Method of plant improvement using aspartate kinase-homoserine dehydrogenase

10538780 · 2020-01-21

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to the field of plant improvement, in particular of the improvement of yield for plants, by transforming plants with a transgene containing a promoter driving expression of a AK-HSDH protein.

Claims

1. A method for increasing plant yield, wherein yield is the weight of seeds per unit area, comprising the steps of sowing seeds of wheat, and growing plants from these sowed seeds, wherein the seeds are transgenic wheat seeds containing, in the genome, a transgene comprising a nucleic acid construct comprising: i. a promoter active in plants, wherein the promoter is a constitutive promoter, operatively linked to ii. a nucleic acid coding for an aspartate kinase-homoserine dehydrogenase (AK-HSDH) protein, wherein the AK-HSDH comprises the amino acid sequence set forth in SEQ ID NO:2; and wherein the yield obtained from said grown plants is increased as compared to the yield obtained from plants grown from seeds which do not contain said nucleic acid construct.

2. A method for increasing or maintaining plant yield under stressed conditions, wherein yield is the weight of seeds per unit area, comprising the steps of sowing seeds of wheat, and growing plants from these sowed seeds, wherein the seeds are transgenic wheat seeds containing, in the genome, a transgene comprising a nucleic acid construct comprising: i. a promoter active in plants, wherein the promoter is a constitutive promoter, operatively, linked to ii. a nucleic acid coding for an aspartate kinase-homoserine dehydrogenase (AK-HSDH) protein, wherein the AK-HSDH comprises the amino acid sequence set forth in SEQ ID NO:2, and wherein the growing phase is made under stress conditions, and wherein the obtained from said grown plants is increased as compared to the yield obtained from plants grown from seeds which do not contain said nucleic acid construct or the yield obtained from said grown plants is maintained as compared to the yield obtained from plants containing said nucleic acid construct and grown in normal conditions.

3. The method of claim 1, wherein said promoter is an actin promoter comprising SEQ ID NO: 3.

4. The method of claim 1, wherein said nucleic acid construct has the sequence SEQ ID NO: 8.

5. The method of claim 2, wherein said promoter is an actin promoter comprising SEQ ID NO: 3.

6. The method of claim 2, wherein said nucleic acid construct has the sequence SEQ ID NO: 8.

7. The method of claim 2, wherein the stress conditions include nitrogen deficiency.

8. The method of claim 1, wherein said promoter comprises SEQ ID NO: 26.

9. The method of claim 1, wherein said promoter is a PEPC promoter comprising SEQ ID NO: 23.

10. The method of claim 1, wherein said promoter is a rubi3 promoter comprising SEQ ID NO: 29.

11. The method of claim 2, wherein said promoter comprises SEQ ID NO: 26.

12. The method of claim 2, wherein said promoter is a PEPC promoter comprising SEQ ID NO: 23.

13. The method of claim 2, wherein said promoter is a rubi3 promoter comprising SEQ ID NO: 29.

Description

DESCRIPTION OF THE FIGURES

(1) FIG. 1 A: Level of expression (CT) for AK-HSHD gene, and NNI on Arche genotypes in roots at 2 stages (Z32 and Z65 (Zadoks scale)). B: Level of expression (CT) for AK-HSHD gene, and NNI for leaf samples on Soissons genotypes on leaf samples at Z30 and Z44 stages (Zadoks scale).

(2) FIG. 2: Comparison of yield for wheat plants containing the AK-HSDH construct and controls.

EXAMPLES

Example 1: Transcriptomic Data

(3) 1) Materials & Methods

(4) Wheat leaf samples were collected on 2 trials (La Miniere and Boigneville stationsArvalis Institut du Vgtal; France): one in field for cultivar Arche and in greenhouse for cultivar Soissons. Different nitrogen treatments were applied to lead to samples with a range of Nitrogen Nutrional Index (NNI) from 0.39 to 1.58.

(5) During wheat culture, sampling was done at different stages.

(6) Total RNAs were extracted from all the samples with the SV96 Total RNA Isolation System (Promega) according to the manufacturer recommendations. RNA integrity was verified on the Agilent Bioanalyzer and presence of potential genomic DNA was checked by QPCR on RNA. In the absence of genomic DNA no amplification is expected from RNA.

(7) For each sample, 2 g of total RNA were submitted to the reverse transcription using the High capacity reverse transcription kit (Applied Biosystems) and random primers in 100 l. RT reaction was then 1/10th diluted and 2 l of cDNA used for the amplification. Each RNA sample was submitted to 2 independent RT reactions for technical reproducibility evaluation.

