Multiplex detection of intracellular or surface molecular targets in single cells
11702687 · 2023-07-18
Assignee
Inventors
Cpc classification
C12Q2525/161
CHEMISTRY; METALLURGY
C12Q1/6809
CHEMISTRY; METALLURGY
C12Q2525/203
CHEMISTRY; METALLURGY
C12Q2537/143
CHEMISTRY; METALLURGY
C12Q2523/319
CHEMISTRY; METALLURGY
C12Q2525/203
CHEMISTRY; METALLURGY
C12Q2565/514
CHEMISTRY; METALLURGY
C12Q2537/143
CHEMISTRY; METALLURGY
C12Q1/6809
CHEMISTRY; METALLURGY
C12Q2565/514
CHEMISTRY; METALLURGY
C12Q2523/319
CHEMISTRY; METALLURGY
C12Q2525/161
CHEMISTRY; METALLURGY
International classification
Abstract
This disclosure demonstrates an approach that translates synthetic DNA codes to spatial codes registered in nanoliter microchambers for multiplexed measurement of nearly any type of molecular targets (e.g., miRNAs, mRNAs, intracellular and surface proteins) in single cells.
Claims
1. A method comprising: (a) contacting cells that comprise nucleic acid targets with at least two conjugates, each conjugate comprising (i) a nucleic acid bait strand linked to (ii) a nucleic acid reporter strand through (iii) a cleavable linker, wherein the nucleic acid bait strand contains a nucleotide sequence complementary to a nucleic acid target of interest, to produce modified cells comprising target-conjugate complexes; (b) loading modified cells of step (a) on a base substrate containing microwells to produce a loaded base substrate, and (c) contacting the loaded base substrate with a cover substrate comprising at least two sets of at least two immobilized nucleic acid capture probes to produce at least two enclosed microwells, wherein (i) each of the capture probes of step (c) comprises a nucleotide sequence complementary to a nucleotide sequence of a nucleic acid reporter strand of step (a), (ii) each of the at least two enclosed microwells comprises a set of at least two different capture probes of the cover substrate, and (iii) each capture probe of the set of at least two different capture probes of the cover substrate corresponds to a different nucleic acid reporter strand associated with a different nucleic acid target of interest in the cells of step (a).
2. The method of claim 1, further comprising (d) cleaving the cleavable linkers of the conjugates to release the nucleic acid reporter strands.
3. The method of claim 1, further comprising maintaining the enclosed microwells under nucleic acid hybridization conditions to produce reporter-capture complexes immobilized on the cover substrate.
4. The method of claim 3, further comprising dissociating the cover substrate containing the immobilized reporter-capture complexes from the base substrate and visualizing at least one reporter-capture complex immobilized on the cover substrate.
5. The method of claim 4, further comprising identifying at least one nucleic acid target of interest of step (a).
6. The method of claim 1, wherein step (a) comprises contacting cells that comprise nucleic acid targets with at least three conjugates.
7. The method of claim 6, wherein step (a) comprises contacting cells that comprise nucleic acid targets with at least five conjugates.
8. The method of claim 7, wherein step (a) comprises contacting cells that comprise nucleic acid targets with at least ten conjugates.
9. The method of claim 1, wherein the cells are permeabilized or fixed.
10. The method of claim 1, wherein the nucleic acid bait strand contains a nucleotide sequence complementary to a ribonucleic acid (RNA) target.
11. The method of claim 10, wherein the RNA target is selected from mRNA targets, tRNA targets, rRNA targets and miRNA targets.
12. The method of claim 1, wherein the nucleic acid bait strand contains a nucleotide sequence complementary to a deoxyribonucleic acid (DNA) target.
13. The method of claim 1, wherein the cleavable linker is selected from photocleavable linkers and enzyme-cleavable linkers.
14. The method of claim 1, wherein the nucleic acid reporter strand is linked to a detectable label.
15. The method of claim 1, wherein the base substrate is a microchip.
16. The method of claim 1, wherein each microwell has a volume of 1-999 nanoliters.
17. The method of claim 1, wherein the cover substrate forms a seal with the base substrate to prevent fluid communication among the enclosed microwells.
18. A device comprising: (a) a base substrate comprising microwells, each microwell containing at least one cell containing at least two target-conjugate complexes, each complex comprising a nucleic acid target bound to a nucleic acid bait strand linked to a nucleic acid reporter strand through a cleavable linker; and (b) a cover substrate comprising at least two sets of at least two immobilized nucleic acid capture probes, each capture probe comprising a nucleotide sequence complementary to a nucleotide sequence of a nucleic acid reporter strand of (a), wherein the cover substrate is in contact with the base substrate to form at least two enclosed microwells, each of the at least two enclosed microwells containing a set of at least two different capture probes of the cover substrate, and each capture probe of the set of at least two different capture probes corresponds to a different nucleic acid reporter strand associated with a different cellular target.
19. The method of claim 1, wherein the at least two sets of at least two immobilized nucleic acid capture probes are patterned on the cover substrate.
20. The method of claim 19, wherein each of the enclosed microwells comprises at least one patterned set of the at least two immobilized nucleic acid capture probes.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
DETAILED DESCRIPTION
(17) The present disclosure provides, in some embodiments, methods comprising (a) contacting cells comprising nucleic acid and/or protein (or peptide) targets with reporter-probe conjugates (“RPC” or “conjugates”), each conjugate comprising (i) a nucleic acid bait strand or an antibody linked to (ii) a nucleic acid reporter strand through (iii) a cleavable linker, wherein the nucleic acid bait strand contains a nucleotide sequence complementary to a nucleic acid target of the cells or wherein the antibody binds specifically to the protein (or peptide) target of interest, to produce modified cells comprising target-conjugate complexes, and (b) loading modified cells of step (a) on a base substrate containing microwells, to produce a loaded base substrate (see, e.g.,
(18) Also provided herein are devices comprising (a) a base substrate comprising microwells, each microwell containing at least one cell containing at least two target-conjugate complexes, each complex comprising a nucleic acid or protein target bound to a nucleic acid bait strand linked to a nucleic acid reporter strand through a cleavable linker; and (b) a cover substrate comprising at least two sets of at least two immobilized capture probes, each capture probe comprising a nucleotide sequence complementary to a nucleotide sequence of a nucleic acid reporter strand of (a), wherein the cover substrate is in contact with the base substrate to form at least two enclosed microwells, each of the at least two enclosed microwells containing a set of at least two capture probes of the cover substrate.
(19) The cells used as provided herein may be prokaryotic cells (e.g., bacterial cells such as Escherichia coli cells) or eukaryotic cells (e.g., mammalian or yeast cells). In some embodiments, the cells are mammalian cells. For example, the cells may be human cells. In some embodiments, the cells are tumor cells. The tumor cells may be non-cancerous or cancerous. Thus, in some embodiments, the cells are cancer cells. Modified cells are cells containing exogenous (not native) protein or nucleic acid.
(20) In some embodiments, the cells are fixed and/or permeabilized prior to contacting the cells with the conjugates. Methods of fixation and permeabilization are known, any of which may be used as provided herein. In some embodiments, the cells are not fixed. In some embodiments, the cells are not permeabilized.
(21) Nucleic acid targets are typically intracellular targets. In some embodiments, the nucleic acid targets are RNA targets (e.g., mRNA, tRNA, rRNA and/or miRNA). In some embodiments, the nucleic acid targets are DNA targets. Targets may be a combination of RNA targets and DNA targets.
(22) Protein (or peptide) targets may be intracellular proteins or cell surface proteins (e.g., receptors). A protein target is not limited by type. For example, a protein may be an enzyme, hormone, receptor, ligand, or other type of protein.
(23) In some embodiments, the nucleic acid target and/or the protein target is a biomarker, indicative of a disease or condition, for example cancer.
(24) Depending in part on the number of targets of interest, cells may be contacted with at least two conjugates. In some embodiments, cells are contacted with at least 3, 4, 5, 6, 7, 8, 9 or 10 conjugates. In some embodiments, cells are contacted with 2-5, 2-10, 2-15, 5-10, 5-15, 3-5, 3-10 or 3-15 conjugates. More than 10 conjugates may be used. For example, at least 10, 15, 20, 25, 30, 35, 40, 45 or 50 (e.g., 2-10 or 2-50) conjugates may be used.
(25) A conjugate (or RPC) as provided herein includes a nucleic acid (e.g., DNA) bait strand linked to a nucleic acid (e.g., DNA) reporter strand through a cleavable linker. In some embodiments, a nucleic acid bait strand and/or a nucleic acid reporter strand has a length of 4-50 nucleotides. For example, a nucleic acid bait strand and/or a nucleic acid reporter strand may have a length of 4, 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides. In some embodiments, a nucleic acid bait strand and/or a nucleic acid reporter strand has a length longer than 50 nucleotides.
(26) The cleavable linker may be, for example, a photocleavable linker (e.g., nitrobenzyl linker), disulfide bridge and/or phosphate linkage. Many different cleavable linkers are known, any of which may be used as provided herein.
(27) Nucleic acid bait strands include a nucleotide sequence that is complementary to a nucleotide sequence of a target nucleic acid. Thus, under conditions that permit nucleic acid hybridization, the nucleic acid bait strand is able to bind (hybridize) to the target nucleic acid and/or the nucleic acid reporter strand is able to bind (hybridize) to the nucleic acid capture probe. The complementarity between nucleic acid strands intended for hybridization need not be, but in some embodiments is, wholly (100%) complementary. In some embodiments, a nucleic acid bait strand is only partially complementary (e.g., at least 50, 60, 70, 70 to 90% complementary) to a nucleic acid target strand. In some embodiments, a nucleic acid reporter strand is only partially complementary (e.g., at least 50, 60, 70, 70 to 90% complementary) to a nucleic acid capture probe.
(28) Nucleic acid reporter strands include a detectable label, such as a fluorophore. For example, a nucleic acid reporter strand may be labeled with Hydroxycoumarin, Aminocoumarin, Methoxycoumarin, Cascade Blue, Pacific Blue, Pacific Orange, Lucifer yellow, NBD, R-Phycoerythrin (PE), PE-Cy5 conjugates, PE-Cy7 conjugates, Red 613, PerCP, TruRed, FluorX, Fluorescein, BODIPY-FL, Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7, TRITC, X-Rhodamine, Lissamine Rhodamine B, Texas Red, Allophycocyanin (APC), and/or APC-Cy7 conjugates. Other dyes and fluorescent labels are encompassed herein.
(29) Binding of the nucleic acid bait strand to a target produces a target-conjugate complex, which is then subject to cleavage conditions (cleaved) such that the nucleic acid reporter strand of the conjugate is released from the nucleic acid bait strand and, thus, released from the target-conjugate complex. The free nucleic acid reporter strand can then bind to an immobilized capture probe.
(30) Modified cells containing the target-conjugate complexes are loaded onto (delivered to) a base substrate containing microwells to produce a loaded base substrate. The base substrate may be comprised of glass or plastic (or other material), for example. In some embodiments a base substrate is a microchip (e.g., similar to a microarray) or a microplate.
(31) In some embodiments, a single microwell contains a single cell, although more cells may be contained within a single microwell. In some embodiments, a single microwell comprises 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 cells. In some embodiments, a single microwell comprises 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9 or 1-10 cells. In some embodiments, a single microwell comprises 5 cells or less, or less than 5 cells. In some embodiments, 25-33% of the microwells of a base substrate contain only a single cell. In some embodiments, at least 30% of the microwells of a base substrate contain only a single cell. For example, at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% of the microwells of a base substrate contain only a single cell. In some embodiments, all (100%) of the microwells of a base substrate contain only a single cell.
(32) A base substrate may include any number of microwells. For example, a base substrate (e.g., microchip or microplate) may include 2-10, 2-20, 2-50, 2-100, 2-500, 2-1000, 2-5000, 2-10000, or 2-20000 microwells.
(33) Each microwell may have a volume of 1 nanoliter to 999 nanoliters, for example. In some embodiments, a microwell has a volume of 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, or 900 nanoliters. In some embodiments, a microwell has a volume of 1-10, 1-15 or 1-20 nanoliters.
