NEURON-SPECIFIC HuR-DEFICIENT OR INDUCIBLE HuR-DEFICIENT ANIMAL MODELS
20200015461 ยท 2020-01-16
Inventors
- Xiaoxia Li (Cleveland, OH, US)
- Tomasz Herjan (Beachwood, OH, US)
- Kevin Sun (Solon, OH, US)
- Xing Chen (Cleveland, OH, US)
Cpc classification
A01K67/0275
HUMAN NECESSITIES
A01K2217/206
HUMAN NECESSITIES
A01K2217/15
HUMAN NECESSITIES
C12N15/8509
CHEMISTRY; METALLURGY
C12N2015/8527
CHEMISTRY; METALLURGY
International classification
Abstract
Provided herein non-human transgenic animals comprising a genome that: i) under-expresses, or is inducible to under-express, Hu Antigen R (HuR) in at least some neurons of said transgenic animal; ii) does not express HuR, or is inducible to not express HuR, in at least some neurons of said transgenic animal; or iii) does not express functional HuR, or is inducible to not express functional HuR in at least some neurons of said transgenic animal, as well as methods of screening drugs and therapies (e.g., useful in treating ALS) using such animals.
Claims
1. A non-human transgenic animal comprising a genome that: i) under-expresses compared to wild-type, or is inducible to under-express compared to wild-type, Hu Antigen R (HuR) in at least some neurons of said transgenic animal; ii) does not express HuR, or is inducible to not express HuR, in at least some neurons of said transgenic animal; or iii) does not express functional HuR, or is inducible to not express functional HuR in at least some neurons of said transgenic animal.
2. The non-human transgenic animal of claim 1, wherein said genome comprises a heterologous genetic construct.
3. The non-human transgenic animal of claim 2, wherein said genetic construct comprises a neuron-specific promoter.
4. The non-human transgenic animal of claim 3, wherein said genetic construct further comprises at least one recombinase sequence inducible by an exogenous agent, wherein said recombinase sequence, once induced, mediates the deletion of the HuR gene in said transgenic animal.
5. The transgenic animal of claim 1, wherein said animal is selected from the group consisting of a mouse, a rat, a dog, and a rabbit.
6. The transgenic animal of claim 1, wherein said at least some neuron cells are in said transgenic animal's brain or spinal cord.
7. The transgenic animal of claim 1, wherein said animal displays symptoms of, or similar to, amyotrophic lateral sclerosis (ALS).
8. The transgenic animal of claim 1, wherein said genome i) under-expresses, or is inducible to under-express, Hu Antigen R (HuR) in at least some neurons of said transgenic animal.
9. The transgenic animal of claim 1, wherein said genome ii) does not express HuR, or is inducible to not express HuR, in at least some neurons of said transgenic animal.
10. The transgenic animal of claim 1, wherein said genome iii) does not express functional HuR, or is inducible to not express functional HuR in at least some neurons of said transgenic animal.
11. A method of screening an intervention for a disease or condition, comprising: a) contacting a non-human transgenic animal with a candidate intervention, wherein said non-human transgenic animal comprises a genome that: i) under-expresses compared to wild-type, or is inducible to under-express compared to wild-tyep, Hu Antigen R (HuR) in at least some neurons of said transgenic animal; ii) does not express HuR, or is inducible to not express HuR, in at least some neurons of said transgenic animal; or iii) does not express functional HuR, or is inducible to not express functional HuR in at least some neurons of said transgenic animal; and b) determining the effect of said intervention on a disease or condition in said non-human transgenic animal.
12. The method of claim 11, wherein said intervention is a biological drug or small-molecule drug.
13. The method of claim 11, wherein said intervention is selected from the group consisting of a lifestyle change, an alternative medicine therapy, and a combination thereof.
14. The method of claim 11, wherein said disease is ALS.
15. The method of claim 11, wherein said animal is selected from the group consisting of a mouse, a rat, a dog, and a rabbit.
16. The method of claim 11, wherein said at least some neuron cells are in said transgenic animal's brain or spinal cord.
17. The method of claim 11, wherein said genome i) under-expresses, or is inducible to under-express, Hu Antigen R (HuR) in at least some neurons of said transgenic animal.
18. The method of claim 11, wherein said genome ii) does not express HuR, or is inducible to not express HuR, in at least some neurons of said transgenic animal.
19. The method of claim 11, wherein said genome iii) does not express functional HuR, or is inducible to not express functional HuR in at least some neurons of said transgenic animal.
Description
DESCRIPTION OF THE FIGURES
[0011] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
DETAILED DESCRIPTION
[0018] Provided herein non-human transgenic animals comprising a genome that: i) under-expresses, or is inducible to under-express, Hu Antigen R (HuR) in at least some neurons of said transgenic animal; ii) does not express HuR, or is inducible to not express HuR, in at least some neurons of said transgenic animal; or iii) does not express functional HuR, or is inducible to not express functional HuR in at least some neurons of said transgenic animal, as well as methods of screening drugs and therapies (e.g., useful in treating ALS) using such animals.
