High cAMP yielding yeast strain and use thereof

Abstract

Provided is a yeast strain capable of excessively synthesizing cAMP and its construction method and fermentation technique thereof, and application in the field of medicine, animal husbandry, food or chemical industry. The yeast strain includes first and second gene modifications, wherein the first gene includes protein kinase A (PKA) catalytic subunit encoding genes TPK1, TPK2 and TPK3, by modifying the first gene, the activity or expression of PKA is completely inhibited, so that feedback inhibition to cyclic adenosine monophosphate (cAMP) is eliminated, but at the same time, the growth of the yeast is inhibited; and the second gene modification eliminates growth inhibition caused by the first gene modification, so that the yeast grows normally, and the cAMP yield by the yeast is increased, wherein the increase of the cAMP yield is relative to the cAMP yield by an unmodified yeast. The yeast strain further includes third and/or fourth gene modifications. The recombinant yeast strain of the present invention can stably, continuously and efficiently produce extracellular cAMP by up to 9721.6 μmol/L.

Claims

1. A yeast for cyclic adenosine monophosphate (cAMP) synthesis, wherein the yeast includes: a) first gene modifications to the protein kinase A (PKA) catalytic subunit encoding genes TPK1, TPK2 and TPK3, wherein the activity or expression of PKA is completely inhibited such that PKA-mediated feedback inhibition of cAMP synthesis is eliminated, wherein the first gene modifications inhibit the growth of the yeast; b) a second gene modification to the Yak1 encoding gene thereby eliminating the growth inhibition caused by the first gene modifications such that the yeast grows normally and the cAMP yield by the yeast is increased relative to the cAMP yield by an unmodified yeast; c) a third gene modification to the cAMP phosphodiesterase encoding gene PDE1 to reduce the degradation of cAMP, thereby increasing cAMP yield; and wherein the yeast does not contain a functional ura3 gene.

2. The yeast according to claim 1, wherein the activity or expression of the Yak1 is completely inhibited.

3. The yeast according to claim 2, wherein the Yak1 gene is deleted.

4. The yeast according to claim 1, wherein the activity or expression of the PDE1 is completely inhibited.

5. The yeast according to claim 4, wherein the PDE1 gene is deleted.

6. The yeast according to claim 1, wherein the PKA encoding genes TPK1, TPK2 and TPK3 are deleted.

7. The yeast according to claim 1, wherein the yeast further comprises a fourth gene modification to enhance the positive regulation of synthesis of a cAMP precursor in a purine synthesis pathway, so that the synthesis of the cAMP precursor increases, thereby increasing the cAMP yield.

8. The yeast according to claim 7, wherein the fourth gene comprises transcription factor Bas1 and Bas2 encoding genes.

9. The yeast according to claim 8, wherein the gene modification increases the expression of the Bas1/Bas2 complex.

10. The yeast according to claim 7, wherein the fourth gene modification comprises point mutation, ligation of a strong promoter, ligation of an enhancer, increase of a copy number, or fusion co-expression.

11. The yeast according to claim 1, wherein the yeast is Saccharomyces cerevisiae.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a schematic diagram of the plasmid according to Example 1, wherein FIG. 1A is the plasmid pUC18-URA3, and FIG. 1B is the plasmid pUC18-TPK2p-TPK2t-URA3-TPK2t.

(2) FIG. 2 is a preliminary evaluation of cAMP production of 5 gene deletion strains according to example 5.

(3) FIG. 3 is a schematic diagram of the plasmid pUC18-H1.sub.YNRCΔ9-BAS1-BAS2-H2.sub.YNRCΔ9-URA3-H2.sub.YNRCΔ according to example 6.

DETAILED DESCRIPTION

(4) The technical solution of the present invention will be further described below in conjunction with specific examples. It is understood that the specific implementations described herein are shown by way of examples, and are not intended to limit the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The main features of the present invention can be applied to various implementations without departing from the scope of the invention. Those skilled in the art will recognize or be able to recognize that many equivalents can be used in the specific steps described herein by only using normal experiments. These equivalents are considered to be within the scope of the invention and are covered by the claims.

(5) Several media involved in the examples are as follows:

(6) 1) Medium YPAD for Yeast Strain Activation and Seed Broth Preparation

(7) Yeast extract 10 g/L, peptone 20 g/L, glucose 20 g/L, and adenine 0.05 g/L, natural pH; agar powder 15 g/L is added in a case of solid media.

(8) 2) Transformation Screening Medium CMG-URA when Using Uracil (URA) Auxotrophic Selectable Marker

(9) Screening was performed using a uracil-free minimal medium CMG plate, CMG.sup.−URA plate for short. The components are as follows: amino acid-base mixture, 0.83 g/L; amino acid-free yeast nitrogen base, YNB for short, 6.7 g/L; glucose, 20 g/L; and agar powder, 15 g/L. The amino acid-base mixture therein is shown in Table 1.

(10) TABLE-US-00001 TABLE 1 Components of amino acid - base mixture Adenine 50 mg/L Leucine 100 mg/L Arginine 20 mg/L Lysine 30 mg/L Aspartic acid 100 mg/L Methionine 20 mg/L Glutamic acid 100 mg/L Phenylalanine 50 mg/L Histidine 100 mg/L Serine 150 mg/L Isoleucine 30 mg/L Threonine 15 0 mg/L Tryptophan 100 mg/L Tyrosine 30 mg/L Uracil 50 mg/L Valine 150 mg/L

(11) Note: A selective medium can be made by eliminating specific amino acid components. The pH was adjusted to 5.6, the glucose was sterilized at 110° C. for 15 min, the other components were sterilized at 121° C. for 21 min, and all the components were mixed before use.

(12) 3) 5′-FOA Plate (5′-Fluoroorotic Acid Plate)

(13) The preparation method is as follows:

(14) a. 100 ml of 5′-FOA solution was prepared, including:

(15) YNB w/o AA: 1.4 g dropout powder: 0.17 g 5′-FOA: 0.2 g

(16) Uracil: 20 mg Adenine: 10 mg Leucine: 40 mg

(17) Histidine: 30 mg Tryptophan: 20 mg Glucose: 4 g

(18) All the components were dissolved by continuous stirring at 45° C. with a magnetic stirrer, followed by filtration sterilization;

(19) b. 100 ml of agar powder Agar solution was prepared to a final concentration of 3.0%, sterilized at 121° C. for 15 min, and then cooled to 45° C.; and

(20) c. 100 ml of 5′-FOA was uniformly mixed with 100 ml of Agar solution to prevent air bubbles from forming, and the mixture was poured into a sterile Petri dish, and cooled to form.

