plasmid Construction of Npuc or NpucHN Tagged Target Proteins for Mammalian Cell Expression
[0174] The Npuc or NpucHN split intein and the target protein genes were fused through overlap PCR. To enhance the tagged target protein secretion, a signal peptide derived from an immunoglobulin kappa (METDTLLLWVLLLWVPGSTGD, SEQ ID NO: 28) was engineered to the front of the tagged target protein. The Kozac sequence was also optimized for mammalian cell expression. Two unique restriction enzymes: HindIII and AfeI were designed at 5- and 3-end of the PCR product, respectively. The PCR-amplified precursor protein genes were digested with HindIII and AfeI and then ligated into the pTT vector for HEK293 or CHO-K 1 cell transient expression.
[0175] (b) Transient Expression in Mammalian Cell System
[0176] The mammalian cell line HEK293 (ATCC CRL-10852) and CHO-K1 (ATCC CCL-61) were purchased from ATCC. The cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 4 mM L-glutamine and 10% fetal bovine serum in a T-75 tissue culture flask. The cells were incubated at 37 C. with 5% CO.sub.2 in air atmosphere. For transient transfection, the plasmids were mixed with polyethylenimine (PEI) as a transfection vector at a 1:3 ratio (w/w). The DNA-PEI mixture was incubated at room temperature for 30 minutes and then sterilized through a 0.22 m syringe filter. In general, 1 g of plasmid DNA per 1 ml of culture was transfected when the cell confluency was in the range of 40 to 60%. The sterile DNA-PEI mixture was gently added to the cell culture media without shaking. The expressed protein was then harvested 3 days after transfection.
[0177] (c) A General Protocol for Recombinant Protein Purification USING NPU.sub.N-Coupled Resin
[0178] To purify the Npuc or Npu.sup.HN-tagged proteins, 200 L (bed volume) of the Npu.sub.N-coupled SulfoLink resin was packed into a chromatographic column and equilibrated with 10 column-volume of binding buffer (20 mM AMPD/PIPES, 500 mM NaCl, pH 8.5). The expressed protein mixtures (or lysates in the cases of E. coli expression) were first diluted 5-fold in binding buffer and clarified by centrifugation at 10,000 g, 4 C. for 2 minutes. The collected supernatant was loaded onto the Npu.sub.N column for binding and then washed with at least 10 column-volumes of wash buffer (20 mM AMPD/PIPES, 500 mM NaCl, pH 8.5) to thoroughly remove the impurities. The C-terminal cleaving reaction was induced by adding one column-volume of cleavage buffer (20 mM AMPD/PIPES, 500 mM NaCl, pH 6.2) and sealed for 5 hours at room temperature. The final cleaved product was then eluted from the column. To regenerate the Npu.sub.N-coupled SulfoLink resin, 0.1M NaOH, 0.5% Triton X100 and 2 mM ZnCl.sub.2 was added to denature the split intein assembly at 40 C. for at least 40 minutes.
[0179] (d) Streptokinase Activity Assay
[0180] The activity assay of Streptokinase is based on the potency of converting plasminogen to plasmin. Plasminogen activation by streptokinase can be quantitatively assayed using the synthetic chromogenic substrate S-2251 (Chromogenix cat. no. 820332). The SK-converted plasmin accelerates the hydrolysis of S-2251, resulting in the formation of a yellow end-product that can be detected at an optical absorbance of 405 nm. The native Glu-Plasminogen was purchased from ThermoFisher (Catalog #: RP-43078). Substrate S-2251 was used for testing the amount of SK-converted plasmin in the reaction. To perform the assay, the SK samples were diluted in sample buffer (5 mL Tris-HCl pH 7.4 (from 0.5M stock) 25 L NaCl (from 1M stock) 250 mg BSA (Sigma cat. no. A3311) filtered diH.sub.2O to 50 mL) to a desired dilution for the assay. To assay in a 96-well plate format, 60 L of diluted SK sample was mixed with 45 L of glu-plasminogen, and 40 L of substrate solution (1mL 0.5M Tris-HCl pH 7.4 1 mL 3 mM S-2251 5 L 10% Tween 20), mixed thoroughly. The plate was then incubated at 37 C. for one hour and then read the absorbance at 405 nm.
5. Example 5: A Npu Split Intein-Mediated Recombinant Protein Purification Using a Conventional Affinity Tag Immobilization Method
[0181] The Npu.sub.N intein segment is fused at its C-terminus to a conventional affinity tag, in this case a chitin binding domain (CBD), to demonstrate a chromatographic purification method. The Npu.sub.N-CBD was expressed in E. coli and then purified directly from the E. coli cell lysate using CBD tag. After removing the impurities, the Npu.sub.N-CBD bound to the chitin resin effectively forms an Npu.sub.N-conjugated resin, as shown in
[0182] To demonstrate the actual application of this chromatographic purification scheme, the Npu.sub.C-SK precursor protein was expressed in a separate IVT (In vitro translation) system. Two IVT lysates were used here: the HeLa-IVT and CHO-IVT, resulting from lysis or HeLa and CHO cells, respectively; and both of which have been evaluated for synthesizing therapeutic proteins, including monoclonal antibodies. A total of 200 L of Npu.sub.N-conjugated resin was packed in a chromatographic column and equilibrated with 20 column-volumes of binding buffer (20 mM AMPD/PIPES, 500 mM NaCl, pH 8.5).