[0019] ELAV-like protein 1, or Human antigen R (HuR), is an RNA binding protein in the ELAVL protein family that selectively binds to AU-rich elements (AREs) found in 3 untranslated regions of mRNA (5). Unlike other members of the ELAVL protein family, HuR is ubiquitously expressed in both neuronal and non-neuronal cells. Importantly, there is no available HuR-related genetic animal model that specifically targets neuronal cells with a phenotype that can simulate ALS and its related signature markers. In order to investigate the potential role of HuR specifically in neurons, we developed inducible neuron-specific HuR-deficient mice using neuron-specific Thy1 promoter to robustly drive both Cre recombinase and yellow fluorescent protein (YFP) expression. The Cre recombinase under the control of estrogen receptor is activated by tamoxifen, which translocates to the nucleus and mediates the deletion of the floxed HuR gene.
[0020] After tamoxifen-induced deletion of HuR, these mice developed a phenotype composed of poor balance, decreased movement, and decreased strength, which were quantified by an array of behavioral tests (including an open-field test, a Y-maze test, a rotarod test, and a grip strength test). These results demonstrate a motor deficiency phenotype in neuron-specific HuR-deficient mice. In support of this, immunostaining of brain and spinal cord sections indicated neuronal cell death in pyramidal neurons and alpha motor neurons of HuR-deficient mice. Moreover, microarray and RT-PCR analyses identified genes with altered expression in brain tissue of neuron-specific HuR-deficient mice, including genes important for cell growth and immune regulation. Some of the HuR-regulated genes are also significantly altered in the brain and spinal cord of ALS patients. These findings suggest that the molecular signature and neuropathology shown by the neuron-specific HuR-deficient mice can be explored as a model system to study ALS.
[0021] The HuR-deficient, or inducible HuR-deficient, transgenic animals disclosed herein find use, for example, in drug (e.g., ALS) screens. In some embodiments, test compounds (e.g., a drug that is suspected of being useful to treat ALS, or a compound from a compound library) and control compounds (e.g., a placebo) are administered to the transgenic animals and the control animals and the effects evaluated.
[0022] The HuR-deficient, or inducible HuR-deficient, transgenic animals can be generated via a variety of methods (see, e.g., Example 1). In some embodiments, embryonal cells at various developmental stages are used to introduce transgenes for the production of HuR-deficient, or inducible HuR-deficient, transgenic animals. Different methods are used depending on the stage of development of the embryonal cell. The zygote is a good target for micro-injection. In the mouse, the male pronucleus reaches the size of approximately 20 micrometers in diameter that allows reproducible injection of 1-2 picoliters (pl) of DNA solution. The use of zygotes as a target for gene transfer has a major advantage in that in most cases the injected DNA will be incorporated into the host genome before the first cleavage (e.g., Brinster et al., Proc. Natl. Acad. Sci. USA 82:4438-4442 (1985), herein incorporated by reference). As a consequence, all cells of the transgenic non-human animal will carry the incorporated transgene. This will in general also be reflected in the efficient transmission of the transgene to offspring of the founder since 50% of the germ cells will harbor the transgene. U.S. Pat. No. 4,873,191 describes a method for the micro-injection of zygotes; the disclosure of this patent is incorporated herein in its entirety. Additional methods for generating transgenic animal are described, for example, in Palmiter, Ann. Rev. Genet. 20:465-99 (1986); Gordon, Methods in enzymology, vol. 225; and Camper, Biotechniques. Vol 5. No 7. (1987); each of which is herein incorporated by reference in its entirety.