(21) 4) LB Medium for E. coli Culture

(22) Yeast extract 5 g/L, peptone 10 g/L, and sodium chloride (NaCl) 10 g/L, pH adjusted to 7.0; agar powder 15 g/L is added in a case of solid media. Antibiotics are added as needed, and the final concentration of ampicillin is 100 μg/mL.

(23) The primer sequences involved in the examples are shown in Table 2.

(24) TABLE-US-00002 TABLE 2 Primer sequences used in the examples Sequence (5′.fwdarw.3′) and Sequence No. Name Added Restriction Enzyme Cutting Sites SEQ ID No. 1 P1 CCCGGGGGATCCTTGATICGGIAATCTCCGAA (BamHI) SEQ ID No. 2 P2 CCCGGGGTCGACCTGAFATAATTAAATTGAAGCT (SalI) SEQ ID No. 3 P3 SEQ ID No. 4 P4 SEQ ID No. 5 P5 CCCGGGGAGCTCTCAATTTGGTTGTAAGCAAC (SacI) SEQ ID No. 6 P6 CCCGGGGGTACCCGACAATTTTCAACAGTATG (KpnI) SEQ ID No. 7 P7 CCTCAAGATAAACCAGCTGG SEQ ID No. 8 P8 ATAATGGTGATATCAGCACC SEQ ID No. 9 P9 SEQ ID No. 10 P10 SEQ ID No. 11 P11 CCCGGGGAGCTCCTCCGTTAATCCTAGTCTGT (SacI) SEQ ID No. 12 P12 CCCGGGGGTACCTTCTGTGCTACCTTTGAAGC (KpnI) SEQ ID No. 13 P13 ATCCCTCCCATCCTCCTTAA SEQ ID No. 14 P14 GAAGGAGCCGCAGCATTATT SEQ ID No. 15 P15 SEQ ID No. 16 P16 SEQ ID No. 17 P17 CCCGGGGAGCTCGTCAACGTTTCAGATACTCT (SacI) SEQ ID No. 18 P18 CCCGGGGGTACCTTTGTGCAGGCTCGCTCTTT (KpnI) SEQ ID No. 19 P19 GCGACTATGCATTTTTGCAAA SEQ ID No. 20 P20 CGGAGCCTTCATGAGATAAA SEQ ID No. 21 P21 SEQ ID No. 22 P22 SEQ ID No. 23 P23 CCCGGGGAGCTCCTTTCGCCCTCAAACTCAAC (SacI) SEQ ID No. 24 P24 CCCGGGGGTACCATGTTCCCITGCACAATGGC (KPnI) SEQ ID No. 25 P25 CAATACGGATGAATATTTGTG SEQ ID No. 26 P26 ACTTTTGATTGCGCTGTGAA SEQ ID No. 27 P27 SEQ ID No. 28 P28 0 SEQ ID No. 29 P29 CCCGGGGAGCTCCAGACATATAGTCTCGAAGA (SacI) SEQ ID No. 30 P30 CCCGGGGGTACCCCTCGTTAAAAGCCACTTTC (KpnI) SEQ ID No. 31 P31 AATCTTACTTTGGCGAATG SEQ ID No. 32 P32 ACACTATTTCCTTGTTCATAC SEQ ID No. 33 P33 GCGCGCGAATTCCGTATTGACCATTCCTAA (EcoRI) SEQ ID No. 34 P34 TCGACTCCCGGGTACCGAGCTCTATCGTATCGCAGCCTA (SacI) SEQ ID No. 35 P35 GCTCGGTACCCGGGAGTCGACTGTAGACCTAAGTTCAT (SalI) SEQ ID No. 36 P36 ATATTAGGATCCGCCTTGCTTACCTAGATG (BamHI) SEQ ID No. 37 P37 GCGTTAGGATCCGATTCGGTAATCTCCG (BamHI) SEQ ID No. 38 P38 AGGTCTACAGGGGTAATAACTGATAT SEQ ID No. 39 P39 GTTATTACCCCTGTAGACCTAAGTTCAT SEQ ID No. 40 P40 CGTACGAAGCTTGCCTTGCTTACCTAGATG (HindIII) SEQ ID No. 41 P41 GGGCCCGAGCTCTCTTTAGCCGTAATTGCGAA (SacI) SEQ ID No. 42 P42 GTACGAGAATTCTTCCATCATGGATGTAGTCCTTGATATCTC SEQ ID No. 43 P43 ATGATGGAAGAATTCTCGTAC SEQ ID No. 44 P44 GGGCCCGTCGACTCATATCCATCTATGCTCGTC (SalI) SEQ ID No. 45 P45 TCAACTTTGGGATTACTGC SEQ ID No. 46 P46 CTCATCATTTGCGTCATCT

(25) In the examples, the S. cerevisiae strain W303-1A (=ATCC208352) is commercially available from ATCC, USA. YCplac33 is available from Invitrogen. pUC18 is available from companies such as Invitrogen and Promega.

Example 1: Construction of TPK2 Gene-Deleted Yeast Strain

(26) Using the homologous recombination double-exchange mechanism to delete the TPK2 gene on the yeast chromosome, the plasmid pUC18-TPK2p-TPK2t-UR43-TPK2t for deletion was firstly constructed. This plasmid was digested to be linearized and transformed into yeast competent cells, and URA3 was used as a selectable marker gene for screening to obtain the yeast strain tpk2Δ::URA3 obtained by double-exchange using TPK2p and TPK2t downstream of URA3 as the left and right homology arms, respectively; and the 5′-FOA plate was used for screening to obtain the yeast strain tpk2Δ in which the URA3 gene was ejected due to the recombination between two TPK2t sequences on the left and right sides of the URA3 in the tpk2Δ::URA3 chromosome.

(27) The primers for construction and identification are shown in Table 2, and the schematic diagram is shown in FIG. 1.