(34) In some embodiments, cells are loaded into the microwells as a suspension (e.g., in buffer, such as saline buffer) having a volume of 1-10 nanoliters.
(35) Following loading of cells into the microwells, the loaded microwells (loaded base substrate) are contacted with a cover substrate comprising at least 2 sets of at least 2 immobilized capture probes. In some embodiments, the loaded microwells (loaded base substrate) are contacted with a cover substrate comprising at least 2 sets of at least 3 immobilized capture probes. In some embodiments, the loaded microwells (loaded base substrate) are contacted with a cover substrate comprising at least 3 sets of at least 2 immobilized capture probes. In some embodiments, the loaded microwells (loaded base substrate) are contacted with a cover substrate comprising at least 3 sets of at least 3 immobilized capture probes. In some embodiments, the loaded microwells (loaded base substrate) are contacted with a cover substrate comprising at least 4 sets of at least 2 immobilized capture probes. In some embodiments, the loaded microwells (loaded base substrate) are contacted with a cover substrate comprising at least 4 sets of at least 3 immobilized capture probes. In some embodiments, the loaded microwells (loaded base substrate) are contacted with a cover substrate comprising at least 4 sets of at least 4 immobilized capture probes. In some embodiments, the loaded microwells (loaded base substrate) are contacted with a cover substrate comprising at least 5 sets of at least 2 immobilized capture probes. In some embodiments, the loaded microwells (loaded base substrate) are contacted with a cover substrate comprising at least 5 sets of at least 3 immobilized capture probes. In some embodiments, the loaded microwells (loaded base substrate) are contacted with a cover substrate comprising at least 5 sets of at least 4 immobilized capture probes. In some embodiments, the loaded microwells (loaded base substrate) are contacted with a cover substrate comprising at least 5 sets of at least 5 immobilized capture probes.
(36) The cover substrate may be glass or plastic, for example. It may be a flat substrate such that it encloses and seals the microwells of the base substrate, thus preventing fluid communication among the enclosed microwells.
(37) Capture probes comprise a nucleotide sequence complementary to a nucleotide sequence of a nucleic acid reporter strand (of a conjugate). Released reporter strands (following cleavage) bind to nucleic acid capture probes. The capture probes are typically provided as multiple sets of probes immobilized and patterned (e.g., arrayed in parallel) on a cover substrate. For example, a single set of capture probes may include 3, 4, 5 or more different capture probes, each probe coded for (capable of binding to) a different reporter strand (corresponding to a different cellular target). A cover substrate includes multiple sets of capture probes patterned such that any single microwell contains a (at least one) complete set of capture probes, when the cover substrate is placed into contact with the base substrate. As an example, a single set of capture probes may include capture probe A′, capture probe B′ and capture probe C′. The cover substrate contains multiple immobilized sets of capture probe A′, capture probe B′ and capture probe C′ positioned (e.g., in linear, parallel form—see, e.g.,
(38) A single set of capture probes may comprise at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 different capture probes. In some embodiments, a single set of capture probes comprises 2-5, 2-10, 2-15, 5-10, 5-15, 3-5, 3-10 or 3-15 capture probes. More than 10 capture probes may be used. For example, at least 10, 15, 20, 25, 30, 35, 40, 45 or 50 capture probes may be used.
(39) A cover substrate may comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 sets of capture probes (e.g., 2-50 captures probes per set). In some embodiments, a cover substrate comprises 2-10, 2-20, 2-50, 2-100, 2-500, 2-1000, 2-5000, 2-10000, or 2-20000 sets of capture probes.
(40) In some embodiments, the methods further comprise cleaving the cleavable linkers of the conjugates to release the nucleic acid reporter strands. Cleavage conditions typically depend on the type of cleavable linker used. Examples of cleavable linkers are known and provided elsewhere herein.
(41) In some embodiments, the methods further comprise maintaining enclosed microwells under nucleic acid hybridization conditions to produce reporter-capture complexes immobilized on the cover substrate. Conditions that permit complementary nucleic acids to bind (hybridize) to each other are known and/or determined based in part on the length and composition of the nucleic acids (e.g., low stringency or high stringency, low salt, particular buffers, times and temperatures).
(42) In some embodiments, the methods further comprise dissociating (removing) the cover substrate containing the immobilized reporter-capture complexes from the base substrate and visualizing at least one reporter-capture complex immobilized on the cover substrate.
(43) In some embodiments, the methods further comprise identifying at least one nucleic acid target of interest of (a). Targets are identified based a correlation between the target identity and the spatial location and spectral property of a corresponding immobilized reporter strand.
(44) The present disclosure, in some embodiments, is related to methods of multiplexed detection of cell surface and/or intracellular targets on or in a single cell or a pool of individual cells. The present method also relates to detecting more than one cell surface target and/or intracellular target, on or in a single cell or a pool of individual cells. In some embodiments, the method of multiplexed detecting of more than one cell surface target on an individual cell comprises: (a) incubating cells with at least two reporter-probe conjugates (RPC), each of which comprises, in the following order: (1) an antibody that binds a cell surface target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which antibody components of the RPCs bind to their cell surface targets, thereby producing cells to which RPCs are bound to a target on their surface; (b) washing the product of (a) to remove unbound RPCs and produce a suspension of cells that bear (have bound to their surface) a RPC; (c) loading the suspension produced in (b) onto a microchip comprising nanoliter microwells and producing a microchip comprising nanoliter microwells that contain a single cell; (d) covering the microchip produced in (c) with a substrate bearing a microarray comprising nucleic acid probes complementary to the nucleic acid reporter molecules of (a)(3) and arrayed in a known spatial arrangement; (e) identifying microwells of (d) that contain a single cell; (f) maintaining the microwells that contain a single cell under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to a target on their surface, and the released reporter molecules hybridize to complementary nucleic acid probes on the microarray and produce reporter molecule nucleic acid-nucleic acid probe complexes bound to the substrate; (g) removing the substrate bearing the complexes produced in (f) from the microchip; and (h) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound, determining that cell surface targets are present on the cell. In some embodiments, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity. For example, the combination of surface antigens CD3 and CD8 can define the cytotoxic T lymphocytes. Surface antigens such as CD3, CD4, CD8, CD11a, CD11b, CD12 and CD24 can be measured together to distinguish different immune cell phenotypes.
(45) In some embodiments, the method of multiplexed detecting of more than one cell surface target on each member of a pool of individual cells comprises: (a) incubating the cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) an antibody that binds a cell surface target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which antibody components of the RPCs bind to their cell surface targets, thereby producing cells to which RPCs are bound to a target on their surface; (b) washing the product of (a) to remove unbound RPCs and produce a suspension of cells that bear (have bound to their surface) a RPC; (c) loading the suspension produced in (b) onto a microchip comprising nanoliter microwells and producing a microchip comprising nanoliter microwells that each contain a pool of individual cells; (d) covering the microchip produced in (c) with a substrate bearing a microarray comprising nucleic acid probes complementary to the nucleic acid reporter molecules of (a)(3) and arrayed in a known spatial arrangement; (e) identifying microwells of (d) that contain a pool of individual cells; (f) maintaining the microwells that each contain a pool of individual cells under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from each member of the pool of individual cells to which RPCs are bound to a target on their surface, and the released reporter molecules hybridize to complementary nucleic acid probes on the microarray and produce reporter molecule nucleic acid-nucleic acid probe complexes bound to the substrate; (g) removing the substrate bearing the complexes produced in (f) from the microchip; and (h) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound, determining that cell surface targets are present on members of the pool of individual cells. In some embodiments, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity. In some embodiments, the pool of cells comprises a single cell type. In some embodiments, the pool of cells comprises multiple cell types.
(46) In some embodiments, the method of multiplexed detecting of more than one intracellular target in an individual cell comprises: (a) producing a suspension of fixed, permeabilized cells; (b) incubating cells of (a) with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) a nucleic acid bait that hybridizes to an intracellular target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which nucleic acid bait components of the RPCs bind to their intracellular targets, thereby producing cells comprising intracellular target-bound RPCs; (c) washing the product of (b) to remove unbound RPCs and produce a suspension of cells that bear (have bound to intracellular targets) a RPC; (d) loading the suspension produced in (c) onto a microchip comprising nanoliter microwells and producing a microchip comprising nanoliter microwells that contain a single cell; (e) covering the microchip produced in (d) with a substrate bearing a microarray comprising nucleic acid probes complementary to the nucleic acid reporter molecules of (b)(3) and arrayed in a known spatial arrangement; (f) identifying microwells of (e) containing a single cell; (g) maintaining the microwells that contain a single cell under conditions under which the cleavable linkers of the intracellular target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to an intracellular target, and the released reporter molecules hybridize to complementary nucleic acid probes on the microarray and produce reporter molecule nucleic acid-nucleic acid probe complexes bound to the substrate; (h) removing the substrate bearing the complexes produced in (g) from the microchip; and (i) determining whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound, determining that cell surface targets are present on the cell. In some embodiments, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity. For example, the detection of intracellular proteins such as p-Akt can determine the proliferation potential of a give type of cancer cells. Detecting a panel of intracellular proteins such as pEGFR, pERK and pS6 can distinguish the differential roles of Ras and Pi3K-Akt pathways in determining the fate of individual cells including a heterogeneous population of cancer cells.
(47) In some embodiments, the method of multiplexed detecting of more than one intracellular target on each member of a pool of individual cells comprises: (a) producing a suspension of fixed, permeabilized cells; (b) incubating cells of (a) with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) a nucleic acid bait that hybridizes to an intracellular target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which nucleic acid bait components of the RPCs bind to their intracellular targets, thereby producing cells comprising intracellular target-bound RPCs; (c) washing the product of (b) to remove unbound RPCs and produce a suspension of cells that bear (have bound to intracellular targets) a RPC; (d) loading the suspension produced in (c) onto a microchip comprising nanoliter microwells and producing a microchip comprising nanoliter microwells that each contain a pool of individual cells; (e) covering the microchip produced in (d) with a substrate bearing a microarray comprising nucleic acid probes complementary to the nucleic acid reporter molecules of (b)(3) and arrayed in a known spatial arrangement; (f) identifying microwells of (e) that each contain a pool of individual cells; (g) maintaining the microwells that contain a single cell under conditions under which the cleavable linkers of the intracellular target-bound RPCs in the microwells are cleaved and the reporter molecules are released from each member of the pool of individual cells to which RPCs are bound to an intracellular target, and the released reporter molecules hybridize to complementary nucleic acid probes on the microarray and produce reporter molecule nucleic acid-nucleic acid probe complexes bound to the substrate; (h) removing the substrate bearing the complexes produced in (g) from the microchip; and (i) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound, determining that intracellular targets are present inside members of the pool of individual cells. In some embodiments, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity. In some embodiments, the pool of cells comprises a single cell type. In some embodiments, the pool of cells comprises multiple cell types. For example, the detection of intracellular proteins such as p-Akt can determine the proliferation potential of a give type of cancer cells. Detecting a panel of intracellular proteins such as pEGFR, pERK and pS6 can distinguish the differential roles of Ras and Pi3K-Akt pathways in determining the fate of individual cells including a heterogeneous population of cancer cells.