[0023] In other embodiments, retroviral infection is used to introduce transgenes into a non-human animal. In some embodiments, the retroviral vector is utilized to transfect oocytes by injecting the retroviral vector into the perivitelline space of the oocyte (see, e.g., U.S. Pat. No. 6,080,912, incorporated herein by reference). In other embodiments, the developing non-human embryo can be cultured in vitro to the blastocyst stage. During this time, the blastomeres can be targets for retroviral infection (e.g., Janenich, Proc. Natl. Acad. Sci. USA 73:1260 (1976), herein incorporated by reference). Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (e.g., Hogan et al., in Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1986), herein incorporated by reference). The viral vector system used to introduce the transgene is typically a replication-defective retrovirus carrying the transgene (e.g., Jahner et al., Proc. Natl. Acad Sci. USA 82:6927 (1985), herein incorporated by reference). Transfection is easily and efficiently obtained by culturing the blastomeres on a monolayer of virus-producing cells (e.g., Stewart, et al., EMBO J., 6:383 (1987), herein incorporated by reference). Alternatively, infection can be performed at a later stage. Virus or virus-producing cells can be injected into the blastocele (e.g., Jahner et al., Nature 298:623 (1982), herein incorporated by reference). Most of the founders will be mosaic for the transgene since incorporation occurs only in a subset of cells that form the transgenic animal. Further, the founder may contain various retroviral insertions of the transgene at different positions in the genome that generally will segregate in the offspring. In addition, it is also possible to introduce transgenes into the germline, albeit with low efficiency, by intrauterine retroviral infection of the midgestation embryo (e.g., Jahner et al., supra (1982)). Additional means of using retroviruses or retroviral vectors to create transgenic animals known to the art involve the micro-injection of retroviral particles or mitomycin C-treated cells producing retrovirus into the perivitelline space of fertilized eggs or early embryos (PCT International Application WO 90/08832 (1990), and Haskell and Bowen, Mol. Reprod. Dev., 40:386 (1995); both of which are herein incorporated by reference).
[0024] In other embodiments, the transgene is introduced into embryonic stem cells and the transfected stem cells are utilized to form an embryo. ES cells are obtained by culturing pre-implantation embryos in vitro under appropriate conditions (Evans et al., Nature 292:154 (1981); Bradley et al., Nature 309:255 (1984); Gossler et al., Proc. Acad. Sci. USA 83:9065 (1986); and Robertson et al., Nature 322:445 (1986); all of which are herein incorporated by refernece). Transgenes can be efficiently introduced into the ES cells by DNA transfection by a variety of methods known to the art including calcium phosphate co-precipitation, protoplast or spheroplast fusion, lipofection and DEAE-dextran-mediated transfection. Transgenes may also be introduced into ES cells by retrovirus-mediated transduction or by micro-injection. Such transfected ES cells can thereafter colonize an embryo following their introduction into the blastocoel of a blastocyst-stage embryo and contribute to the germ line of the resulting chimeric animal (for review, See, Jaenisch, Science 240:1468 (1988), herein incorporated by reference). Prior to the introduction of transfected ES cells into the blastocoel, the transfected ES cells may be subjected to various selection protocols to enrich for ES cells which have integrated the transgene assuming that the transgene provides a means for such selection. Alternatively, the polymerase chain reaction may be used to screen for ES cells that have integrated the transgene. This technique obviates the need for growth of the transfected ES cells under appropriate selective conditions prior to transfer into the blastocoel. In still other embodiments, homologous recombination is utilized to knock-out gene function or create deletion mutants (e.g., truncation mutants). Methods for homologous recombination are described in U.S. Pat. No. 5,614,396, incorporated herein by reference.
[0025] In some embodiments, the present disclosure provides drug screening assays (e.g., to screen for drugs to treat autoimmune disease). Specifically, the present disclosure provides screening methods for identifying modulators, i.e., candidate or test compounds or agents (e.g., proteins, peptides, peptidomimetics, peptoids, small molecules or other drugs) which decrease symptoms of ALS disease. In certain embodiments, a small molecule library is screened for such activity in the animal models herein.
[0026] In certain embodiments, drug screening methods of the present disclosure utilize HuR-deficient, or inducible HuR-deficient, transgenic animals. In some embodiments, the transgenic animals exhibit symptoms characteristic of ALS. For example, in some embodiments, test compounds are administered to transgenic animals of the present disclosure and the effect of the test compound on transgene expression and/or function is assayed. In other embodiments, test compounds are administered to transgenic animals of the present disclosure and the effect of the test compound on ALS type symptoms in the animal is assessed.
[0027] The test compounds of the present disclosure can be obtained using any suitable method, including biological libraries; peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone, which are resistant to enzymatic degradation but which nevertheless remain bioactive; see, e.g., Zuckennann et al., J. Med. Chem. 37: 2678-85 (1994), herein incorporated by reference); spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the one-bead one-compound library method; and synthetic library methods using affinity chromatography selection. The biological library and peptoid library approaches are preferred for use with peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des. 12:145, herein incorporated by reference).
[0028] Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90:6909 (1993); Erb et al., Proc. Nad. Acad. Sci. USA 91:11422 (1994); Zuckermann et al., J. Med. Chem. 37:2678 (1994); Cho et al., Science 261:1303 (1993); Carrell et al., Angew. Chem. Int. Ed. Engl. 33.2059 (1994); Carell et al., Angew. Chem. Int. Ed. Engl. 33:2061 (1994); and Gallop et al., J. Med. Chem. 37:1233 (1994).