(28) I. Construction of pUC18-TPK2p-TPK2t-URA3-TPK2t

(29) The construction of this plasmid involves four ligations:

(30) (1) Construction of pUC18-URA3

(31) The URA3 gene was amplified by PCR using plasmid YCplac33 as a template, the sequences shown in SEQ ID No. 1 and SEQ ID No. 2 in Table 2 were used as the forward and reverse primers P1 and P2, and the Fast Pfu polymerase produced by TransGen was used. The condition was annealed at 50° C. for 1 min and extended at 72° C. for 1.5 min for a total of 32 cycles to obtain a 1055 bp PCR fragment. This fragment and the vector plasmid pUC18 were digested by restriction enzymes BamHI and SalI, ligated by a T4 DNA ligase and transformed into E. coli Top 10 competent cells. The transformant plasmid was extracted and identified by restriction enzyme analysis to prove to obtain the target plasmid pUC18-BamHI-URA3-SalI (abbreviated as pUC18-URA3, see FIG. 1A).

(32) (2) Construction of pUC18-TPK2t-URA3

(33) The strain W303-1A chromosome was extracted and used as a template to amplify the terminator region of TPK2 gene (abbreviated as TPK2t) by PCR method. The sequences shown in SEQ ID No. 3 and SEQ ID No. 4 in Table 2 were used as the forward and reverse primers P3 and P4, the Fast Pfu polymerase produced by TransGen was used, and the condition was annealed at 50° C. for 1 min and extended at 72° C. for 0.5 min for a total of 32 cycles to obtain a 526 bp PCR fragment. This fragment and the vector plasmid pUC18-URA3 were digested by restriction enzymes KpnI and BamHI, ligated by a T4 DNA ligase and transformed into E. coli Top 10 competent cells. The transformant plasmid was extracted and identified by restriction enzyme analysis to prove to obtain the target plasmid pUC18-TPK2t-URA3.

(34) (3) Construction of pUC18-TPK2p-TPK2t-URA3

(35) The strain W303-1A chromosome was extracted and used as a template to amplify the promoter region of TPK2 gene (abbreviated as TPK2p). The sequences shown in SEQ ID No. 5 and SEQ ID No. 6 in Table 2 were used as the forward and reverse primers P5 and P6, the Fast Pfu polymerase produced by TransGen was used and the condition was annealed at 50° C. for 1 min and extended at 72° C. for 0.5 min for a total of 32 cycles to obtain a 532 bp PCR fragment. This fragment and the vector plasmid pUC18-TPK2t-URA3 were digested by restriction enzymes Sac I and Kpn I, ligated by a T4 DNA ligase and transformed into E. coli Top 10 competent cells. The transformant plasmid was extracted and identified by restriction enzyme analysis to prove to obtain the target plasmid pUC18-TPK2p-TPK2t-URA3.

(36) (4) Construction of pUC18-TPK2p-TPK2t-URA3-TPK2t

(37) The PCR product containing the TPK2t sequence amplified in the above (2) was digested with Sal I and Pst I, and ligated with the same double-digested pUC18-TPK2p-TPK2t-URA3 large fragment to obtain the plasmid pUC18-TPK2p-TPK2t-URA3-TPK2t (see FIG. 1B).

(38) II. Construction of W303-1A (tpk2Δ) Strain

(39) The plasmid pUC18-TPK2p-TPK2t-URA3-TPK2t was digested with Sac I and Pst I to obtain a linearized DNA fragment TPK2p-TPK2t-URA3-TPK2t; and W303-1A strain competent cells were transformed with this linearized fragment by a lithium acetate method, a uracil auxotrophic selectable marker (URA3) was used for screening, that is, a CMG.sup.−URA plate was used for screening, the obtained transformant strain was cultivated into YPAD liquid culture, and the chromosome DNA was extracted and used as a template to carry out PCR identification, where the primer pair was forward and reverse primers P7 and P8 of which the sequences are shown in SEQ ID No. 7 and SEQ ID No. 8 in Table 2, the predicted PCR product from successfully integrated URA3-gene-containing transformant was 2592 bp long, and the control strain PCR product was 2299 bp long. The positive transformant strain was named W303-1A (tpk2Δ::URA3).

(40) The cells grown on the strain W303-1A (tpk2Δ::URA3) plate were further spreaded on a 5′-FOA plate, thereby screening out a colony in which the URA3 fragment was ejected by homologous recombination between two identical sequences (TPK2t) integrated on the chromosome. The same primer pair P7 and P8 was used to verify that the PCR product of the target strain in which the URA3 was successfully ejected was 1053 bp long, and the PCR fragment of the host strain W303-1A (tpk2Δ::URA3) in which the URA3 was not ejected was 2592 bp long. The 1053 bp PCR product was sequenced and the sequencing results confirmed that the expected changes occurred: 2 bases before the initiation codon of the TPK2 gene, the entire ORF region, and 107 bases after the stop codon were completely deleted. Thus, the positive transformant strain W303-1A(tpk2Δ) in which the TPK2 gene was deleted and the URA3 gene was ejected was finally obtained.

Example 2: Construction of TPK1 or TPK3 Gene-Deleted Yeast Strain

(41) 1. Construction of W303-1A (tpk1Δ)

(42) Construction of the plasmid pUC18-TPK1p-TPK1t-URA3-TPK1t for TPK1 gene deletion: the plasmid pUC18-TPK1p-TPK1t-URA3-TPK1t was constructed based on the (1) pUC18-URA3 plasmid in Example 1 by a process identical to the process for obtaining pUC18-TPK2p-TPK2t-URA3-TPK2t by steps (2), (3) and (4) in Example 1. When the primer pair forward and reverse primers P9 and P10 of which the sequences are shown in SEQ ID No. 9 and SEQ ID No. 10 in Table 2 were used to amplify TPK1t, the product was 516 bp long; and when the primer pair forward and reverse primers P11 and P12 of which the sequences are shown in SEQ ID No. 11 and SEQ ID No. 12 in Table 2 were used for amplifying TPK1p, the product was 572 bp long.

