METHOD OF TREATING A METHIONINE-DEPENDENT CANCER
20200022984 ยท 2020-01-23
Inventors
- Zhenxun Wang (Singapore, SG)
- Wai Leong Tam (Singapore, SG)
- Lian Yee Yip (Singapore, SG)
- Ying Swan Ho (Singapore, SG)
- Zhengwei Wu (Singapore, SG)
- Bing Lim (Singapore, SG)
Cpc classification
C12Q2600/106
CHEMISTRY; METALLURGY
A61K31/7105
HUMAN NECESSITIES
C12Q2600/112
CHEMISTRY; METALLURGY
International classification
A61K31/7105
HUMAN NECESSITIES
Abstract
The present specification relates generally to a therapeutic protocol for treating a subject having cancer. Taught herein is a method of treating cancer or reducing the risk of recurrence of cancer in a subject following an anti-cancer therapy.
Claims
1. A method of treating cancer or reducing the risk of recurrence of cancer in a subject following an anti-cancer therapy, the method comprising the step of administering a methionine cycle inhibitor to the subject.
2. The method of claim 1, wherein the cancer comprises a tumor initiating cell.
3. The method of claim 1, wherein the cancer is resistant to chemotherapy or radiotherapy.
4. The method of claim 1, wherein the cancer is a metastatic or recurrent cancer.
5. The method of claim 1, wherein the cancer a methionine-dependent cancer.
6. The method of claim 1, wherein the cancer is a MAT2A-dependent cancer.
7. The method of claim 1, wherein the cancer is methylthioadenosine phosphorylase (MTAP) positive.
8. The method of claim 1, wherein the cancer expresses a biomarker selected from the group consisting of MAT2A, MTHFR, MTR, SAHH, GLDC, SHMT2 and CD166.
9. The method of claim 1, wherein the methionine cycle inhibitor is an inhibitor of MAT2A, MTHFR, MTR, SAHH, GLDC, SHMT2 or CD166.
10. The method of claim 1, wherein the methionine cycle inhibitor is a MAT2A inhibitor selected from the group consisting of FIDAS-5, FIDAS-3, PF-9366 and AG-270.
11. The method of claim 1, wherein the methionine cycle inhibitor is selected from the group consisting of D9, methotrexate and an anti-folate.
12. The method of claim 1, wherein the methionine cycle inhibitor is administered in combination with an anti-cancer therapy, wherein the anti-cancer therapy is not a methionine cycle inhibitor.
13. The method of claim 12, wherein the anti-cancer therapy is selected from a chemotherapy, immunotherapy or radiotherapy.
14. A method of reducing the therapeutic resistance of a subject to an anti-cancer therapy, the method comprising the step of administering a methionine-cycle inhibitor to the subject.
15. A method of inhibiting proliferation or eliminating a tumor initiating cell, the method comprising the step of contacting the tumor initiating cell with a methionine cycle inhibitor for a time and under conditions suitable for inhibiting proliferation or eliminating the tumor initiating cell.
16. A method of diagnosing and treating a methionine-dependent cancer, the method comprising the steps of: a) determining the expression levels of a biomarker selected from the group consisting of MAT2A, MTHFR, MTR, SAHH, GLDC, SHMT2 and CD166 in a cancer specimen obtained from a subject, wherein an increased expression level of a the biomarker in the cancer specimen as compared to the expression level of the biomarker in a non-cancerous specimen indicates that the subject has a methionine-dependent cancer, and b) administering a methionine cycle inhibitor to the subject found to have a methionine-dependent cancer.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
DETAILED DESCRIPTION
[0101] The present invention relates to a therapeutic protocol for treating or reducing the risk of recurrence of cancer in a subject.
[0102] In one aspect, there is provided a method of treating cancer or reducing the risk of recurrence of cancer in a subject following an anti-cancer therapy, the method comprising the step of administering a methionine cycle inhibitor to the subject.
[0103] In one example, the method comprises treating a cancer. In one example, the method comprises treating a recurrent cancer. In one example, the method comprises treating a cancer in a subject following an anti-cancer therapy.
[0104] Without being bound by theory or mode of action, the invention is predicated in part on the determination that some cancer cells, such as in tumor initiating cells, can have highly elevated methionine cycle activity and trans-methylation rates that are driven by key metabolic enzymes. High methionine cycle flux can cause methionine consumption to far outstrip its regeneration leading to a heavy dependence on exogenous methionine for tumor-initiation (i.e. methionine dependence), resulting in a metabolic liability. Pharmacological inhibition of the methionine cycle may be sufficient to cripple the tumor-capability of these cells. In particular, a short term or transient inhibition of the methionine cycle may be sufficient to treat or prevent the recurrence or metastasis of cancer as these cells are highly dependent on the methionine cycle for survival and proliferation.
[0105] The terms cancer and cancerous refer to or describe the physiological condition in mammals that is typically characterized in part by unregulated cell growth. As used herein, the term cancer refers to non-metastatic and metastatic cancers, including early stage and late stage cancers. The term precancerous refers to a condition or a growth that typically precedes or develops into a cancer. By non-metastatic is meant a cancer that is benign or that remains at the primary site and has not penetrated into the lymphatic or blood vessel system or to tissues other than the primary site. Generally, a non-metastatic cancer is any cancer that is a Stage 0, I, or II cancer, and occasionally a Stage III cancer. By early stage cancer is meant a cancer that is not invasive or metastatic or is classified as a Stage 0, I, or II cancer. The term late stage cancer generally refers to a Stage III or Stage IV cancer, but can also refer to a Stage II cancer or a sub-stage of a Stage II cancer. One skilled in the art will appreciate that the classification of a Stage II cancer as either an early stage cancer or a late stage cancer depends on the particular type of cancer. Illustrative examples of cancer include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, pancreatic cancer, colorectal cancer, lung cancer, hepatocellular cancer, gastric cancer, liver cancer, bladder cancer, cancer of the urinary tract, thyroid cancer, renal cancer, carcinoma, melanoma, brain cancer, non-small cell lung cancer, squamous cell cancer of the head and neck, endometrial cancer, multiple myeloma, rectal cancer, and esophageal cancer.
[0106] In an example, the cancer is lung cancer. In an example, the cancer is a metastatic cancer. In an example, the cancer is a metastatic lung cancer.
[0107] In an example, the cancer is non small cell adenocarcinoma.
[0108] In one example, the cancer is a breast cancer. The cancer may be metastatic breast cancer. In one example, the cancer is a triple-negative breast cancer.
[0109] In an example, the cancer or metastatic cancer is driven by a tumor initiating cell (TIC).
[0110] In one example, the cancer is a chemotherapy or drug resistant cell.
[0111] The term tumor initiating cell, TIC, cancer stem cell or CSC refers to a cell that has tumor-initiating and tumor-sustaining capacity, including the ability to extensively proliferate, form new tumors and maintain cancer development, i.e., cells with indefinite proliferative potential that drive the formation and growth of tumors. CSCs are biologically distinct from the bulk tumor cells and possess characteristics associated with stem cells, specifically the ability to self renew and to propagate and give rise to all cell types found in a particular cancer sample. The term cancer stem cell or CSC includes both gene alteration in stem cells (SCs) and gene alteration in a cell which becomes a CSC.
[0112] The term recurrence as used herein may refer to a cancer that has recurred (come back), usually after a period of time during which the cancer could not be detected. The cancer may be called a recurrent cancer. The recurrent cancer may come back to the same place as the original (primary) tumor or to another place in the body. The recurrence may be considered a local recurrence when the cancer is in the same place as the original cancer or very close to it. The recurrence may be a regional recurrence when the tumor has grown into lymph nodes or tissues near the original cancer. The recurrence may be called a distant recurrence when the cancer has spread to organs or tissues far from the original cancer. When the cancer spreads to a distant place in the body, the recurrent cancer may be called metastasis or metastatic cancer.
[0113] The reduction of the risk of cancer recurrence following an anti-cancer therapy can be quantified in terms of a reduction in percentage (%) risk of cancer recurrence. For example, there can be a reduction in a risk of cancer recurrence by anywhere from about 1% to 100%. In an example, there is a reduction in risk of cancer recurrence by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% or a percentage inbetween.
[0114] In an example, the administration of a MAT2A inhibitor leads to a reduction of percentage risk of cancer recurrence following anti-cancer therapy by a percentage of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% or a percentage inbetween.
[0115] The term administering refers to contacting, applying or providing a MAT2A inhibitor to a subject.
[0116] The methods as defined herein may comprise transient administration of a MAT2A inhibitor to a subject. The terms transiently administering or transient administration refers to the short-term administration of a methionine-cycle inhibitor to provide a more long lasting benefit to a subject being treated with an anti-cancer therapy and reduce the risk of recurrence or relapse of cancer. This may be done so by restricting administration to a relatively narrow window of time.
[0117] The transient administration of a methionine cycle inhibitor to a subject may lead to lower levels of toxicity and side effects.
[0118] A therapeutically effective amount of an inhibitor of methionine cycle enzyme expression or activity, in a pharmaceutically acceptable preparation, may be administered to the subject only transiently. Transient administration may be restricted to a finite, predetermined treatment period, and may constitute a predefined dose regimen of one or more doses of the inhibitor. The treatment period has a duration measured from the beginning of the first (or only) dose to the end of the last (or only) dose, with the duration expressed as an integer number of days after rounding up to the nearest whole day. (In other words, a treatment period beginning and ending in less than 24 hours has a duration of one day.) A suitable duration for the treatment period may be less than about 2 or 1 month(s); less than about 3, 2, or 1 week(s); or less than about 6, 5, 4, 3, or 2 days; among others. Accordingly, the treatment period may be only one day and/or a single dose. In some embodiments, the duration of the treatment period may be at least about 2, 3, 4, or 5 days; or at least about 1, 2, 3, or 4 weeks.
[0119] The term subject as used throughout the specification is to be understood to mean a human or may be a domestic or companion animal. While it is particularly contemplated that the methods of the invention are for treatment of humans, they are also applicable to veterinary treatments, including treatment of companion animals such as dogs and cats, and domestic animals such as horses, cattle and sheep, or zoo animals such as primates, felids, canids, bovids, and ungulates. The subject may include a person, a patient or individual, and may be of any age or gender.
[0120] In one example, there is provided a method of reducing the risk of recurrence of cancer in a subject following an anti-cancer therapy, the method comprising the step of transiently administering a methionine cycle inhibitor to the subject.
[0121] In one example, there is provided a method of treating a recurrent cancer in a subject, the method comprising administering a methionine cycle inhibitor to the subject.
[0122] In one example, there is provided a method of treating a recurrent cancer in a subject, the method comprising the step of transiently administering a methionine cycle inhibitor to the subject.
[0123] In one example, there is provided a method of treating a metastatic cancer in a subject, the method comprising administering a methionine cycle inhibitor to the subject.
[0124] In one example, there is a provided a method of treating a metastatic cancer in a subject, the method comprising the step of transiently administering a methionine cycle inhibitor to the subject.
[0125] In one example, there is provided a method of treating a methionine-dependent cancer in a subject, the method comprising the step of administering a methionine cycle inhibitor to the subject.
[0126] In one example, there is provided a method of treating a methionine-dependent cancer in a subject, the method comprising the step of transiently administering a methionine cycle inhibitor to the subject.
[0127] The term methionine-dependent may refer to a cancer that is unable to grow, proliferate or survive in the absence of methionine. It may refer to a cancer that is dependent on methionine cycle enzymes, including MAT2A, MTHFR, SAHH and MTR. Methionine-dependent may also refer to a cancer that is unable to grow, proliferate or survive as a result of the inhibition of the methionine cycle enzymes, such as MAT2A, MTHFR, SAHH or MTR.
[0128] In one example, the cancer is a MAT2A dependent cancer. In one example, the cancer is a MTHFR dependent cancer. In one example, the cancer is a SAHH dependent cancer. In one example, the cancer is a MTR dependent cancer.