[0029] Libraries of compounds may be presented in solution (e.g., Houghten, Biotechniques 13:412-421 (1992)), or on beads (Lam, Nature 354:82-84 (1991)), chips (Fodor, Nature 364:555-556 (1993)), bacteria or spores (U.S. Pat. No. 5,223,409; herein incorporated by reference), plasmids (Cull et al., Proc. Nad. Acad. Sci. USA 89:18651869 (1992)) or on phage (Scott and Smith, Science 249:386-390 (1990); Devlin Science 249:404-406 (1990); Cwirla et al., Proc. Nati. Acad. Sci. 87:6378-6382 (1990); Felici, J. Mol. Biol. 222:301 (1991)).
[0030] In some embodiments, test compound are candidate ALS therapies or interventions (e.g., including but not limited to, non-steroidal anti-inflammatory agents, anti-malarial drug, corticosteroids (system and topical), immunosuppressants, biologics, alternative medicine (e.g., DHEA, fish oil, acupuncture), dietary changes, lifestyle changes, and combinations thereof). Embodiments of this disclosure further pertain to novel agents identified by the above-described screening methods.
EXAMPLES
Example 1
Neuron-Specific HuR-Deficient Mice
[0031] Human antigen R (HuR), is an RNA binding protein in the human antigen protein family. To study the neuron-specific function of HuR, we generated inducible, neuron-specific HuR-deficient mice of both sexes. After tamoxifen-induced deletion of HuR, these mice developed a phenotype consisting of poor balance, decreased movement, and decreased strength. They performed significantly worse on the rotarod test compared to littermate control mice, indicating coordination deficiency. Using the grip strength test, it was also determined that the forelimbs of neuron-specific HuR-deficient mice were much weaker than littermate control mice.
[0032] Immunostaining of the brain and cervical spinal cord showed that HuR-deficient neurons had increased levels of cleaved Caspase 3, a hallmark of cell apoptosis. Caspase 3 cleavage was especially strong in pyramidal neurons and alpha motor neurons of HuR-deficient mice. Genome-wide microarray and RT-PCR analysis further indicated that HuR deficiency in neurons resulted in altered expression of genes in the brain involved in cell growth, including Tchp, Cdkn2c, GPSM2, Ier2, SOD1, and Bcl2. The additional enriched GO terms in the brain tissues of neuron-specific HuR-deficient mice were largely related to inflammation, including interferon-induced genes and complement components. Importantly, some of these HuR-regulated genes were also significantly altered in the brain and spinal cord of patients with amyotrophic lateral sclerosis. Additionally, neuronal HuR deficiency resulted in the redistribution of TDP43 to cytosolic granules, which has been linked to motor neuron disease.
[0033] Materials and Methods:
[0034] Reagents:
[0035] Antibodies against GAPDH, HuR, anti-Nur-77 (sc-166166) were purchased from Santa Cruz Biotechnology. Anti-TDP-43 and anti-ChaT was from Proteintech, anti-NeuN (MAB377) was from Milipore, anti-cleaved Caspase 3 was from Cell Signaling, anti-CD3 was from Abcam, anti-Ier2 (orb157617) was obtained from Biorbyt. B6; SJL-Tg(Thy1-cre/ERT2,-EYFP)VGfng/J mice were obtained from The Jackson Laboratory. These mice were crossed to HuR flox/flox mice (described previously (7)) to generate conditional neuron-specific HuR KO mice (Thy1.sup.Cre-ERT2-EYFPHuR.sup.f/f) and control mice (Thy1.sup.Cre-ERT2-EYFPHuR.sup.f/f). Cre expression was induced via intraperitoneal injection of Tamoxifen (SIGMA) (5 mg/25 g weight, twice). Mice of both sexes were used for experiments. The Cleveland Clinic Institutional Animal Care and Use Committee reviewed and approved all animal experiments.
[0036] Primary Cell Culture:
[0037] Primary astrocyte culture was prepared from 1- to 2-day-old mice. Briefly, Brains freed of meninges were dissociated with 1 ml pipettes. Debris was removed by filtration with a 40 m cell strainer (Falcon). The attached cells were cultured in DMEM plus 10% FBS supplemented with 50 g/ml penicillin and 50 g/ml streptomycin. Astrocytes were confirmed by staining with anti-glial fibrillary acidic protein (GFAP) (Santa cruz) and purity was >90%. Neurons were prepared from the pups at E15. Brains were dissociated with lml pipettes and the debris removed using a 70 m cell strainer (Falcon). Cells were cultured in Neuronbasal media (Invitrogen) plus B-27 (invitrogen) and 50 g/ml penicillin and 50 g/ml streptomycin. >90% of these cultured cells were positive for MAP2 (a marker for neurons, anti-MAP2 from Abcam). Cre expression was induced with tamoxifen at 0.02 mg/ml for 3 consecutive days.