[0183] a. Materials and Methods:
[0184] (a) Plasmid Construction with Naturally Occurring Split Intein (Npu DnaE)
[0185] The Npuc split intein segment and the streptokinase (SK) genes were fused using overlapping PCR. Two unique restriction enzymes: NdeI and XhoI were designed at the 5- and 3-ends of the PCR product, respectively. The PCR-amplified genes (Npu.sub.C-SK) were digested with NdeI and XhoI and ligated into the pET or pT7CFE1-CHis vectors for E. coli or CHO-IVT expression. The Npu.sub.N-CBD fusion was created using overlapping PCR with unique restriction enzyme sites: NdeI and XhoI at the 5- and 3-end, respectively. The resulting PCR product was then digested with NdeI and XhoI and cloned into a pET vector for E. coli. Expression. Table 8 lists the primers used for making the split intein fusion proteins.
TABLE-US-00008 TABLE8 Theprimersusedinmakingsplit intein-mediatedclone(C.H.Shietal.,2013) Primers Sequence(5-3) NpuN-forward 5-GGCCATATGATGGCCTTAAGCTATGAAACGGA AT-3 (SEQIDNO:29) Npu.sub.N-CBD- 5-GATAATTTGCCGAATGGTGGAGGAGGATCTGG overlap-F GGGTGGTGGTTCTATGACGACAAATCCTGGTGTAT C-3 (SEQIDNO:30) Npu.sub.N-CBD- 5-AGGATTTGTCGTCATAGAACCACCACCCCCAG overlap-R ATCCTCCTCCACCATTCGGCAAATTATCAACCCGC AT-3 (SEQIDNO:31) NpuN-reverse 5-GGCCTCGAGTGCGGCCGCAAGCTTTTA-3 (SEQIDNO:32) Npuc-SK- 5-GGCCATATGCATCATCATCATCATCACATCAA forward AATAGCCACACGTAAATA-3 (SEQIDNO:33) Npuc-SK- 5-GTGGTGGTGCTCGAGTCATTATTTGTCATTGG reverse GATTGTCGGG-3 (SEQIDNO:34)
[0186] (b) Immobilization of Chitin Binding Domain Tagged-Npu.sub.N (Npu.sub.N-CBD)
[0187] The Npu.sub.N-CBD genes were expressed in Escherichia coli strain BLR(DE3) (F-ompT hsdSB(rB-,mB-) gal dcm (DE3)), following typical procedures. The harvested cell lysate solutions were clarified by centrifugation at 6000 g, 4 C. for 10 min. For immobilization, the collected supernatants were loaded onto a chromatography column packed with 1 ml of equilibrated chitin-agarose resin (NEB, Cat. # S6651S). The CBD-tagged Npu binds to the chitin resin through the affinity tag. The column was washed with 20 column-volumes of wash buffer (20 mM AMPD/PIPES, 500 mM NaCl, pH 8.5) to completely remove the impurities. Lastly, the Npu-CBD-coupled resin was stored in 20% ethanol at 4 C. for future use.
[0188] (c) Recombinant Protein Express in In Vitro Translation (IVT) Systems
[0189] The HeLa-IVT or CHO-IVT system was purchased from Thermo Fisher Scientific (CHO Lysate, Accessory Proteins, 5 Reaction Mix, 4 Dialysis Buffer, Cat. #88894). To express proteins in a 100 L reaction, the materials are mixed in the following order: Lysate 50 L, Accessory Proteins 10 L, 5 Reaction Mix 20 L. The plasmids constructed with the precursor protein genes as described previously were added to the mixture to a total amount of 4 g DNA. The whole reaction mixture was then transferred to a micro-dialysis tube (Thermo, Cat. #88891Y) and immersed into a 2 ml micro-centrifuge tube supplied with 1400 L of dialysis buffer. The mixture was incubated at 30 C. for 16 hours to allow expression of the tagged target protein.
[0190] (d) Protein Purification Using Split Intein (Npu.sub.N-CBD)-Coupled Resin
[0191] To purify the Npu.sub.C-tagged SK target proteins, 200 L of the Npu.sub.N-CBD-coupled resin was packed into a gravity column, and equilibrated with 20 column-volumes of wash buffer (20 mM AMPD/PIPES, 500 mM NaCl, pH 8.5). IVT reactions with expressed proteins were first diluted in 5 volumes of wash buffer and then clarified by centrifugation at 10,000 g, 4 C. for 2 minutes. The collected supernatant was loaded onto the Npu.sub.N-CBD column and then washed with 20 column-volumes of wash buffer. After thoroughly washing out the impurities, one column-volume of elution buffer (20 mM AMPD/PIPES, 500 mM NaCl, pH 8.5) was added to the column and the column was sealed for 5 hours and incubated at 37 C. to allow cleavage.