[0129] The cancer cell may demonstrate high methionine cycle activities, as determined by methionine, SAM, SAH, and homocysteine levels, which can be measured by mass spectrometry and biochemical assays. The cancer cell may also demonstrates high methionine cycle activities, as determined by biochemical methylation assays of methylated histones and methylated DNA
[0130] The terms co-administered and administered concurrently and the like refer to the administration of a single composition containing two or more actives, or the administration of each active as separate compositions and/or delivered by separate routes either contemporaneously or simultaneously or sequentially within a short enough period of time that the effective result is equivalent to that obtained when all such actives are administered as a single composition. By simultaneously is meant that the active agents are administered at substantially the same time, and desirably together in the same formulation. By contemporaneously it is meant that the active agents are administered closely in time, e.g., one agent is administered within from about one minute to within about one day before or after another. Any contemporaneous time is useful. However, it will often be the case that when not administered simultaneously, the agents will be administered within about one minute to within about eight hours and suitably within less than about one to about four hours. When administered contemporaneously, the agents are suitably administered at the same site on the subject. The term same site includes the exact location, but can be within about 0.5 to about 15 centimetres, including from within about 0.5 to about 5 centimetres. The term separately as used herein means that the agents are administered at an interval, for example at an interval of about a day to several weeks or months. The active agents may be administered in either order. The term sequentially as used herein means that the agents are administered in sequence, for example at an interval or intervals of minutes, hours, days or weeks. If appropriate the active agents may be administered in a regular repeating cycle.
[0131] In one example, the method comprises administering the methionine cycle inhibitor to a cancer cell. In one example, the cancer cell is a tumour initiating cell. In one example, the method comprises administering the methionine cycle inhibitor to a tumor initiating cell. In an example, the tumor initiating cell is a lung tumor initiating cell.
[0132] The cancer cell may express MAT2A and/or CD166, or other known tumour initiating cell markers. In one example, the cancer expresses a biomarker selected from the group consisting of MAT2A and CD166. In one example, the cancer cell expresses MAT2A and CD166. In one example, the cancer cell expresses MAT2A. In one example, the cancer cell expresses CD166.
[0133] The tumour initiating cell may express MAT2A and/or CD166, or other known tumour initiating cell biomarkers. In one example, the tumour initiating cell expresses a biomarker selected from the group consisting of MAT2A and CD166. In one example, the cancer cell expresses MAT2A and CD166. In one example, the cancer cell expresses MAT2A. In one example, the cancer cell expresses CD166.
[0134] In one example, the cancer comprises a tumor initiating cell.
[0135] In one example, the cancer is resistant to chemotherapy or radiotherapy.
[0136] In one example, the cancer is a metastatic or recurrent cancer.
[0137] In one example, the cancer is a methionine-dependent cancer.
[0138] In one example, the tumour initiating cell is methionine-dependent.
[0139] In an example, the tumor initiating cell is methylthioadenosine phosphorylase (MTAP) positive. MTAP is an enzyme found in all normal tissues that catalyzes the conversion of methylthioadenosine (MTA) into adenine and 5-methylthioribose-1 -phosphate. The adenine is salvaged to generate adenosine monophosphate, and the 5-methylthioribose-1 -phosphate is converted to methionine and formate. In one example, the tumor initiating cell expresses MAT2A and is MTAP positive.
[0140] In one example, the cancer cell expresses a biomarker selected from the group consisting of MAT2A, MTHFR, MTR, SAHH, GLDC, SHMT2 and CD166.
[0141] In one example, the methionine cycle inhibitor is an inhibitor of MAT2A, MTHFR, MTR, SAHH, GLDC, SHMT2 or CD166.
[0142] In one aspect, there is provided a method of diagnosing and treating a methionine-dependent cancer, the method comprising the steps of: a) determining the expression levels of a biomarker selected from the group of MAT2A, MTHFR, MTR, SAHH, GLDC, SHMT2 and CD166 in a cancer specimen obtained from a subject, wherein an increased expression level of a biomarker in the cancer specimen as compared to the expression level of the biomarker in a non-cancerous cancer specimen indicates that the subject has a methionine-dependent cancer, and b) administering a methionine cycle inhibitor to the subject found to have a methionine-dependent cancer.
[0143] In one example, there is provided a methionine cycle inhibitor for use in treating a methionine-dependent cancer, wherein the expression levels of a biomarker selected from the group of MAT2A, MTHFR, MTR, SAHH, GLDC, SHMT2 and CD166 in a cancer specimen obtained from a subject is to be determined, wherein increased expression level of a biomarker in the cancer specimen as compared to the expression level of the biomarker in a non-cancerous cancer specimen indicates that the subject has a methionine-dependent cancer, and wherein a methionine cycle inhibitor to the subject found to have a methionine-dependent cancer is to be administered to the subject.
[0144] In one example, there is provided the use of a methionine cycle inhibitor in the manufacture of a medicament for treating a methionine-dependent cancer, wherein the expression levels of a biomarker selected from the group of MAT2A, MTHFR, MTR, SAHH, GLDC, SHMT2 and CD166 in a cancer specimen obtained from a subject is to be determined, wherein increased expression level of a biomarker in the cancer specimen as compared to the expression level of the biomarker in a non-cancerous cancer specimen indicates that the subject has a methionine-dependent cancer, and wherein a methionine cycle inhibitor to the subject found to have a methionine-dependent cancer is to be administered to the subject.
[0145] In one example, there is provided a method of identifying a cancer patient who is responsive to a methionine cycle or MAT2A inhibitor, the method comprising detecting an increased level of expression of a biomarker selected from the group consisting of MAT2A, MTHFR, MTR, SAHH, CD166 and MTAP in a sample obtained from the cancer patient, wherein an increased level of expression of the biomarker in the cancer specimen as compared to the level of expression in a non-cancerous specimen indicates that the cancer is responsive to a methionine cycle or MAT2A inhibitor.
[0146] The expression levels of the above markers in a specimen or cell can be assessed relative to that in a reference specimen or cell, e.g. a non-cancerous specimen or cell or a cancer specimen or cell that is not methionine dependent. The specimen could be a tissue sample obtained from a patient. The expression of markers such as MAT2A, MTHFR, MTR, SAHH, CD166 or MTAP can be determined using any standard bioassay procedures known in the art for determination of the level of expression of a gene or protein, such as ELISA, RIA, immunoprecipitation, immunoblotting, immunofluorescence microscopy, RT-PCR, in situ hybridization, cDNA microarray, or the like.
[0147] The term increased expression level of a biomarker may refer to a 1.2 fold or greater difference between the expression (or mean expression) of a biomarker in a cancer specimen or cell as compared to in a control such as a non-cancerous cell. The term increased expression level may also refer to a fold difference of at least 1.5 fold, 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 11 fold, 12 fold, 13 fold, 14 fold, 15 fold, 16 fold, 17 fold, 18 fold, 19 fold, 20 fold, 21 fold, 22 fold, 23 fold, 24 fold, 25 fold, 26 fold, 27 fold, 28 fold, 29 fold, 30 fold, 31 fold, 32 fold, 33 fold, 34 fold, 35 fold, 36 fold, 37 fold, 38 fold, 39 fold, 40 fold, 41 fold, 42 fold, 43 fold, 44 fold, 45 fold, 46 fold, 47 fold, 48 fold, 49 fold, 50 fold, 51 fold, 52 fold, 53 fold, 54 fold, 55 fold, 56 fold, 57 fold, 58 fold, 59 fold, 60 fold, 61 fold, 62 fold, 63 fold, 64 fold, 65 fold, 66 fold, 67 fold, 68 fold, 69 fold, 70 fold, 71 fold, 72 fold, 73 fold, 74 fold, 75 fold, 76 fold, 77 fold, 78 fold, 79 fold, 80 fold, 81 fold, 82 fold, 83 fold, 84 fold, 85 fold, 86 fold, 87 fold, 88 fold, 89 fold, 90 fold, 91 fold, 92 fold,93 fold, 94 fold, 95 fold, 96 fold, 97 fold, 98 fold, 99 fold or 100 fold.
[0148] An increased expression level of one or more biomarkers such as MAT2A, MTHFR, MTR, SAHH, CD166 or MTAP in a cancer specimen or cell as compared to a non-cancerous specimen or cell may indicate that a subject has a methionine-dependent cancer. In other embodiments, the subject has a methionine-dependent cancer when there is an increased expression level of one or more biomarkers such as MAT2A, MTHFR, MTR, SAHH, CD166 or MTAP in a cancer specimen or sample as compared to a non-cancerous specimen or sample indicates that a subject has a methionine-dependent cancer. In other embodiments, a subject has a methionine-dependent cancer when a certain percentage of the cells in a cancer sample or specimen has increased expression of the biomarker. This can be, for example, at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of cells in the cancer sample.
[0149] A methionine cycle inhibitor may be an inhibitor of a methionine cycle enzyme's activity or expression. The inhibitor can be an inhibitor capable of specifically reducing enzyme activity, generally by interacting with the protein of the enzyme, or can be an enzyme expression inhibitor capable of specifically reducing protein expression. The unmodified term inhibitor is used herein to encompass both types of inhibitor. The inhibitor may be a single compound or may include two or more compounds. If the inhibitor includes two or more compounds, at least a subset of the compounds may be present together in the same pharmaceutical preparation or may be present in separate preparations, which may be administered separately to the subject.
[0150] In one example, the methionine cycle inhibitor is selected from the group consisting of D9, methotrexate and an anti-folate.
[0151] In one example, the methionine cycle inhibitor is an inhibitor of MAT2A, MTHFR, MTR, SAHH, GLDC, SHMT2 or CD166. In one example, the methionine cycle inhibitor is an inhibitor of MAT2A.
[0152] In one example, the methionine cycle inhibitor is an inhibitor of SAHH. The inhibitor of SAHH may be D9 or DZNep.
[0153] Inhibitors are any agent that modulates an enzyme's function, for example, an agent that interacts with MAT2A to inhibit or enhance MAT2A activity or otherwise affect normal MAT2A function. An enzyme's function can be affected at any level, including transcription, protein expression, protein localization, and cellular or extra-cellular activity.
[0154] In the methods of this invention, a MAT2A inhibitor can be any MAT2A inhibitor. In a particular embodiment, the MAT2A inhibitor is an oligonucleotide that represses MAT2A gene expression or product activity by, for example, binding to and inhibiting MAT2A nucleic acid (i.e. DNA or mRNA). In a particular embodiment, the MAT2A inhibitor is an oligonucleotide e.g. an antisense oligonucleotide, shRNA, siRNA, microRNA or an aptamer. In a particular embodiment, the MAT2A inhibitor is a oligonucleotide, for example, as described in WO2004065542. In a particular embodiment, the MAT2A inhibitor is an siRNA, for example, as described in patent application CN 2015-10476981 or in Wang et al, Zhonghua Shiyan Waike Zazhi, 2009, :26(2): 184-186 or Wang et al, Journal of Experimental & Clinical Cancer Research (2008) volume 27. In a particular embodiment, the MAT2A inhibitor is a microRNA oligonucleotide, for example, as described in US patent application publication no. 20150225719 or in Lo et al, PLoS One (2013), 8(9), e75628. In an embodiment, the MAT2A inhibitor is an antibody that binds to MAT2A.
[0155] In an example, the MAT2A inhibitor is an inhibitor of MAT2A expression. Exemplary inhibitors of MAT2A expression include nucleic acids or analogs thereof. The inhibitor of MAT2A expression may include anti-MAT2A interfering RNA that binds specifically to an MAT2A gene and/or MAT2A RNA.
[0156] In an example, the MAT2A inhibitor is an inhibitor of MAT2A enzyme activity. The MAT2A inhibitor may be selected from the group consisting of FIDAS-5, FIDAS-3, PF-9366 and AG-270.
