COMPOSITION FOR IMPROVING SKIN CONDITION INCLUDING FERMENTED PEARL PRODUCT

20200016063 ยท 2020-01-16

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a composition for improving skin condition comprising a fermented pearl product. More specifically, the present invention provides a composition for improving skin condition which uses a fermented pearl product having remarkably increased ingredients such as amino acids, polyphenol, and organic calcium content, and has a remarkably enhanced skin condition-improving effect such as activity of inhibiting melanin production, and promoting differentiation and exfoliation of keratinocytes, as compared with conventional pearl extracts.

Claims

1. A method for improving skin condition, the method comprising: applying on the skin a cosmetically effective amount of a composition comprising a fermented pearl product prepared by adding pearl powders in an amount ranging from 0.05% to 20% (w/v) and performing after-fermentation with fermented apple vinegar.

2. The method according to claim 1, wherein the fermented pearl product has a total polyphenol content of 100 to 1,000 ppm, a total amino acid content of 300 to 1,000 ppm, and a total calcium content of 1,000 to 20,000 ppm.

3. The method according to claim 1, wherein the after-fermentation is performed at 20 C. to 40 C. for 3 to 7 days.

4. The method according to claim 1, wherein the improving skin condition is an improvement in skin regeneration, skin whitening, skin moisturizing, skin elasticity, skin aging, or wrinkle.

5. The method according to claim 1, which inhibits melanin production.

6. The method according to claim 1, which promotes differentiation of keratinocytes.

7. The method according to claim 1, which promotes removal of the stratum corneum.

8. A composition for improving skin condition comprising: a fermented pearl product prepared by adding pearl powders in an amount ranging from 0.05% to 20% (w/v) and performing after-fermentation with fermented apple vinegar.

Description

BRIEF DESCRIPTION OF RELATED ART

[0041] FIG. 1 illustrates a process flow diagram for preparing the fermented pearl product of the present invention.

[0042] FIG. 2 illustrates results obtained by measuring melanin contents in mouse pigment cells (B 16 melanoma cells) which had been treated with each of spirit vinegar, fermented apple vinegar, pearl extract, and fermented pearl product.

[0043] FIGS. 3A to 3D illustrate results which show expression levels of respective genes (IVL, LOR, KLK-5, and KLK-7) identified by real-time PCR. For a negative control, *: p<0.05, **: p<0.01.

[0044] FIG. 4 illustrates results of staining in the artificial skin from which an exfoliation level of the stratum corneum is observed. CON means a control.

[0045] FIG. 5 illustrates results which show an expression level of type 1 procollagen gene identified by real-time PCR. For a negative control, *: p<0.05, **: p<0.01.

DETAILED DESCRIPTION OF THE INVENTION

[0046] Hereinafter, the present invention will be described in more detail with reference to examples. These examples are given merely to more specifically describe the present invention, and it will be apparent to those skilled in the art that in accordance with the gist of the present invention, the scope of the present invention is not limited by these examples.

EXAMPLES

Example 1

Preparation of Fermented Pearl Product

[0047] 10% (w/v) of pearl powders were added to a fermented apple vinegar stock solution and then after-fermentation was performed at 25 C. for 3 to 7 days. Upon completion of the fermentation, a fermented pearl product that contains ionized calcium at a high concentration was prepared through microfiltration (pore size: 0.1 L).

Comparative Example 1

Spirit Vinegar

[0048] Spirit vinegar diluted to 1% by weight was used as Comparative Example 1.

Comparative Example 2

Fermented Apple Vinegar

[0049] Fermented apple vinegar diluted to 1% by weight was used as Comparative Example 2.

Comparative Example 3

Preparation of Pearl Extract

[0050] For the pearl extract of Comparative Example 3, pearl powders were placed in a suitable container, an appropriate amount of water was added therein so that the pearl powders absorbed the water, and then extra water was added therein. At this time, washing filtration was performed once or twice. To 1 g of the washed pearl solids was slowly added a 10% acetic acid (CH3COOH) aqueous solution so that a final weight became 90 g. The mixture was stirred at 350 rpm at room temperature. When no carbon dioxide was generated, it was judged that the reaction was completed, and supernatant was recovered.

[0051] The supernatant was neutralized with diluted alkali, and then water was added so that a final product became 100 g. Then, filtration was performed to prepare 1% by weight of a pearl extract, which was used in the following experimental examples.

Experimental Example 1

WhiteningEvaluation for Inhibition of Melanin Production

[0052] Inhibitory effects on melanin production caused by treatment with the compositions of Comparative Examples 1, 2, and 3, and Example 1 were measured using mouse pigment cells (B16 melanoma cells, ATCC, CRL-6475TH). Such inhibitory effects were compared with inhibitory effects on melanin production caused by arbutin (100 g/ml) which is known to inhibit melanin production.