[0038] Collection of Tissue and Immunofluorescence:
[0039] Briefly, mice were perfused with 4% paraformaldehyde/phosphate-buffered saline (PBS), brains/spinal cords were collected and post-fixed for 24 h in 4% paraformaldehyde/PBS at 4 C., and snap-frozen in OCT medium followed by cryosectioning at 10 m. For immunofluorescent staining, frozen tissue sections was fixed and permeabilized with 4% paraformaldehyde solution containing 0.2% Triton X-1100 for 10 minutes. 10% normal goat serum was used as a blocking agent. Sections were incubated in PBS/0.2% Triton X-100/10% goat serum with appropriate primary and secondary antibodies and used for immunofluorescent staining followed by microscopic analysis.
[0040] RNA-Binding Assays RIP:
[0041] 1010.sup.6 NSC-34 cells were trypsinized, washed twice, and re-suspended in 10 ml ice-cold PBS. Cells were fixed in 0.1% formaldehyde for 15 min at room temperature, whereupon the cross-linking reaction was stopped with glycine (pH 7; 0.25 M). The cells were then washed twice with ice-cold PBS, re-suspended in 2 ml RIPA buffer (50 mM Tris-HCl [pH 7.5], 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.05% SDS, 1 mM EDTA, 150 mM NaCl, and proteinase inhibitors), and sonicated. The lysate was centrifuged (15 min, 4 C., 16,000g), and 1 ml each supernatant was immunoprecipitated overnight at 4 C., using Dynabeads (invitrogen) pre-incubated with 20 g anti-HuR or anti-IgG Ab. The beads were washed five times with 1 ml RIPA buffer and re-suspended in 150 l elution buffer (50 mM Tris-Cl [pH 7], 5 mM EDTA, 10 mM DTT, 1% SDS). Cross-linking was reversed by incubation at 70 C. for 45 min, RNA was purified from immunoprecipitates with Trizol (Invitrogen) according to the manufacturer's instructions and treated with RNase-free DNase, and cDNAs were synthesized and 10% (two microliters) of the reverse transcriptase product was subjected to quantitative real-time PCR. Primers used for quantitative real-time PCR are listed in Table 1.
TABLE-US-00001 TABLE1 Real-timePCRprimers SEQ SEQ ID ID Gene NO.: Forwardprimer NO.: Reverseprimer Tchp 4 TTGCCCTCTTATTGGTCCAGC 25 TAGCGACTGTTCTGTTCCCAC Cdkn2c 5 GGGGACCTAGAGCAACTTACT 26 AAATTGGGATTAGCACCTCTGAG Ifit1 6 GCCTATCGCCAAGATTTAGATGA 27 TTCTGGATTTAACCGGACAGC Bst2 7 TGTTCGGGGTTACCTTAGTCA 28 ACCCGTCTCTACAGGCCAC Ifitm2 8 TGGGCTTCGTTGCCTATGC 29 AGAATGGGGTGTTCTTTGTGC Hmga1 9 GCTGGTCGGGAGTCAGAAAG 30 GGTGACTTTCCGGGTCTTGG C2 10 CTCATCCGCGTTTACTCCAT 31 TGTTCTGTTCGATGCTCAGG Col1a1 11 GCTCCTCTTAGGGGCCACT 32 ATTGGGGACCCTTAGGCCAT C3F 12 AGCAGGTCATCAAGTCAGGC 33 GATGTAGCTGGTGTTGGGCT C4bF 13 TCTCACAAACCCCTCGACAT 34 AGCATCCTGGAACACCTGAA Gpsm2F 14 TTGATAAGCATGAGGGAAGACCA 35 GGCAGTCCCCTGATTTACATAGA ChaflaF 15 GGAGCAGGACAGTTGGAGTG 36 GACGAATGGCTGAGTACAGA Arfip1F 16 CCTTTGCCATGTGTTCTGTCT 37 CCACGGCCTAGTTTCTCAGATA TrdnF 17 CGACAACCACAACGGTGATAG 38 ACCATGTGATAATCAGAGCGATG Ier2F 18 GCCGAAGTTGCAGTGGAAGTA 39 TACCGTCGCTCAAATCGCTG TDP43F 19 TCCCCTGGAAAACAACAGAG 40 CCAGACGAGCCTTTGAGAAG FUSF 20 TCAAACGACTATACCCAACAAGC 41 TGGCCGTATCCTGAAGTGTCA GAPDH 21 ATGACATCAAGAAGGTGGTG 42 CATACCAGGAAATGAGCTTG F b-actinF 22 GGTCATCACTATTGGCAACG 43 ACGGATGTCAACGTCACACT SOD1 23 AACCAGTTGTGTTGTCAGGAC 44 CCACCATGTTTCTTAGAGTGAGG Bcl2 24 GATTGTGGCCTTCTTTGAG 45 CAAACTGAGCAGAGTCTTC
[0042] RIP data analysis: Ct value of each RIP RNA fractions was normalized to the Input RNA fraction Ct value for the same qPCR Assay (Ct) to account for RNA sample preparation differences. Then the normalized RIP fraction Ct value (Ct) was adjusted for the normalized background (anti-IgG) [non-specific (NS) Ab] fraction Ct value (Ct). The fold enrichment [RIP/non-specific (NS)] was calculated by linear conversion of the Ct. Shown below are the formulas used for the calculation: Ct [normalized RIP]=Ct [RIP](Ct [Input]Log 2 (fraction of the input RNA saved))); Ct [RIP/NS]=Ct [normalized RIP]Ct [normalized NS]; Fold Enrichment=2 (Ct [RIP/NS]).