[0157] In one example, the MAT2A inhibitor is FIDAS-5. The FIDAS-5 inhibitor may have the following structure:
##STR00001##
[0158] In one example, the MAT2A inhibitor is FIDAS-3 with the following structure:
##STR00002##
[0159] In one example, the MAT2A inhibitor is PF-9366. The PF-9366 inhibitor may have the following structure:
##STR00003##
[0160] In a particular embodiment, the MAT2A inhibitor is a small molecule compound, e.g. AGI-512 or AGI-673. In an embodiment, the MAT2A inhibitor is a fluorinated N,N-dialkylaminostilbene described in Zhang et al, ACS Chem Biol, 2013, 8(4):796-803. In an embodiment, the MAT2A inhibitor is a 2,6- dihalostyrylaniline, pyridine or pyrimidine described in Sviripa et al, J Med Chem, 2014, 57:6083-6091. In a particular embodiment the compound is selected from the following compounds:
##STR00004## ##STR00005##
[0161] In another embodiment, the MAT2A inhibitor is a compound disclosed in WO2012103457. In an embodiment, the MAT2A inhibitor is a compound of the formula:
XAr.sub.1CR.sup.3CR.sup.bAr.sub.2
where R.sup.a and R.sup.b are independently H, alkyl, halo, alkoxy, cyano; X represents at least one halogen, e.g., a fluorine, chlorine, bromine, or iodine substituent, on Ar.sub.1; each of An and Ar.sub.2 are aryl, e.g., phenyl, naphthyl, and heteroaryl, e.g., pyridyl, pyrolidyl, piperidyl, pyrimidyl, indolyl, thienyl, which can be further substituted with halo, amino, alkylamino, dialkylamino, arylalkylamino, N-oxides of dialkylamino, trialkylammonium, mercapto, alkylthio, alkanoyl, nitro, nitrosyl, cyano, alkoxy, alkenyloxy, aryl, heteroaryl, sulfonyl, sulfonamide, CONR.sub.11R.sub.12, NR.sub.11CO(R.sub.13), NR.sub.11COO(R.sub.13), NR.sub.11CONR.sub.12R.sub.n where R.sub.n, R.sub.12, R.sub.13 are independently, H, alkyl, aryl, heteroaryl or a fluorine; provided that Ar.sub.2 contains at least one nitrogen atom in the aryl ring or at least one nitrogen substituent on the aryl ring; e.g., an NR.sup.cR.sup.dZ substituent on Ar.sub.2 where R.sup.d is H, alkyl, alkoxy, aryl, heteroaryl R.sup.d is an alkyl group, Z is a an unshared pair of electrons, H, alkyl, oxygen.
[0162] In another embodiment, the MAT2A inhibitor is a compound of formula:
##STR00006##
where R.sup.a and R.sup.b are as defined above, R.sub.1 to R.sub.10 are independently H, halo, amino, alkylamino, dialkylamino, N-oxides of dialkylamino, arylalkylamino, dialkyloxyamino, trialkylammonium, mercapto, alkylthio, alkanoyl, nitro, nitrosyl, cyano, alkoxy, alkenyloxy, aryl, heteroaryl, sulfonyl, sulfonamide, CONR.sub.11R.sub.12, NR.sub.11CO(R.sub.13), NR.sub.11COO(R.sub.13), NR.sub.11CONR.sub.12R.sub.13 where R.sub.11, R.sub.12, R.sub.13, are independently, H, alkyl, aryl, heteroaryl or a fluorine; provided at least one of R.sub.1 to R.sub.5 is a halogen, e.g. a fluorine and/or chlorine; and at least one of R.sub.6 to R.sub.10 is a nitrogen containing substituent, e.g., an NR.sup.cR.sup.dZ substituent where R.sup.c is H, alkyl, e.g., a lower alkyl, alkoxy, aryl, heteroaryl, R.sup.d is an alkyl group, Z is a an unshared pair of electrons, H, alkyl, oxygen, or a pharmaceutically acceptable salt thereof, or a biotinylated derivative thereof.
[0163] In another embodiment, the MAT2A inhibitor is a compound of formula:
##STR00007##
where R.sub.1, R.sub.2, R.sub.3, R.sub.5, R.sub.6, R.sub.7, R.sub.9, R.sub.10, R.sup.a, R.sup.b and NR.sup.cR.sup.dZ are the same as defined above, or pharmaceutically acceptable salts thereof, or a biotinylated derivative thereof. In one embodiment, R.sup.a, R.sup.b are both H, one or more of R.sub.1, R.sub.2, R.sub.3, or R.sub.5, are fluorine or chlorine and R.sup.c is H or lower alkyl, such as a methyl, ethyl, propyl group, and R.sup.d is a lower alkyl, such as a methyl, ethyl, propyl group.
[0164] In an embodiment, the MAT2A inhibitor is selected from the group consisting of: (E)-4-(2-Fluorostyryl)-N,N-dimethylaniline; (E)-4-(3-Fluorostyryl)-N,N-dimethylaniline; (E)-4-(4-Fluorostyryl)-N,N-dimethylaniline; (E)-4-(2-Fluorostyryl)-N,N-diethylaniline; (E)-4-(2-Fluorostyryl)-N,N-diphenylaniline; (E)-1-(4-(2-Fluorostyryl)phenyl)-4-methylpiperazine; (E)-4-(2-Fluorostyryl)-N,N-dimethylnaphthalen-1-amine; (E)-2-(4-(2-Fluorostyryl)phenyl)-1-methyl-1H-imidazole; (E)-4-(2,3-Difluorostyryl)-N,N-dimethylaniline; (E)-4-(2,4-Difluorostyryl)-N,N-dimethylaniline; (E)-4-(2,5-Difluorostyryl)-N,N-dimethylaniline; (E)-4-2-(2,6-Difluorostyryl)-N,N-dimethylaniline; (E)-3-(2,6-Difluorostryl)-N,N-dimethylaniline; (E)-4-(2,6-Difluorostyryl)-N,N-dimethylaniline; (E)-4-(2,6-Difluorostyryl)-N,N-diethylaniline; (E)-4-(3,4-Difluorostyryl)-N,N-dimethylanine; (E)-4-(3,5-Difluorostyryl)N,N-dimethylaniline; (E)-N,N-Dimethyl-4-(2,3,6-trifluorostyryl)aniline; (E)-N,N-Dimethyl-4-(2,4,6-trifluorostyiyl)aniline; (E)-4-(2<hloro-6-Fluorostyryl)-N,N-dimethylaniline; (E)-4-(2,6-dichlorostyryl)-N,N-dimethylaniline; (E)-4-(2,6-Difluorophenelhyl)-N,N-dimethylaniline; and (E)-2-benzamide-4-(2,6-difluoroslyiyl)-N,N-dimethylaniline.
[0165] In one example, the methionine cycle inhibitor is administered in combination with an anti-cancer therapy, wherein the anti-cancer therapy is not a methionine cycle inhibitor.
[0166] As used herein, the term anti-cancer agent may refer to any treatment for cancer including drugs, immunotherapy, targeted therapy, hormonal therapy, chemotherapy, including alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, kinase inhibitors and other anti-tumor agents, surgery and radiation therapy.
[0167] In an example, the anti-cancer therapy is selected from the group consisting of a chemotherapy, immunotherapy and a radiotherapy. The choice of therapy would depend upon the location and grade of the tumor and the stage of the disease, as well as the general state of the patient.
[0168] The chemotherapy may involve administering an anti-proliferative agent such as known anti-proliferative alkylating agents, antitumor antibiotics, antimetabolites, natural alkaloids and inhibitors of protein tyrosine kinases and/or serine/threonine kinases. For instance, examples of such agents include: [0169] (i) alkylating agents, such as cis-platinum(II)-diaminedichloride (platinol or cisplatin); oxaliplatin (Eloxatin or Oxaliplatin Medac); and carboplatin (Paraplatin); [0170] (ii) antitumor antibiotics, including those selected from the group comprising anthracyclines, such as doxorubicin (Adriamycin, Rubex); [0171] (iii) antimetabolites, including folic acid analogues such as pyrimidine analogues such as 5-fluorouracil (Fluoruracil, 5-FU), gemcitabine (Gemzar), or histone deacetylase inhibitors (HDI) for instance, Vorinostat (rINN); [0172] (iv) natural alkaloids, including paclitaxel (Taxol); [0173] (v) inhibitors of protein tyrosine kinases and/or serine/threonine kinases including Sorafenib (Nexavar), Erlotinib (Tarceva), Dasatanib (BMS-354825 or Sprycel).
[0174] In one example, the anti-cancer therapy is a targeted anti-cancer therapy such as one that uses a receptor kinase inhibitor.
[0175] Provided herein is a method of reducing the therapeutic resistance of a subject to an anti-cancer therapy, the method comprising the step of administering a methionine cycle inhibitor to the subject.
[0176] In one example, there is provided a methionine cycle inhibitor for reducing the therapeutic resistance of a subject to an anti-cancer therapy.
[0177] In one example, there is provided the use of a methionine cycle inhibitor in the manufacture of a medicament for reducing the therapeutic resistance of a subject to an anti-cancer therapy.
[0178] Provided herein is a method of inhibiting proliferation or eliminating a tumor initiating cell, the method comprising the step of restricting the intake of methionine into the tumor initiating cell for a time and under conditions suitable for inhibiting proliferation or eliminating the tumor initiating cell. The method may be an in vitro, in vivo or ex vivo method.
[0179] Provided herein is a method of inhibiting proliferation or eliminating a tumor initiating cell, the method comprising the step of contacting (or treating) the tumor initiating cell with a methionine cycle inhibitor for a time and under conditions suitable for inhibiting proliferation or eliminating the tumor initiating cell. The method may be an in vitro, in vivo or ex vivo method.
[0180] The term inhibiting proliferation or eliminating a tumor initiating cell may refer to the eradication of tumor initiating cells by inhibiting or suppressing growth, division, maturation or viability of tumor initiating cells, and/or causing the death of tumor initiating cells, individually or in aggregate with other tumor initiating cells, by cytotoxicity or the induction of apoptosis. One of skill in the art will appreciate that by definition, inhibiting proliferation or eliminating a tumor initiating cell also encompasses the eradication or inhibition of the growth, division, maturation or viability of cancer cells, and/or causing the death of cancer cells, individually or in aggregate with other cancer cells, by cytotoxicity or the induction of apoptosis.
[0181] Provided herein is a method of treating a subject having a methionine-dependent cancer, the method comprising the step of: [0182] a) providing a labeled exogenous methionine to a cancer sample obtained from the subject; [0183] b) measuring the labeled and unlabeled levels of a metabolite selected from the group consisting of SAM, SAH and homocysteine in the sample; [0184] c) comparing the levels of the labeled metabolite to the unlabeled metabolite; wherein a high level of labeled metabolite as compared to the unlabeled metabolite indicates that the subject has a methionine-dependent cancer; [0185] d) administering a methionine cycle inhibitor if the subject is found to have a methionine-dependent cancer.
[0186] The term metabolite as used herein may refer to any substance produced or used during all the physical and chemical processes within the body that create and use energy, such as: digesting food and nutrients, eliminating waste through urine and faeces, breathing, circulating blood, and regulating temperature. In an example, the metabolite is a metabolite that is part of the methionine cycle. The metabolite may, for example, be methionine, SAM, SAH or homocysteine.
[0187] The term high as used herein, refers to a measure that is greater than normal, greater than a standard such as a predetermined measure or a subgroup measure or that is relatively greater than another subgroup measure. A normal measure may be determined according to any method available to one skilled in the art. The term high may also refer to a measure that is equal to or greater than a predetermined measure, such as a predetermined cut-off. If a subject is not high for a particular marker, it is low for that marker. In general, the cut-off used for determining whether a subject is high or low should be selected such that the division becomes clinically relevant.
[0188] The term treating as used herein may refer to (1) preventing or delaying the appearance of one or more symptoms of the disorder; (2) inhibiting the development of the disorder or one or more symptoms of the disorder; (3) relieving the disorder, i.e., causing regression of the disorder or at least one or more symptoms of the disorder; and/or (4) causing a decrease in the severity of one or more symptoms of the disorder.
[0189] In an example, the labeled exogenous methionine is .sup.13C methionine.
[0190] In an example, the labeled and unlabeled levels of metabolite are measured by mass spectrometry or liquid chromatography mass spectrometry (LCMS).
[0191] Provided herein is a method of treating a subject having a methionine-dependent cancer, the method comprising: [0192] a) providing labeled homocysteine to a cancer sample obtained from the subject; [0193] b) measuring the levels of labeled S-adenosyl methionine and unlabeled S-adenosyl methionine in the sample; [0194] c) comparing the levels of labeled S-adenosyl methionine to unlabeled S-adenosyl methionine; wherein a low level of labeled S-adenosyl methionine as compared to unlabeled S-adenosyl methionine indicates that the cell is dependent on exogenous methionine; and [0195] d) administering a methionine cycle inhibitor if the subject is found to have a methionine-dependent cancer.
[0196] In an example, the labeled homocysteine is deuterated homo-cysteine.
