Monooxygenase mutant, preparation method and application thereof

Abstract

The present application relates to the technical field of genetic engineering, and provides a monooxygenase mutant, a preparation method and application thereof. The monooxygenase mutant has any one of the amino acid sequences shown in (I) and (II): (I) an amino acid sequence having at least 80% identity with the amino acid sequence shown in SEQ ID NO. 1; and (II) an amino acid sequence obtained by modifying, substituting, deleting, or adding one or several amino acids to the amino acids at 23 to 508 positions of the amino acid sequence shown in SEQ ID NO. 1, the substituting referring to a substitution of 1 to 34 amino acids, wherein the mutant has the activity of monooxygenase.

Claims

1. A monooxygenase mutant with monooxygenase activity, wherein the monooxygenase mutant comprises the amino acid sequence of SEQ ID NO: 1, except for the substitution S500I and optionally one or more additional substitutions selected from the group consisting of M25A, P106R, A265E, M377V, A474E, Q490K, I495A, M23L, A74D, M75L, A93E, L110F, M117A, T137R, W153F, R159L, M166L, M260L, M284I, C289S, C334L, A359E, M360I, L380F, M426L, M428F, P435L, P435A, F436L, F436Y, F436A, T437S, T437A, T437Y, L439G, L439A, L439S, M457L, C479V, I495F, I495V and M508L, wherein the amino acid numbering corresponds to the amino acid sequence of SEQ ID NO: 1.

2. A nucleic acid comprising a nucleotide sequence encoding the monooxygenase mutant according to claim 1.

3. An expression vector comprising the nucleic acid according to claim 2.

4. An isolated host cell comprising the expression vector according to claim 3.

5. A method for preparing the monooxygenase mutant according to claim 1, comprising: (1) preparing a recombinant host cell, wherein the recombinant host cell comprises a DNA molecule comprising a nucleic acid sequence encoding the monooxygenase mutant according to claim 1; (2) incubating the recombinant host cell in a culture medium suitable for expressing the monooxygenase mutant; and (3) recovering of the monooxygenase mutant from the culture medium.

6. A composition comprising the monooxygenase mutant according to claim 1.

7. The monooxygenase mutant according to claim 1, wherein the one or more additional substitutions are selected from the group consisting of M25A, P106R, A265E, M377V, A474E, Q490K, I495A, RI59L, C289S, L380F, P435L, F436Y, T437A, L439S, and C479V.

8. The monooxygenase mutant according to claim 1, wherein the one or more additional substitutions are selected from the group consisting of M25A, P106R, A265E, A474E and Q490K.

9. The composition according to claim 6, wherein the composition is a dry powder, a tablet or a liquid.

Description

DETAILED DESCRIPTION OF THE EMBODIMENTS

(1) In order to further illustrate the technical means adopted by the present invention and the effects thereof, the following detailed description is given to further illustrate the technical solution of the present invention, but the present invention is not limited to the embodiments.

(2) The present invention uses conventional techniques and methods used in the fields of genetic engineering and molecular biology, and general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can adopt other conventional methods, experimental protocol and reagents in the art on the basis of the technical solutions described in the present invention, and are not limited to the specific embodiments of the present invention.

(3) The particular techniques or conditions not specified in the embodiments are in accordance with the techniques or conditions described in the literature in the art, or in accordance with the product specifications. Reagents or instruments used without specifying the manufacturer, are conventional products commercially available through regulatory sources.

Example 1 Monooxygenase Mutant with Single Point Mutation (M25A)

(4) Constructing a Monooxygenase Mutant Gene:

(5) In order to improve the activity, stability, soluble expression and selectivity of monooxygenase CHMO from Brachymonas petroleovorans (the amino acid sequence is SEQ ID NO.1, and the nucleotide sequence is SEQ ID NO.2), and reduce the amount of enzyme used, the M25A site was mutated respectively, specific steps are as follows:

(6) The nucleotide sequence shown in SEQ ID NO. 2 is as follows:

(7) TABLE-US-00002 ATGAGTAGCAGCCCGAGCAGCGCCATCCACTTTGACGCCATTGTGGTGGG TGCCGGTTTTGGCGGCATGTATATGCTGCACAAGCTGCGCGACCAGCTGG GCCTGAAAGTTAAAGTGTTCGACACCGCCGGTGGTATTGGTGGTACCTGG TACTGGAACCGCTATCCGGGTGCCCTGAGCGACACCCATAGCCACGTGTA CCAGTACAGCTTCGATGAGGCCATGCTGCAGGAGTGGACATGGAAAAATA AATATCTGACCCAGCCGGAAATCCTGGCATATCTGGAATACGTGGCCGAT CGTCTGGATTTACGCCCTGACATTCAGCTGAACACCACCGTTACCAGCAT GCATTTTAACGAGGTGCACAATATCTGGGAAGTTCGCACCGATCGTGGCG GCTACTATACAGCACGCTTCATTGTGACCGCACTGGGTCTGTTAAGTGCC ATCAACTGGCCGAACATCCCGGGCCGTGAGTCTTTTCAAGGCGAAATGTA TCATACCGCCGCCTGGCCGAAAGATGTTGAACTGCGCGGCAAGCGCGTGG GTGTGATCGGTACAGGTAGCACCGGTGTGCAGCTGATCACCGCCATTGCA CCGGAGGTGAAGCACCTGACCGTTTTTCAGCGTACCCCGCAGTATAGCGT TCCGACAGGCAATCGCCCGGTTAGCGCCCAGGAAATCGCAGAAGTGAAAC GCAACTTTAGCAAAGTGTGGCAGCAGGTGCGTGAGAGTGCCGTTGCCTTT GGCTTTGAGGAAAGCACCGTGCCGGCAATGAGCGTTAGCGAGGCAGAACG CCAGCGTGTTTTCCAGGAAGCATGGAATCAGGGCAACGGCTTTTACTATA TGTTTGGCACCTTTTGCGATATCGCCACAGATCCGCAGGCCAACGAGGCA GCCGCCACCTTCATTCGTAATAAGATCGCCGAAATCGTTAAAGATCCGGA GACAGCCCGCAAACTGACACCGACAGACGTTTATGCCCGTCGTCCGCTGT GCGATAGCGGCTACTATCGCACCTACAATCGTAGCAACGTGAGCCTGGTG GATGTGAAGGCCACCCCGATCAGTGCAATGACCCCGCGCGGCATTCGTAC CGCAGATGGCGTGGAGCATGAACTGGACATGCTGATTCTGGCAACCGGCT ACGACGCCGTTGATGGCAACTATCGCCGTATTGATCTGCGTGGCCGCGGT GGCCAGACCATTAACGAACACTGGAATGACACCCCTACCAGCTATGTTGG CGTGAGCACCGCCAATTTTCCGAACATGTTCATGATTCTGGGCCCTAACG GCCCGTTCACCAATCTGCCGCCGAGTATCGAAGCCCAGGTGGAATGGATT ACCGATCTGGTGGCACACATGCGTCAGCACGGTCTGGCAACCGCCGAACC TACCCGCGATGCCGAAGATGCCTGGGGTCGTACCTGTGCAGAGATTGCCG AGCAGACCCTGTTCGGCCAGGTGGAAAGCTGGATCTTTGGCGCAAACAGC CCGGGTAAGAAGCATACCCTGATGTTTTATCTGGCCGGCCTGGGCAATTA CCGCAAACAGCTGGCCGATGTGGCAAATGCCCAGTATCAGGGCTTTGCCT TCCAGCCTCTGTAA;

(8) (1) Introducing mutations: designing a primer according to the nucleotide shown in SEQ ID NO. 2, and designing a forward primer and a reverse primer containing the M25A site, wherein the forward primer and the reverse primer are as follows:

(9) TABLE-US-00003 The forward primer (SEQ ID NO. 3): gccggttttggcggcatgtatgcgctgcacaagc. The reverse primer (SEQ ID NO. 4): gcttgtgcagcgcatacatgccgccaaaaccggc.

(10) Mixing the primers and a template plasmid, adding high fidelity Taq polymerase KOD-Plus, carrying out full plasmid PCR amplification, and carrying out electrophoresis detection on a PCR product after the PCR is finished, wherein the PCR amplification system is as follows:

(11) TABLE-US-00004 Final System Addition amount (μL) concentration KOD-Plus enzyme (1.0 1 1.0 U/50 μL U/μL) 10× PCR buffer solution 5 1×  2 mM dNTP 5 0.2 mM 25 mM MgSO4 2 1.0 mM forward and reverse 3 0.3 μM primers (10 pmol/μL) DNA Template 1 0.3 μM ddH.sub.2O Adding to 50 μL;

(12) Amplification conditions of the PCR reaction are as follows:

(13) TABLE-US-00005 Reaction Procedure Number of cycles Amplification 94° C. 2 min  1 procedure 98° C 10 s 20 68° C. 4 min  4° C. —;

(14) (2) transformation: adding Dpn I enzyme, digesting a template, transferring into E. coli competent BL21 (DE3), culturing overnight at 37° C., and picking out a monoclone to a test tube;