[0043] Western Blot Analysis:
[0044] Brains and spinal cord were homogenized and stored at 80 C. Tissues were homogenized in ice-cold extraction buffer (120 mM NaCl, 50 mM Tris-base (pH 8.0) supplemented with 1 complete protease inhibitor mixture (Roche Applied Science)) straight after sampling and homogenates were centrifuged 30 min at 17,000g at 4 C. The resulting pellets were re-homogenized and centrifuged again 30 min at 17,000g at 4 C. Supernatants were resolved on SDS-PAGE followed by immunoblotting with antibodies.
[0045] Behavioral Tests
[0046] For all of behavioral studies, 15 conditional neuron-specific HuR-deficient mice (Thy1.sup.Cre-ERT2-EYFPHuR.sup.f/f, designed as KO) and 15 age matched control mice (Thy1.sup.Cre-ERT2-EYFPHuR.sup.f/+, designed as wild type, WT) of both sexes were used (specifically, 8 WT males, 8 KO males, 7 WT females and 7 KO females were used).
[0047] Open Field Behavioral Test:
[0048] Experimental mice were placed at the periphery of the open field apparatus with the head facing toward the proximal wall and allowed to explore the arena freely for 15 min. The experimenter was out of view from the mice at all times. The distance traveled were automatically recorded on either a video-tracking system or infrared sensors. Measurements were taken over two weeks, twice per week; N=15 for both groups.
[0049] Rotarod:
[0050] To assess motor coordination and locomotion, the accelerating rotarod (Rotarmex-5, Columbus Instruments, Columbus, Ohio) was utilized. Each mouse received baseline training. Rod rotations increased from 4 to 40 rotations per minute (RPM) during each five-minute trial. An average latency to fall over four trials with a 30 min. inter-trial interval. was calculated for each testing day and compared across all between the two groups. Measurements were taken over two weeks, one time per week; N=15 for both groups.
[0051] Y-Maze:
[0052] Each mouse was placed in the Y-maze and manually scored for spontaneous alternations (the sequential entry of all arms before entering another arm) and total arm entries. Each mouse was tested at 7, 31, 61, and 91 DPI. At the beginning of each trial, the mouse was placed in the center of the Y-maze and allowed to freely explore for 5 minutes. N=15 for both groups. Measurements were taken over two weeks, twice per week; N=15 for both groups.
[0053] Grip Strength:
[0054] mice were subject to quantitative grip-strength assessment using a commercial apparatus (BioSeb, Chaville, France). Forelimb and hindlimb grip strength were measured following the manufacturer's instructions. For each experiment, measurements were taken over two weeks, one time per week. N=15 for both groups.
[0055] Gene Ontology Term Enrichment Analysis:
[0056] GO analysis was performed on the web server of the DAVID functional annotation tool (PMID: 19131956). A FDR of 10% was applied to evaluate significance.
[0057] Gene Array:
[0058] RNA samples from whole brain tissue of three pairs of experimental neuron-specific HuR-deficient mice and littermate control mice were analyzed on Affymetrix Mouse Gene 2.0 ST arrays. Biotinylated RNA was prepared according to Affymetrix WT Plus Labeling Kit from 150 ng total RNA. The labeled RNA were hybridized for 16 hr at 45 C. on GeneChip 2.0 Arrays. GeneChips were washed and stained in the AffymetrixFluidics Station 450. GeneChips were scanned using the Affymetrix GeneChip Scanner 3000. The full microarray data has been deposited in the NCBI GEO as series GSE112678.
[0059] Quantitative Real-Time PCR
[0060] Total RNA was isolated with TRIzol reagent (Invitrogen). Real-time PCR was performed using a SYBR Green PCR Master Mix kit (Applied Biosystems). The primers used are presented in Table 1.