[0197] The term low as used herein, refers to a measure that is lower than normal, lower than a standard such as a predetermined measure or a subgroup measure or that is relatively lower than another subgroup measure. A normal measure may be determined according to any method available to one skilled in the art. The term low may also refer to a measure that is equal to or lower than a predetermined measure, such as a predetermined cutoff.
[0198] In an example, there is provided a methionine cycle inhibitor for use in treating cancer, wherein the methionine cycle inhibitor is to be administered to a subject. The cancer may be a metastatic cancer. The cancer may also be a methionine dependent cancer.
[0199] In an example, there is provided the use of a methionine cycle inhibitor for the manufacture of a medicament for treating cancer, wherein the medicament is to be administered to a subject.
[0200] In an example, there is provided a methionine cycle inhibitor for use in reducing the risk of recurrence of cancer in a subject following an anti-cancer, wherein the methionine cycle inhibitor is to be administered to the subject.
[0201] In an example, there is provided the use of a methionine cycle inhibitor for the manufacture of a medicament for reducing the risk of recurrence of cancer in a subject following an anti-cancer therapy, wherein the medicament is to be administered to a subject.
[0202] In an example, there is provided a methionine cycle inhibitor for use in treating a subject having a methionine-dependent cancer, wherein [0203] a) a labeled exogenous methionine is provided to a cancer sample obtained from the subject; [0204] b) the labeled and unlabeled levels of a metabolite selected from the group consisting of SAM, SAH and homocysteine are measured in the sample; [0205] c) the levels of the labeled metabolite to the unlabeled metabolite are compared; [0206] wherein a high level of labeled metabolite as compared to the unlabeled metabolite indicates that the subject has a methionine-dependent cancer; and wherein a methionine cycle inhibitor is to be administered to the subject if the subject is found to have a methionine-dependent cancer.
[0207] In an example, there is provided the use of a methionine cycle inhibitor in the manufacture of a medicament for treating a subject having a methionine-dependent cancer, wherein [0208] a) a labeled exogenous methionine is provided to a cancer sample obtained from the subject; [0209] b) the labeled and unlabeled levels of a metabolite selected from the group consisting of SAM, SAH and homocysteine are measured in the sample; [0210] c) the levels of the labeled metabolite to the unlabeled metabolite are compared; [0211] wherein a high level of labeled metabolite as compared to the unlabeled metabolite indicates that the subject has a methionine-dependent cancer; and wherein the medicament is to be administered to the subject if the subject is found to have a methionine-dependent cancer.
[0212] In an example, there is provided a methionine cycle inhibitor for use in treating a subject having a methionine-dependent cancer, wherein [0213] a) a labeled homocysteine is provided to a cancer sample obtained from the subject; [0214] b) the levels of labeled S-adenosyl methionine and unlabeled S-adenosyl methionine are measured in the sample; [0215] c) the levels of labeled S-adenosyl methionine to unlabeled S-adenosyl methionine are compared; wherein a low level of labeled S-adenosyl methionine as compared to unlabeled S-adenosyl methionine indicates that the cell is dependent on exogenous methionine; and [0216] wherein a methionine cycle inhibitor is to be administered to the subject if the subject is found to have a methionine-dependent cancer.
[0217] In an example, there is provided the use of a methionine cycle inhibitor in the manufacture of a medicament for treating a subject having a methionine-dependent cancer, wherein [0218] a) a labeled homocysteine is provided to a cancer sample obtained from the subject; [0219] b) the levels of labeled S-adenosyl methionine and unlabeled S-adenosyl methionine are measured in the sample; [0220] c) the levels of labeled S-adenosyl methionine to unlabeled S-adenosyl methionine are compared; wherein a low level of labeled S-adenosyl methionine as compared to unlabeled S-adenosyl methionine indicates that the cell is dependent on exogenous methionine; and [0221] wherein the medicament is to be administered to the subject if the subject is found to have a methionine-dependent cancer.
[0222] The dosage of the methionine cycle inhibitor or a pharmaceutically acceptable salt, solvate, or prodrug thereof, may be administered to a subject in the range from 0.1 mg/kg to 100 mg/kg. For instance, the dosage amount may be 0.5 mg/kg, 1.0 mg/kg, 2.0 mg/kg, 3.0 mg/kg, 4.0 mg/kg, 5.0 mg/kg, 6.0 mg/kg, 7.0 mg/kg, 8.0 mg/kg, 9.0 mg/kg, 10.0 mg/kg, 11.0 mg/kg, 12.0 mg/kg, 13.0 mg/kg, 14.0 mg/kg, 15.0 mg/kg, 16.0 mg/kg, 17.0 mg/kg, 18.0 mg/kg, 19.0 mg/kg, 20.0 mg/kg, 21.0 mg/kg, 22.0 mg/kg, 23.0 mg/kg, 24.0 mg/kg, 25.0 mg/kg, 26.0 mg/kg, 27.0 mg/kg, 28.0 mg/kg, 29.0 mg/kg, 30.0 mg/kg, 31.0 mg/kg, 32.0 mg/kg, 33.0 mg/kg, 34.0 mg/kg, 35.0 mg/kg, 36.0 mg/kg, 37.0 mg/kg, 38.0 mg/kg, 39.0 mg/kg, 40.0 mg/kg, 41.0 mg/kg, 42.0 mg/kg, 43.0 mg/kg, 44.0 mg/kg, 45.0 mg/kg, 46.0 mg/kg, 47.0 mg/kg, 48.0 mg/kg, 49.0 mg/kg, 50.0 mg/kg, 51.0 mg/kg, 52.0 mg/kg, 53.0 mg/kg, 54.0 mg/kg, 55.0 mg/kg, 56.0 mg/kg, 57.0 mg/kg, 58.0 mg/kg, 59.0 mg/kg, 60.0 mg/kg, 61.0 mg/kg, 62.0 mg/kg, 63.0 mg/kg, 64.0 mg/kg, 65.0 mg/kg, 66.0 mg/kg, 67.0 mg/kg, 68.0 mg/kg, 69.0 mg/kg, 70.0 mg/kg, 71.0 mg/kg, 72.0 mg/kg, 73.0 mg/kg, 74.0 mg/kg, 75.0 mg/kg, 76.0 mg/kg, 77.0 mg/kg, 78.0 mg/kg, 79.0 mg/kg, 80.0 mg/kg, 81.0 mg/kg, 82.0 mg/kg, 83.0 mg/kg, 84.0 mg/kg, 85.0 mg/kg, 86.0 mg/kg, 87.0 mg/kg, 88.0 mg/kg, 89.0 mg/kg, 90.0 mg/kg, 91.0 mg/kg, 92.0 mg/kg, 93.0 mg/kg, 94.0 mg/kg, 95.0 mg/kg, 96.0 mg/kg, 97.0 mg/kg, 98.0 mg/kg, or 99.0 mg/kg or an amount in between.
[0223] The methionine cycle inhibitor or a pharmaceutically acceptable salt, solvate, or prodrug thereof may be administered as a single or multiple doses.
[0224] The methionine cycle inhibitor or a pharmaceutically acceptable salt, solvate, or prodrug thereof may be administered continuously in multiple doses to a subject for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 32 days, 33 days, 34 days, 35 days, 36 days, 37 days, 38 days, 39 days, 40 days, 41 days, 42 days, 43 days, 44 days, 45 days, 46 days, 47 days, 48 days, 49 days, 50 days, 51 days, 52 days, 53 days, 54 days, 55 days, 56 days, 57 days, 58 days, 59 days, 60 days, 61 days, 62 days, 63 days, 64 days, 65 days, 66 days, 67 days, 68 days, 69 days, 70 days, 71 days, 72 days, 73 days, 74 days, 75 days, 76 days, 77 days, 78 days, 79 days, 80 days, 81 days, 82 days, 83 days, 84 days, 85 days, 86 days, 87 days, 88 days, 89 days, 90 days, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months or 12 months or any time period inbetween.
[0225] In an example, there is provided a pharmaceutical composition comprising the methionine cycle inhibitor or a pharmaceutically acceptable salt, solvate, or prodrug thereof.
[0226] Generally, the dosage of the compound of formula (I), or a pharmaceutically acceptable salt, solvate, or prodrug thereof, in a pharmaceutical composition may be in the range from 10-5,000 mg per subject, and typically will be in the range of 50-2,000 mg per subject, and more typically between 20-200 mg per subject.
[0227] Methods for the preparation of pharmaceutical compositions are known in the art, for example as described in Remington's Pharmaceutical Sciences, 18th ed., 1990, Mack Publishing Co., Easton, Pa. and U.S. Pharmacopeia: National Formulary, 1984, Mack Publishing Company, Easton, Pa.
[0228] Administration and delivery of the compositions may be for example by the intravenous, intraperitoneal, subcutaneous, intramuscular, oral, or topical route, or by direct injection. The mode and route of administration in most cases will depend on the severity and frequency of the concussive events.
[0229] The dosage form, frequency and will depend on the mode and route of administration.
[0230] The administration of the methionine cycle inhibitor, or a pharmaceutically acceptable salt, solvate, or prodrug thereof, and other agents may also include the use of one or more pharmaceutically acceptable additives, including pharmaceutically acceptable salts, amino acids, polypeptides, polymers, solvents, buffers, excipients, preservatives and bulking agents, taking into consideration the particular physical, microbiological and chemical characteristics of the agents to be administered.
[0231] For example, the methionine cycle inhibitor, or a pharmaceutically acceptable salt, solvate, or prodrug thereof, can be prepared into a variety of pharmaceutically acceptable compositions in the form of, e.g., an aqueous solution, an oily preparation, a fatty emulsion, an emulsion, a lyophilised powder for reconstitution, etc. and can be administered as a sterile and pyrogen free intramuscular or subcutaneous injection or as injection to an organ, or as an embedded preparation or as a transmucosal preparation through nasal cavity, rectum, uterus, vagina, lung, etc. The composition may be administered in the form of oral preparations (for example solid preparations such as tablets, caplets, capsules, granules or powders; liquid preparations such as syrup, emulsions, dispersions or suspensions).
[0232] It will be appreciated that any compound that is a prodrug of a compound of methionine cycle inhibitor is also within the scope and spirit of the invention. The term pro-drug is used in its broadest sense and encompasses those derivatives that are converted in vivo to the compounds of the invention. Such derivatives would readily occur to those skilled in the art, and include, for example, phosphonic acid derivatives.
[0233] Compositions containing the methionine cycle inhibitor, or a pharmaceutically acceptable salt, solvate, or prodrug thereof, may also contain one or more pharmaceutically acceptable preservatives, buffering agents, diluents, stabilisers, chelating agents, viscosity enhancing agents, dispersing agents, pH controllers, or isotonic agents.
[0234] Examples of suitable preservatives are benzoic acid esters of para-hydroxybenzoic acid, propylene glycol, phenols, phenylethyl alchohol or benzyl alcohol. Examples of suitable buffers are sodium phosphate salts, citric acid, tartaric acid and the like. Examples of suitable stabilisers are, antioxidants such as alpha-tocopherol acetate, alpha-thioglycerin, sodium metabisulphite, ascorbic acid, acetylcysteine, 8-hydroxyquinoline, chelating agents such as disodium edetate. Examples of suitable viscosity enhancing agents, suspending or dispersing agents are substituted cellulose ethers, substituted cellulose esters, polyvinyl alchohol, polyvinylpyrrolidone, polyethylene glcols, carbomer, polyoxypropylene glycols, sorbitan monooleate, sorbitan sesquioleate, polyoxyethylene hydrogenated castor oil 60.
[0235] Examples of suitable pH controllers include hydrochloric acid, sodium hydroxide and the like. Examples of suitable isotonic agents are glucose, D-sorbitol or D-mannitol, sodium chloride.
[0236] The administration of the methionine cycle inhibitor, or a pharmaceutically acceptable salt, solvate, or prodrug thereof, in the various embodiments of the present invention may also be in the form of a composition containing a pharmaceutically acceptable carrier, diluent, excipient, suspending agent, lubricating agent, adjuvant, vehicle, delivery system, emulsifier, disintegrant, absorbent, preservative, surfactant, colorant, glidant, anti-adherant, binder, flavorant or sweetener, taking into account the physical, chemical and microbiological properties of the agents being administered.