(43) The plasmid pUC18-TPK1p-TPK1 t-URA3-TPK1t was digested with Sac I and Psi I to obtain a linearized DNA fragment TPK1p-TPK1t-URA3-TPK1t; and the W303-1A strain competent cells were transformed, a uracil (URA) auxotrophic selectable marker was used for screening, that is, a CMG.sup.−URA plate was used for screening, and the obtained transformant strain was further cultivated and the chromosome was extracted as a template for PCR identification, where the primer pair was forward and reverse primers P13 and P14 of which the sequences are shown in SEQ ID No. 13 and SEQ ID No. 14 in Table 2, the successfully integrated transformant PCR product was 2631 bp long, and the control strain PCR product was 2476 bp long. The positive transformant strain was named W303-1A(tpk1Δ::URA3).

(44) The cells grown on the strain W303-1A(tpk1Δ::UR3) plate were further spreaded on a 5′-FOA plate, thereby screening out a colony in which the URA3 fragment was ejected by homologous recombination between two identical sequences (TPK1t) integrated on the chromosome. The same primer pair P13 and P14 was used to verify that the PCR product of the target strain in which the URA3 was successfully ejected was 1102 bp long, and the control PCR fragment in which the (URA3 was not ejected was 2631 bp long. The 1102 bp PCR product was sequenced and the sequencing results confirmed that the expected changes occurred: the 70 bases before the initiation codon of the TPK1 gene, the entire ORF region, and 116 bases after the stop codon were completely deleted. Thus, the positive transformant strain W303-1A (tpk1Δ) in which the TPK1 gene was deleted and the URA3 gene was ejected was finally obtained.

(45) II. Construction of W303-1A (tpk3Δ)

(46) Construction of plasmid for TPK3 gene deletion: the plasmid pUC18-TPK3p-TPK3t-URA3-TPK3t was constructed based on the (1) pUC18-URA3 plasmid in Example 1 by a process identical to the process for obtaining pUC18-TPK2p-TPK2t-URA3-TPK2t by steps (2), (3) and (4) in Example 1. When the primer pair forward and reverse primers P15 and P16 of which the sequences are shown in SEQ ID No. 15 and SEQ ID No. 16 in Table 2 was used to amplify TPK3t, the product was 566 bp long; and when the primer pair forward and reverse primers P17 and P18 of which the sequences are shown in SEQ ID No. 17 and SEQ ID No. 18 in Table 2 was used to amplify TPK3p, the product was 545 bp long.

(47) The plasmid pUC18-TPK3p-TPK3t-URA3-TPK3t was digested with Sac I and Pst I to obtain a linearized DNA fragment TPK3p-TPK3t-URA3-TPK3t; and the W303-1A strain competent cells were transformed, and screening and identification were carried out by the method identical to “construction of W303-1A (tpk2Δ))” in Example 1 to obtain the W303-1A (tpk3Δ::URA3) strain and W303-1A (tpk3Δ) strain. The primer pair used in the PCR identification was forward and reverse primers P19 and P20 of which the sequences are shown in SEQ ID No. 19 and SEQ ID No. 20 in Table 2, the successfully integrated URA3-gene-containing transformant PCR product was 2695 bp long, the successfully integrated transformant PCR product in which the URA3 gene was ejected was 1116 bp long, and the control strain PCR product was 2400 bp long. The 1116 bp PCR product was sequenced and the sequencing results confirmed that the expected changes occurred: the entire ORF region of TPK3 gene and 93 bases after the stop codon were completely deleted. Thus, the positive transformant strain W303-1A (tpk3Δ) in which the TPK3 gene was deleted and the UR43 gene was ejected was finally obtained.

Example 3: Construction of YAK1 Gene-Deleted Yeast Strain

(48) Construction of plasmid for YAK1 gene deletion: the plasmid pUC18-YAK1p-YAK1t-URA3-YAK1t was constructed based on the (1) pUC18-URA3 plasmid in Example 1 by a process identical to the process for obtaining pUC18-TPK1p-TPK1t-URA3-TPK1t by steps (2), (3) and (4) in Example 1. When the primer pair forward and reverse primers P21 and P22 of which the sequences are shown in SEQ ID No. 21 and SEQ ID No. 22 in Table 2 was used to amplify YAK1t, the product was 506 bp long; and when the primer pair forward and reverse primers P23 and P24 of which the sequences are shown in SEQ ID No. 23 and SEQ ID No. 24 in Table 2 was used to amplify YAK p, the product was 504 bp long.

(49) Construction of YAK1 gene-deleted strain: the plasmid pUC18-YAK1p-YAK1t-URA3-YAK1t was digested with Sac I and Pst I to obtain a linearized DNA fragment YAK1p-YAK1t-URA3-YAK1t; and the W303-1A strain competent cells were transformed, and screening and identification were carried out by the method identical to “construction of W303-1A (tpk2Δ)” in Example 1 to obtain the W303-1A (yak1Δ::URA3) strain and W303-1A (yak1Δ) strain. The primer pair used in the PCR identification was forward and reverse primers P25 and P26 of which the sequences are shown in SEQ ID No. 25 and SEQ ID No. 26 in Table 2, the successfully integrated URA3-gene-containing transformant PCR product was 2529 bp long, the successfully integrated transformant PCR product in which the URA3 gene was ejected was 1010 bp long, and the control strain PCR product was 3614 bp long. The 1010 bp PCR product was sequenced and the sequencing results confirmed that the expected changes occurred: the 40 bases before the initiation codon of the TPK1 gene, the entire ORF region, and 146 bases after the stop codon were completely deleted. Thus, the positive transformant strain W303-1A (yak1Δ) in which the YAK1 gene was deleted and the URA3 gene was ejected was finally obtained.

Example 4: Construction of Yeast Strain in which TPK1, TPK2, TPK3 and YAK1 Genes are Deleted Simultaneously

(50) The following four steps were performed to obtain a strain in which four genes were simultaneously deleted. In fact, it is known to those skilled in the art that except for the inactivation of a combination of TPK1, TPK2 and TPK3 in a haploid yeast cell (this combination cannot survive due to growth defect), the above-mentioned four genes may be modified in any order and in any combination.

(51) 1. Deletion of YAK1 Gene

(52) The W303-1A (yak1Δ) strain was constructed by the same method as in Example 3.