(15) (3) inducing expression: inoculating from a test tube into a 1.5 L shake flask, culturing at 37° C. until the OD.sub.600 reduces to 1, reducing the culture temperature to 25° C., and adding IPTG with the final concentration of 0.1 mM to induce expression for 16 h; and

(16) (4) reaction verification: adding substrate (3-chlorobenzyl) dimethyl sulfide 40 mg to 10 mL reaction bottle, add 0.1 M Tris-HCl 9.0, 20 mg isopropanol, 0.4 mg NADP.sup.+, 4 mg alcohol dehydrogenase, adding 4 mg monooxygenase CHMO (0.1 wt), mixing well, the total volume is 1 mL, at 50° C., in a shaker at 200 rpm, reacting for 16 hours.

Example 2 Monooxygenase Mutant with Single Point Mutation (P106R)

(17) The P106R is subjected to site-directed mutation, and the specific steps are as follows:

(18) Introducing mutations: designing a forward primer and a reverse primer containing the P106R site, wherein the forward primer and the reverse primer are as follows:

(19) TABLE-US-00006 The forward primer (SEQ ID NO. 5): cgtctggatttacgccgtgacattcagctgaac. The reverse primer (SEQ ID NO. 6): gttcagctgaatgtcacggcgtaaatccagacg.

(20) Other methods and steps are the same as example 1.

Example 3 Monooxygenase Mutant with Single Point Mutation (R159L)

(21) Introducing mutations: designing a forward primer and a reverse primer containing the R159L site, wherein the forward primer and the reverse primer are as follows:

(22) TABLE-US-00007 The forward primer (SEQ ID NO. 7): cgaacatcccgggccttgagtcttttcaagg. The reverse primer (SEQ ID NO. 8): ccttgaaaagactcaaggcccgggatgttcg.

(23) Other methods and steps are the same as example 1.

Example 4 Monooxygenase Mutant with Single Point Mutation (A265E)

(24) Introducing mutations: designing a forward primer and a reverse primer containing the A265E site, wherein the forward primer and the reverse primer are as follows:

(25) TABLE-US-00008 The forward primer (SEQ ID NO. 9): gagcgttagcgaggaagaacgccagcgtg. The reverse primer (SEQ ID NO. 10): cacgctggcgttcttcctcgctaacgctc.

(26) Other methods and steps are the same as example 1.

Example 5 Monooxygenase Mutant with Single Point Mutation (C289S)

(27) Introducing mutations: designing a forward primer and a reverse primer containing the C289S site, wherein the forward primer and the reverse primer are as follows:

(28) TABLE-US-00009 The forward primer (SEQ ID NO. 11): tttactatatgtttggcacctttagcgatatcgccacag. The reverse primer (SEQ ID NO. 12): ctgtggcgatatcgctaaaggtgccaaacatatagtaaa.

(29) Other methods and steps are the same as example 1.

Example 6 Monooxygenase Mutant with Single Point Mutation (M377V)

(30) Introducing mutations: designing a forward primer and a reverse primer containing the M377V site, wherein the forward primer and the reverse primer are as follows:

(31) TABLE-US-00010 The forward primer (SEQ ID NO. 13): ggagcatgaactggacgtgctgattctggcaac. The reverse primer (SEQ ID NO. 14): gttgccagaatcagcacgtccagttcatgctcc.

(32) Other methods and steps are the same as example 1.

Example 7 Monooxygenase Mutant with Single Point Mutation (L380F)

(33) Introducing mutations: designing a forward primer and a reverse primer containing the L380F site, wherein the forward primer and the reverse primer are as follows:

(34) TABLE-US-00011 The forward primer (SEQ ID NO. 15): agcatgaactggacatgctgattttcgcaaccggctac. The reverse primer (SEQ ID NO. 16): gtagccggttgcgaaaatcagcatgtccagttcatgct.

(35) Other methods and steps are the same as example 1.

Example 8 Monooxygenase Mutant with Single Point Mutation (P435L)

(36) Introducing mutations: designing a forward primer and a reverse primer containing the P435L site, wherein the forward primer and the reverse primer are as follows:

(37) TABLE-US-00012 The forward primer (SEQ ID NO. 17): gggccctaacggcctgttcaccaatctgc. The reverse primer (SEQ ID NO. 18): gcagattggtgaacaggccgttagggccc.

(38) Other methods and steps are the same as example 1.

Example 9 Monooxygenase Mutant with Single Point Mutation (F436Y)

(39) Introducing mutations: designing a forward primer and a reverse primer containing the F436Y site, wherein the forward primer and the reverse primer are as follows:

(40) TABLE-US-00013 The forward primer (SEQ ID NO. 19): gggccctaacggcccgtataccaatctgccg. The reverse primer (SEQ ID NO. 20): cggcagattggtatacgggccgttagggccc.