[0237] For these purposes, the composition may be administered orally, parenterally, by inhalation spray, adsorption, absorption, topically, rectally, nasally, mucosally, transdermally, bucally, vaginally, intraventricularly, via an implanted reservoir in dosage formulations containing conventional non-toxic pharmaceutically-acceptable carriers, or by any other convenient dosage form. The term parenteral as used herein includes subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intraventricular, intrasternal, and intracranial injection or infusion techniques.
[0238] When administered parenterally, the compositions will normally be in a unit dosage, sterile, pyrogen free injectable form (solution, suspension or emulsion, which may have been reconstituted prior to use), which is generally isotonic with the blood of the recipient with a pharmaceutically acceptable carrier. Examples of such sterile injectable forms are sterile injectable aqueous or oleaginous suspensions. These suspensions may be formulated according to techniques known in the art using suitable vehicles, dispersing or wetting agents and suspending agents. The sterile injectable forms may also be sterile injectable solutions or suspensions in non-toxic parenterally acceptable diluents or solvents, for example, as solutions in 1,3-butanediol. Among the pharmaceutically acceptable vehicles and solvents that may be employed are water, ethanol, glycerol, saline, Ringer's solution, dextrose solution, isotonic sodium chloride solution, and Hanks' solution. In addition, sterile, fixed oils are conventionally employed as solvents or suspending mediums. For this purpose, any bland fixed oil may be employed including synthetic mono- or di-glycerides, corn, cottonseed, peanut, and sesame oil. Fatty acids such as ethyl oleate, isopropyl myristate, and oleic acid and its glyceride derivatives, including olive oil and castor oil, especially in their polyoxyethylated versions, are useful in the preparation of injectables. These oil solutions or suspensions may also contain long-chain alcohol diluents or dispersants.
[0239] The carrier may contain minor amounts of additives, such as substances that enhance solubility, isotonicity, and chemical stability, for example anti-oxidants, buffers and preservatives.
[0240] In addition, the compositions may be in a form to be reconstituted prior to administration. Examples include lyophilisation, spray drying and the like to produce a suitable solid form for reconstitution with a pharmaceutically acceptable solvent prior to administration.
[0241] Compositions may include one or more buffers, bulking agents, isotonic agents and cryoprotectants and lyoprotectants. Examples of excipients include, phosphate salts, citric acid, non-reducing such as sucrose or trehalose, polyhydroxy alcohols, amino acids, methylamines, and lyotropic salts which are usually used instead of reducing sugars such as maltose or lactose.
[0242] When administered orally, the methionine cycle inhibitor, or a pharmaceutically acceptable salt, solvate, or prodrug thereof, will usually be formulated into unit dosage forms such as tablets, caplets, cachets, powder, granules, beads, chewable lozenges, capsules, liquids, aqueous suspensions or solutions, or similar dosage forms, using conventional equipment and techniques known in the art. Such formulations typically include a solid, semisolid, or liquid carrier. Exemplary carriers include excipients such as lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, mineral oil, cocoa butter, oil of theobroma, alginates, tragacanth, gelatin, syrup, substituted cellulose ethers, polyoxyethylene sorbitan monolaurate, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and the like.
[0243] A tablet may be made by compressing or molding the agent optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing, in a suitable machine, the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active, or dispersing agent. Moulded tablets may be made by moulding in a suitable machine, a mixture of the powdered active ingredient and a suitable carrier moistened with an inert liquid diluent.
[0244] The administration of the compound of a methionine cycle inhibitor, or a pharmaceutically acceptable salt, solvate, or prodrug thereof, may also utilize controlled release technology.
[0245] The methionine cycle inhibitor, or a pharmaceutically acceptable salt, solvate, or prodrug thereof, may also be administered as a sustained-release pharmaceutical composition. To further increase the sustained release effect, the agent may be formulated with additional components such as vegetable oil (for example soybean oil, sesame oil, camellia oil, castor oil, peanut oil, rape seed oil); middle fatty acid triglycerides; fatty acid esters such as ethyl oleate; polysiloxane derivatives; alternatively, water-soluble high molecular weight compounds such as hyaluronic acid or salts thereof, carboxymethylcellulose sodium hydroxypropylcellulose ether, collagen polyethylene glycol polyethylene oxide, hydroxypropylmethylcellulosemethylcellulose, polyvinyl alcohol, polyvinylpyrrolidone.
[0246] Alternatively, the compound of methionine cycle inhibitor, or a pharmaceutically acceptable salt, solvate, or prodrug thereof, may be incorporated into a hydrophobic polymer matrix for controlled release over a period of days. The agent may then be moulded into a solid implant, or externally applied patch, suitable for providing efficacious concentrations of the agents over a prolonged period of time without the need for frequent re-dosing. Such controlled release films are well known to the art. Other examples of polymers commonly employed for this purpose that may be used include nondegradable ethylene-vinyl acetate copolymer a degradable lactic acid-glycolic acid copolymers, which may be used externally or internally. Certain hydrogels such as poly(hydroxyethylmethacrylate) or poly(vinylalcohol) also may be useful, but for shorter release cycles than the other polymer release systems, such as those mentioned above.
[0247] The carrier may also be a solid biodegradable polymer or mixture of biodegradable polymers with appropriate time-release characteristics and release kinetics. The agent may then be moulded into a solid implant suitable for providing efficacious concentrations of the agents over a prolonged period of time without the need for frequent re-dosing. The agent can be incorporated into the biodegradable polymer or polymer mixture in any suitable manner known to one of ordinary skill in the art and may form a homogeneous matrix with the biodegradable polymer, or may be encapsulated in some way within the polymer, or may be moulded into a solid implant.
[0248] For topical administration, the methionine cycle inhibitor, or a pharmaceutically acceptable salt, solvate, or prodrug thereof, may be in the form of a solution, spray, lotion, cream (for example a non-ionic cream), gel, paste or ointment. Alternatively, the composition may be delivered via a liposome, nanosome, rivosome, or nutri-diffuser vehicle.
[0249] It will be appreciated that other forms of administration of agents are also contemplated, including the use of a nucleic acid encoding a polypeptide for delivering of such agents.
[0250] In an example, there is provided a method for determining if a subject has a methionine-dependent cancer, the method comprising the step of: a) determining the expression levels of a biomarker selected from the group of MAT2A, MTHFR, MTR, SAHH, GLDC, SHMT2 and CD166 in a cancer specimen obtained from a subject, wherein an increased expression level of a biomarker in the cancer specimen as compared to the expression level of the biomarker in a non-cancerous cancer specimen indicates that the subject has a methionine-dependent cancer.
[0251] Throughout this specification, unless the context requires otherwise, the word comprise, or variations such as comprises or comprising, will be understood to imply the inclusion of a stated element or integer or method step or group of elements or integers or method steps but not the exclusion of any other element or integer or method steps or group of elements or integers or method steps.
[0252] As used in the subject specification, the singular forms a, an and the include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to a method includes a single method, as well as two or more methods; reference to an agent includes a single agent, as well as two or more agents; reference to the disclosure includes a single and multiple aspects taught by the disclosure; and so forth. Aspects taught and enabled herein are encompassed by the term invention. Any variants and derivatives contemplated herein are encompassed by embodiments of the invention.
EXAMPLES
[0253] Aspects disclosed herein are further described by the following non-limiting Examples. Materials and Methods employed are described below.
Materials and Methods
[0254] Tissue culture
[0255] Two tumor sphere (TS) lines independently derived from two patients, and TS GLDC KD lines were maintained in DMEM/F12 (US Biomedical) supplemented with 4 mg/ml Bovine Serum Albumin (Sigma), Non-essential animo acids, sodium pyruvate (Life Technologies), 20 ng/ml Epidermal Growth Factor, 4 ng/ml bovine Fibroblast Growth Factor and InsulinTransferrin Selenium (Sigma). TS-derived adherent (Adh) and NIH 3T3 lines were maintained in the same media as above without EGF, bFGF, ITS and BSA, but instead supplemented with 10% fetal bovine serum. Glutamine, methionine, serine-glycine, leucine, tryptophan and threonine starvation media were generated from DMEM/F12 powder (US Biomedical) lacking the corresponding metabolites. Sodium formate and 5-Methyl-THF disodium salt was purchased from Santa Cruz Biotechnology.
Inhibitors
[0256] Cis-platinum (cis-Diammineplatinum(II) dichloride) and MG132 (10 M final concentration) was purchased from Sigma, FIDAS-5 (final concentration of 10 M in culture medium) from Merck Millipore and D9 (final concentration of 500 nM in culture medium).
Immunohistochemistry Analysis
[0257] The NSCLC tissue tumor microarray (n=47) comprising of paired formalin-fixed paraffin-embedded patient normal and tumor samples at 4 m thickness were constructed and IHC was performed by Singhealth Advanced Molecular Pathology Laboratory at Singapore General Hospital using a Bond Leica Machine, using Bond Epitope solution 1. The staged tissue tumor microarray (LUM 961and LUC1021) comprising of formalin fixed paraffin-embedded NSCLC primary and metastatic tumors was purchased from Pantomics. Anti-MTHFR (ab125707) from Abcam and Anti-MAT2A (HPA043028) from Sigma was used for both IHC analyses. IHC of the staged tissue microarray sections was performed using the VECTASTAIN ABC kits (Vector Labs). Samples were subsequently scored by visual assessment as 0/+1, +2 or +3, according to the staining intensities MAT2A and MTHFR.
Immunofluorescence Analyses
[0258] Formalin-fixed paraffin-embedded NSCLC samples were obtained and cut into 4 m sections. Sections were deparaffinized and antigen-retrieval was carried out in citrate buffer in the presence of 0.5% Tween 20. Sections were further permabilized in 0.2% Triton X100 and then quenched with TruBlack (Gold Biotechnology). Sections were then incubated with Anti-MAT2A (GTX50027) from Genetex and Anti-CD166 (HPA010926) from Sigma. Alexa-Fluor 594 Goat anti-Mouse (A11005) and Alexa-Fluor 647 Donkey anti-Rabbit (A21245) from ThermoFisher was used as secondary antibodies. Images were visualized and captured using the Zeiss Observer D1 epifluorescence microscope.
Tumor Implantation and Collection
[0259] 510.sup.5 single cells were mixed in a 1:1 mixture of serum free DMEM/F12 and Matrigel (BD) and injected subcutaneously into the flanks of 4-6 week old male and female NOD.Cg-Prkdc.sup.scid II2rg.sup.tmlwjl SzJ (Jackson Laboratories). About 6 weeks later, or when tumor sizes exceed 2 cm in length, mice were sacrificed and tumors harvested for analysis. All animal experiments were approved by the Agency for Science Technology and Research SingaporeBiological Resource Centre. Mice were randomized by sex.
Orthotopic Tumor Implantation.
[0260] GFP expressing 1.510.sup.6 single TS cells (transduced with PLL3.7 vector) with suspended in tumor sphere media and injected intravenously through tail-vein into 4-6 week old male and female NOD.Cg-Prkdc.sup.scid II2rg.sup.tmlwjl SzJ (Jackson Laboratories) mice. Mice were continuously monitored and then sacrificed at 5 weeks post injection. Lungs were harvested, fixed in 4% paraformaldehyde and embedded in paraffin for subsequent analysis. Anti-GFP (ab13970) antibody from Abcam and Alexa-Fluor Goat 488 anti-Chicken antibody (A-11039; ThermoFisher) was used to visualize and quantify GFP-positive lesions using immunofluorescence protocol outlined above. Mice were randomized by sex.
Cell Proliferation Assays
[0261] Cells were seeded into 96-well plates at a density of 2,000 cells/well for TS cells and 500 cells/well for Adh cells. The relative number of viable cells was determined by the quantification of ATP using the CellTiter-Glo Luminescent Cell Viability Assay (Promega) system.
ATP Analyses
[0262] Cells were seeded into 96-well plates at a density of 1,000 cells/well at 10 replicate wells per condition. Cells were then left to equilibrate at 37 C. for 3 h. ATP was then quantified using the CellTiter-GLo reagent (Promega). 5 biological replicates were used.