[0053] Mouse pigment cells (B16 F10) were suspended in DMEM containing 10% fetal bovine serum (FBS) and inoculated into a 6-well plate at 110.sup.5 cells per well. Culture was performed until the cells adhered to a well bottom. In order to induce melanin production, treatment with 0.1 M -MSH was performed, and culture was performed for 3 days after addition of the sample. A concentration at which treatment with a substance was performed was set to 100 g/ml. Arbutin was used as a positive control in an experiment for melanin production capability. The cultured cells were washed with phosphate-buffered saline (PBS) and recovered with trypsin. The recovered cells were counted with a hematocytometer, collected so that the same cell number at 110.sup.6 cells/ml was obtained for each treatment group, and centrifuged at 1,000 rpm for 10 minutes to obtain cells. The recovered cells were dried at 60 C. for 1 hour, and then 400 l of a 1 M NaOH solution containing 10% DMSO was added to obtain intracellular melanin. An inhibition rate for melanin production was evaluated by measuring an absorbance at 490 nm of the melanin solution using a microplate reader.

[0054] As can be identified in FIG. 2, melanin contents in the mouse pigment cells were decreased by the treatment with the compositions of Comparative Examples 1, 2, and 3, and Example 1. In particular, the fermented pearl product of Example 1 exhibited the best inhibitory activity against melanin production.

Experimental Example 2

Analysis of Gene Expression in Keratinocyte Cell Line

[0055] 2-1. Culture of HaCaT Cells, Human Skin Keratinocyte Cell Line

[0056] Keratinocytes HaCaT (CLS, 300493), a constitutive cell line of human skin, were cultured using a DMEM culture solution that contains 10% FBS and antibiotics. A 75T-flask was used as a container for culture, and culture was performed in an incubator at 37 C. to which 5% CO.sub.2 is supplied. The culture solution was replaced every 3 to 4 days and subculture was performed when the cells were excessively grown. The HaCaT cells were dispensed into a 6-well plate (510.sup.5/well), cultured for 24 hours using DMEM, and then washed with phosphate buffered saline (PBS). To each well was added each of 1.2 mM calcium chloride, and the compositions of Comparative Example 1, Comparative Example 2, and Comparative Example 3, and Example 1, diluted in a Ca-free DMEM medium containing no FBS so as to be 1% by weight. After 24 hours, cDNA was synthesized and PCR was performed to evaluate gene expression levels.

[0057] 2-2. Test for Effects on Keratinocyte Differentiation and Expression of Exfoliating Factors Using Real-Time PCR

[0058] The synthesized cDNA was subjected to real-time PCR using primers and an SYBR green master mixture which is a cyanine dye, so that gene expression levels were finally evaluated. Comparison for expression of genes was made with a relative value obtained through calibrated quantification of the internal control gene -actin according to the C.sub.t (threshold cycle) method, and primer sequences used are shown in Table 1 below.

TABLE-US-00001 TABLE1 Primer name Sequence(5.fwdarw.3) SEQIDNO IVL Forward TGAAACAGCCAACTCCACTG SEQIDNO:1 Reverse GGAGCTCCAACAGTTGCTCT SEQIDNO:2 LOR Forward AATAGATCCCCCAGGGTACCA SEQIDNO:3 Reverse CGGTGCCCCTGGAAAAC SEQIDNO:4 KLK-5 Forward GCCACACTGCAGGAAGAAA SEQIDNO:5 Reverse GGATTTGACCCCCTGGAA SEQIDNO:6 KLK-7 Forward GCATCCCCGACTCCAAGAA SEQIDNO:7 Reverse CAGGGTACCTCTGCACACCAA SEQIDNO:8 -Actin Forward GGCCATCTCTTGCTCGAAGT SEQIDNO:9 Reverse GACACCTTCAACACCCCAGC SEQIDNO:10

[0059] As can be seen in FIGS. 3A and 3B, it was identified that treatment with a 1% fermented pearl product of Example 1 results in significantly increased expression levels of involucrin (IVL), loricrin (LOR), kallikrein-related peptidase-5 (KLK-5), and KLK-7, as compared with the other treatment groups. More specifically, increased expression of IVL and LOR means that epidermal keratinocyte differentiation is promoted and skin turnover is caused to occur normally. An expression level of IVL was significantly increased in the fermented pearl product of Example 1 as compared with the fermented apple vinegar Comparative Example 2 and the pearl extract of Comparative Example 3. In particular, in a case of an expression level of LOR, the fermented pearl product exhibits a remarkable synergistic effect which cannot be easily predicted from the other treatment groups. Thus, it was identified that the fermented pearl product of Example 1 can induce a superior skin turnover effect.