[0061] Results
[0062] Generation of Neuron-Specific HuR-Deficient Mice
[0063] To examine the function of the RNA-binding protein HuR in neurons, we generated HuR.sup.f/f mice and bred onto Thy1.sup.Cre-ERT2-EYFP to obtain conditional neuron-specific HuR-deficient mice (Thy1.sup.Cre-ERT2-EYFPHuR.sup.f/f, designed as KO) and control mice (Thy1.sup.Cre-ERT2-EYFPHuR.sup.f/+, designed as wild type, WT). Cre expression was induced through Tamoxifen administration to conditional neuron-specific HuR-deficient mice (Thy1.sup.Cre-ERT2-EYFPHuR.sup.f/f) and control mice (Thy1.sup.Cre-ERT2-EYFPHuR.sup.f/+) of either sex at 10 and 11 weeks of age (
[0064] Neuron-Specific HuR-Deficient Mice Show Impaired Motor Coordination and Grip Strength
[0065] Neuron-specific HuR-deficient mice developed a phenotype consisting of poor motor skills and abnormal gait that resembled wobbler mice in gross observation, indicating symptoms of motor neuron disease. This phenotype was quantified using a variety of behavioral tests to further confirm the motor deficits. First, we conducted general assessments of basal locomotor activity and evaluated exploration in an open field. Mice were placed in an open area for 15 minutes and overall distance walked was measured. The conditional neuron-specific HuR-deficient mice (Thy1.sup.Cre-ERT2-EYFPHuR.sup.f/+) covered significantly less distance (500 cm) compared to age-matched control (Thy1.sup.Cre-ERT2-EYFPHuR.sup.f/+) mice (700 cm; P<0.05) (
[0066] To further characterize motor function impairments, we employed the rotarod test, which measures coordination, balance, and motor skills. Mice were placed on a rod that rotated with increasing speed and the time they remained on the rod before falling was recorded. During the test, the conditional neuron-specific HuR-deficient mice (Thy1.sup.Cre-ERT2-EYFPHuR.sup.f/f), performed significantly worse (50 seconds) on the rotarod compared to control (Thy1.sup.Cre-ERT2-EYFPHuR.sup.f/+) mice (120 seconds; P<0.05), indicating coordination deficiency (
[0067] It is important to point out that we also analyzed the data based on gender and no significant difference in behavior was observed between male and female mice (data not shown). The differences between conditional neuron-specific HuR-deficient mice (Thy1.sup.Cre-ERT2-EYFPHuR.sup.f/f) and control mice in the behavioral tests (
[0068] Neuron-Specific HuR-Deficient Mice Display Degeneration of Cortical and Spinal Motor Neurons
[0069] We then examined whether there was any neuronal pathology that might account for the impaired motor coordination and grip strength in neuron-specific HuR-deficient mice. We performed immunostaining of brain sections from neuron-specific HuR-deficient mice and littermate controls using anti-NeuN (neuron-specific marker), anti-ChaT (motor neuron marker) and anti-cleaved Caspase 3 (apoptotic cells marker). We found that there was an increased number of apoptotic neuronal cells (8-fold greater cleaved caspase 3-positive cells) in neuron-specific HuR-deficient mice compared to wild-type mice (
[0070] Microarray Analysis of Brain Tissue from Neuron-Specific HuR-Deficient Mice
[0071] To investigate the possible mechanism for how neuron-specific HuR deficiency impacts neuropathology, we then performed genome-wide microarray analysis using brain tissues from neuron-specific HuR-deficient and control mice. We identified a total of 3516 genes that showed significant differential expression in the brain tissues of neuron-specific HuR-deficient mice compared to control mice. Gene Ontology (GO) enrichment analysis of the significantly altered genes showed that the most significantly enriched GO term for HuR-regulated transcripts was negative regulation of cell growth (
[0072] Neuron-Specific HuR-Deficient Mice Display a Molecular Signature Reminiscent of ALS
[0073] Considering the impaired function in motor neurons, we compared the list of genes that were differentially expressed in the brain tissues of neuron-specific HuR-deficient mice with the GEO database for ALS patients. We identified a group of genes from our array analysis that were also significantly altered in the brain and spinal cord of ALS patients (
[0074] One question is whether there is a direct HuR target(s) among the HuR-regulated transcripts that we identified using neuron-specific HuR-deficient mice and the GEO database for ALS patients (11). Ier2 was found to be an mRNA target of HuR (12). To assess RNA binding of HuR to Ier2 mRNA in neuronal cells, we immunoprecipitated HuR from NSC-34 motor neuron-like cells, followed by RT-PCR analysis. Enriched Ier2 mRNA was detected in HuR immunoprecipitates compared to those from IgG immunoprecipitation controls (
[0075] Since HuR was implicated in positively regulating TDP-43 and FUS expression in astrocytes, we examined the impact of neuron-specific HuR deficiency on TDP-43 and FUS expression. We failed to detect significant impact of neuron-specific HuR deficiency on TDP-43 or FUS expression in brain tissue by both RT-PCR and western blot analysis (
[0076] We have created a neuron-specific HuR-deficient mouse strain to study a HuR function/phenotype that can be used as a motor neuron disease model. Second, neuron-specific HuR-deficient mice show significant deficits in forelimb motor function that are supported by anatomical evidence of motor neuron death in both motor cortex and cervical spinal cord. Third, microarray analysis revealed reductions in several hallmark molecules of ALS in neuron-specific HuR-deficient mice, as well as significant up-regulation of inflammation-related genes similar to those found in ALS patients.