Soft Agar Colony Formation
[0263] 2.5 ml lower layer of 0.7% agar in complete DMEM/F12 with 10% fetal bovine serum was placed in 3 wells of a 6 well dish, and permitted to solidify. 210.sup.4 Cells (for 3 wells) were then suspended in a 2 ml layer of 0.35% agar in complete DMEM/F12 with 10% fetal bovine serum and layered on top of the bottom layer. Colonies were stained with crystal violet and counted after approximately 2 months.
Apoptosis Assay
[0264] 10.sup.6 cells were stained with FITC Annexin V and PI, and analysed for apoptosis by flow cytometry using an LSRII Cell Analyzer (BD) according to manufacturer's instructions.
Cell Cycle Analysis
[0265] Cell cycle analysis was performed using the BID Pharmingen BrdU FITC Flow kit according to manufacturer's instructions.
Metabolomic Analyses
[0266] The following reagents and materials were purchased from the indicated sources. Optima grade methanol: Fisher Scientific (Loughborough, UK); de-ionized water (18.2 m): Sartorius (Gottingen, Germany); Tricine salt, sodium chloride: SigmaAldrich, (St Louis, Mo.); Acetonitrile, chloroform, formic acid: Merck (Whitehouse Station, N.J.); Isotopic labeled Methionine .sup.13C.sub.5 .sup.15N was purchased from Sigma; Homocysteine .sup.2D.sub.4 was purchased from Cambridge Isotope Laboratories.
Sample Preparation of Cell Lysate for Metabolomic Analyses
[0267] For suspension cell culture, 10 million cells per sample were obtained and quenched with 4 volumes of ice-cold 150 mM sodium chloride solution. The cell pellets were collected by centrifugation of the quenched samples at 3000 g for 5 mM at 4 C. and the supernatant was aspirated and discarded. For adherent cell culture, the media was gently aspirated and the cells on the surfaces of the well plates were gently washed with ice-cold 150 mM sodium chloride solution thrice. Ice-cold sodium chloride was added to the plate and a cell scraper was used to release adherent cells from the plate surface. The cell pellets were collected as described earlier and kept on ice. For pulse-chase analysis, cells that were starved with methionine for 16 h in methionine-free media were given a single treatment of labeled methionine (.sup.13C.sub.5, .sup.15N) or labelled homocysteine (.sup.2D.sub.4). The cells were either lysed immediately as described previously or chased in the incubating media at various time points.
[0268] The cell pellets were extracted using a two-phase liquid-liquid extraction protocol based on the modified method of Bligh and Dyer.sup.76. Briefly, methanol, chloroform and 3.8 mM tricine solution (approx. 1:1:0.5 v/v) was used to separate polar metabolites (aqueous fraction) from lipid species (organic fraction). Polar metabolites in the aqueous fraction comprising of methanol and water were collected in 2 mL Eppendorf tubes. Extracts were stored at 80 C. prior to UPLC-MS analysis. The samples were dried under vacuum pressure at 4 C. using a CentriVap centrifugal vacuum concentrator (Labconco, Mo., USA) and reconstituted in 5% methanol-water solution (v/v) prior to LC/MS analysis.
UPLC-MS Analysis
[0269] Untargeted LC/MS analysis of the polar metabolites was performed using an ultra-high performance liquid chromatography (UPLC) system (ACQUITY, Waters Corp, Milford, Mass.) interfaced with a mass spectrometer (LTQ-Orbitrap; Thermo Scientific, Bremen, Germany) Electrospray ionization (ESI) in the MS was conducted in both positive and negative modes in full scan with a mass range of 50 to 1000 m/z at a resolution of 15,000. Sheath and auxiliary gas flow was set at 40 and 15 (arbitrary units) respectively, with a capillary temperature of 400 C. The ESI source and capillary voltages were 4.5 kV and 40V respectively for positive ESI mode, and 2.8 kV and 15V respectively for negative ESI mode. Mass calibration was performed using standard LTQ-Orbitrap calibration solution (Thermo Scientific) prior to sample injection. A pooled quality control (QC) mixture comprised of equal aliquots of all samples was run at regular intervals throughout each analytical batch. The samples were randomized for each analytical batch and triplicate injections were performed for each sample.
[0270] Targeted LC/MS/MS analysis was performed using a UPLC system (ACQUITY, Waters Corp)) interfaced to a triple quadrupole mass spectrometer (Xevo TQ-S, Waters Corp). Multiple reaction monitoring (MRM) experiments were performed in both ESI positive and negative mode using elution gradient as described in Table 1. The compound-dependent MS parameters for the analytes are shown in Table 2. The source temperature and desolvation temperature were set at 150 C. and 500 C. respectively. The cone gas flow was 150 L/h and desolvation gas flows were 700 L/h (ESI+) and 300 L/h (ESI). The capillary voltage was 2.90 kV for the positive ESI mode and 1.0 kV for the negative ESI mode.
TABLE-US-00001 TABLE 1 Elution condition for LC/MS analysis Time Solvent Solvent Solvent Flow rate (min) A (%) B1 (%) B2 (%) (mL/min) Sample analysis Initial 99.9 0.1 0.400 0.50 99.9 0.1 8.50 50.0 50.0 8.51 2.0 98.0 11.50 2.0 98.0 Column wash 12.50 2.0 98.0 0.500 15.50 2.0 98.0 Column equilibration 16.50 99.9 0.1 0.400 18.00 99.9 0.1 Solvent A: 0.1% formic acid in water, Solvent B1: 0.1% formic acid in methanol and Solvent B2: 0.1% formic acid in acetonitrile.
TABLE-US-00002 TABLE 2 Optimized compound-dependent MS parameters using Xevo TQ-S mass spectrometer. Parent ion Daughter Cone Collision mass ion mass Dwell time voltage Energy ESI Analyte (m/z) (m/z) (s) (V) (V) Mode Methionine 150 105 0.025 40 15 Pos Methionine (.sup.13C.sub.5.sup.15N.sub.1) 156 109 0.025 40 15 Pos *Regenerated methionine 155 108 0.025 40 15 Pos from Homocysteine (.sup.13C.sub.4.sup.15N.sub.1) S-adenosylmethionine 399 136 0.025 62 42 Pos *SAM (.sup.13C.sub.5.sup.15N.sub.1) 405 136 0.025 62 42 Pos *Regenerated SAM from 404 136 0.025 62 42 Pos Homocysteine (.sup.13C.sub.4.sup.15N.sub.1) S-adenosylhomocysteine 385 134 0.025 66 33 Pos *SAH (.sup.13C.sub.5.sup.15N.sub.1) 390 139 0.025 66 33 Pos Homocysteine 136 90 0.025 15 16 Pos Deuterium Labelled 140 94 0.025 15 16 Pos Homocysteine (.sup.2D.sub.4) *Methionine (.sup.2D.sub.4) 154 108 0.025 40 15 Pos *SAM (.sup.2D.sub.4) 404 136 0.025 62 42 Pos *SAH (.sup.2D.sub.4) 389 137 0.025 66 33 Pos Hippuric acid 185 110 0.025 30 16 Pos (Internal Standard)
[0271] The MRM transitions and the MS parameters were optimized using either analytical grade standards or intracellularly synthesized metabolites (*).
[0272] All chromatographic separations were performed using an ACQUITY UPLC HSS T3 1.7 m 502.1 mm i.d. column (Waters Corp). The column and autosampler temperatures were maintained at 30 C. and 4 C. respectively. The elution condition is indicated in Table 1. The injection volume was 4 L.
Data Pre-Processing and Metabolite Identification
[0273] For untargeted LC/MS, the raw UPLC-MS data was pre-processed and analyzed using an in-house software which incorporated the XCMS peak finding algorithm. The pooled QC mixture was used for signal correction between and within each batch analysis. Samples were normalized based on their cell counts. The identities of marker metabolites were verified by comparison of their retention time and mass spectra with commercially available standards.
[0274] For targeted LC/MS analysis, the chromatographic peak integration was performed using Targetlynx software (Waters Corp). In addition, for the .sup.13C-labeled methionine pulse-chase experiments, the atomic percent excess (APE) for each species was calculated and natural abundance corrected from an isotopomer matrix accounting for the presence of natural abundance carbons distributed throughout each possible parent/daughter ion combination (Table 3).
TABLE-US-00003 TABLE 3 Metabolite species in .sup.13C-labeled methionine pulse-chain experiment and the corresponding MRM transition pairs (Q1/Q3) Metabolites Q1/Q3 Methionine Endogenous methionine 150/105 Methionine (.sup.13C.sub.5.sup.15N.sub.1) 156/109 *Regenerated methionine from 155/108 Homocysteine (.sup.13C.sub.4.sup.15N.sub.1) S-adenosylmethionine Endogenous S-adenosylmethionine 399/136 *SAM (.sup.13C.sub.5.sup.15N.sub.1) 405/136 *Regenerated SAM from 404/136 Homocysteine (.sup.13C.sub.4.sup.15N.sub.1) S-adenosylhomocysteine Endogenous S-adenosylhomocysteine 385/134 *SAH (.sup.13C.sub.5.sup.15N.sub.1) 390/139
RNA Interference and Lentiviral Transduction
[0275] Short hairpin RNAs (shRNA) were cloned into the lentiviral plasmid pLKO.1 (Addgene). 2 shRNAs each was used against GLDC, MAT2A and MTHFR. Tumor sphere lines were infected with plKO.1 lentivirus and selected in 2 g/ml puromycin for 7 days.
[0276] Sense sequences are as follows:
TABLE-US-00004 ControlLuciferaseshRNA: (SEQIDNO:1) 5-CCGGCGCTGAGTACTTCGAAATGTCCTCGAGGACATTTCGAAGTACT CAGCGTTTTTG-3; SHMT2sh1: (SEQIDNO:2) 5-CCGGCCGGAGAGTTGTGGACTTTATCTCGAGATAAAGTCCACAACTC TCCGGTTTTTG-3; SHMT2sh2: (SEQIDNO:3) 5-CCGGGTCTGACGTCAAGCGGATATCCTCGAGGATATCCGCTTGACGT CAGACTTTTTG-3; GLDCsh1: (SEQIDNO:4) 5-CCGGCCTGCCAACATCCGTTTGAAACTCGAGTTTCAAACGGATGTTG GCAGGTTTTTG-3; GLDCsh2: (SEQIDNO:5) 5-CCGGCCACGGAAACTGCGATATTAACTCGAGTTAATATCGCAGTTTC CGTGGTTTTTG-3; MAT2Ash1: (SEQIDNO:6) 5CCGGAGCAGTTGTGCCTGCGAAATACTCGAGTATTTCGCAGGCACAA CTGCTTTTTTG-3; MAT2Ash2: (SEQIDNO:7) 5-CCGGCCAGATAAGATTTGTGACCAACTCGAGTTGGTCACAAATCTT ATCTGGTTTTTG-3; MTHFRsh1: (SEQIDNO:8) 5-CCGGATATTAGACAGGACCATTATGCTCGAGCATAATGGTCCTGTC TAATATTTTTTG-3; MTHERsh2: (SEQIDNO:9) 5-CCGGAGAGTATCCAAGACGACATTCCTCGAGGAATGTCGTCTTGGA TACTCTTTTTT-3; mat2ash1: (SEQIDNO:10) 5-CCGGTTTGGAGGACGTACGTAATAACTCGAGTTATTACGTACGTCC TCCAAATTTTTG-3; mat2ash2: (SEQIDNO:11) 5-CCGGACCGGAATGAGGAAGATATTGCTCGAGCAATATCTTCCTCAT TCCGGTTTTTTG-3.
Immunoblotting
[0277] 1.510.sup.6 cells were lysed in Llaemli-SDS buffer and then sonicated. Total protein concentration was measured by Bradford assay. Total cell lysates were separated by SDS-PAGE and transferred onto nitrocellulose, followed by blocking in 5% (v/v) milk in Tris-buffered saline in Tween 20, probing with the indicated antibodies and visualized by chemiluminescence (Roche). Primary antibodies used were anti--Actin (sc-47778), anti-GAPDH (sc-32233) from Santa Cruz; anti-GLDC (ab97625), anti-H3 (ab1791), anti-H3 (dimethylK36) (ab9049), anti-MAT2A (ab77471), anti-MTR (ab9209), anti-H3 (trimethylK79) (ab2621), anti-MTHFR (ab125707), anti-MTAP (ab ab55517) from Abcam; anti-H3(trimethyl K4) (39159), anti-H3(trimethyl K27)(39155), anti-H3(trimethylK36)(61101) and anti-H3(trimethylK9)(39765) from Active Motif; anti--catenin (BD610154) from BD Biosciences; anti-SHMT2 (HPA020549)and anti-SAHH (WH0000191M8) from Sigma; anti-Symmetric Di-Methyl Arginine Motif (13222) from CST.