(48) In some embodiments, the method of multiplexed detecting more than one of low abundance cell surface targets of an individual cell comprises: (a) incubating cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) an antibody that binds to a low abundance cell surface target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which antibody components of the RPCs bind to their cell surface targets, thereby producing cells to which RPCs are bound to a target on their surface; (b) washing the product of (a) to remove unbound RPCs and produce a suspension of cells that bear (have bound to their surface) a RPC; (c) loading (1) the suspension produced in (b); and (2) PCR enzymes and PCR oligonucleotide primers complementary to the nucleic acid reporter molecule of (b)(3) onto a microchip comprising nanoliter microwells, thereby producing a microchip comprising nanoliter microwells that contain a single cell and PCR enzymes and oligonucleotide primers; (d) covering the microchip produced in (c) with a substrate comprising a hydrophobic surface, under conditions under which the hydrophobic surface contacts the microwells of (c); (e) maintaining the microwells that contain a single cell and PCR enzymes and PCR oligonucleotides under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to a target on their surface; (f) amplifying the cleaved nucleic acid reporter molecules of (e) by PCR, thereby producing a plurality of amplification products in each microwell; (g) lowering the temperature inside the microwells of (f) and providing conditions under which the amplification products of (f) do not interact with the substrate of (d); (h) maintaining the conditions of (g) and removing the substrate of (d) from the microchip; (i) covering the microchip produced in (h) with a substrate bearing a microarray comprising nucleic acid probes complementary to the amplification products of (f) and arrayed in a known spatial arrangement; (j) combining the amplification products of (f) with the nucleic acid probes complementary to the amplification products under conditions under which the amplification products and the nucleic acid probes hybridize on the microarray of the substrate and produce amplification product-nucleic acid probe complexes bound to the substrate; (k) identifying microwells of (f) containing a single cell; (l) removing the substrate bearing the complexes produced in (j) from the microchip; and (m) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound determining that cell surface targets are present on the cell. In some embodiments, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity. For example, surface antigen PD-1, which is immune check point protein, has a very wide range of expression levels. The ability to detect low abundance expression of PD-1 is of significance in determining the activation state of individual immune cells.
(49) In some embodiments, the method of multiplexed detecting of more than one low abundance cell surface target on each member of a pool of cells comprises: (a) incubating cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) an antibody that binds to a low abundance cell surface target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which antibody components of the RPCs bind to their cell surface targets, thereby producing cells to which RPCs are bound to a target on their surface; (b) washing the product of (a) to remove unbound RPCs and produce a suspension of cells that bear (have bound to their surface) a RPC; (c) loading (1) the suspension produced in (b); and (2) PCR enzymes and PCR oligonucleotide primers complementary to the nucleic acid reporter molecule of (b)(3) onto a microchip comprising nanoliter microwells, thereby producing a microchip comprising nanoliter microwells that each contain a pool of individual cells and PCR enzymes and oligonucleotide primers; (d) covering the microchip produced in (c) with a substrate comprising a hydrophobic surface, under conditions under which the hydrophobic surface contacts the microwells of (c); (e) maintaining the microwells that contain a single cell and PCR enzymes and PCR oligonucleotides under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to a target on their surface; (f) amplifying the cleaved nucleic acid reporter molecules of (e) by PCR, thereby producing a plurality of amplification products in each microwell; (f) amplifying the cleaved nucleic acid reporter molecules of (e) by PCR, thereby producing a plurality of amplification products in each microwell; (g) lowering the temperature inside the microwells of (f) and providing conditions under which the amplification products of (f) do not interact with the substrate of (d); (h) maintaining the conditions of (g) and removing the substrate of (d) from the microchip; (i) covering the microchip produced in (h) with a substrate bearing a microarray comprising nucleic acid probes complementary to the amplification products of (f) and arrayed in a known spatial arrangement; (j) combining the amplification products of (f) with the nucleic acid probes complementary to the amplification products under conditions under which the amplification products and the nucleic acid probes hybridize on the microarray of the substrate and produce amplification product-nucleic acid probe complexes bound to the substrate; (k) identifying microwells of (f) that each contain a pool of individual cells; (l) removing the substrate bearing the complexes produced in (j) from the microchip; and (m) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound determining that cell surface targets are present on members of the pool of individual cells. In some embodiments, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity.
(50) In some embodiments the method of multiplexed detecting of more than one low abundance intracellular target from an individual cell comprises (a) producing a suspension of fixed, permeabilized cells; (b) incubating cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) a nucleic acid bait that hybridizes to a low abundance intracellular target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which nucleic acid bait components of the RPCs bind to their intracellular targets, thereby producing cells comprising intracellular target-bound RPCs; (c) washing the product of (b) to remove unbound RPCs and produce a suspension of cells that bear (have bound to intracellular targets) a RPC; (d) loading (1) the suspension produced in (c); and (2) PCR enzymes and PCR oligonucleotide primers complementary to the nucleic acid reporter molecule of (b)(3) onto a microchip comprising nanoliter microwells, thereby producing a microchip comprising nanoliter microwells that contain a single cell and PCR enzymes and oligonucleotide primers; (e) covering the microchip produced in (d) with a substrate comprising a hydrophobic surface under conditions under which the hydrophobic surface contacts the microwells of (d); (f) maintaining the microwells that contain a single cell and PCR enzymes and PCR oligonucleotides under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to an intracellular target; (g) amplifying the released nucleic acid reporter molecules of (f) by PCR, thereby producing a plurality of amplification products in each microwell; (h) lowering the temperature inside the microwells of (g) and providing conditions under which the amplification products of (g) do not interact with the substrate of (e); (i) maintaining the conditions of (h) and removing the substrate of (d) from the microchip; (j) covering the microchip produced in (h) with a substrate bearing a microarray comprising nucleic acid probes complementary to the amplification products of (g) and arrayed in a known spatial arrangement; (k) providing conditions under which the amplification products of (g) hybridize to the nucleic acid probes of (j) and produce amplification product-nucleic acid probe complexes bound to the substrate; (l) identifying microwells of (f) containing a single cell; (m) removing the substrate bearing the complexes produced in (k) from the microchip; and, (n) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound determining that intracellular targets are present. After hybridization of the reporter molecule nucleic acid to the complementary nucleic acid on the microarray occurs, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity. For example, intracellular phosphoproteins such as p-mTOR are important signal transduction proteins and are present at low abundance as compared to total mTOR. Detecting these phosphoproteins rather than total proteins directly correlate to the activation of corresponding signaling cascades.
(51) In some embodiments, the method of multiplexed detecting of more than one low abundance intracellular target from each member of a pool of cells comprises: (a) producing a suspension of fixed, permeabilized cells; (b) incubating cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) a nucleic acid bait that hybridizes to a low abundance intracellular target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which nucleic acid bait components of the RPCs bind to their intracellular targets, thereby producing cells comprising intracellular target-bound RPCs; (c) washing the product of (b) to remove unbound RPCs and produce a suspension of cells that bear (have bound to intracellular targets) a RPC; (d) loading (1) the suspension produced in (c); and (2) PCR enzymes and PCR oligonucleotide primers complementary to the nucleic acid reporter molecule of (b)(3) onto a microchip comprising nanoliter microwells, thereby producing a microchip comprising nanoliter microwells that each contain a pool of individual cells and PCR enzymes and oligonucleotide primers; (e) covering the microchip produced in (d) with a substrate comprising a hydrophobic surface under conditions under which the hydrophobic surface contacts the microwells of (d); (f) maintaining the microwells that contain a single cell and PCR enzymes and PCR oligonucleotides under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to an intracellular target; (g) amplifying the released nucleic acid reporter molecules of (f) by PCR, thereby producing a plurality of amplification products in each microwell; (h) lowering the temperature inside the microwells of (g) and providing conditions under which the amplification products of (g) do not interact with the substrate of (e); (i) maintaining the conditions of (h) and removing the substrate of (d) from the microchip; (j) covering the microchip produced in (h) with a substrate bearing a microarray comprising nucleic acid probes complementary to the amplification products of (g) and arrayed in a known spatial arrangement; (k) providing conditions under which the amplification products of (g) hybridize to the nucleic acid probes of (j) and produce amplification product-nucleic acid probe complexes bound to the substrate; (l) identifying microwells of (f) each containing a pool of individual cells; (m) removing the substrate bearing the complexes produced in (k) from the microchip; and, (n) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound determining that intracellular targets are present on members of the pool of individual cells. After hybridization of the reporter molecule nucleic acid to the complementary nucleic acid on the microarray occurs, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity.
(52) In some embodiments, the pool of cells comprises between about 2 and about 100 cells. In some embodiments, the pool of cells comprises 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10 cells.
(53) In some embodiments, the cells of (a) are incubated with 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 RPCs.
(54) In some embodiments, the antibody of each RPC is a polyclonal antibody. In some embodiments, the antibody of each RPC is a monoclonal antibody. In some embodiments, the antibody of each RPC is a chimeric antibody. In some embodiments, the antibody of each RPC is a humanized antibody. In some embodiments, the antibody of each RPC is selected from the group consisting of CD3, CD4, CD8, CD11, CD24, EPCAM, and PSMA.
(55) In some embodiments, the nucleic acid bait of each RPC is between about 10 and about 500 nucleotides in length. In some embodiments, the nucleic acid bait of each RPC is between about 10 and about 30 nucleotides in length. In some embodiments, the nucleotide bait of each RPC is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
(56) In some embodiments, the cleavable linker of each RPC is photocleavable. In some embodiments, the cleavable linker of each RPC is enzyme cleavable.
(57) In some embodiments, the reporter molecule of each RPC is between about 10 and about 500 nucleotides in length. In some embodiments, the reporter molecule of each RPC is between about 10 and about 30 nucleotides in length. In some embodiments, the reporter molecule of each RPC is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
(58) In some embodiments, the microchip comprising nanoliter microwells is made of polydimethylsiloxane (PDMS). In some embodiments, the volume of the nanoliter wells of the microchip comprising nanoliter microwells is between about 1 nL and 999 nL. In some embodiments, the substrate used to cover the microchip is glass. In some embodiments, the substrate used to cover the microchip bears a microarray comprising nucleic acid probes complementary to the known nucleic acid sequences of the RPC reporter probes, and arrayed in a known spatial arrangement. In some embodiments, the substrate used to cover the microchip bears a microarray comprising nucleic acid probes complementary to PCR amplicons of the known nucleic acid sequences of the RPC reporter probes, and arrayed in a known spatial arrangement. In some embodiments, the substrate used to cover the microchip has a hydrophobic surface. In some embodiments, the hydrophobic surface of the substrate used to cover the microchip is Teflon®. In some embodiments, the hydrophobic surface of the substrate used to cover the microchip is alkane long chain functionalized silicon oxide surface or metal surfaces.
(59) In some embodiments, the temperature of the microwells is lowered below 0° C. In some embodiments, the temperature of the microwells is lowered below −10° C. In some embodiments, the temperature of the microwells is lowered by between about 20° C. and 100° C. In some embodiments, the temperature of the microwells is lowered over a time span of 1 ms to 5 minutes. In some embodiments, the temperature of the microwells is lowered over a time span of 0.5 ms to 2 minutes. In some embodiments, the temperature of the microwells is lowered over a time span of is to 1 minute.
(60) In some embodiments, the detecting of the reporter probe-nucleic acid probe complexes is performed by microarray scanning. In some embodiments, the detecting of the PCR amplicon-nucleic acid probe complexes is performed by microarray scanning.
(61) The present disclosure, in some embodiments, is related to methods of multiplexed detection of cell surface and/or intracellular targets on or in a single cell or a pool of individual cells. The present method also relates to detecting more than one cell surface target and/or intracellular target, on or in a single cell or a pool of individual cells. In some embodiments, the method of multiplexed detecting of more than one cell surface target on an individual cell comprises: (a) incubating cells with at least two reporter-probe conjugates (RPC), each of which comprises, in the following order: (1) an antibody that binds a cell surface target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which antibody components of the RPCs bind to their cell surface targets, thereby producing cells to which RPCs are bound to a target on their surface; (b) washing the product of (a) to remove unbound RPCs and produce a suspension of cells that bear (have bound to their surface) a RPC; (c) loading the suspension produced in (b) onto a microchip comprising nanoliter microwells and producing a microchip comprising nanoliter microwells that contain a single cell; (d) covering the microchip produced in (c) with a substrate bearing a microarray comprising nucleic acid probes complementary to the nucleic acid reporter molecules of (a)(3) and arrayed in a known spatial arrangement; (e) identifying microwells of (d) that contain a single cell; (f) maintaining the microwells that contain a single cell under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to a target on their surface, and the released reporter molecules hybridize to complementary nucleic acid probes on the microarray and produce reporter molecule nucleic acid-nucleic acid probe complexes bound to the substrate; (g) removing the substrate bearing the complexes produced in (f) from the microchip; and (h) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound, determining that cell surface targets are present on the cell. In some embodiments, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity. For example, the combination of surface antigens CD3 and CD8 can define the cytotoxic T lymphocytes. Surface antigens such as CD3, CD4, CD8, CD11a, CD11b, CD12 and CD24 can be measured together to distinguish different immune cell phenotypes.