(41) Other methods and steps are the same as example 1.

Example 10 Monooxygenase Mutant with Single Point Mutation (T437A)

(42) Introducing mutations: designing a forward primer and a reverse primer containing the T437A site, wherein the forward primer and the reverse primer are as follows:

(43) TABLE-US-00014 The forward primer (SEQ ID NO. 21): taacggcccgttcgccaatctgccgcc. The reverse primer (SEQ ID NO. 22): ggcggcagattggcgaacgggccgtta.

(44) Other methods and steps are the same as example 1.

Example 11 Monooxygenase Mutant with Single Point Mutation (L439S)

(45) Introducing mutations: designing a forward primer and a reverse primer containing the L439S site, wherein the forward primer and the reverse primer are as follows:

(46) TABLE-US-00015 The forward primer (SEQ ID NO. 23): cctaacggcccgttcaccaattcgccgccgagta. The reverse primer (SEQ ID NO. 24): tactcggcggcgaattggtgaacgggccgttagg.

(47) Other methods and steps are the same as example 1.

Example 12 Monooxygenase Mutant with Single Point Mutation (A474E)

(48) Introducing mutations: designing a forward primer and a reverse primer containing the A474E site, wherein the forward primer and the reverse primer are as follows:

(49) TABLE-US-00016 The forward primer (SEQ ID NO. 25): gcgatgccgaagatgagtggggtcgtacctg. The reverse primer (SEQ ID NO. 26): caggtacgaccccactcatcttcggcatcgc.

(50) Other methods and steps are the same as example 1.

Example 13 Monooxygenase Mutant with Single Point Mutation (C479V)

(51) Introducing mutations: designing a forward primer and a reverse primer containing the C479V site, wherein the forward primer and the reverse primer are as follows:

(52) TABLE-US-00017 The forward primer (SEQ ID NO. 27): gcctggggtcgtaccgttgcagagattgccga. The reverse primer (SEQ ID NO. 28): tcggcaatctctgcaacggtacgaccccaggc.

(53) Other methods and steps are the same as example 1.

Example 14 Monooxygenase Mutant with Single Point Mutation (Q490K)

(54) Introducing mutations: designing a forward primer and a reverse primer containing the Q490K site, wherein the forward primer and the reverse primer are as follows:

(55) TABLE-US-00018 The forward primer (SEQ ID NO. 29): agaccctgttcggcaaggtggaaagctgg. The reverse primer (SEQ ID NO. 30): ccagatttccaccttgccgaacagggtct.

(56) Other methods and steps are the same as example 1.

Example 15 Monooxygenase Mutant with Single Point Mutation (I495A)

(57) Introducing mutations: designing a forward primer and a reverse primer containing the I495A site, wherein the forward primer and the reverse primer are as follows:

(58) TABLE-US-00019 The forward primer (SEQ ID NO. 31): ccaggtggaaagctgggcctttggcgcaaacagc. The reverse primer (SEQ ID NO. 32): gctgtttgcgccaaaggcccagctttccacctgg.

(59) Other methods and steps are the same as example 1.

Example 16 Monooxygenase Mutant with Single Point Mutation (S500I)

(60) Introducing mutations: designing a forward primer and a reverse primer containing the S500I site, wherein the forward primer and the reverse primer are as follows:

(61) TABLE-US-00020 The forward primer (SEQ ID NO. 33): gctggatctttggcgcaaacatcccgggtaaga. The reverse primer (SEQ ID NO. 34): tcttacccgggatgtttgcgccaaagatccagc.

(62) Other methods and steps are the same as example 1.

(63) Transformation Rate Detection

(64) Adding 3 mL acetonitrile into a reaction sample system, uniformly mixing, placing into a 5 mL EP tube, centrifuging at 12000 rpm for 3 minutes, taking 100 μL supernatant into a sample feeding bottle, adding 900 μL 90% acetonitrile, detecting by HPLC with detection wavelength of 210 nm, the results are shown in table 1.