(53) II. Deletion of YAK1 and TPK1 Genes

(54) The plasmid pUC18-TPK1p-TPK1t-URA3-TPK1t for deletion constructed in Example 2 was digested with Sac I and Pst I to obtain a linearized DNA fragment TPK1p-TPK1t-URA3-TPK1t; and the W303-1A (yak1Δ) strain competent cells in step 1 were transformed, a uracil (URA) auxotrophic selectable marker was used for screening, that is, a CMG.sup.−URA plate was used for screening, the obtained transformant strain was identified by the method identical to that in Example 2 to obtain the TPK1-deleted W303-1A (yak1Δ) (tpk1Δ::URA3), and further reverse screening was carried out to obtain the W303-1A (yak1Δ) (tpk1Δ).

(55) III. Deletion of TPK2 and TPK3 Genes

(56) The W303-1A was subjected to mating type transformation to obtain the W303-1B strain MATα leu2-3,112 ura3-1 trp1-92 his3-11,15 ade2-1 can1-100) having the identical genotype as the W303-1A strain other than mating type, and by using the W303-1B as the host, the two genes TPK2 and TPK3 were sequentially knocked out.

(57) The plasmid pUC18-TPK2p-TPK2t-URA3-TPK2t constructed in Example 1 was digested with Sac I and Pst I to obtain a linearized DNA fragment TPK2p-TPK2t-URA3-TPK2t; and the W303-1B strain competent cells were transformed, and screening and identification were carried out by the method identical to “construction of W303-1A (tpk2Δ)” in Example 1 to obtain the W303-1B (tpk2Δ::URA3) and W303-1B (tpk2Δ) strain.

(58) The plasmid pUC18-TPK3p-TPK3t-UR43-TPK3t constructed in Example 2 was digested with Sac I and Pst I to obtain a linearized DNA fragment TPK3p-TPK3t-URA3-TPK3t; and the W303-1B (tpk2Δ) strain competent cells were transformed, and screening and identification were carried out by the method identical to “construction of W303-1A (tpk2Δ)” in Example 1 to obtain the W303-1B (tpk2Δ tpk3Δ::URA3) strain and W303-1B (tpk2Δ tpk3Δ) strain.

(59) IV. Simultaneous Deletion of TPK1, TPK2, TPK3 and YAK1 Genes

(60) The W303-1A (tpk1A yak1Δ) strain was crossed with the W303-1B (tpk2Δ tpk3Δ) strain to obtain a diploid strain, then the alleles were isolated by spore production and spore isolation, and screening and identification were carried out to obtain the W303-1A (tpk1A tpk2Δ tpk3A yak1Δ) and W303-1B (tpk1A tpk2Δ tpk3A yak1Δ). Primers for the identification of four gene knockouts were the same as before. The sequencing results of the identified PCR products confirmed that the four gene nucleic acid sequences on the chromosomes of the two strains had the expected changes, and the ORF regions of both were deleted.

(61) V. Evaluation on Growth and Fermentation Production of Extracellular cAMP of Four-Gene-Deleted Strain

(62) The four-gene-deleted strain was subjected to evaluation on growth and fermentation production of extracellular cAMP, and the operations are as follows:

(63) 1. Seed cultivation: the colony grown on the YPAD plate was picked and inoculated into a test tube containing 5 mL of YPAD medium, and cultured at 30° C., 220 rpm overnight, and if necessary, subjected to secondary inoculation and cultivation;

(64) 2. Fermentation: fermentation medium: yeast extract 10 g/L, peptone 20 g/L, and glucose 20 g/L, natural pH; the fresh seed solution was inoculated into a 100 ml flask containing 25 ml of fermentation medium, and fermented at 30° C., 220 rpm while controlling the initial OD600 value at 0.1 or so;

(65) 3. Detection of OD600 of fermentation broth: OD600 was determined to detect growth after the fermentation sample was properly diluted;

(66) 4. HPLC analysis of cAMP concentration in fermentation supernatant, i.e., extracellular cAMP concentration: the method for HPLC analysis of cAMP was adjusted according to the method of the Pharmacopoeia of the People's Republic of China: 2010 Edition (edited by the National Pharmacopoeia Commission) on page 419. The specific operations are as follows: 1) the fermentation sample was centrifuged at 13000 rpm for 1 min, the supernatant was properly diluted and filtered with a filter membrane with a pore size of 0.22 μm, and the filtrate was used for chromatographic detection: detection wavelength 258 nm, Thermo Syncronis C18 Column, mobile phase (5.78 g/L KH2PO4, 2.72 g/L tetrabutylammonium bromide): acetonitrile=85:15 ( ), pH adjusted to 4.3 with phosphoric acid, flow rate 1 mL/min, column temperature 35° C.; 2) preparation of cAMP standard sample and determination of standard curve: a cAMP standard sample was prepared into a 50 mmol/L with sterilized deionized water, and then diluted with deionized water to obtain the standard samples with final concentrations of 1, 3, 5, 7.5 and 10 μmol/L, the standard samples were filtered through a 0.2 μm filter membrane and subjected to HPLC analysis, and a peak area-cAMP concentration standard curve was made; and 3) the cAMP concentration in the fermentation broth sample was calculated by the external standard method using the standard curve.

(67) The results of evaluation on growth and fermentation production of extracellular cAMP within 96 h are shown in Table 3.

(68) TABLE-US-00003 TABLE 3 Evaluation on growth and cAMP production of four-gene-deleted strains Maximum Extracellular Maximum cAMP Concentration Strain Name OD.sub.600 (μmol/L) W303-1A 21.1 (48 h)  1.39 (60 h) W303-1A(tpk1Δ tpk2Δ 35.0 (48 h) 200.2 (24 h) tpk3Δ yak1Δ) W303-1B(tpk1Δ tpk2Δ 33.5 (48 h) 215.6 (24 h) tpk3Δ yak1Δ)

(69) As can be seen from Table 3, the maximum extracellular cAMP concentration by the two deleted strains were 144.0 and 155.1 times the maximum extracellular cAMP concentration by the control strain W303-1A, respectively. It should be noted that the cAMP concentration by the two deleted strains increased rapidly within 0-24 hand decreased slightly after reaching the maximum value at 24h, but remained above 180 μmol/L or above until 96h.