(62) In some embodiments, the method of multiplexed detecting of more than one cell surface target on each member of a pool of individual cells comprises: (a) incubating the cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) an antibody that binds a cell surface target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which antibody components of the RPCs bind to their cell surface targets, thereby producing cells to which RPCs are bound to a target on their surface; (b) washing the product of (a) to remove unbound RPCs and produce a suspension of cells that bear (have bound to their surface) a RPC; (c) loading the suspension produced in (b) onto a microchip comprising nanoliter microwells and producing a microchip comprising nanoliter microwells that each contain a pool of individual cells; (d) covering the microchip produced in (c) with a substrate bearing a microarray comprising nucleic acid probes complementary to the nucleic acid reporter molecules of (a)(3) and arrayed in a known spatial arrangement; (e) identifying microwells of (d) that contain a pool of individual cells; (f) maintaining the microwells that each contain a pool of individual cells under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from each member of the pool of individual cells to which RPCs are bound to a target on their surface, and the released reporter molecules hybridize to complementary nucleic acid probes on the microarray and produce reporter molecule nucleic acid-nucleic acid probe complexes bound to the substrate; (g) removing the substrate bearing the complexes produced in (f) from the microchip; and (h) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound, determining that cell surface targets are present on members of the pool of individual cells. In some embodiments, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity. In some embodiments, the pool of cells comprises a single cell type. In some embodiments, the pool of cells comprises multiple cell types.
(63) In some embodiments, the method of multiplexed detecting of more than one intracellular target in an individual cell comprises: (a) producing a suspension of fixed, permeabilized cells; (b) incubating cells of (a) with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) a nucleic acid bait that hybridizes to an intracellular target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which nucleic acid bait components of the RPCs bind to their intracellular targets, thereby producing cells comprising intracellular target-bound RPCs; (c) washing the product of (b) to remove unbound RPCs and produce a suspension of cells that bear (have bound to intracellular targets) a RPC; (d) loading the suspension produced in (c) onto a microchip comprising nanoliter microwells and producing a microchip comprising nanoliter microwells that contain a single cell; (e) covering the microchip produced in (d) with a substrate bearing a microarray comprising nucleic acid probes complementary to the nucleic acid reporter molecules of (b)(3) and arrayed in a known spatial arrangement; (f) identifying microwells of (e) containing a single cell; (g) maintaining the microwells that contain a single cell under conditions under which the cleavable linkers of the intracellular target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to an intracellular target, and the released reporter molecules hybridize to complementary nucleic acid probes on the microarray and produce reporter molecule nucleic acid-nucleic acid probe complexes bound to the substrate; (h) removing the substrate bearing the complexes produced in (g) from the microchip; and (i) determining whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound, determining that cell surface targets are present on the cell. In some embodiments, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity. For example, the detection of intracellular proteins such as p-Akt can determine the proliferation potential of a give type of cancer cells. Detecting a panel of intracellular proteins such as pEGFR, pERK and pS6 can distinguish the differential roles of Ras and Pi3K-Akt pathways in determining the fate of individual cells including a heterogeneous population of cancer cells.
(64) In some embodiments, the method of multiplexed detecting of more than one intracellular target on each member of a pool of individual cells comprises: (a) producing a suspension of fixed, permeabilized cells; (b) incubating cells of (a) with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) a nucleic acid bait that hybridizes to an intracellular target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which nucleic acid bait components of the RPCs bind to their intracellular targets, thereby producing cells comprising intracellular target-bound RPCs; (c) washing the product of (b) to remove unbound RPCs and produce a suspension of cells that bear (have bound to intracellular targets) a RPC; (d) loading the suspension produced in (c) onto a microchip comprising nanoliter microwells and producing a microchip comprising nanoliter microwells that each contain a pool of individual cells; (e) covering the microchip produced in (d) with a substrate bearing a microarray comprising nucleic acid probes complementary to the nucleic acid reporter molecules of (b)(3) and arrayed in a known spatial arrangement; (f) identifying microwells of (e) that each contain a pool of individual cells; (g) maintaining the microwells that contain a single cell under conditions under which the cleavable linkers of the intracellular target-bound RPCs in the microwells are cleaved and the reporter molecules are released from each member of the pool of individual cells to which RPCs are bound to an intracellular target, and the released reporter molecules hybridize to complementary nucleic acid probes on the microarray and produce reporter molecule nucleic acid-nucleic acid probe complexes bound to the substrate; (h) removing the substrate bearing the complexes produced in (g) from the microchip; and (i) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound, determining that intracellular targets are present inside members of the pool of individual cells. In some embodiments, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity. In some embodiments, the pool of cells comprises a single cell type. In some embodiments, the pool of cells comprises multiple cell types. For example, the detection of intracellular proteins such as p-Akt can determine the proliferation potential of a give type of cancer cells. Detecting a panel of intracellular proteins such as pEGFR, pERK and pS6 can distinguish the differential roles of Ras and Pi3K-Akt pathways in determining the fate of individual cells including a heterogeneous population of cancer cells.
(65) In some embodiments, the method of multiplexed detecting more than one of low abundance cell surface targets of an individual cell comprises: (a) incubating cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) an antibody that binds to a low abundance cell surface target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which antibody components of the RPCs bind to their cell surface targets, thereby producing cells to which RPCs are bound to a target on their surface; (b) washing the product of (a) to remove unbound RPCs and produce a suspension of cells that bear (have bound to their surface) a RPC; (c) loading (1) the suspension produced in (b); and (2) PCR enzymes and PCR oligonucleotide primers complementary to the nucleic acid reporter molecule of (b)(3) onto a microchip comprising nanoliter microwells, thereby producing a microchip comprising nanoliter microwells that contain a single cell and PCR enzymes and oligonucleotide primers; (d) covering the microchip produced in (c) with a substrate comprising a hydrophobic surface, under conditions under which the hydrophobic surface contacts the microwells of (c); (e) maintaining the microwells that contain a single cell and PCR enzymes and PCR oligonucleotides under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to a target on their surface; (f) amplifying the cleaved nucleic acid reporter molecules of (e) by PCR, thereby producing a plurality of amplification products in each microwell; (g) lowering the temperature inside the microwells of (f) and providing conditions under which the amplification products of (f) do not interact with the substrate of (d); (h) maintaining the conditions of (g) and removing the substrate of (d) from the microchip; (i) covering the microchip produced in (h) with a substrate bearing a microarray comprising nucleic acid probes complementary to the amplification products of (f) and arrayed in a known spatial arrangement; (j) combining the amplification products of (f) with the nucleic acid probes complementary to the amplification products under conditions under which the amplification products and the nucleic acid probes hybridize on the microarray of the substrate and produce amplification product-nucleic acid probe complexes bound to the substrate; (k) identifying microwells of (f) containing a single cell; (l) removing the substrate bearing the complexes produced in (j) from the microchip; and (m) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound determining that cell surface targets are present on the cell. In some embodiments, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity. For example, surface antigen PD-1, which is immune check point protein, has a very wide range of expression levels. The ability to detect low abundance expression of PD-1 is of significance in determining the activation state of individual immune cells.
(66) In some embodiments, the method of multiplexed detecting of more than one low abundance cell surface target on each member of a pool of cells comprises: (a) incubating cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) an antibody that binds to a low abundance cell surface target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which antibody components of the RPCs bind to their cell surface targets, thereby producing cells to which RPCs are bound to a target on their surface; (b) washing the product of (a) to remove unbound RPCs and produce a suspension of cells that bear (have bound to their surface) a RPC; (c) loading (1) the suspension produced in (b); and (2) PCR enzymes and PCR oligonucleotide primers complementary to the nucleic acid reporter molecule of (b)(3) onto a microchip comprising nanoliter microwells, thereby producing a microchip comprising nanoliter microwells that each contain a pool of individual cells and PCR enzymes and oligonucleotide primers; (d) covering the microchip produced in (c) with a substrate comprising a hydrophobic surface, under conditions under which the hydrophobic surface contacts the microwells of (c); (e) maintaining the microwells that contain a single cell and PCR enzymes and PCR oligonucleotides under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to a target on their surface; (f) amplifying the cleaved nucleic acid reporter molecules of (e) by PCR, thereby producing a plurality of amplification products in each microwell; (f) amplifying the cleaved nucleic acid reporter molecules of (e) by PCR, thereby producing a plurality of amplification products in each microwell; (g) lowering the temperature inside the microwells of (f) and providing conditions under which the amplification products of (f) do not interact with the substrate of (d); (h) maintaining the conditions of (g) and removing the substrate of (d) from the microchip; (i) covering the microchip produced in (h) with a substrate bearing a microarray comprising nucleic acid probes complementary to the amplification products of (f) and arrayed in a known spatial arrangement; (j) combining the amplification products of (f) with the nucleic acid probes complementary to the amplification products under conditions under which the amplification products and the nucleic acid probes hybridize on the microarray of the substrate and produce amplification product-nucleic acid probe complexes bound to the substrate; (k) identifying microwells of (f) that each contain a pool of individual cells; (l) removing the substrate bearing the complexes produced in (j) from the microchip; and (m) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound determining that cell surface targets are present on members of the pool of individual cells. In some embodiments, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity.
(67) In some embodiments the method of multiplexed detecting of more than one low abundance intracellular target from an individual cell comprises (a) producing a suspension of fixed, permeabilized cells; (b) incubating cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) a nucleic acid bait that hybridizes to a low abundance intracellular target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which nucleic acid bait components of the RPCs bind to their intracellular targets, thereby producing cells comprising intracellular target-bound RPCs; (c) washing the product of (b) to remove unbound RPCs and produce a suspension of cells that bear (have bound to intracellular targets) a RPC; (d) loading (1) the suspension produced in (c); and (2) PCR enzymes and PCR oligonucleotide primers complementary to the nucleic acid reporter molecule of (b)(3) onto a microchip comprising nanoliter microwells, thereby producing a microchip comprising nanoliter microwells that contain a single cell and PCR enzymes and oligonucleotide primers; (e) covering the microchip produced in (d) with a substrate comprising a hydrophobic surface under conditions under which the hydrophobic surface contacts the microwells of (d); (f) maintaining the microwells that contain a single cell and PCR enzymes and PCR oligonucleotides under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to an intracellular target; (g) amplifying the released nucleic acid reporter molecules of (f) by PCR, thereby producing a plurality of amplification products in each microwell; (h) lowering the temperature inside the microwells of (g) and providing conditions under which the amplification products of (g) do not interact with the substrate of (e); (i) maintaining the conditions of (h) and removing the substrate of (d) from the microchip; (j) covering the microchip produced in (h) with a substrate bearing a microarray comprising nucleic acid probes complementary to the amplification products of (g) and arrayed in a known spatial arrangement; (k) providing conditions under which the amplification products of (g) hybridize to the nucleic acid probes of (j) and produce amplification product-nucleic acid probe complexes bound to the substrate; (l) identifying microwells of (f) containing a single cell; (m) removing the substrate bearing the complexes produced in (k) from the microchip; and, (n) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound determining that intracellular targets are present. After hybridization of the reporter molecule nucleic acid to the complementary nucleic acid on the microarray occurs, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity. For example, intracellular phosphoproteins such as p-mTOR are important signal transduction proteins and are present at low abundance as compared to total mTOR. Detecting these phosphoproteins rather than total proteins directly correlate to the activation of corresponding signaling cascades.