(65) Stability Detection

(66) Taking two parts of monooxygenase SEQ ID NO: 1 with a mass of 4 mg, adding isopropanol with a final concentration of 10% in one part and standing for 1 h at 30° C. and the other part was isopropanol-free and standing for 1 h at 30° C., and the reaction was carried out according to the following system:

(67) adding substrate (3-chlorobenzyl) dimethyl sulfide 40 mg to 10 mL reaction bottle, add 0.1 M Tris-HCl 9.0, 20 mg isopropanol, 0.4 mg NADP.sup.+, 4 mg alcohol dehydrogenase, adding 4 mg monooxygenase CHMO, mixing well, the total volume is 1 mL, at 50° C., in a shaker at 200 rpm, reacting for 16 hours. Adding 3 mL acetonitrile into a reaction sample system, uniformly mixing, placing into a 5 mL EP tube, centrifuging at 12000 rpm for 3 minutes. Taking 100 μL supernatant into a sample feeding bottle, adding 900 μL 90% acetonitrile, detecting by HPLC with detection wavelength of 210 nm.

(68) Mutant stability is expressed as the percentage of monooxygenase transformation rate incubated in isopropanol versus monooxygenase transformation rate incubated without isopropanol, and the results are shown in Table 1.

(69) TABLE-US-00021 TABLE 1 Transformation Residual Mutation Amount of rate viability Mutant site enzyme used (%) (%) Control N/A 0.2 wt 35.1 50.3 Example 1 M25A 0.1 wt 48.1 47.2 Example 2 P106R 0.1 wt 55.5 51.1 Example 3 R159L 0.1 wt 67.8 43.5 Example 4 A265E 0.1 wt 59.7 62.7 Example 5 C289S 0.1 wt 72.5 46.8 Example 6 M377V 0.1 wt 53.7 57.5 Example 7 L380F 0.1 wt 56.6 56.3 Example 8 P435L 0.1 wt 41.2 45.7 Example 9 F436Y 0.1 wt 48.5 50.6 Example 10 T437A 0.1 wt 44.4 49.6 Example 11 L439S 0.1 wt 40.9 47.8 Example 12 A474E 0.1 wt 52.5 64.8 Example 13 C479V 0.1 wt 57.5 46.6 Example 14 A490K 0.1 wt 58.2 60.2 Example 15 I495A 0.1 wt 62.1 42.1 Example 16 S500I 0.1 wt 60.6 59.2

(70) As can be seen from Table 1, the transformation effect of the single point mutant was improved compared with that of the parent, but the desired effect was not achieved. The residual activity in isopropanol of Examples 4 (A265E), 8 (A474E) and 10 (A490K) of the single point mutant was improved to more than 60%. In general, the performance of mutants with single point mutation is hardly different from that of the parent, and better mutants can be obtained by the combination of mutation sites.

Example 17 Monooxygenase Mutant with Single Point Mutation

(71) Introducing mutations: designing forward primers and reverse primers containing 23 additional sites (M23L, A74D, M75L, A93E, L110F, M117A, T137R, W153F, M166L, M260L, M284I, C334L, A359E, M360I, M426L, M428F, P435A, F436L, F436A, T437S, T437Y, L439G, L439A, M457L, I495F, I495V or M508L), respectively, with the specific primers listed in the following Table 2:

(72) TABLE-US-00022 TABLE 2 Site Forward primer Reverse primer M23L (SEQ ID gccggttttggcggcttgtatatgctgcaca tgtgcagcatatacaagccgccaaaaccggc NO. 35-36) A74D (SEQ ID acagcttcgatgaggacatgctgcaggagtg cactcctgcagcatgtcctcatcgaagctgt NO. 37-38) M75L (SEQ ID gcttcgatgaggccttgctgcaggagtgg ccactcctgcagcaaggcctcatcgaagc NO. 39-40) A93E (SEQ ID ccagccggaaatcctggaatatctggaatacgtgg ccacgtattccagatattccaggatttccggctgg NO. 41-42) L110F (SEQ ID tacgccctgacattcagttcaacaccaccgttaccag ctggtaacggtggtgttgaactgaatgtcagggcgta NO. 43-44) M117A (SEQ ID gaacaccaccgttaccagcgcgcatittaacgaggtgcac gtgcacctcgttaaaatgcgcgctggtaacggtggtgttc NO. 45-46) T137R (SEQ ID gatcgtggcggctactatagagcacgcttca tgaagcgtgctctatagtagccgccacgatc NO. 47-48) W153F (SEQ ID cgggatgttcgggaagttgatggcacttaacagaccc gggtctgttaagtgccatcaacttcccgaacatcccg NO. 49-50) M166L (SEQ ID tgagtcttttcaaggcgaattgtatcataccgccg cggcggtatgatacaattcgccttgaaaagactca NO. 51-52) M260L (SEQ ID gcaccgtgccggcattgagcgttagcg cgctaacgctcaatgccggcacggtgc NO. 53-54) M284I (SEQ ID atcagggcaacggcllllactatatatttggcaccttttg caaaaggtgccaaatatatagtaaaagccgttgccctgat NO. 55-56) C334L (SEQ ID gcccgtcgtccgctgttagatagcggctactatc gatagtagccgctatctaacagcggacgacgggc NO. 57-58) A359E (SEQ ID accccgatcagtgaaatgaccccgcgc gcgcggggtcatttcactgatcggggt NO. 59-60) M360I (SEQ ID accccgatcagtgcaataaccccgcgc gcgcggggttattgcactgatcggggt NO. 61-62) M426L (SEQ ID ccgccaattttccgaacttgttcatgattctgggc gcccagaatcatgaacaagttcggaaaattggcgg NO. 63-64) M428F (SEQ ID caattaccgaacatgttcttcattctgggccctaacggcc ggccgttagggcccagaatgaagaacatgttcggaaaattg NO. 65-66) P435A (SEQ ID gggccctaacggcgcgttcaccaatct agattggtgaacgcgccgttagggccc NO. 67-68) F436L (SEQ ID gccctaacggcccgttaaccaatctgcc ggcagattggttaacgggccgttagggc NO. 69-70) F436A (SEQ ID gccctaacggcccggccaccaatctgccgc gcggcagattggtggccgggccgttagggc NO. 71-72) T437S (SEQ ID acggcccgttcagcaatctgccgcc ggcggcagattgctgaacgggccgt NO. 73-74) T437Y (SEQ ID gccctaacggcccgttctataatctgccgccgagtat atactcggcggcagattatagaacgggccgttagggc NO. 75-76) L439G (SEQ ID acggcccgttcaccaatgggccgccgag ctcggcggcccattggtgaacgggccgt NO. 77-78) L439A (SEQ ID acggcccgttcaccaatgcgccgccgag ctcggcggcgcattggtgaacgggccgt NO. 79-80) M457L (SEQ ID tctggtggcacacttgcgtcagcacgg ccgtgctgacgcaagtgtgccaccaga NO. 81-82) I495F (SEQ ID ccaggtggaaagctggttctttggcgcaaacag ctgtttgcgccaaagaaccagctttccacctgg NO. 83-84) I495V (SEQ ID ccaggtggaaagctgggtctttggcgcaaacag ctgtttgcgccaaagacccagctttccacctgg NO. 85-86) M508L (SEQ ID gtaagaagcataccctgttgattatctggccggc gccggccagataaaacaacagggtatgcttcttac NO. 87-88)

(73) Other methods and steps are the same as example 1.

(74) Verification of Activity

(75) Ultrasonically crushing the cultured strain, and detecting the expression amount of the protein in the supernatant and the precipitate, the results are shown in table 3:

(76) TABLE-US-00023 TABLE 3 Expression of Expression of Mutation site supernatant precipitate N/A +++++ +++++ M23L +++++ +++++ A74D ++++++++ ++ M75L +++++ +++++ A93E +++++ +++++ L110F +++++ +++++ M117A +++++ +++++ T137R +++++ +++++ M153F ++++++ +++++ M166L +++++ +++++ M260L +++++ +++++ M284I +++++ ++++ C334L +++++ +++++ A359E +++++ +++++ M360I +++++ +++++ M426L +++++ +++++ M428F +++++ +++++++ P435A +++++ +++++ F436L +++++ +++++ F436A +++++ +++++ T437S +++++ +++++ T437Y +++++ +++++ L439G +++++ +++++ L439A +++++ +++++ M457L +++++ +++++ I495F +++++ +++++ I495V +++++ +++++ M508L +++++ +++++

(77) It can be seen from table 3 that although these sites did not increase the transformation rate of monooxygenase, they did increase the soluble expression of monooxygenase, especially A74D and M153F significantly increased the supernatant expression.

Example 18 Monooxygenase Mutant with Multi Point Mutation

(78) Randomly recombining mutation sites through a DNA shuffling method, establishing a mutation library, then screening, and preparing a monooxygenase mutant with multi-point mutation, which comprises the following specific steps of:

(79) (1) obtaining homologous genes with M25A, P106R, A265E, M377V, A474E, C479V, Q490K, I495A and S500I mutation sites by PCR, purifying PCR products, mixing the genes according to equimolar amount, digesting the genes into random fragments by nuclease I, forming a library from the random fragments, and carrying out PCR amplifications with primers and a template mutually; when one gene copy fragment is used as a primer of another gene copy, template exchange and gene recombination occurred, and the reaction system of the N-PCR is as follows:

(80) TABLE-US-00024 System Addition amount (μL) 10× PFU buffer solution 5 dNTP 5 DNA template (80-200 bp) 6 Pfu polymerase (2.5 U) 0.5 μL ddH.sub.2O Adding to 50 μL;