(8) Quantitative PCR was performed on an ABI7900 machine (Applied Biosystems), using Applied Biosystems reagents. The PCR reactions consisted of a hot-start Taq Polymerase activation step of 95 C. for 5 minutes, followed by 2 steps amplification cycles (denaturation 95 C., 30 sec, annealing/elongation 60 C., 1 min). Expression levels of mRNA for AK-HSHD gene were calculated using the Ct estimated by the SDS software (Applied Biosystems) and normalized across samples using 4 control genes. Relative expression was then considered as the Ct between AK_HSHD gene and the average of controls.

(9) 2) Results

(10) In order to validate the role of the AK-HSHD gene in Nitrogen stressed conditions, an experiment on two bread wheat genotypes, i.e. Arche and Soissons, was conducted on leaf and root samples for Arche and for Soissons collected at different stages under different nitrogen constraints.

(11) The N nutrition index (NNI) value was calculated for each sample. Moreover, for the same samples, RNA was extracted and the expression pattern of AK_HSHD was analysed by qPCR using sequence specific primers forward: GATGTGCGTGTCATCGGAATA; SEQ ID NO: 6 reverse: CATCACTTCTGCTTGTCGGC; SEQ ID NO: 7

(12) The results are shown in FIG. 1.

(13) Significant correlations of R.sup.2=0.80 (mean of R.sup.2 correlation at Z32 and Z65 on root samples) and 0.80 (mean of R.sup.2 correlation at Z30 and Z44 on leaf samples) were found between the expression (CT values) of the AK-HSHD gene and the NNI score of the samples for both the Arche and Soissons genotypes, respectively, suggesting a role of AK-HSDH in nitrogen metabolism and yield establishment.

Example 2: Association Studies in Wheat

(14) The aim of association studies is to identify loci contributing to quantitative traits, based on the statistical association between genotypes and phenotypes using a large germplasm collection (panel) without knowledge on pedigree.

(15) Contrary to linkage mapping, association studies can be performed using a selection of cultivars without the need for crossing and screening offsprings. In this way, one can look at a maximum of genotypic variability (depending on panel selection) in a single study. Thus, using this technique, it is possible to identify favorable alleles of the AK-HSHD gene linked to phenotypic data, with a high resolution.

(16) A SNPs discovery was performed for the AK-HSDH gene, that are then linked to phenotypic data. The expected results were a positive association between SNPs and phenotypic data to conclude on the implication of the gene in the QTL's effect (Linkage Disequilibrium in the area has to be considered). Association study can provide information on gene polymorphisms implicated in traits and can indicate which allele is favorable regarding these traits.

(17) In AK-HSHD, a SNP (BWS5547) showed significant association results between genotypic and phenotypic data on traits like yield, grain protein content, biomass and yield in Nitrogen stressed conditions).

Example 3: Cloning of AK-HSDH Downstream the Rice Actin Promoter and Transformation

(18) The AK-HSDH sequence was cloned via a GATEWAY LR reaction, between a rice Actin promoter (proActin) (McElroy et al. 1990) plus an Actin intron (intActin, exemplified in SEQ ID NO: 4) (McElroy et al. 1990), and a 3 Nopaline synthase (Nos) termination sequence (tNos, depicted in SEQ ID NO: 5) (Depicker et al. 1982), into the destination binary plasmid pSC4Act-R1R2-SCV forming pBIOS1779.

(19) The binary vector pSC4Act-R1R2-SCV is a derivative of the binary vector pSCV nos nptII which is a derivative of pSCV1 (Firek et al. 1993) which contains a nos promoter driving a Kanamycin resistance gene, cloned between the EcoRV and EcoRI sites of pSCV1.

(20) The pBIOS1779 plasmid was transferred into agrobacteria EHA105 according to Komari et al. (1996). Wheat cultivar (NB01) was transformed with these agrobacterial strains essentially as described by WO2000063398.

(21) Similarly, four other constructs were made and inserted in the destination binary plasmid pSC4Act-R1R2-SCV forming pBIOS10221, pBIOS10227, pBIOS10233 and pBIOS10249 plasmids ready for transformation.

(22) pBIOS10221 is comprising an optimized sequence of the rice AK-HSDH gene (SEQ ID No: 1) encoding SEQ ID NO: 2 for expression in wheat. This sequence is cloned downstream of the sorghum promoter SvPEPc_C4 (SEQ ID NO: 23) and upstream of the terminator AtSac66 (SEQ ID NO: 24). The full construct sequence is given in SEQ ID NO: 22.

(23) pBIOS10227 is comprising an optimized sequence of the rice AK-HSDH gene (SEQ ID NO: 1) encoding SEQ ID NO: 2 cloned downstream of a modified version of the rice Actin promoter (SEQ ID NO: 26) and upstream of the terminator AtSac66 (SEQ ID NO: 24). The full construct sequence is given in SEQ ID NO: 25.