(68) In some embodiments, the method of multiplexed detecting of more than one low abundance intracellular target from each member of a pool of cells comprises: (a) producing a suspension of fixed, permeabilized cells; (b) incubating cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) a nucleic acid bait that hybridizes to a low abundance intracellular target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which nucleic acid bait components of the RPCs bind to their intracellular targets, thereby producing cells comprising intracellular target-bound RPCs; (c) washing the product of (b) to remove unbound RPCs and produce a suspension of cells that bear (have bound to intracellular targets) a RPC; (d) loading (1) the suspension produced in (c); and (2) PCR enzymes and PCR oligonucleotide primers complementary to the nucleic acid reporter molecule of (b)(3) onto a microchip comprising nanoliter microwells, thereby producing a microchip comprising nanoliter microwells that each contain a pool of individual cells and PCR enzymes and oligonucleotide primers; (e) covering the microchip produced in (d) with a substrate comprising a hydrophobic surface under conditions under which the hydrophobic surface contacts the microwells of (d); (f) maintaining the microwells that contain a single cell and PCR enzymes and PCR oligonucleotides under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to an intracellular target; (g) amplifying the released nucleic acid reporter molecules of (f) by PCR, thereby producing a plurality of amplification products in each microwell; (h) lowering the temperature inside the microwells of (g) and providing conditions under which the amplification products of (g) do not interact with the substrate of (e); (i) maintaining the conditions of (h) and removing the substrate of (d) from the microchip; (j) covering the microchip produced in (h) with a substrate bearing a microarray comprising nucleic acid probes complementary to the amplification products of (g) and arrayed in a known spatial arrangement; (k) providing conditions under which the amplification products of (g) hybridize to the nucleic acid probes of (j) and produce amplification product-nucleic acid probe complexes bound to the substrate; (l) identifying microwells of (f) each containing a pool of individual cells; (m) removing the substrate bearing the complexes produced in (k) from the microchip; and, (n) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound determining that intracellular targets are present on members of the pool of individual cells. After hybridization of the reporter molecule nucleic acid to the complementary nucleic acid on the microarray occurs, the identity of the intracellular target is determined with reference to the position of the complementary nucleic acid on the microarray, which specifies the target identity.
(69) In some embodiments, the pool of cells comprises between about 2 and about 100 cells. In some embodiments, the pool of cells comprises 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10 cells.
(70) In some embodiments, the cells of (a) are incubated with 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 RPCs.
(71) In some embodiments, the antibody of each RPC is a polyclonal antibody. In some embodiments, the antibody of each RPC is a monoclonal antibody. In some embodiments, the antibody of each RPC is a chimeric antibody. In some embodiments, the antibody of each RPC is a humanized antibody. In some embodiments, the antibody of each RPC is selected from the group consisting of CD3, CD4, CD8, CD11, CD24, EPCAM, and PSMA.
(72) In some embodiments, the nucleic acid bait of each RPC is between about 10 and about 500 nucleotides in length. In some embodiments, the nucleic acid bait of each RPC is between about 10 and about 30 nucleotides in length. In some embodiments, the nucleotide bait of each RPC is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
(73) In some embodiments, the cleavable linker of each RPC is photocleavable. In some embodiments, the cleavable linker of each RPC is enzyme cleavable.
(74) In some embodiments, the reporter molecule of each RPC is between about 10 and about 500 nucleotides in length. In some embodiments, the reporter molecule of each RPC is between about 10 and about 30 nucleotides in length. In some embodiments, the reporter molecule of each RPC is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
(75) In some embodiments, the microchip comprising nanoliter microwells is made of polydimethylsiloxane (PDMS). In some embodiments, the volume of the nanoliter wells of the microchip comprising nanoliter microwells is between about 1 nL and 999 nL. In some embodiments, the substrate used to cover the microchip is glass. In some embodiments, the substrate used to cover the microchip bears a microarray comprising nucleic acid probes complementary to the known nucleic acid sequences of the RPC reporter probes, and arrayed in a known spatial arrangement. In some embodiments, the substrate used to cover the microchip bears a microarray comprising nucleic acid probes complementary to PCR amplicons of the known nucleic acid sequences of the RPC reporter probes, and arrayed in a known spatial arrangement. In some embodiments, the substrate used to cover the microchip has a hydrophobic surface. In some embodiments, the hydrophobic surface of the substrate used to cover the microchip is Teflon®. In some embodiments, the hydrophobic surface of the substrate used to cover the microchip is alkane long chain functionalized silicon oxide surface or metal surfaces.
(76) In some embodiments, the temperature of the microwells is lowered below 0° C. In some embodiments, the temperature of the microwells is lowered below −10° C. In some embodiments, the temperature of the microwells is lowered by between about 20° C. and 100° C. In some embodiments, the temperature of the microwells is lowered over a time span of 1 ms to 5 minutes. In some embodiments, the temperature of the microwells is lowered over a time span of 0.5 ms to 2 minutes. In some embodiments, the temperature of the microwells is lowered over a time span of is to 1 minute.
(77) In some embodiments, the detecting of the reporter probe-nucleic acid probe complexes is performed by microarray scanning. In some embodiments, the detecting of the PCR amplicon-nucleic acid probe complexes is performed by microarray scanning.
Additional Embodiments
(78) 1. A method of multiplexed detecting of more than one cell surface target of an individual cell comprising:
(79) (a) incubating cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) an antibody that binds a cell surface target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which antibody components of the RPCs bind to their cell surface targets, thereby producing cells to which RPCs are bound to their surface;
(80) (b) washing the product of (a) to remove unbound RPCs and produce a suspension of cells that bear (have bound to their surface) a RPC;
(81) (c) loading the suspension produced in (b) onto a microchip comprising nanoliter microwells and producing a microchip comprising nanoliter microwells that contain a single cell;
(82) (d) covering the microchip produced in (c) with a substrate bearing a microarray comprising nucleic acid probes complementary to the nucleic acid reporter molecules of (a)(3) and arrayed in a known spatial arrangement;
(83) (e) identifying microwells of (d) containing a single cell;
(84) (f) maintaining the conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells of (e) are cleaved, releasing the reporter molecule from the target-bound antibody, under conditions under which nucleic acid reporter molecules of the RPCs hybridize to complementary nucleic acid probes on the microarray and produce reporter molecule nucleic acid-nucleic acid probe complexes bound to the substrate;
(85) (g) removing the substrate bearing the complexes produced in (f) from the microchip; and
(86) (h) detecting the location of nucleic acid-nucleic acid probe complexes bound to the substrate and determining if cell surface targets are present.
(87) 2. A method of multiplexed detection of cell surface targets of a pool of cells comprising:
(88) (a) incubating the cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) an antibody that binds a cell surface target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which antibody components of the RPCs bind to their cell surface targets, thereby producing cells to which RPCs are bound to a target on their surface;
(89) (b) washing the product of (a) to remove unbound RPCs and produce a suspension of cells that bear (have bound to their surface) a RPC;
(90) (c) loading the suspension produced in (b) onto a microchip comprising nanoliter microwells and producing a microchip comprising nanoliter microwells that each contain a pool of individual cells;
(91) (d) covering the microchip produced in (c) with a substrate bearing a microarray comprising nucleic acid probes complementary to the nucleic acid reporter molecules of (a)(3) and arrayed in a known spatial arrangement;
(92) (e) identifying microwells of (d) that contain a pool of individual cells;
(93) (f) maintaining the microwells that each contain a pool of individual cells under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from each member of the pool of individual cells to which RPCs are bound to a target on their surface, and the released reporter molecules hybridize to complementary nucleic acid probes on the microarray and produce reporter molecule nucleic acid-nucleic acid probe complexes bound to the substrate;
(94) (g) removing the substrate bearing the complexes produced in (f) from the microchip; and
(95) (h) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound, determining that cell surface targets are present on members of the pool of individual cells.
(96) 3. The method of embodiment 2, wherein the pool of cells comprises between about 2 and about 100 cells.
(97) 4. The method of embodiment 3, wherein the pool of cells comprises 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10 cells.
(98) 5. The method of any one of embodiments 1 to 4, wherein the cells of (a) are incubated with 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 RPCs.
(99) 6. The method of any one of embodiments 1 to 5, wherein the antibody of (a)(1) is a polyclonal antibody.
(100) 7. The method of any one of embodiments 1 to 5, wherein the antibody of (a)(1) is a monoclonal antibody.
(101) 8. The method of any one of embodiments 1 to 7, wherein the antibody of (a)(1) is a chimeric antibody.
(102) 9. The method of embodiment 8, wherein the antibody of (a)(1) is a humanized antibody. 10. The method of any one of embodiments 1 to 9, wherein the antibody of (a)(1) is selected from the group consisting of antibodies against CD3, CD4, CD8, CD11, CD24, EPCAM, and PSMA.
(103) 11. The method of any one of embodiments 1 to 10, wherein the cleavable linker of (a)(2) is photocleavable.
(104) 12. The method of any one of embodiments 1 to 10, wherein the cleavable linker of (a)(2) is enzyme cleavable.
(105) 13. The method of any one of embodiments 1 to 13, wherein the reporter molecule of (a)(3) is between about 10 and about 500 nucleotides in length.
(106) 14. The method of any one of embodiments 1 to 13, wherein the reporter molecule of (a)(3) is between about 10 and about 30 nucleotides in length.
(107) 15. The method of any one of embodiments 1 to 14, wherein the reporter molecule of (a)(3) is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
(108) 16. The method of any one of embodiments 1 to 15, wherein the microchip of (c) is made of polydimethylsiloxane (PDMS).
(109) 17. The method of any one of embodiments 1 to 16, wherein the volume of the nanoliter wells of the microchip of (c) is between about 1 nL and 999 nL.
(110) 18. The method of any one of embodiments 1 to 17, wherein the detecting of (h) is performed by microarray scanning.
(111) 19. A method of multiplexed detection of low abundance cell surface targets of an individual cell comprising:
(112) (a) incubating cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) an antibody that binds to a low abundance cell surface target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which antibody components of the RPCs bind to their cell surface targets, thereby producing cells to which RPCs are bound to a target on their surface;
(113) (b) washing the product of (a) to remove unbound RPCs and produce a suspension of cells that bear (have bound to their surface) a RPC;
(114) (c) loading (1) the suspension produced in (b); and (2) PCR enzymes and PCR oligonucleotide primers complementary to the nucleic acid reporter molecule of (b)(3) onto a microchip comprising nanoliter microwells, thereby producing a microchip comprising nanoliter microwells that contain a single cell and PCR enzymes and oligonucleotide primers;
(115) (d) covering the microchip produced in (c) with a substrate comprising a hydrophobic surface, under conditions under which the hydrophobic surface contacts the microwells of (c);
(116) (e) maintaining the microwells that contain a single cell and PCR enzymes and PCR oligonucleotides under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to a target on their surface;
(117) (f) amplifying the cleaved nucleic acid reporter molecules of (e) by PCR, thereby producing a plurality of amplification products in each microwell;
(118) (g) lowering the temperature inside the microwells of (f) and providing conditions under which the amplification products of (f) do not interact with the substrate of (d);
(119) (h) maintaining the conditions of (g) and removing the substrate of (d) from the microchip;
(120) (i) covering the microchip produced in (h) with a substrate bearing a microarray comprising nucleic acid probes complementary to the amplification products of (f) and arrayed in a known spatial arrangement;
(121) (j) combining the amplification products of (f) with the nucleic acid probes complementary to the amplification products under conditions under which the amplification products and the nucleic acid probes hybridize on the microarray of the substrate and produce amplification product-nucleic acid probe complexes bound to the substrate;
(122) (k) identifying microwells of (f) containing a single cell;
(123) (l) removing the substrate bearing the complexes produced in (j) from the microchip; and
(124) (m) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound determining that cell surface targets are present on the cell.