(81) The amplification conditions of the N-PCR reaction are as follows:

(82) TABLE-US-00025 Reaction Procedure Number of cycles Amplification 95° C. 10 min 1 primer 94° C. 30 s 5 69° C. 30 s 72° C. 2 min/1 kb 94° C. 30 s 5 69° C. 30 s 72° C. 2 min/1 kb 94° C. 30 s 5 69° C. 30 s 72° C. 2 min/1 kb 72° C. 10 min 1  4° C. —;

(83) (2) transformation and screening: transferring the prepared product into E. coli, and culturing;

(84) (3) preparing enzyme solution: centrifuging a 96-well plate to remove a supernatant culture medium, adding 200 μL enzymolysis solution (lysozyme 2 mg/mL, polymyxin 0.5 mg/mL, pH=7.0) into each well, and carrying out heat preservation and crushing at 37° C. for 3 hours;

(85) (4) high-throughput screening: 250 μL activity assay system: the final concentration of the substrate (3-chlorobenzyl) dimethyl sulfide was 2 mM, the final concentration of NADPH was 0.3 mM, the addition amount of a crushing enzyme solution was 100 pt, the pH value was 9.0, the temperature was 30° C., the mutant obtained by screening is subjected to shake flask culture, and then amplification reaction is carried out;

(86) (5) inducing expression: 25° C., 0.1 mM IPTG inducing overnight;

(87) (6) reaction verification: adding 40 mg substrate into 10 mL reaction bottle, add 0.1 M Tris-HCl 9.0, 20 mg isopropanol, 0.4 mg NADP.sup.+, 4 mg alcohol dehydrogenase, adding 4 mg monooxygenase CHMO (0.1 wt), mixing well, the total volume is 1 mL, at 50° C., in a shaker at 200 rpm, reacting for 16 hours.

(88) Transformation Rate Detection

(89) Adding 3 mL acetonitrile into a reaction sample system, uniformly mixing, placing into a 5 mL EP tube, centrifuging at 12000 rpm for 3 minutes, taking 100 μL supernatant into a sample feeding bottle, adding 900 μL 90% acetonitrile, detecting by HPLC with detection wavelength of 210 nm, the results are shown in table 2.

(90) Stability Detection

(91) Taking two parts of monooxygenase SEQ ID NO: 1 with a mass of 4 mg, adding isopropanol with a final concentration of 10% in one part and standing for 1 h at 30° C. and the other part was isopropanol-free and standing for 1 h at 30° C., and the reaction was carried out according to the following system:

(92) adding 40 mg substrate into 10 mL reaction bottle, add 0.1 M Tris-HCl 9.0, 20 mg isopropanol, 0.4 mg NADP.sup.+, 4 mg alcohol dehydrogenase, adding 4 mg monooxygenase CHMO, mixing well, the total volume is 1 mL, at 50° C., in a shaker at 200 rpm, reacting for 16 hours. Adding 3 mL acetonitrile into a reaction sample system, uniformly mixing, placing into a 5 mL EP tube, centrifuging at 12000 rpm for 3 minutes. Taking 100 μL supernatant into a sample feeding bottle, adding 900 μL 90% acetonitrile, detecting by HPLC with detection wavelength of 210 nm.

(93) Mutant stability is expressed as the percentage of monooxygenase transformation rate incubated in isopropanol versus monooxygenase transformation rate incubated without isopropanol, and the results are shown in Table 4.

(94) TABLE-US-00026 TABLE 4 Amount of Transfor- Residual enzyme mation viability Mutatation site used (%) (%) N/A 0.2 wt 35.1 50.3 M25A-C479V 0.1 wt 52.8 47.5 M25A-S500I 0.1 wt 65.1 45.6 S500I-P106R 0.1 wt 69.9 52.3 S500I-A265E 0.1 wt 85.5 60.4 S500I-A474E 0.1 wt 66.3 61.7 S500I-Q490K 0.1 wt 75.3 58.7 S500I-A265E-M25A 0.1 wt 96.3 69.5 S500I-A265E-P106R 0.1 wt 73.3 47.8 S500I-A265E-A474E 0.1 wt 84.9 58.6 S500I-A265E-Q490K 0.1 wt 61.4 55.4 M377V-M25A-C289S 0.1 wt 23.6 50.1 M377V-M25A-C479V 0.1 wt 28.8 49.3 M377V-M25A-S500I 0.1 wt 45.5 54.7 S500I-A265E-M25A-P106R 0.1 wt 16.9 61.5 S500I-A265E-M25A-A474E 0.1 wt 97.1 59.3 S500I-A265E-M25A-Q490K 0.1 wt 97.0 55.8 S500I-A265E-M25A-A474E-P106R 0.1 wt 97.1 67.5 S500I-A265E-M25A-Q490K-P106R 0.1 wt 96.5 63.2 S500I-A265E-M25A-A474E-Q490K 0.1 wt 97.1 66.1 S500I-A265E-M25A-A474E-Q490K-I495A 0.1 wt 72.2 49.5 5500I-A265E-M25A-I495A 0.1 wt 65.0 47.6 S500I-A265E-M25A-A474E-I495A 0.1 wt 59.0 43.9