Molecular Cloning
[0278] The open reading frame for human MTHFR was first cloned into the lentiviral expression plasmid PLVX-Tight. The modified doxycyline-inducible promoter sequence was then replaced with a constitutive CMV promoter sequence to allow for constitutive expression of MTHFR. The open reading frame for the shRNA-resistant human GLDC was also cloned into the same modified PLVX-CMV construct.
Protein Turnover Experiments
[0279] 510.sup.5 cells were treated with 20 g/ml of cycloheximide (Sigma) and harvested for immunoblotting at indicated time points thereafter.
Analysis of -ketoglutarate/Succinate Ratios
[0280] Analysis of intracellular o-ketoglutarate and succinate levels were performed using the BioVision kits (K677, K649) according to manufacturer's instructions.
Statistical Analysis
[0281] Graphpad Prism (Graphpad Software) v 7.0 was used for statistical analyses. No statistical methods were used to predetermine sample size. Statistical analysis in
Data Availability
[0282] The metabolomics datasets generated or analysed during this study are included in this published article in Supplementary Tables 1 and 2. Additional datasets are also available from the corresponding author on reasonable request.
TABLE-US-00005 TABLE 4 Summary of metabolites detected in TS, Adh and GLDC KD cells (see also FIG. 1e) Total number of features in positive and negative ESI modes: 1409 Metabolites with confirmed identities Fold-change with respect to Adh Class/Function Metabolite ID Avg GLDC KD Avg TS Glycolysis intermediates Glucose 0.072 0.005 G6P/F6P 0.313 0.449 F1, 6P 0.689 0.530 GD3P 0.575 0.655 Lactate 0.219 1.036 TCA cycle intermediates Malate 0.285 1.224 Isocitrate/Citrate 0.714 1.832 Nucleotides CMP 1.162 2.570 UMP 1.057 3.305 AMP 1.633 4.701 GMP 2.327 11.079 CDP 1.513 4.882 ADP 1.007 2.723 cAMP 1.311 2.309 Guanosine 0.373 2.253 Uridine 0.110 3.789 Inosine 0.319 0.686 Inosine phosphate 1.903 6.261 Sugars/Nucleotide sugars N-acetylneuraminate 0.778 1.228 Glucosamine/Galactosamine 0.771 1.025 GDP-Fucose 1.172 2.124 UDP-Glucose/UDP-Galactose 0.461 0.922 UDP-GlcNAc/UDP-GalNAc 4.385 3.078 Amino acids Taurine 0.000 0.000 4-Hydroxy-L-Proline 1.129 0.987 Aminobutanoate 1.821 4.047 Arginine 12.024 23.917 Histidine 1.363 3.558 Aspartate 0.158 0.367 Glutamate 2.157 5.701 Alanine 0.093 0.367 Valine 0.723 2.467 Isoleucine 0.830 2.126 Leucine 2.512 7.634 Proline 0.808 3.774 Tryptophan 1.230 4.662 Phenylalanine 0.761 2.414 Tyrosine 1.885 8.315 Serine 0.847 0.691 Methionine cycle and redox Methionine 1.303 3.818 metabolism SAH 0.668 1.650 SAM 1.515 1.412 Glutamine 1.921 2.656 Pyroglutamate 0.398 2.543 Glutathione (Reduced) 1.482 2.679 Glutathione (Oxidized) 0.897 1.293 Cysteine-glutathione disulfide 27.124 0.884 Methyl group donors Choline 3.549 4.784 Betaine 15.076 63.656 Co-factors and vitamins Riboflavin 17.623 38.186 Folic acid Absent in Adh Absent in Adh Pantothenate 0.054 0.214 NAD 0.812 1.244 NADH 0.809 2.051 NADP 0.949 1.730 FAD 0.876 1.300 Phospholipid synthesis CDP-choline 2.166 3.781 CDP-ethanolamine 0.509 1.441 Glycerophosphocholine 2.979 3.874 Glycerophosphoethanolamine 1.887 5.004 Metabolites with putative identities Fold-change with respect to Adh Putative metabolite ID* Avg GLDC KD Avg TS *Putative metabolite 2-Phospho-glycerate/3-Phospho-glycerate 1.037 0.455 IDs based on 7,8-Dihydrobiopterin 0.653 1.573 accurate mass 10-Formyldihydrofolate Absent in Adh Absent in Adh matching with Adenylosuccinate 1.001 23.944 HMDB and KEGG Ala-Ala/Methyl-glutamine 0.013 0.238 databases Aminoimidazole ribotide 2.424 2.618 Asp-Gly 1.106 0.963 Asp-Phe 5.993 7.340 beta-Asp-Glu 0.567 0.968 CMP-N-glycoloylneuraminate 2.71E06 2.61E06 cyclic dGMP 0.891 1.170 Deoxy-ribose phosphate/Deoxy-xylulose phosphate 9.328 30.968 Dihydroxy-phenylalanine Absent in Adh Absent in Adh Flavin mononucleotide 0.792 1.488 Formyldihydrofolate 14.631 52.256 gamma-Glu-Gln Absent in Adh Absent in Adh Glu-Glu 86.079 349.636 Glycerophosphoglycerol 0.243 0.902 Glycerophosphoinositol 0.048 0.106 Glycerophosphoric acid 0.365 1.264 Homovanillate 1.124 0.989 Lys-Ala-Ala 24.109 201.054 Methylhippuric acid 13.994 36.452 N2-Acetyl-L-aminoadipate 3.482 6.350 N-Acetylasparagine/N-Formimino-glutamate 1.681 6.484 N-Acetylglucosaminate/N-Acetylgalactosaminate/ 1.079 0.833 Biopterin N-Acetylglucosamine phosphate/ 1.620 1.641 N-Acetylgalactosamine phosphate N-Acetylglutamine/Glycyl-hydroxyproline 3.230 8.694 N-glycoloylneuraminate 0.001 0.000 N-Methyl-aspartate 199.239 758.484 Phenylpyruvate 0.745 1.724 Phosphocholine 2.750 4.261 Phosphoribosyl-AMP 0.920 2.190 Pro-Gly 0.082 0.129 Propanoyl phosphate/Glycerol cyclic phosphate 0.245 0.988 Riboflavin cyclic phosphate 0.877 1.204 S-(Formylmethyl)glutathione 5.971 26.082 S-Lactoylglutathione 0.355 0.271 Selenohomocysteine 0.341 0.145 S-Methyl-thioribose phosphate 14.109 163.343 Thiamin diphosphate 0.606 0.365
TABLE-US-00006 TABLE 5 comparison of metabolite abundances detected in TS, Control Luc shRNA knockdown and GLDC KD Rescue cells normalized to the abundances in Adh cells (see also FIG. 13). Fold-change p-value with respect to Adh with respect to Adh (Welch's t-test) Class/Function Metabolite ID Avg TS Ave Luc Ave Rescue TS Luc Rescue Glycolysis Intermediate Glucose 0.65 0.61 0.63 0.003 <0.001 0.023 G6P/F6P 0.80 1.08 1.15 0.011 0.429 0.309 F1,6P 1.60 2.14 1.72 0.010 <0.001 0.029 GD3P 0.38 0.31 0.41 0.020 0.018 0.014 Lactate 1.21 1.31 2.30 0.110 0.019 0.033 TCA Cycle Intermediates Malate 1.47 1.40 1.76 0.020 0.008 0.007 Isocitrate/Citrate 2.11 2.09 2.30 0.010 <0.001 <0.001 Nucleotides CMP 6.13 7.85 9.87 <0.001 <0.001 0.010 UMP 7.97 8.54 11.68 0.004 <0.001 0.004 AMP 7.07 10.66 13.29 0.003 <0.001 0.012 GMP 10.53 14.07 18.56 0.008 0.004 0.027 CDP 4.52 3.75 4.16 0.002 <0.001 0.012 ADP 2.63 2.94 3.14 0.007 <0.001 0.012 cAMP 1.38 1.24 1.79 0.068 0.147 0.009 Guanosine 0.29 0.41 0.79 0.031 0.047 0.258 Uridine 0.27 0.48 0.56 0.085 0.147 0.193 Inosine 0.81 1.47 4.73 0.397 0.120 0.057 Inosine phosphate 2.92 1.62 2.88 0.011 0.008 0.034 Sugars/Nucleotides sugars N-acetylneuraminate 3.25 5.11 5.18 0.010 0.002 0.024 Glucosamine 1.18 1.17 1.10 0.015 0.015 0.042 GDP-Fucose 1.83 1.74 2.39 0.060 0.004 0.041 UDP-Glucose/UDP-Galactose 1.14 0.95 1.12 0.314 0.570 0.604 UDP-GlcNAc/UDP-GalNAc 2.39 6.58 4.96 0.031 <0.001 0.077 Amino acids Taurine 0.02 0.03 0.03 0.002 0.002 0.002 4-Hydroxy-L-Proline 1.17 1.16 1.11 0.011 0.011 0.056 Aminobutanoate 5.78 6.00 7.70 0.005 <0.001 0.023 Arginine 5.05 6.75 3.45 <0.001 <0.001 0.004 Histidine 10.90 10.82 13.39 0.012 0.001 0.017 Aspartate 1.17 1.25 1.06 0.308 0.096 0.769 Glutamic acid 7.63 7.90 9.78 0.011 <0.001 0.019 Valine 3.64 4.42 4.69 0.009 <0.001 0.015 Isoleucine 4.39 5.63 6.15 0.009 <0.001 0.011 Leucine 5.47 7.07 7.25 0.008 <0.001 0.011 Proline 4.25 6.56 6.10 0.002 <0.001 0.024 Tryptophan 3.93 4.67 5.60 0.008 <0.001 0.022 Phenylalanine 5.15 6.30 7.09 0.007 <0.001 0.017 Tyrosine 4.48 5.30 6.08 0.005 <0.001 0.007 Serine 3.17 4.68 4.19 0.059 <0.001 0.085 Methionine cycle and redox metabolism Methionine 9.32 11.50 12.27 0.007 <0.001 0.021 SAH 2.29 2.41 3.54 0.013 0.017 0.006 SAM 2.40 1.76 2.03 0.002 0.001 0.013 Glutamine 38.60 49.46 46.52 0.003 0.001 0.021 Pyroglutamic acid 4.93 4.84 6.56 0.005 <0.001 0.018 Glutathione (Reduced) 5.20 3.63 4.73 0.002 <0.001 0.007 Glutathione (Oxidised) 3.80 2.83 3.57 0.054 0.006 0.001 L-Cysteine-glutathione Disulfide 3.37 3.67 3.52 0.106 0.035 0.197 Methyl Group Donors Choline 1.42 2.66 2.43 0.012 <0.001 0.029 Betaine 11.13 16.39 15.34 0.003 <0.001 0.012 Co-factors and vitamins Riboflavin 18.93 19.75 24.22 0.001 <0.001 0.018 Folic acid 57.17 58.49 78.21 0.014 0.005 0.010 Pantothenic acid 1.12 1.12 1.32 0.330 0.233 0.213 NAD 1.45 1.48 1.61 0.005 0.006 0.053 NADH 1.02 1.35 2.20 0.897 0.129 0.077 NADP 0.95 1.16 1.21 0.553 0.266 0.265 FAD 0.76 0.98 1.18 0.068 0.833 0.229 Phospholipid synthesis CDP-ethanolamine 0.79 1.18 1.05 0.124 0.141 0.788 Glycerophosphocholine 0.30 0.90 0.93 0.010 0.318 0.608 Glycerophosphoethanolamine 0.58 1.11 0.98 0.016 0.275 0.837
Example 1
Metabolomic Comparison of Patient-Derived Lung Tumor-Initiating and Isogenic Differentiated Cells
[0283] The manner by which serine-glycine metabolites contribute to tumor initiation is not known in the art. TIC populations in cancer cell lines are poorly defined, providing limited utility for understanding TICs in patients. To overcome this limitation, two previously characterized TIC-enriched lines (LC1O and LC32) derived from resected primary NSCLC adenocarcinoma samples were grown as non-adherent tumorspheres (TS, TS10 and TS32) in serum-free media (
[0284] From each of these parental TS cells, two types of corresponding isogenic cell lines were derived. Firstly, adherent (Adh; Adh10 and Adh32) cells were generated by continual passage in serum-containing media, thus causing them to lose CD166 expressiona cell surface marker previously shown to be enriched in tumor-initiating populations (
[0285] To determine whether specific metabolites are differentially produced or utilized by TICs compared to differentiated cells, an unbiased LC/MS-based metabolomics analysis was performed with the three isogenic lines (TS, Adh and GLDC-KD) derived from TS32 (
[0286] From the global metabolomics analysis, three classes of metabolites stood out: 1) nucleotide intermediates, which are derived from serine-glycine and one-carbon pathway activity in TS cells and abrogated by GLDC knockdown; 2) branched chain and aromatic amino acids; and 3) metabolites related to the methionine cycle (
[0287] The methionine cycle is composed of two main steps (
[0288] In Adh and GLDC-KD cells, methionine and SAH were consistently depleted. This provided the first indication that decreases in methionine cycle activity and cellular trans-methylation were associated with the lack of tumor-initiating capabilities in differentiated cells (
[0289] Additionally, knockdown of GLDC led to a similar decrease in steady state levels of ATP.sup.33, a SAM precursor, as knockdown of SHMT2 (
[0290] Interestingly, there was no significant change in SAM levels in GLDC-KD cells compared to TS cells, despite their decreased methionine levels (
Methionine is an Indispensable Metabolic Substrate for Lung Tumor-Initiating Cells
[0291] To assess the specific importance of methionine and other methylation-associated metabolites in TS cells, their role in conferring these cells with tumor-initiating capabilities was examined. The requirement for methionine by TS cells was first assessed using a transient 48 h starvation protocol because the general lethality associated with long-term (i.e. more than 7 days) methionine depletion could confound any conclusions (
[0292] As expected, 48 h methionine starvation reduced methionine cycle activity. This was demonstrated by a dramatic decrease (30 fold) in SAM levels and a slight decrease in SAH levels (
[0293] Methionine is an essential amino acid. Hence, even short-term starvation may result in a general loss of cell viability that may be unrelated to tumor-initiation potential. To address this possibility, TS cells were transiently starved of other essential amino acids that include threonine, leucine or tryptophan, in a manner similar to methionine, prior to xenografting into NSG mice (
[0294] To further confirm that the defects in colony- and tumor-forming abilities were attributed to a loss of methionine cycle activity, and not a general loss of viability or translation inhibition, an attempt was made to rescue methionine-starved cells through three approaches (
[0295] To dissect changes to the methionine cycle activity under these three rescue conditions, cellular histone methylation was first analysed (
[0296] As a comparison, TS cells were starved of glutamine or both serine and glycine in the same manner to compare the relative importance of methionine in TICs to other known cancer-associated amino acids. Of particular interest, glutamine level was also found to be most abundant in TS cells, relative to Adh and GLDC KD cells (
[0297] The viability of cells was tested to determine if the cells were affected during the rescue conditions to ensure that non-viable cells are not subjected to downstream assays. Consistent with the TS cell starvation studies, the viability of cells in all three rescue conditions did not seem to be severely impacted. A slight increase in apoptosis was observed under the 48 h recovery condition, but proliferation rates were partially restored (
[0298] The data, thus far, implicated methionine cycle and SAM production as key determinants in maintaining TIC function, and further highlighting the involvement of an epigenetic program that may be crucial for conferring tumorigenicity to TICs.