(125) 20. A method of multiplexed detection of low abundance cell surface targets of a pool of cells comprising:
(126) (a) incubating cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) an antibody that binds to a low abundance cell surface target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which antibody components of the RPCs bind to their cell surface targets, thereby producing cells to which RPCs are bound to a target on their surface;
(127) (b) washing the product of (a) to remove unbound RPCs and produce a suspension of cells that bear (have bound to their surface) a RPC;
(128) (c) loading (1) the suspension produced in (b); and (2) PCR enzymes and PCR oligonucleotide primers complementary to the nucleic acid reporter molecule of (b)(3) onto a microchip comprising nanoliter microwells, thereby producing a microchip comprising nanoliter microwells that each contain a pool of individual cells and PCR enzymes and oligonucleotide primers;
(129) (d) covering the microchip produced in (c) with a substrate comprising a hydrophobic surface, under conditions under which the hydrophobic surface contacts the microwells of (c);
(130) (e) maintaining the microwells that contain a single cell and PCR enzymes and PCR oligonucleotides under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to a target on their surface;
(131) (f) amplifying the cleaved nucleic acid reporter molecules of (e) by PCR, thereby producing a plurality of amplification products in each microwell; (f) amplifying the cleaved nucleic acid reporter molecules of (e) by PCR, thereby producing a plurality of amplification products in each microwell;
(132) (g) lowering the temperature inside the microwells of (f) and providing conditions under which the amplification products of (f) do not interact with the substrate of (d);
(133) (h) maintaining the conditions of (g) and removing the substrate of (d) from the microchip;
(134) (i) covering the microchip produced in (h) with a substrate bearing a microarray comprising nucleic acid probes complementary to the amplification products of (f) and arrayed in a known spatial arrangement;
(135) (j) combining the amplification products of (f) with the nucleic acid probes complementary to the amplification products under conditions under which the amplification products and the nucleic acid probes hybridize on the microarray of the substrate and produce amplification product-nucleic acid probe complexes bound to the substrate;
(136) (k) identifying microwells of (f) that each contain a pool of individual cells;
(137) (l) removing the substrate bearing the complexes produced in (j) from the microchip; and
(138) (m) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound determining that cell surface targets are present on members of the pool of individual cells.
(139) 21. The method of embodiment 20, wherein the pool of cells comprises between about 2 and about 100 cells.
(140) 22. The method of embodiment 21, wherein the pool of cells comprises 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10 cells.
(141) 23. The method of any one of embodiments 19 to 22, wherein the cells of (a) are incubated with 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 RPCs.
(142) 24. The method of any one of embodiments 19 to 23, wherein the antibody of (a)(1) is a polyclonal antibody.
(143) 25. The method of any one of embodiments 19 to 23, wherein the antibody of (a)(1) is a monoclonal antibody.
(144) 26. The method of any one of embodiments 19 to 25, wherein the antibody of (a)(1) is a chimeric antibody.
(145) 27 The method of embodiment 26, wherein the antibody of (a)(1) is a humanized antibody.
(146) 28. The method of any one of embodiments 19 to 27, wherein the antibody of (a)(1) is selected from the group consisting of antibodies against CD3, CD4, CD8, CD11, CD24, EPCAM, and PSMA.
(147) 29. The method of any one of embodiments 19 to 28, wherein the cleavable linker of (a)(2) is photocleavable.
(148) 30. The method of any one of embodiments 19 to 28, wherein the cleavable linker of (a)(2) is enzyme cleavable.
(149) 31. The method of any one of embodiments 19 to 30, wherein the reporter molecule of (a)(3) is between about 10 and about 500 nucleotides in length.
(150) 32. The method of any one of embodiments 19 to 30, wherein the reporter molecule of (a)(3) is between about 10 and about 30 nucleotides in length.
(151) 33. The method of any one of embodiments 19 to 32, wherein the reporter molecule of (a)(3) is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
(152) 34. The method of any one of embodiments 19 to 33, wherein the microchip of (c) is made of polydimethylsiloxane (PDMS).
(153) 35. The method of any one of embodiments 19 to 34, wherein the volume of the nanoliter wells of the microchip of (c) is between about 1 nL and 999 nL.
(154) 36. The method of any one of embodiments 19 to 35, wherein the detecting of (l) is performed by microarray scanning.
(155) 37. The method of any one of embodiments 19 to 36, wherein the substrate of (d) is glass.
(156) 38. The method of any one of embodiments 19 to 37, wherein the hydrophobic surface of the substrate of (d) is Teflon®.
(157) 39. The method of any one of embodiments 19 to 37, wherein the hydrophobic surface of the substrate of (d) is alkane chain functionalized silicone oxide surface and metal surface.
(158) 40. The method of any one of embodiments 19 to 39, wherein the temperature is lowered below 0° C.
(159) 41. The method of embodiment 40, wherein the temperature is lowered below −10° C. 42. The method of any one of embodiments 19 to 41, wherein the temperature is lowered by between about 20° C. and 100° C.
(160) 43. The method of any one of embodiments 19 to 42, wherein the temperature is lowered over a time span of 1 ms to 5 minutes.
(161) 44. The method of embodiment 43, wherein the temperature is lowered over a time span of 0.5 ms to 2 minutes.
(162) 45. The method of embodiment 44, wherein the temperature is lowered over a time span of 1 s to 1 minute.
(163) 46. A method of multiplexed detection of intracellular targets in an individual cell comprising:
(164) (a) producing a suspension of fixed, permeabilized cells;
(165) (b) incubating cells of (a) with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) a nucleic acid bait that hybridizes to an intracellular target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which nucleic acid bait components of the RPCs bind to their intracellular targets, thereby producing cells comprising intracellular target-bound RPCs;
(166) (c) washing the product of (b) to remove unbound RPCs and produce a suspension of cells that bear (have bound to intracellular targets) a RPC;
(167) (d) loading the suspension produced in (c) onto a microchip comprising nanoliter microwells and producing a microchip comprising nanoliter microwells that contain a single cell;
(168) (e) covering the microchip produced in (d) with a substrate bearing a microarray comprising nucleic acid probes complementary to the nucleic acid reporter molecules of (b)(3) and arrayed in a known spatial arrangement;
(169) (f) identifying microwells of (e) containing a single cell;
(170) (g) maintaining the microwells that contain a single cell under conditions under which the cleavable linkers of the intracellular target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to an intracellular target, and the released reporter molecules hybridize to complementary nucleic acid probes on the microarray and produce reporter molecule nucleic acid-nucleic acid probe complexes bound to the substrate;
(171) (h) removing the substrate bearing the complexes produced in (g) from the microchip; and
(172) (i) determining whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound, determining that cell surface targets are present on the cell.
(173) 47. A method of multiplexed detection of intracellular targets in a pool of cells comprising:
(174) (a) producing a suspension of fixed, permeabilized cells;
(175) (b) incubating cells of (a) with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) a nucleic acid bait that hybridizes to an intracellular target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which nucleic acid bait components of the RPCs bind to their intracellular targets, thereby producing cells comprising intracellular target-bound RPCs;
(176) (c) washing the product of (b) to remove unbound RPCs and produce a suspension of cells that bear (have bound to intracellular targets) a RPC;
(177) (d) loading the suspension produced in (c) onto a microchip comprising nanoliter microwells and producing a microchip comprising nanoliter microwells that each contain a pool of individual cells;
(178) (e) covering the microchip produced in (d) with a substrate bearing a microarray comprising nucleic acid probes complementary to the nucleic acid reporter molecules of (b)(3) and arrayed in a known spatial arrangement;
(179) (f) identifying microwells of (e) that each contain a pool of individual cells;
(180) (g) maintaining the microwells that contain a single cell under conditions under which the cleavable linkers of the intracellular target-bound RPCs in the microwells are cleaved and the reporter molecules are released from each member of the pool of individual cells to which RPCs are bound to an intracellular target, and the released reporter molecules hybridize to complementary nucleic acid probes on the microarray and produce reporter molecule nucleic acid-nucleic acid probe complexes bound to the substrate;
(181) (h) removing the substrate bearing the complexes produced in (g) from the microchip; and
(182) (i) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound, determining that intracellular targets are present inside members of the pool of individual cells.
(183) 48. The method of embodiment 47, wherein the pool of cells comprises between about 2 and about 100 cells.
(184) 49. The method of embodiment 48, wherein the pool of cells comprises 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10 cells.
(185) 50. The method of any one of embodiments 46 to 49, wherein the cells of (b) are incubated with 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 RPCs.
(186) 51. The method of any one of embodiments 46 to 50, wherein the nucleic acid bait of (b)(1) is between about 10 and about 500 nucleotides in length.
(187) 52. The method of any one of embodiments 46 to 51, wherein the nucleic acid bait of (b)(1) is between about 10 and about 30 nucleotides in length.
(188) 53. The method of any one of embodiments 46 to 52, wherein the nucleotide bait of (b)(1) is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
(189) 54. The method of any one of embodiments 46 to 53, wherein the cleavable linker of (b)(2) is photocleavable.
(190) 55. The method of any one of embodiments 46 to 53, wherein the cleavable linker of (b)(2) is enzyme cleavable.
(191) 56. The method of any one of embodiments 46 to 55, wherein the reporter molecule of (b)(3) is between about 10 and about 500 nucleotides in length.
(192) 57. The method of any one of embodiments 46 to 56, wherein the reporter molecule of (b)(3) is between about 10 and about 30 nucleotides in length.
(193) 58. The method of any one of embodiments 46 to 57, wherein the reporter molecule of (b)(3) is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
(194) 59. The method of any one of embodiments 46 to 58, wherein the microchip of (d) is made of polydimethylsiloxane (PDMS).
(195) 60. The method of any one of embodiments 46 to 59, wherein the volume of the nanoliter wells of the microchip of (d) is between about 1 nL and 999 nL.
(196) 61. The method of any one of embodiments 46 to 60, wherein the detecting of (i) is performed by microarray scanning.
(197) 62. A method of multiplexed detection of low abundance intracellular targets from an individual cell comprising:
(198) (a) producing a suspension of fixed, permeabilized cells;
(199) (b) incubating cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) a nucleic acid bait that hybridizes to a low abundance intracellular target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which nucleic acid bait components of the RPCs bind to their intracellular targets, thereby producing cells comprising intracellular target-bound RPCs;
(200) (c) washing the product of (b) to remove unbound RPCs and produce a suspension of cells that bear (have bound to intracellular targets) a RPC;
(201) (d) loading (1) the suspension produced in (c); and (2) PCR enzymes and PCR oligonucleotide primers complementary to the nucleic acid reporter molecule of (b)(3) onto a microchip comprising nanoliter microwells, thereby producing a microchip comprising nanoliter microwells that contain a single cell and PCR enzymes and oligonucleotide primers;
(202) (e) covering the microchip produced in (d) with a substrate comprising a hydrophobic surface under conditions under which the hydrophobic surface contacts the microwells of (d);
(203) (f) maintaining the microwells that contain a single cell and PCR enzymes and PCR oligonucleotides under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to an intracellular target;
(204) (g) amplifying the released nucleic acid reporter molecules of (f) by PCR, thereby producing a plurality of amplification products in each microwell;
(205) (h) lowering the temperature inside the microwells of (g) and providing conditions under which the amplification products of (g) do not interact with the substrate of (e);
(206) (i) maintaining the conditions of (h) and removing the substrate of (d) from the microchip;
(207) (j) covering the microchip produced in (h) with a substrate bearing a microarray comprising nucleic acid probes complementary to the amplification products of (g) and arrayed in a known spatial arrangement;
(208) (k) providing conditions under which the amplification products of (g) hybridize to the nucleic acid probes of (j) and produce amplification product-nucleic acid probe complexes bound to the substrate;
(209) (l) identifying microwells of (f) containing a single cell;
(210) (m) removing the substrate bearing the complexes produced in (k) from the microchip; and,
(211) (n) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound determining that intracellular targets are present.