6. Example 6: Sensitivity Enhancing Motifs
[0192] Intein modification summary: the 1 residue is the first amino acid before the intein, while the +1 amino acid is formally the first amino acid of the intein. The zinc binding motifs include the amino acids before the intein, occasionally along with the first amino acid of the intein.
TABLE-US-00009 TABLE9 Extein/InteinControllingAbility Extein/ Controlling Intein 1 +1 Ability LN001 GEGH FILAEGTRI + (SEQIDNO:24) (SEQIDNO:25) LN002 GEGH CLAEGTRI Cannotgetthe (SEQIDNO:24) (SEQIDNO:26) precursorsin E.coil LN003 GEGHH ALAEGTRI ++ (SEQIDNO:14) (SEQIDNO:27) LN003b GDGHH ALAEGTRI ++++ (SEQIDNO:16) (SEQIDNO:27) LN004 GEGHG CLAEGTRI +++ (SEQIDNO:15) (SEQIDNO:26) LN004b GDGHG CLAEGTRI ++++ (SEQIDNO:17) (SEQIDNO:26)
[0193] DNA sequences (modifications, including the +1 amino acid are underlined):
TABLE-US-00010 (SEQIDNO:18) 01:GGAGAGGGACATCACCTCGCAGAGGGCACTCGGAT (SEQIDNO.19) 02:GGAGAGGGACATTGCCTCGCAGAGGGCACTCGGAT (SEQIDNO:20) 03:GGAGAGGGACATCATGCCCTCGCAGAGGGCACTCG (SEQIDNO:21) 04:GGAGAGGGACATGGATGCCTCGCAGAGGGCACTCGG (SEQIDNO:22) 3b:GGAGATGGACATCATGCCCTCGCAGAGGGCACTCGGA (SEQIDNO:23) 4b:GGAGATGGACATGGATGCCTCGCAGAGGGCACTCGGA
TABLE-US-00011 Table 10 shows EC.sub.50 values for the modifications: CM LN003 LN004 LN003b LN004b EC.sub.50 (M) 100.49 107.23 52.13 23.21 17.30
[0194] It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.
7. REFERENCES
[0195] Iwai H. Zuger S, Jin J, Tam P H (2006) Highly efficient protein trans-splicing by a naturally split DnaE intein from Nostoc punctiforme. Febs Letters 580: 1853-1858. [0196] Mootz H D, Dhar T (2011) Modification of transmembrane and GPI-anchored proteins on living cells by efficient protein trans-splicing using the Npu DnaE intein. Chemical Communications 47: 3063-3065. [0197] Ramirez M, Valdes N, Guan D. Chen Z (2013) Engineering split intein DnaE from Nostoc punctiforme for rapid protein purification. Protein Eng Des Sel 26: 215-223. [0198] Guan D, Ramirez M, Chen Z (2013) Split intein mediated ultra-rapid purification of tagless protein (SIRP). Biotechnol Bioeng 110: 2471-2481. [0199] Wood D W, Wu W, Belfort G, Derbyshire V, Belfort M (1999) A genetic system yields self-cleaving inteins for bioseparations. Nature Biotechnology 17: 889-892. [0200] Shi C, Tarimala A, Meng Q, Wood DW (2014) A general purification platform for toxic proteins based on intein trans-splicing. Appl Microbiol Biotechnol 98: 9425-9435. [0201] Vila-Perello M, Liu Z, Shah N H, Willis J A, Idoyaga J, et al. (2013) Streamlined expressed protein ligation using split inteins. J Am Chem Soc 135: 286-292. [0202] Perler, F. B., et al., (1994) Nucleic Acids Res 22, 1125-1127 [0203] Perler, F. B. (2002) Nucleic Acids Res 30, 383-384. [19] Saleh, L., et al. (2006) Chem Rec 6, 183-193. [0204] Liu, X. Q. et al. (2003) J Biol Chem 278, 26315-26318 [0205] Yang, J., et al. (2004) Mol Microbiol 51, 1185-1192. [0206] Telenti, A., et al. (1997) J Bacterid 179, 6378-6382. [0207] Wu, H., Xu, M. Q., et al. (1998) Biochim Biophys Acta 1387. 422-432. [0208] Derbyshire, V., et al. (1997) Proc Natl Acad Sci USA 94, 11466-11471. [0209] Duan, X., et al. (1997) Cell 89, 555-564. [0210] Ichiyanagi, K., et al. (2000) J Mol Biol 300, 889-901. [0211] Klabunde. T., et al. (1998) Nat Struct Biol 5, 31-36. [0212] Ding, Y., et al. (2003) J Biol Chem 278, 39133-39142. [29] Xu, M. Q., et al. (1996) Embo J 15, 5146-5153. [0213] Scott, C. P., et al., (1999) Proc Natl Acad Sci U.S.A. 96, 13638-13643. [0214] Xu. M. Q., et al., (2001) Methods 24, 257-277. [0215] Evans, T. Cl Jr., et al. (2000) J Biol Chem 275, 9091-9094. [0216] Kwon, Y. et al., (2006) Angew Chem Int Ed 45, 1726-1729