Example 5: Construction of Yeast Strain in which TPK1, TPK2, TPK3, YAK1 and PDE1 Genes are Deleted Simultaneously

(70) I. Deletion of PDE1 Gene

(71) PCR was carried out by using the W303-1A chromosome as a template to amplify the terminator region of PDE1 gene (abbreviated as PDE1t). The forward and reverse primers P27 and P28 of which the sequences are shown in SEQ ID No. 27 and SEQ ID No. 28 in Table 2, and Fast Pfu polymerase produced by TransGen were used, the condition was annealed at 50° C. for 1 min and extended at 72° C. for 0.5 min for a total of 32 cycles to obtain a 500 bp PCR fragment. This fragment and the vector plasmid pUC18-URA3 were digested by restriction enzymes KpnI and BamHI, ligated with a T4 DNA ligase and then E. coli Top 10 competent cells were transformed. The transformant plasmid was extracted for restriction enzyme analysis and proved to obtain the target plasmid pUC18-PDE1t-URA3.

(72) PCR was carried out by using the W303-1A chromosome as a template to amplify the promoter region of PDE1 gene (abbreviated as PDE1p). The forward and reverse primers P29 and P30 of which the sequences are shown in SEQ ID No. 29 and SEQ ID No. 30 in Table 2, and Fast Pfu polymerase produced by TransGen were used. PCR was annealed at 50° C. for 1 min and extended at 72° C. for 0.5 min for a total of 32 cycles to obtain a 544 bp PCR fragment. This fragment and the vector plasmid pUC18-PDE1t-URA3 were digested by restriction enzymes Sac I and Kpn I and ligated with a T4 DNA ligase, then E. coli Top 10 competent cells were transformed. The transformant plasmid was extracted for restriction enzyme analysis and proved to obtain the plasmid pUC18-PDE1p-PDE1t-URA3.

(73) The above amplified PCR product containing the PDE1t sequence was digested with Sal I and Pst I, and ligated with the same double-digested pUC18-PDE1p-PDE1t-URA3 large fragment to obtain the plasmid pUC18-PDE1p-PDE1t-URA3-PDE 1t.

(74) The plasmid pUC18-PDE1p-PDE1t-URA3-PDE It was digested with double enzymes Sac I and Pst I, and the W303-1A (tpk1Δ tpk2Δ tpk3Δ yak1Δ) constructed in Example 4 was used as a host to construct the W303-1A (tpk1Δ tpk2Δ tpk3Δ yak1Δ pde1Δ::URA3) and W303-1A (tpk1Δ tpk2Δ tpk3Δ yak1Δ pde1Δ) by using the method identical to that in “construction of W303-1A (tpk2Δ) strain” in Example 1. The primer pair used in the PCR identification was forward and reverse primers P31 and P32 of which the sequences are shown in SEQ ID No. 31 and SEQ ID No. 32 in Table 2, the successfully integrated URA3-gene-containing transformant PCR product was 2958 bp long, the successfully integrated transformant PCR product in which the URA3 gene was ejected was 1445 bp long, and the control strain PCR product was 2635 bp long. The 1445 bp PCR product was sequenced and the sequencing results confirmed that the expected changes occurred: the 40 bases before the initiation codon of the PDE1 gene, the entire ORF region, and 46 bases after the stop codon were completely deleted. Thus, the positive transformant strain in which the PDE1 gene was deleted and the URA3 gene was ejected was finally obtained.

(75) II. Comparison of cAMP Production with W303-1A (tpk1Δ tpk2Δ tpk3Δ yak1Δ pde1Δ::URA3) and W303-1A (tpk1Δtpk2Δ tpk3Δ yak1Δ pde1Δ)

(76) To compare the possible effects of the selectable marker gene URA3 on cAMP production, a preliminary evaluation on cAMP production with two strains was performed. 1. Seed cultivation: same as in Example 4; 2. Fermentation: 1) fermentation medium: yeast extract 10 g/L, peptone 20 g/L, and glucose 20 g/L, natural pH; and 2) fermentation condition: the fresh seed was inoculated into a 100 ml flask containing 25 ml of fermentation medium, and fermented at 30° C., 220 rpm while controlling the initial OD600 value at 0.1 or so. The analysis of the fermentation broth was the same as the HPLC analysis method in Example 4. The results of extracellular cAMP production within 120 h are shown in FIG. 2. The results in FIG. 2 show that: 1. the maximum extracellular cAMP concentrations within 120 h by the two deleted strains were 252.0 and 953.8 μmol/L, respectively, which were 173.8 and 657.8 times that of the control strain W303-1A (1.45 μmol/L), and 1.17 and 4.42 times that of W303-1B (tpk1Δ tpk2Δ tpk3Δ yak1Δ) strain in Example 4, respectively; 2. The cAMP concentration by the strain W303-1A (tpk1Δ tpk2Δ tpk3Δ yak1Δ pde1Δ::URA3) was basically stable from 48 h, while the cAMP concentration by W303-1A (tpk1Δtpk2Δtpk3Δyak1Δpde1Δ) increased continuously; and 3. No retaining URA3 gene can significantly increase the cAMP yield.

(77) III. Evaluation on Growth and cAMP Production of W303-1A (tpk1Δ tpk2Δ tpk3Δ yak1Δ pde1Δ)

(78) The URA3-free five-gene-deleted strain was subjected to evaluation on growth and fermentation production of extracellular cAMP: 1. The seed cultivation: same as in Example 4; 2. fermentation: 1) fermentation medium: yeast extract 10 g/L, peptone 20 g/L, and glucose 20-150 g/L, natural pH; and 2) fermentation conditions: the fresh seed solution was inoculated into a 100 ml flask containing 25 ml of fermentation medium, and fermented at 30° C., 220 rpm while controlling the initial OD600 value at 1 or so. The analysis of the fermentation broth was the same as the HPLC analysis method in Example 4. The results of evaluation on growth and fermentation production of extracellular cAMP within 120 h are shown in Table 4.