Example 2
Dependency on Methionine Cycle Flux and SAM Leads to the Addiction of Tumor Initiating Cells to Methionine
[0299] The failure of exogenous homocysteine to rescue methionine starvation in lung TS cells could indicate that de novo synthesis of methionine was insufficient to meet demands for methionine and SAM utilization. To trace the rate of methionine production and consumption, short-term pulse-chase experiments were first performed using carbon-13 (.sup.13C) labeled methionine, followed by LC/MS detection and quantification (
[0300] To further support the notion that lung TICs depend on exogenous methionine, it was sought to investigate the basis by which TS cells could not utilize homocysteine as a methionine substitute. As a comparison, NIH 3T3 cells were included because they were able to utilize homocysteine and grow in methionine starvation conditions despite lower relative abundances of all methionine cycle enzymes (
Example 3
Contribution of the One-Carbon Pathway to the Methionine Cycle
[0301] TICs depend on the methionine cycle, which lies downstream of the one-carbon pathway. It was previously demonstrated that GLDC, a key rate-limiting step controlling serine-glycine metabolism, was crucial for TIC function, but its contribution towards the methionine cycle has not been addressed. Here, it was found that TICs, which were depleted of GLDC (GLDC KD), had decreased methionine regeneration and methylated histone levels (
[0302] One-carbon flux supplies MTHFR-generated methyl-THF units required for methionine remethylation. To understand the impact of GLDC and MTHFR downregulation in methionine cycle flux in TICs, deuterium-labeled homocysteine pulse-chase was performed in GLDC knockdown (GLDC KD) and MTHFR knockdown (MTHFR KD) cells (
[0303] Since MTHFR lie downstream of serine-glycine metabolism, and GLDC KD led to MTHFR downregulation, it was reasoned that its reactivation could, to some extent, rescue the phenotype of GLDC KD TICs (
[0304] Because SAM is consumed at an exceedingly high rate in TS cells and is generated from exogenous methionine in a rate-limiting reaction by the enzyme MAT2A, it was reasoned MAT2A could be a potential therapeutic target. To assess the contribution of MAT2A in conferring tumorigenic capabilities to TICs, MAT2A was knocked down in TS cells (
[0305] To establish the clinical relevance of MAT2A and MTHFR expression in lung adenocarcinoma, MAT2A and MTHFR protein abundance in a panel of patient non-small cell lung cancer (NSCLC) tumors were assessed to determine their association with cancer progression (
Example 4
Small Molecule Perturbation of the Methionine Cycle Impacts the Tumorigenicity of TICs
[0306] To evaluate the methionine cycle as a therapeutic target in lung TICs, small molecule inhibitors that target enzymes within this pathway were employed, mimicking the effects of short-term methionine starvation (
[0307] Following the treatment of cells with each of these inhibitors, the modes of action of these inhibitors were validated through LC/MS analyses (
[0308] To exclude the possibility of general cytotoxicity by these inhibitors in TS cells, the transient exposure to D9 or FIDAS5, to a large extent, did not negatively impact their long-term proliferation ability or trigger apoptosis (
[0309] Since FIDAS5 appeared to more specifically disrupt the methionine cycle and inhibit cellular methylation activities compared to D9, it was sought to test whether its systemic delivery could impact the tumorigenic potential of TS cells. These highly tumorigenic cells were first subcutaneously implanted into NSG mice and FIDAS5 (40 mg/kg) or corn oil carrier was immediately administered via intraperitoneal injection for three consecutive days. After 6 weeks, mice transiently treated with FIDAS5 produced tumors that were much smaller than carrier-treated controls. Similarly, a decreased number of pulmonary lesions were found in NSG mice that were orthotopically implanted with TS cells and transiently treated with FIDAS (
Example 5
[0310] Here, it is demonstrated for the first time that more that just influencing proliferation, methionine consumption via a greatly increased flux into the methionine cycle is critical for driving tumorigenesis of TLCs in lung cancer. While both TICs and their differentiated counterparts depend on exogenous methionine for long term survival, short term starvation of methionine, but not other amino acids, leads to dramatic disruption of tumor initiating ability, largely attributable to a blockade in cellular methylation in TICs. In contrast to their previously characterized roles as oncometabolites in cancer cell proliferation, short-term starvation of glutamine or serine and glycine did not impact methionine cycle flux or tumor formation ability. This underscores the less-appreciated influence of methionine cycle flux programs that are associated with tumor initiation.
[0311] Prolonged methionine starvation in immunocompromised mice was previously found to reduce tumor load but it was eventually lethal. Here, it is demonstrated that transient methionine depletion could produce long-term disruption of TIC function and highlight methionine cycle inhibition as a TIC-targeting strategy. As a proof of principle, transient methionine starvation or small molecule inhibition with FIDAS5 could dramatically alter the tumorigenicity of TIC, while having little impact on differentiated cancer. This highlights the therapeutic potential of targeting TIC vulnerability through disruption of the methionine cycle. More broadly, it was also observed that MAT2A expression to be significantly higher in other cancers than their corresponding normal tissues (
[0312] The metabolic basis of methionine dependency was previously unclear. Earlier studies attempting to address this were confounded by the relatively longer time frame (48 hours) required for radioactive label-transfer experiments, in contrast to the exceedingly rapid rates of methionine consumption and regeneration in cells. Using a LC/MS-based isotopomer method that is highly sensitive for metabolite tracking and detection, it is shown that methionine dependency is a direct consequence of high methionine and SAM consumption rates and not due to a defect in homocysteine re-methylation. Because of the surprisingly high rates of methionine consumption unique to lung TICs, de novo synthesis from homocysteine cannot meet demands for sustaining SAM synthesis, thus creating an addiction to exogenous methionine. This addiction seems to be a result of unusually fast turnover of methylated histones that was only observed in TICs (
[0313] Prolonged methionine starvation in immunocompromised mice could reduce tumor load but it was eventually lethal. Here, it was demonstrated that transient methionine depletion could produce long-term disruption of TIC function and highlight methionine cycle inhibition as a TIC-targeting strategy. As proof of principle, transient methionine starvation or small molecule inhibition with FIDAS5 could dramatically alter the tumorigenicity of TIC, while having little impact on differentiated cancer. This highlights the therapeutic potential of targeting TIC vulnerability through disruption of the methionine cycle. More broadly, it was also observed that MAT2A expression to be significantly higher in other cancers than their corresponding normal tissues (
[0314] MAT2A expression has been shown to be tuned to SAM metabolite abundance, implying that MAT2A abundance could reflect SAM demand and extent of methionine dependency of a tumor mass. As proof of principle, a collection of cancer cell lines representing a variety of cancers with varying MAT2A expression (
[0315] MAT2A inhibition, as exemplified through the use of the MAT2A inhibitor, FIDAS5 , is shown to be effective against triple-negative breast cancer (TNBC) cells, in particular in highly aggressive chemotherapy resistant cells (BC2.2) (
[0316] The metabolic basis of methionine dependency was previously unclear. Earlier studies attempting to address this were confounded by the relatively longer time frame (48 hours) required for radioactive label-transfer experiments, in contrast to the exceedingly rapid rates of methionine consumption and regeneration in cells. Using a LC/MS-based isotopomer method that is highly sensitive for metabolite tracking and detection, methionine dependency is now shown to be a direct consequence of high methionine and SAM consumption rates and not due to a defect in homocysteine remethylation. Because of the surprisingly high rates of methionine consumption unique to lung TICs, de novo synthesis from homocysteine cannot meet demands for sustaining SAM synthesis, thus creating an addiction to exogenous methionine. This addiction seems to be a result of unusually fast turnover of methylated histones that was only observed in TICs (
[0317] Notably, sustained MTHFR expression in GLDC KD cells could partially restore the tumorigenicity of GLDC KD cells, once again underlining the importance of MTHFR-driven flux in TICs and histone methylation. Indeed, MTHFR was previously demonstrated to play a key role in regulating the methionine cycle. In particular, somatic MTHFR hypomorphic mutations were also previously shown to decrease methionine cycle flux and transmethylation. However, the inability of MTHFR re-expression to fully restore the tumorigenicity of GLDC KD cells suggests that other branches of the one-carbon pathway might contribute to this phenotype. Of relevance, decreased one-carbon flux leading to a reduced capability to produce NAPDH units for maintaining redox balance might also contribute to the loss of tumorigenicity in GLDC KD cells, since oxidative stress can act as a barrier to tumor re-initiation.
[0318] Throughout the specification the aim has been to describe the embodiments of the invention without limiting the invention to any one embodiment or specific collection of features. Those of skill in the art will therefore appreciate that, in light of the instant disclosure, various modifications and changes can be made in the particular embodiments exemplified without departing from the scope of the present invention. All such modifications and changes are intended to be included within the scope of the appended claims.