(24) pBIOS10233 is comprising an optimized sequence of E. coli AK-HSDH gene encoding SEQ ID NO 11 for expression in wheat. This sequence is cloned downstream of proActin (SEQ ID NO: 26) and upstream of the terminator AtSac66 (SEQ ID NO: 24). The full construct sequence is given in SEQ ID NO: 27.

(25) pBIOS10249 is comprising an optimized sequence of the rice AK-HSDH gene (SEQ ID NO: 1) encoding SEQ ID NO: 2 for expression in corn cloned downstream of the rice ubi3 promoter (SEQ ID NO: 29) and upstream of the sugarcane terminator SoUbi4 (SEQ ID NO: 30). The full construct sequence is given in SEQ ID NO: 28.

(26) The pBIOS10249 plasmid was transferred into agrobacteria LBA4404 (pSB1) according to Komari et al. (1996). Maize cultivar A188 was transformed with this agrobacterial strain essentially as described by Ishida et al. (1996).

(27) All the above plasmids, constructs and transgenes are part of the invention, and can be used in plants or in methods as disclosed above. The use of the constructs as disclosed above is not restricted to the plants mentioned above.

Example 4: Wheat and Corn Field Trials

(28) Field trials show that seed yield and particularly yield in nitrogen deficient conditions is improved when AK-HSDH is overexpressed.

(29) 1) Field Trials:

(30) Homozygous transgenic lines were self-pollinized for seed increase. T4 (proActin-intActin-AK-HSDH-terNos) homozygous plants were used for field trials.

(31) Controls are obtained by bulking null segregant siblings isolated from T1 segregation. The null segregants are used as a reference for statistical analysis. They thus differ from the tested lines at very few loci, and for the presence of the transgene. These control are thus quasi-isogenic to the tested lines.

(32) Improved yield was observed for wheat plants containing the AK-HSDH construct as compared to the controls, as can be seen in FIG. 2.

(33) Field evaluation was performed under two Nitrogen conditions: In normal (optimal) growing condition with an optimal Nitrogen fertilization. The applied Nitrogen rate was calculated using local guideline. In nitrogen stress condition, the applied Nitrogen rate was between 0 and 50% of the optimal Nitrogen rate.

(34) After harvest, the stress intensity of the N stress condition was eventually characterized, based on the seed yield lost compare to the seed yield of the normal condition. The N stress intensity is generally characterized based on the approximate following categories.

(35) TABLE-US-00001 Seed yield lost compare to Nitrogen stress level the optimal condition Low N stress condition 0 to 15% Moderate N stress condition 15% to 30% Strong N stress condition Above 30%

(36) Yield was calculated as follows:

(37) During harvest, grain weight and grain moisture are measured using on-board equipment on the combine harvester.

(38) Grain weight is then normalized to moisture at 15%, using the following formula:

(39) Normalized grain weight=measured gain weight(100-measured moisture (as a percentage))/85 (which is 100-normalized moisture at 15%)

(40) As an example, if the measured grain moisture is 25%, the normalized grain weight will be: normalized grain weight=measured grain weight75/85.

(41) Yield is then expressed in a conventional unit (such as quintal per hectare).

(42) The corn field trials are assessed as described above for the wheat

(43) 2) Experimental Design:

(44) Field trials were conducted in 2013 (2 N stress locations) and 2014 (1 N stress location, 1 N stress and yield location, 1 yield location)

(45) In 2013, plants were sown between April 23 (location 1) and May 11th (location 2).

(46) In 2014, plants were sown between April 16 and May 17th.

(47) The experimental design was Randomized complete block or Lattice with 4 replicate seeded at 360 seeds/m.sup.2.

(48) A bulk of null segregant of the construct was used as control in these experiments. 4 transgenic events of the construct T01789 were used for the field trials in 4 replicates.

(49) Results are represented in FIG. 2 with the yield expressed in (Qx/ha) and in percentage compared to the control.

(50) Under nitrogen deficiency (ND) conditions, in 2013 the observed yield ranged from 91.7% to 120.5% of the mean of the yield of the controls with a global average of 105.5%. No effect on seed moisture content was observed.

(51) Under nitrogen deficiency (ND) conditions, in 2014 the observed yield ranged from 98.4% to 112.3% of the mean of the yield of the controls with a global average of 104.6%. No effect on seed moisture content was observed.

(52) Under standard conditions, in 2014 the yield observed ranged from 98.6% to 110.3% of the mean of the yield of the controls with a global average of 105.2%. No effect on seed moisture content was observed.

(53) This figure demonstrates that the transgenic plants present an increased yield stability (normalized for moisture). No other phenotypes were observed for these plants.