(212) 63. A method of multiplexed detection of low abundance intracellular targets from a pool of cells comprising:
(213) (a) producing a suspension of fixed, permeabilized cells;
(214) (b) incubating cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) a nucleic acid bait that hybridizes to a low abundance intracellular target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which nucleic acid bait components of the RPCs bind to their intracellular targets, thereby producing cells comprising intracellular target-bound RPCs;
(215) (c) washing the product of (b) to remove unbound RPCs and produce a suspension of cells that bear (have bound to intracellular targets) a RPC;
(216) (d) loading (1) the suspension produced in (c); and (2) PCR enzymes and PCR oligonucleotide primers complementary to the nucleic acid reporter molecule of (b)(3) onto a microchip comprising nanoliter microwells, thereby producing a microchip comprising nanoliter microwells that each contain a pool of individual cells and PCR enzymes and oligonucleotide primers;
(217) (e) covering the microchip produced in (d) with a substrate comprising a hydrophobic surface under conditions under which the hydrophobic surface contacts the microwells of (d);
(218) (f) maintaining the microwells that contain a single cell and PCR enzymes and PCR oligonucleotides under conditions under which the cleavable linkers of the surface target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to an intracellular target;
(219) (g) amplifying the released nucleic acid reporter molecules of (f) by PCR, thereby producing a plurality of amplification products in each microwell;
(220) (h) lowering the temperature inside the microwells of (g) and providing conditions under which the amplification products of (g) do not interact with the substrate of (e);
(221) (i) maintaining the conditions of (h) and removing the substrate of (d) from the microchip;
(222) (j) covering the microchip produced in (h) with a substrate bearing a microarray comprising nucleic acid probes complementary to the amplification products of (g) and arrayed in a known spatial arrangement;
(223) (k) providing conditions under which the amplification products of (g) hybridize to the nucleic acid probes of (j) and produce amplification product-nucleic acid probe complexes bound to the substrate;
(224) (l) identifying microwells of (f) each containing a pool of individual cells;
(225) (m) removing the substrate bearing the complexes produced in (k) from the microchip; and,
(226) (n) detecting whether nucleic acid-nucleic acid probe complexes are bound to the substrate, and if complexes are bound determining that intracellular targets are present on members of the pool of individual cells.
(227) 64. The method of embodiment 63, wherein the pool of cells comprises between about 2 and about 100 cells.
(228) 65. The method of embodiment 64, wherein the pool of cells comprises 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10 cells.
(229) 66. The method of any one of embodiments 62 to 65, wherein the cells of (b) are incubated with 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 RPCs.
(230) 67. The method of any one of embodiments 62 to 66, wherein the nucleic acid bait of (b)(1) is between about 10 and about 500 nucleotides in length.
(231) 68. The method of any one of embodiments 62 to 67, wherein the nucleic acid bait of (b)(1) is between about 10 and about 30 nucleotides in length.
(232) 69. The method of any one of embodiments 62 to 68, wherein the nucleotide bait of (b)(1) is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
(233) 70. The method of any one of embodiments 62 to 69, wherein the cleavable linker of (b)(2) is photocleavable.
(234) 71. The method of any one of embodiments 62 to 69, wherein the cleavable linker of (b)(2) is enzyme cleavable.
(235) 72. The method of any one of embodiments 62 to 71, wherein the reporter molecule of (b)(3) is between about 10 and about 500 nucleotides in length.
(236) 73. The method of any one of embodiments 62 to 72, wherein the reporter molecule of (b)(3) is between about 10 and about 30 nucleotides in length.
(237) 74. The method of any one of embodiments 62 to 73, wherein the reporter molecule of (b)(3) is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
(238) 75. The method of any one of embodiments 62 to 74, wherein the microchip of (d) is made of polydimethylsiloxane (PDMS).
(239) 76. The method of any one of embodiments 62 to 75, wherein the volume of the nanoliter wells of the microchip of (d) is between about 1 nL and 999 nL.
(240) 77. The method of any one of embodiments 62 to 76, wherein the detecting of (n) is performed by microarray scanning.
(241) 78. The method of any one of embodiments 62 to 77, wherein the substrate of (e) is glass.
(242) 79. The method of any one of embodiments 62 to 78, wherein the hydrophobic surface of the substrate of (e) is Teflon®.
(243) 80. The method of any one of embodiments 62 to 78, wherein the hydrophobic surface of the substrate of (e) is alkane chain functionalized silicone oxide or metal surfaces.
(244) 81. The method of any one of embodiments 62 to 80, wherein the temperature is lowered below 0° C.
(245) 82. The method of embodiment 81, wherein the temperature is lowered below −10° C. 83. The method of any one of embodiments 62 to 82, wherein the temperature is lowered by between about 20° C. and 100° C.
(246) 84. The method of any one of embodiments 62 to 83, wherein the temperature is lowered over a time span of 1 ms to 5 minutes.
(247) 85. The method of embodiment 84, wherein the temperature is lowered over a time span of 0.5 ms to 2 minutes.
(248) 86. The method of embodiment 85, wherein the temperature is lowered over a time span of 1 s to 1 minute. 87. A method of multiplexed detection of intracellular targets comprising:
(249) (a) incubating a suspension of fixed, permeabilized cells with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) a nucleic acid bait that hybridizes to an intracellular target; (2) a cleavable linker; and (3) a nucleic acid reporter molecule of known sequence, under conditions under which nucleic acid bait components of the RPCs bind to their intracellular targets, thereby producing cells comprising intracellular target-bound RPCs;
(250) (b) loading the suspension produced in (a) onto a microchip comprising a plurality of nanoliter microwells to produce a loaded microchip;
(251) (c) contacting the loaded microchip produced in (b) and a substrate bearing a microarray comprising a plurality of capture probes, wherein each capture probe comprises a nucleic acid sequence complementary to at least one of the nucleic acid reporter molecules of (b)(3), wherein the plurality of capture probes is arrayed on the substrate in a known spatial arrangement, wherein contacting of the microchip and the substrate encloses each microwell of the microchip and wherein each enclosed microwell contains each capture probe of the microarray;
(252) (d) maintaining the loaded microchip under conditions under which the cleavable linkers of the intracellular target-bound RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to an intracellular target, and the released reporter molecules hybridize to complementary nucleic acid probes on the microarray and produce reporter molecule—capture probe complexes bound to the substrate;
(253) (e) removing the substrate bearing the complexes produced in (d) from the microchip; and
(254) (f) visualizing one or more reporter molecule—capture probe complexes bound to the substrate and
(255) (g) identifying one or more intracellular targets corresponding to one or more reporter molecules bound to the substrate for at least one enclosed microwell containing less than five cells.
(256) 88. The method of embodiment 87, wherein the method comprises identifying one or more corresponding intracellular targets present on the substrate for at least one enclosed microwell containing a single cell.
(257) 89. The method of embodiment 87 or 88, wherein the method comprises incubating a suspension of fixed, permeabilized cells with at least 5 RPC, at least 10 RPC, at least 15 RPC, at least 20 RPC, at least 25 RPC, at least 30 RPC, at least 35 RPC, at least 40 RPC, at least 45 RPC, or at least 50 RPC.
(258) 90. The method of any one of embodiments 87-89, wherein the microchip comprises between 2 and 20,000 microwells, inclusive of the endpoints.
(259) 91. The method of any one of embodiments 87-89, wherein the microchip comprises between 5,000 and 20,000 microwells, inclusive of the endpoints.
(260) 92. The method of any one of embodiments 87-91, wherein each microwell has a volume of between 1 nanoliter and 999 nanoliters.
(261) 93. The method of any one of embodiments 87-91, wherein each microwell has a volume of between 1 nanoliter and 10 nanoliters.
(262) 94. The method of any one of embodiments 87-93, wherein each microwell comprises a volume of the suspension of (a) of between 1 nanoliter and 10 nanoliters.
(263) 95. The method of any one of embodiments 87-94, wherein the nucleic acid bait of (a)(1) comprises a DNA sequence, an RNA sequence, a peptide or a combination thereof.
(264) 96. The method of any one of embodiments 87-95, wherein the nucleic acid reporter molecule of (a)(3) comprises a DNA sequence, an RNA sequence, a peptide or a combination thereof.
(265) 97. The method of any one of embodiments 87-95, wherein the nucleic acid reporter molecule of (a)(3) comprises a DNA sequence, an RNA sequence, a peptide or a combination thereof.
(266) 98. The method of any one of embodiments 87-95, wherein the nucleic acid reporter molecule of (a)(3) comprises a DNA sequence.
(267) 99. The method of any one of embodiments 87-98, wherein the substrate comprises a glass composition.
(268) 100. The method of any one of embodiments 87-99, wherein the nucleic acid sequence complementary to at least one of the nucleic acid reporter molecules of (b)(3) of each capture probe comprises a DNA sequence, an RNA sequence, a peptide or a combination thereof.
(269) 101. The method of any one of embodiments 87-99, wherein the nucleic acid sequence complementary to at least one of the nucleic acid reporter molecules of (b)(3) of each capture probe comprises a DNA sequence.
(270) 102. The method of any one of embodiments 87-101, wherein the plurality of capture probes comprises a number of distinct capture probes equal to the number of RPCs of (a).
(271) 103. The method of any one of embodiments 87-101, wherein the plurality of capture probes comprises at least 2, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 capture probes.
(272) 104. The method of any one of embodiments 87-103, wherein the known spatial arrangement of capture probes of the microarray comprises a repeating pattern.
(273) 105. The method of embodiment 104, wherein the repeating pattern comprises parallel lines.
(274) 106. The method of any one of embodiments 87-105, wherein the enclosed microwells are prevented from fluid communication with any other enclosed microwell on the microchip.
(275) 107. The method of embodiment 106, wherein the substrate contacts the entire surface of the microchip, enclosing each microwell of the microchip.
(276) 108. The method of any one of embodiments 87-107, wherein each capture probe of the plurality of capture probes comprises a detectable label.
(277) 109. The method of embodiment 108, wherein the detectable label is a fluorescent label.
(278) 110. The method of any one of embodiments 108-109, wherein the identifying step comprises combining a signal from the detectable label and a position within the known spatial arrangement within the microarray to determine an identity of the reporter molecule—capture probe complex bound to the substrate.
(279) 111. The method of any one of embodiments 87-110, further comprising the step of washing the product of (a) to remove unbound RPCs and produce a suspension of cells that comprise a RPC.
(280) 112. The method of any one of embodiments 87-111, wherein the cleavable linker of (a)(2) is photocleavable.
(281) 113. The method of any one of embodiments 87-111, wherein the cleavable linker of (a)(2) is enzyme cleavable.
(282) 114. The method of any one of embodiments 87-113, wherein the microchip is made of polydimethylsiloxane (PDMS).
(283) 115. The method of any one of embodiments 87-115, wherein the visualizing step is performed by microarray scanning.
(284) 116. The method of any one of embodiments 87-116, wherein one or more intracellular targets are low abundance and wherein the method further comprises incubating the suspension of (a) with PCR enzymes and PCR oligonucleotide primers complementary to the nucleic acid reporter molecule of (a)(3) to produce a PCR suspension,
(285) loading onto the microchip the PCR suspension to produce a PCR loaded microchip;
(286) maintaining the PCR loaded microchip under conditions under which the cleavable linkers of the intracellular RPCs in the microwells are cleaved and the reporter molecules are released from the cells to which RPCs are bound to an intracellular target;
(287) amplifying the released nucleic acid reporter molecules of by PCR, thereby producing a plurality of amplification products in each microwell;
(288) contacting the PCR loaded microchip with a substrate bearing a microarray comprising nucleic acid probes complementary to the amplification products.
(289) 117. The method of embodiment 116, wherein the method further comprises contacting the PCT loaded microchip with a substrate comprising a hydrophobic surface and providing conditions under which the amplification products do not interact with the hydrophobic surface prior to contacting the PCR loaded microchip with a substrate bearing a microarray comprising nucleic acid probes complementary to the amplification products.
(290) 118. The method of embodiment 117, further comprising lowering at temperature within each of the microwells prior to contacting the PCT loaded microchip with a substrate comprising a hydrophobic surface.
(291) 119. The method of embodiment 117 or 118, wherein the hydrophobic surface of the substrate is Teflon®.
(292) 120. The method of embodiment 117 or 118, wherein the hydrophobic surface of the substrate of (e) is alkane chain functionalized silicone oxide or metal surfaces.
(293) 121. The method of embodiment 118, wherein the temperature is lowered below 0° C.
(294) 122. The method of embodiment 118, wherein the temperature is lowered below −10° C.
(295) 123. The method of embodiment 118, wherein the temperature is lowered by between about 20° C. and 100° C.
(296) 124. The method of any one of embodiments 118 or 121-123, wherein the temperature is lowered over a time span of 1 millisecond to 5 minutes.