(95) It can be seen from Table 4 that most of the transformation effects of multipoint mutants are further improved compared with single point mutants, and a small part of them have no improvement in transformation effect, but the stability is improved. It can be seen that multipoint mutations will further improve the properties of monooxygenase. Among the multipoint mutants, the transformation rates of S500I-A265E-M25A mutants, S500I-A265E-M25A-A474E mutants, S500I-A265E-M25A-Q490K mutants, S500I-A265E-M25A-A474E-P106R mutants, S500I-A265E-M25A-Q490K-P106R mutants and S500I-A265E-M25A-A474E-Q490K mutants can reach more than 90%, and the residual activity in isopropanol can reach more than 60%. The amplification effect of the six mutants was further verified.

Example 19 Verification of Amplification Reaction of Multi-Point Mutants

(96) Further verify the yield of the prepared S500I-A265E-M25A mutant, S500I-A265E-M25A-A474E mutant, S500I-A265E-M25A-Q490K mutant, S500I-A265E-M25A-A474E-P106R mutant, S500I-A265E-M25A-Q490K-P106R mutant and S500I-A265E-M25A-A474E-Q490K mutant, the specific steps are as follows:

(97) (1) adding substrate (3-chlorobenzyl) dimethyl sulfide 1 g to 250 mL reaction bottle, add 0.1 M Tris-HCl 9.0, 500 mg isopropanol, 10 mg NADP.sup.+, 100 mg alcohol dehydrogenase, adding 100 mg monooxygenase CHMO, mixing well, the total volume is 25 mL, at 50° C., in a shaker at 200 rpm, reacting for 16;

(98) (2) sampling 1 mL from the reaction sample system, adding 3 ml acetonitrile, uniformly mixing, placing in a 5 ml EP tube, and centrifuging at 12000 rpm for 3 minutes. Taking 100 μL supernatant into a sample feeding bottle, adding 900 μL 90% acetonitrile, detecting by HPLC with detection wavelength of 210 nm;

(99) (3) after the reaction is finished, adding 50 mL ethyl acetate for extraction three times, combining the extracted organic phases, adding magnesium sulfate for drying, performing rotary evaporation to dryness, and weighing, and the results are shown in Table 5:

(100) TABLE-US-00027 TABLE 5 Mutation site Yield (%) e.e. (%) S500I-A265E-M25A 86.5 99 S500I-A265E-M25A-A474E 89.5 99 S500I-A265E-M25A-Q490K 90.2 99 S500I-A265E-M25A-A474E-P106R 88.9 99 S500I-A265E-M25A-Q490K-P106R 90.8 99 S500I-A265E-M25A-A474E-Q490K 89.3 99

(101) As can be seen from Table 5, the yield of the six mutants can reach more than 86%, the e. e. values are all 99%, in particular, the yield of the (5500I-A265E-M25A-Q490K-) mutant can reach 90.2% with e. e. value of 99%, it can be seen that multi-site mutations have achieved good results.

(102) In summary, through verification, it is found that on the basis of the original monooxygenase, the individual mutations of the 12 sites, namely, M25A, P106R, R159L, A265E, C289S, M377V, L380F, A474E, C479V, Q490K, I495A and S500I, can improve the activity of monooxygenase, and by combining the mutations of the 12 sites, the yield of the five mutants, S500I-A265E-M25A mutant, S500I-A265E-M25A-Q490K mutant, S500I-A265E-M25A-A474E-P106R mutant, S500I-A265E-M25A-Q490K-P106R mutant and S500I-A265E-M25A-A474E-Q490K mutant is the highest, which can reach more than 86%, the residual activity of enzyme in isopropanol can reach more than 60%, and the transformation rate can reach more than 90%.

(103) The applicant states that the present invention illustrates a detailed method of the present invention by way of the above-described embodiments, but the present invention is not limited to the above-described detailed method, that is, it does not mean that the present invention must be carried out depending on the above-described detailed method. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of raw materials, addition of auxiliary components, selection of specific modes, and the like, for the products of the present invention all fall within the scope of protection and disclosure of the present invention.