(79) TABLE-US-00004 TABLE 4 Evaluation on growth and cAMP production of five-gene-deleted strains Glucose Maximum Extracellular Concentration Maximum cAMP Concentration (g/L) OD.sub.600 (μmol/L) 20 31.1 (24 h)  981.0 (48 h) 50 35.0 (48 h) 2223.7 (72 h) 100 63.7 (72 h) 3596.6 (96 h) 150 69.5 (72 h) 3925.6 (96 h)

Example 6: BAS1-BAS2 Fusion Co-Expression

(80) The BAS1 and BAS2 genes were subjected to fusion co-expression and integrated into the chromosome of the yeast cell. Therefore, the construction of a fusion co-expression integration vector with left and right homology arms is firstly required. The integration site selected here is YNRC Δ 9, which was reported to have high gene expression efficiency in the literature (Bai Flagfeldt D, Siewers V, Huang L. et al. Characterization of chromosomal integration sites for heterologous gene expression in Saccharomyces cerevisiae. Yeast, 2009, 26(10): 545-551), and is located on chromosome XIV.

(81) I. Construction of BAS1-BAS2 Fusion Co-Expression Plasmid

(82) 4 ligations were performed to obtain the BAS1-BAS2 fusion co-expression plasmid pUC18-H1.sub.YNRCΔ9-BAS1-BAS2-H2.sub.YNRCΔ9-URA3-H2.sub.YNCΔ9 (see FIG. 3 for the schematic diagram).

(83) 1. Construction of pUC18-H1.sub.YNRCΔ9-SacI-SalI-H2.sub.YNRCΔ9 Plasmid

(84) PCR was performed by using the strain W303-1A chromosomal DNA as a template to amplify the partial sequence of YNRCΔ9 to obtain the integrated left and right homology arms. The forward and reverse primers P33 and P34 of which the sequences are shown in SEQ ID No. 33 and SEQ ID No. 34 in Table 2, and the Fast Pfu polymerase produced by TransGen were used, PCR was annealed at 50° C. for 1 min and extended at 72° C. for 45 sec for a total of 32 cycles to obtain a 521 bp PCR1 fragment (the corresponding sequence was used as the integrated left homology arm H1YNRCΔ9). The forward and reverse primers P35 and P36 of which the sequences are shown in SEQ ID No. 35 and SEQ ID No. 36 in Table 2 were used, and the same method was used to obtain a 448 bp PCR2 fragment (the corresponding sequence was used as the integrated right homology arm H2YNRCΔ9). By using PCR1 and PCR2 products as the templates and P33 and P36 as the primer pair, the overlapping extension PCR was performed to obtain a 949 bp PCR12 fragment. The restriction enzyme cutting site EcoRI was added to the 5′ end of this fragment, BamHI was added to the 3′ end, and SacI and Sal I were added in the middle. The PCR product was digested with EcoRI and BamHI and ligated with the same double-digested pUC18 large fragment. E. coli Top 10 competent cells were transformed, and the transformant plasmid was extracted to perform digestion identification and proved to obtain the plasmid pUC18-H1YNRCΔ9-SacI-SalI-H2 YNRCΔ9. The sequencing results proved that the cloned fragment did not undergo mutation.

(85) 2. Construction of pUC18-H1.sub.YNRCΔ9-SacI-SalI-H2.sub.YNRCΔ9-URA3-H2.sub.YNRCΔ9 Plasmid

(86) PCR was performed to amplify the URA3 gene by using YCplac33 as the template to obtain the selectable marker gene for integration. The forward and reverse primers P37 and P38 of which the sequences are shown in SEQ ID No. 37 and SEQ ID No. 38 in Table 2, and Fast Pfu polymerase produced by TransGen were used, and PCR was annealed at 50° C. for 1 min and extended at 72° C. for 1 min for a total of 32 cycles to obtain a 1060 bp PCR1 fragment. PCR was performed by still using the W303-1A chromosomal DNA as the template to amplify the H2 YNRC Δ 9 fragment while the forward and reverse primer pair was replaced with P39 and P40 of which the sequences are SEQ ID No. 39 and SEQ ID No. 40 in Table 2, to obtain a 438 bp PCR2 fragment. By using PCR1 and PCR2 products as the templates and P37 and P40 as the primer pair, the overlapping extension PCR was performed to obtain a 1478 bp PCR12 fragment. The restriction enzyme cutting site BamHI was added to the 5′ end of this fragment, and HindIII was added to the 3′ end. The PCR product was digested with BamHI and HindIII and ligated with the same double-digested pUC18-H1.sub.YNRCΔ9-SacI-SalI-H2.sub.YNRCΔ9 large fragment. E. coli Top 10 competent cells were transformed, and the transformant plasmid was extracted to perform digestion identification and proved to obtain the plasmid pUC18-H1.sub.YNRCΔ9-SacI-SalI-H2.sub.YNRCΔ9-URA3-H2.sub.NRCΔ9. The sequencing results proved that the cloned fragment did not undergo mutation.

(87) 3. Construction of pGEM-T Easy-BAS1-BAS2 Plasmid

(88) PCR was carried out by using the W303-1A chromosomal DNA as a template to amplify the gene BAS1. The forward and reverse primers P41 and P42 of which the sequences are shown in SEQ ID No. 41 and SEQ ID No. 42 in Table 2 and Fast Pfu polymerase produced by TransGen were used, PCR was annealed at 50° C. for 1 min and extended at 72° C. for 2.5 min for a total of 32 cycles to obtain a 2907 bp PCR1 fragment. The restriction enzyme cutting site SacI was added to the 5′ end of this fragment, including the 762 bp sequence upstream of the ATG of the BAS 1 gene initiation codon and the 2112 bp ORF sequence including ATG, and deleting a 324 bp (including the stop codon) sequence at the 3′ end.

(89) PCR was carried out by using the W303-1A chromosomal DNA as a template to amplify the gene BAS2. The forward and reverse primers P43 and P44 of which the sequences are shown in SEQ ID No. 43 and SEQ ID No. 44 in Table 2, and Fast Pfu polymerase produced by TransGen were used, PCR was annealed at 50° C. for 1 min and extended at 72° C. for 1.5 min for a total of 32 cycles to obtain a 1692 bp PCR2 fragment. The restriction enzyme cutting site Sal I was added to the 3′ end, including all sequences of the BAS2 gene ORF (including the stop codon).

(90) By using PCR1 and PCR2 products as the templates and P41 and P44 as the primer pair, the overlapping extension PCR was performed to obtain a 4578 bp PCR12 fragment. Then the PCR fragment was added to the ends with base adenine, separated and recovered by agarose gel electrophoresis. Such PCR fragment was ligated to a pGEM-T easy vector purchased from Promega according to the instructions, E. coli Top 10 competent cells were transformed, and the transformant plasmid was extracted to carry out digestion identification and proved to obtain the plasmid pGEM-T easy-BAS1-BAS2. The sequencing results proved that the cloned fragment did not undergo mutation.