(297) 125. The method of any one of embodiments 118 or 121-123, wherein the temperature is lowered over a time span of 0.5 millisecond to 2 minutes.
(298) 126. The method of any one of embodiments 118 or 121-123, wherein the temperature is lowered over a time span of 1 second to 1 minute.
(299) The following examples are meant to illustrate, but in no way to limit, the claimed invention.
EXAMPLES
Example 1: Materials and Methods
(300) I. Assay procedure (using miRNA detection as an example)
(301) 1. Spin down harvested cells and wash them with DPBS twice 2. Fix cells with paraformaldehyde solution (4% in PBS) inside the tube. Incubate cells for 10 min at 37° C. 3. After 10 min, put the cells on ice for 1 min and then spin them down to remove paraformaldehyde solution 4. Add 90% methanol into the cells and leave them on ice for 30 min. 5. After half an hour, spin down the cells and remove methanol solution. 6. Add blocking buffer (3% BSA+2% NaCl in TET) inside the tube and incubate cells at 37° C. for 1 hour. 7. After an hour, the cells were spin down and blocking buffer was removed. 8. Solution A (T4 DNA ligase inside NEB2A and TET) should be added to the cells 9. Add 1 uL PC linker conjugated micro RNA probe solution (1 ul*100 uM=100 nmole) to 1 mL cell suspension and incubated it at 37° C. for 2 hours. At the same time, the glass slide with DNA probe should be blocked with the Blocking buffer for 2 hours. 1. After 2 hours, cells should be spin down and supernatant was removed. Wash the cells thoroughly with TET six times (incubation step is needed in each washing step). 10. Re-suspend the cells in another 1 mL solution A. Then pipette 200 uL cell suspension onto the PDMS microwells and put the glass slide with flow patterned DNA probes on top of it with surface with DNA facing down. Clamp the glass slide and PDMS microwell slab together. 11. Scan the PDMS microwells trapped with cells using dark field and oblique channel respectively. 12. Flood the device with UV lamp for 900 s (15 min) 13. Put the device into the incubator (37° C.) overnight 14. Remove the device from incubator and then release the glass slide from PDMS microwell slab 15. Wash the glass slide with 5% BSA solution several times 16. Dilute SA-PE 1:100 in 5% BSA and use pipette to add 200 uL onto the glass slide and incubate for 30 min. 17. Wash the glass slide several times and dip it sequentially into DPBS, 50/50 DPBS/water, DI water. Blow dry the slide and detect the signal with Genepix fluorescence scanner.
Example 2: Schematic Depiction of Multiplexed Identification of Intracellular Targets from an Individual Cell
(302)
(303) In this embodiment, the method of multiplexed detection of intracellular targets in an individual cell comprises (a) producing a suspension of fixed, permeabilized cells, (b) incubating cells of (a) with at least two reporter-probe conjugates (RPC) each of which comprises, in the following order: (1) a nucleic acid bait (
(304) The identity of the intracellular target (miRNA 1, 2 or 3) is determined with reference to the position of the complementary nucleic acid on the microarray (A-A′, B-B′ or C-C′), which specifies the target identity. For example, the detection of A-A′ on the microarray indicates the presence of miRNA-1 inside the cell.
Example 3: Schematic Depiction of an Alternative Embodiment of Multiplexed Identification of Intracellular Targets from an Individual Cell
(305)
Example 4: Schematic Depiction of Multiplexed Identification of Low Abundance Targets from an Individual Cell
(306)
Example 5
(307)
(308)
Example 6
(309) Capture probes comprising DNA strands (
Example 7
(310) In this example, approximately 1000 single cells were measured on a microchip. Non-supervised clustering was performed to group the cells.
Example 8
(311) This example demonstrates capture and detection of miR-16-5p from single cells. A log-scale scatter plot shows the fluorescence intensity distribution in zero cell and single cell microwells (
Example 9
(312) This example demonstrates capture and detection of miR-223-3p in single cells. A log-scale scatter plot shows the fluorescence intensity distribution in zero cell and single cell microwells (
Example 10
(313) The standard method of bulk miRNA detection (a pin-spotted microarray) was performed. A series of images depicting a validation of the results shown in
Example 11
(314) The example validates the single cell assay of the disclosure via the standard quantitative PCR (qPCR) assay. THP-1 cells (approximately 1 million cells) were lysed using QIAGEN® RNeasy kit, and miRNAs released from the bulk sample (as described in
Example 12
(315) This example validates the single cell assay of the disclosure for detecting miR16 using fluorescence in situ hybridization (FISH) and a quantification of the fluorescence intensity in each of
(316) TABLE-US-00001 TABLE 1 List of miRNA targets and their sequences 1. miR-146a-5p UGAGAACUGAAUUCCAUGGGUU (SEQ ID NO: 1) 2. miR-145-5p GUCCAGUUUUCCCAGGAAUCCCU (SEQ ID NO: 2) 3. miR-21-5p UAGCUUAUCAGACUGAUGUUGA (SEQ ID NO: 3) 4. miR-16-5p UAGCAGCACGUAAAUAUUGGCG (SEQ ID NO: 4) 5. miR-150-5p UCUCCCAACCCUUGUACCAGUG (SEQ ID NO: 5) 6. miR-142-3p CAUAAAGUAGAAAGCACUACU (SEQ ID NO: 6) 7. miR-155-5p UUAAUGCUAAUCGUGAUAGGGGU (SEQ ID NO: 7) 8. miR-223-3p UGUCAGUUUGUCAAAUACCCCA (SEQ ID NO: 8) 9. miR-424-5p CAGCAGCAAUUCAUGUUUUGAA (SEQ ID NO: 9) 10. miR-28-5p AAGGAGCUCACAGUCUAUUGAG (SEQ ID NO: 10) 11. miR-122-5p UGGAGUGUGACAAUGGUGUUUG (SEQ ID NO: 11) 12. miR-221-3p AGCUACAUUGUCUGCUGGGUUUC (SEQ ID NO: 12)
(317) TABLE-US-00002 TABLE 2 List of DNA reporter (A-M)/miRNA capture sequence (miRNA 1-13) conjugates. 1, miR-146a/A 5′ biotin-AAA AAA AAA AAA ATA CGG ACT TAG CTC CAG GAT AAA AAA-PG Linker- AAA AAA GAT ATA TTT TAA ACC CAT GGA ATT CAG TTG TCA/3InvdT/ (SEQ ID NO: 13) 2, miR-145/B 5′ biotin AAA AAA AAA AAA ATA GGC ATG ATT CAA TGA GGC AAA AAA-PC Linker-AAA AAA GAT ATA TTT TAA GGG ATT CCT GGG AAA ACT GGA C/3InvdT/ (SEQ ID NO: 14) 3, miR-21/C 5′ biotin-AAA AAA AAA AAA GCG ATA GTA GAC GAG TGC AAA AAA-PC Linker-AAA AAA GAT ATA TTT TAT CAA CAT CAG TCT GAT AAG CTA/3InvdT/ (SEQ ID NO: 15) 4, hsa-miR-16-5p/D 5′ biotin AAA AAA AAA AAA ATA CTC TGA CAT CTC GAC CAT AAA AAA-PC Linker-AAA AAA CGCCAATATTTACGTGCTGCTA/3InvdT/ (SEQ ID NO: 16) 5, hsa-miR-150-5p/E 5′ biotin AAA AAA AAA AAA ATA GAT ACT GCC ACT TCA CAT AAA AAA-PC Linker-AAA AAA ACTGGTACAAGGGTTGGGAGA/3InvdT/ (SEQ ID NO: 17) 6, hsa-miR-142-3p/F 5′ biotin AAA AAA AAA AAA ATA CCG TGA ACC TTA CCT GAT AAA AAA-PC Linker-AAA AAA TCCATAAAGTAGGAAACACTACA/3InvdT/ (SEQ ID NO: 18) 7, hsa-miR-155-5p/G 5′ biotin AAA AAA AAA AAA TGC TCG GGA AGG CTA CTC AAA AAA-PC Linker-AAA AAA CCTATCACGATTAGCATTA/3InvdT/ (SEQ ID NO: 19) 8, hsa-miR-223-3p/H 5′ biotin AAA AAA AAA AAA ACG CAC CGC AGT TTG GTC AAT AAA AAA-PC Linker-AAA AAA TGGGGTATTTGACAAACTGACA/3InvdT/ (SEQ ID NO: 20) 9, hsa-miR-424-5p/I 5′ biotin AAA AAA AAA AAA ATC CGA CGC AAC AAT AGG GCA AAA AAA-PC Linker- AAA AAA TTCAAAACATGAATTGCTGCT/3InvdT/ (SEQ lD NO: 21) 10, hsa-miR-28-5p/J 5′ biotin AAA AAA AAA AAA ACC TGC TCG ACA ACT AGA AGA AAA AAA-PC Linker-AAA AAA TCA ATA GAC TGT GAG CTC CT/3InvdT/ (SEQ ID NO: 22) 11, hsa-miR-122-5p/K 5′ biotin AAA AAA AAA AAA ACC GCG ACC AGA ATT AGA TTA AAA AAA-PC Linker-AAA AAA AAACACCATTGTCACACTCCA/3InvdT/ (SEQ ID NO: 23) 12, hsa-miR-221-3p/L 5′ biotin AAA AAA AAA AAA AGC CGA AGC AGA CTT AAT CAC AAA AAA-PC Linker-AAA AAA GAT ATA TTT TAG AAA CCC AGC AGA CAA TGT AGC T/3InvdT/ (SEQ ID NO: 24) 13, Control: miSpike/M 5′ biotin AAA AAA AAA AAA AAC AGG TTG AGA ATC CTC GAC AAA AAA-PC Linker-AAA AAA GAT ATA TTT TAA GAC CGC TCC GCC ATC CTG AG/3InvdT (SEQ ID NO: 25)
(318) TABLE-US-00003 TABLE 3 List of capture DNA probes and their sequences. A′.fwdarw.1: miR-146a (SEQ ID NO: 26) 5′-AAA AAA AAA AAA AAT CCT GGA GCT AAG TCC GTA-3′ B′.fwdarw.2: miR-145 (SEQ ID NO: 27) 5′-AAA AAA AAA AAA AGC CTC ATT GAA TCA TGC CTA-3′ C′.fwdarw.3: miR-21 (SEQ ID NO: 28) 5′-AAA AAA AAA AAA AGC ACT CGT CTA CTA TCG CTA-3′ D′.fwdarw.4: miR-16 (SEQ ID NO: 29) 5′-AAA AAA AAA AAA AAT GGT CGA GAT GTC AGA GTA-3′ E′.fwdarw.5: miR-150 (SEQ ID NO: 30) 5′-AAA AAA AAA AAA AAT GTG AAG TGG CAG TAT CTA-3′ F′.fwdarw.6: miR-142 (SEQ ID NO: 31) 5′-AAA AAA AAA AAA AAT CAG GTA AGG TTC ACG GTA-3′ G′.fwdarw.7: miR-155 (SEQ ID NO: 32) 5′-AAA AAA AAA AGA GTA GCC TTC CCG AGC ATT-3′ H′.fwdarw.8: miR-223 (SEQ ID NO: 33) 5′-AAA AAA AAA AAT TGA CCA AAC TGC GGT GCG-3′ I′.fwdarw.9: miR-424 (SEQ ID NO: 34) 5′-AAA AAA AAA ATG CCC TAT TGT TGC GTC GGA-3′ J′.fwdarw.10: miR-28 (SEQ ID NO: 35) 5′-AAA AAA AAA ATC TTC TAG TTG TCG AGC AGG-3′ K′.fwdarw.11: miR-122 (SEQ ID NO: 36) 5′-AAA AAA AAA ATA ATC TAA TTC TGG TCG CGG-3′ L′.fwdarw.12: miR-221 (SEQ ID NO: 37) 5′-AAA AAA AAA AGT GAT TAA GTC TGC TTC GGC-3′ M′.fwdarw.13: Control/miSpike (SEQ ID NO: 38) 5′-Cy3-AAA AAA AAA AGT CGA GGA TTC TGA ACC TGT-3′