[0060] In addition, an increase in KLK-5 and KLK-7 means that the outermost stratum corneum is normally exfoliated. As illustrated in FIGS. 3C and 3D, it was identified that the fermented pearl product of Example 1 promotes an epidermal differentiation and exfoliation capability as compared with the pearl extract, thereby strengthening a skin barrier and exhibiting an excellent effect in skin moisturizing function.

Experimental Example 3

Histological Observation of Skin

[0061] 3-1. Artificial Skin Culture

[0062] Levels of epidermal differentiation and expression of exfoliation factors caused by the fermented pearl product of Example 1 were identified in the reconstructed human epidermis (RHE), a three-dimensional cultured skin model which is reproduced to resemble human skin. Upon arrival of RHE, culture was performed in a growth medium for 24 hours for stabilization, and then treatment with 1% of each of 1.2 mM calcium chloride and the fermented pearl product of Example 1 was performed.

[0063] 3-2: Experiment on Stratum Corneum Exfoliation Effect Using H&E Staining

[0064] After 2 days of culture, extracted skin tissue was fixed in a 10% formalin solution. Then, paraffin sections were cut and tissue immunostaining was performed.

[0065] As a result, as illustrated in FIG. 4, it is identifiable that the stratum corneum was normally exfoliated over time and no thickened stratum corneum was formed in a group treated with the fermented pearl product of Example 1, as compared with a control CON. These results indicate that the fermented pearl product of Example 1 effectively induces epidermal turnover in a skin-histological manner and has an effect of improving a skin barrier function.

Experimental Example 4

Analysis of Gene Expression in Fibroblast Cell Line

[0066] 4-1. Culture of Hs68 Cells, Human Skin Fibroblast Cell Line

[0067] Fibroblast cell line Hs68 (ATCC, CRL-1635), a constitutive cell line of human skin, was cultured in a DMEM culture solution that contains 10% FBS and antibiotics. A 75T-flask was used as a container for culture, and culture was performed in an incubator at 37 C. to which 5% CO.sub.2 is supplied. The culture solution was replaced every 3 to 4 days and subculture was performed when the cells were excessively grown. The Hs68 cells were dispensed into a 6-well plate (410.sup.5/well), cultured for 24 hours using DMEM, and then washed with phosphate buffered saline (PBS). To each well was added each of the compositions of Comparative Example 1, Comparative Example 2, and Comparative Example 3, and Example 1, diluted in a Ca-free DMEM medium containing no FBS so as to be 1% by weight. After 24 hours, cDNA was synthesized and PCR was performed to evaluate gene expression levels.

[0068] 4-2. Identification of Procollagen Production in Fibroblasts Using Real-Time PCR

[0069] The synthesized cDNA was subjected to real-time PCR using primers and an SYBR green master mixture which is a cyanine dye, so that an expression level of procollagen gene was finally evaluated. Comparison for expression of gene was made with a relative value obtained through calibrated quantification of the internal control gene -actin according to the C.sub.t (threshold cycle) method, and primer sequences used are shown in Table 2 below.

TABLE-US-00002 TABLE2 Primer name Sequence(5.fwdarw.3) SEQIDNO Type1 Forward CTCGAGGTGGACACCACCCT SEQIDNO:11 pro- Reverse CAGCTGGATGGCCACATCGG SEQIDNO:12 collagen -Actin Forward GGCCATCTCTTGCTCGAAGT SEQIDNO:9 Reverse GACACCTTCAACACCCCAGC SEQIDNO:10

[0070] As can be seen in FIG. 5, it was identified that treatment with a 1% fermented pearl product of Example 1 results in a significantly increased expression level of type 1 procollagen, as compared with the other treatment groups. More specifically, increased expression of type 1 procollagen which is a precursor of type 1 collagen mainly produced in fibroblasts and is a major causative agent in determining a thickness of the skin dermal layer, means inhibition of wrinkle formation. From the above results, it can be seen that the fermented pearl product of Example 1 can increase production of type 1 collagen, which acts as a support in the dermis, to induce an effect capable of inhibiting wrinkle and sagging phenomena which are typical aspects of skin aging.

Experimental Example 5

Analysis of Ingredients of Fermented Pearl Product

[0071] In this experimental example, changes in active ingredients of the fermented pearl product prepared in Example 1 were identified (Table 3).

TABLE-US-00003 TABLE 3 Comparative Comparative Example 2 Example 1 Example 1 (fermented (fermented Item (spirit vinegar) apple vinegar) pearl product) Total amino acids 170 372 441 (ppm) Calcium (ppm) 3 92 11,148 Total polyphenol 0 130 125 (ppm)

[0072] While certain parts of the present invention have been specifically described, it is obvious to those skilled in the art that such a specific description is only an embodiment and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and equivalents thereof.