(91) 4. Construction of pUC18-H1.sub.YNRCΔ9-BAS1-BAS2-H2.sub.YNRCΔ9-URA3-H2.sub.YNRCΔ9 plasmid

(92) The pGEM-T easy-BAS1-BAS2 was digested with SacI and Sal I, and ligated with the same double-digested pUC18-H1.sub.YNRCΔ9-SacI-SalI-H2.sub.YNRCΔ9-URA3-H2.sub.YNRCΔ9 large fragment after the large fragment SacI-BAS1-BAS2-Sal I was recovered, to obtain the integrated plasmid pUC18-H1.sub.YNRCΔ9-BAS1-BAS2-H2.sub.YNRCΔ9-URA3-H2.sub.YNRCΔ9.

(93) II. Construction of Strain W303-1A (tpk1Δ tpk2Δ tpk3Δ yak1Δ pde1ΔBAS1BAS2)

(94) The plasmid pUC18-H1.sub.YNRCΔ9-BAS1-BAS2-H2.sub.YNRCΔ9-URA3-H2.sub.YNRCΔ9 was digested with Pvu II to obtain a linearized DNA fragment H1.sub.YNRCΔ9-BAS1-BAS2-H2.sub.YNRCΔ9-URA3-H2.sub.YNRCΔ9; and the strain W303-1A (tpk1Δ tpk2Δ tpk3Δ yak1Δ pde1Δ) competent cells were transformed, and screening and identification were carried out by the method identical to “construction of W303-1A (tpk2Δ)” in example 1 to obtain the strains W303-1A (tpk1Δ tpk2Δ tpk3Δ yak1A pde1Δ BAS1BAS2-URA3) and W303-1A (tpk1Δ tpk2Δ tpk3Δ yak1Δ pde1Δ BAS1BAS2). The forward and reverse primers P45 and P46 of which the sequences are shown in SEQ ID No. 45 and SEQ ID No. 46 in Table 2 were used in the PCR identification. The successfully integrated URA3-gene-containing transformant PCR product was 7389 bp long, the successfully integrated transformant PCR product in which the URA3 gene was ejected was 5929 bp long, and the control strain PCR product was 1687 bp long. The 5929 bp PCR product was sequenced and the results confirmed that the expected changes occurred: a 321 bp sequence of the YNRCΔ9 site was knocked out, and a BAS1BAS2 fusion fragment was inserted instead. This fragment did not undergo mutation, and did not contain the URA3 gene.

(95) III. Evaluation on Growth and cAMP Production of Strain W303-1A(tpk1Δ tpk2Δ tpk3Δ yak1Δ pde1ΔBAS1BAS2)

(96) Example 5 proved that the glucose concentration significantly affects the production of cAMP. In view of the components required for cAMP synthesis (the molecular formula is C10H12N5O6P), while the glucose concentration is increased, it is speculated that the contents of nitrogen and phosphorus in the medium, especially the content of nitrogen, may become the primary limiting factor for cAMP synthesis. In addition, as a precursor for cAMP synthesis, the condition of extracellular adenine also greatly affects the expression level of each gene in the purine synthesis pathway, which in turn affects cAMP production. Therefore, the cAMP production of the above strains at two yeast extract/peptone levels (1*YP, 2*YP) under the condition that adenine was added was compared here. The specific operations are as follows: 1. The seed cultivation: same as in Example 4; 2. fermentation: 1) fermentation medium: yeast extract 10 g/L, peptone 20 g/L, abbreviated as 1*YP, and glucose 150 g/L, natural pH; yeast extract 20 g/L, peptone 40 g/L, abbreviated as 2*YP, and glucose 150 g/L, natural pH; the amount of adenine added was 0.625 and 1.25 g/L, abbreviated as A0.625 and A1.25, respectively; 2) fermentation condition: the fresh seed solution was inoculated into a 100 ml flask containing 25 ml of fermentation medium, and fermented at 30° C., 220 rpm while controlling the initial OD600 value at 1 or so; 3) analysis of fermentation broth: cAMP HPLC analysis method was same as in Example 4, and additionally adenine HPLC analysis was performed as followings: a. the sample processing and HPLC analysis: same as sample processing and HPLC analysis of cAMP analysis; b. making adenine standard curve: an adenine standard sample was prepared into a 5 mg/mL with sterilized deionized water, and then diluted with deionized water to obtain the standard samples with final concentrations of 0.1, 0.2, 0.3, 0.4 and 0.5 mg/mL, respectively, the standard samples were subjected to chromatographic analysis after filtration sterilization, and a standard curve was made; and c. the concentration of adenine in the fermentation broth sample was calculated by the external standard method using the standard curve.

(97) The fermentation results are shown in Table 5. The results in Table 5 indicate that: 1. under the fermentation conditions of 1*YP and 15% glucose, the maximum extracellular cAMP concentration by the fusion co-expression BAS1-BAS2 strain is higher than that (3925.6 μmol/L) of the strain W303-1A(tpk1Δtpk2Δtpk3Δyak1Δpde1Δ) in Example 5, the former being 1.108 times of the latter; 2. the effect on the extracellular cAMP yield by increasing concentrations of yeast powder and peptone is extremely significant; and 3. adding adenine into medium can further increase the extracellular cAMP yield.

(98) TABLE-US-00005 TABLE 5 Evaluation on cAMP production of strain W303-1A (tpk1Δ tpk2Δ tpk3Δ yak1Δ pde1ΔBAS1-BAS2) Maximum cAMP Maximum Concentration Component OD.sub.600 (μmol/L) Ratio Ratio 1*YP, Glucose 70.1 (72 h)  4348.8 (120 h) 1 — 150 g/L 2*YP, Glucose 71.6 (96 h)  8291.5 (168 h) 1.907 1 150 g/L 2*YP, Glucose 68.4 (120 h) 9265.3 (168 h) 2.131 1.117 150 g/L, A0.625 2*YP, Glucose 64.4 (120 h) 9721.6 (168 h) 2.235 1.172 150 g/L, A1.25