[0077] The present Example showed significant motor neuron death in HuR-deficient mice. The loss of HuR in neurons not only alters gene expression, but also increases sensitivity to neurotoxicity and oxidative stress (18). Both post-mortem tissues from ALS patients and transgenic mice expressing mutant SOD1 have revealed a role of oxidative stress in the pathogenesis of ALS (19-21). A recent report indicated a possible link between oxidative stress and TDP-43 delocalization (from nucleus to cytoplasm) and aggregation in the cytosol (13, 22). In the present Example, we have demonstrated delocalization of TDP-43 from nuclei to cytosol in cortical neurons from HuR-deficient mice, suggesting that increased oxidative stress leads to neuronal death in this model.
[0078] In addition to neuropathology, neuron-specific HuR-deficient mice also displayed a molecular signature consistent with motor neuron disease. We identified a group of genes from our array analysis that were also significantly altered in the brain and spinal cord of ALS patients. Genome-wide microarray analysis and RT-PCR analysis indicated that HuR deficiency in neurons reduced the expression of genes important for cell survival and proliferation, including SOD1, Ier2, and GPSM2. Excitingly, while SOD1 mutation is well-known to be associated with ALS, the expression of Ier2 and GPSM2 were also significantly reduced in the brain and spinal cord of ALS patients (11). Notably, out of the 3500 genes differentially expressed in the brain tissues of neuron-specific HuR-deficient mice, the most significantly enriched GO term for HuR-regulated transcripts was regulation of cell growth, which is an important molecular signature of motor neuron diseases.
[0079] Interestingly, the additional enriched GO terms for HuR-regulated transcripts were largely related to inflammation, including complement components and interferon-induced genes. Interestingly, we found that there was increased astrocyte activation in the brain tissue of neuro-specific HuR-deficient mice. Inflammation and astrogliosis have been associated with several neurodegenerative disorders and detected in the brainstem and spinal cord of patients with ALS and in mouse models of this disease (23-25). The complement system has been implicated in ALS pathogenesis; specifically, in an ALS mouse model in which SOD1 was mutated (G93A), deposition of C1q and C3/C3b was found along peripheral nerves, in the spinal cord, and in brain tissue (26-31). Recent findings indicate that, under stress, local complement signaling might therefore promote damage and motor neuron death in ALS (31). However, the exact role of the complement system in ALS pathogenesis and progression remains unclear. Another immune gene found upregulated in ALS patients and in HuR-deficient brain tissue was Interferon Induced Transmembrane Protein 2 (Ifitm2), which has been found to mediate apoptosis by caspase activation, potentially contributing to neuronal cell death in the HuR-deficient mice as indicated by Caspase 3 cleavage. Of note, reduction or deletion of IFN receptor 1 inhibited IFN signaling and increased the life-span of SOD1 (G93A) mice (32). It is possible that neuronal cell death releases a danger signal, which in turn activates immune cells to produce interferons, resulting in the induction of interferon-responsive genes. Additionally, we observed increased immune cell infiltration in the spinal cord of neuron-specific HuR-deficient mice. While astrogliosis has been implicated in the recruitment of leukocytes to the sites of axonal injury in the CNS, T cells have also been shown to be associated with neuroprotective role in ALS possibly by modulating a beneficial inflammatory response to neuronal injury (33). Future studies are required to further analyze the T cell subsets and their functions in the brain tissues of neuro-specific HuR-deficient mice.
[0080] We also searched for the direct HuR target(s) among the many regulated targets altered in HuR-deficient brain and in the CNS of ALS patients. Although HuR was implicated in positively regulating TDP-43 and FUS expression in astrocytes, we failed to detect any significant impact of neuron-specific HuR deficiency on TDP-43 or FUS expression in brain tissue. Instead, we found that Ier2 might be an mRNA target of HuR (12). RT-PCR, western blot analysis, and immunostaining demonstrated reduced expression of Ier2 in brain tissue of neuron-specific HuR-deficient mice. Moreover, enriched Ier2 mRNA was detected in HuR immunoprecipitates compared to those from IgG controls, suggesting HuR-direct binding to Ier2 mRNA in neuronal cells. Importantly, Ier2 mRNA was also significantly reduced in the brain and spinal cord of ALS patients (11). Although TDP-43 was not a direct target of HuR in neuronal cells, neuronal HuR deficiency did result in the redistribution of TDP-43 to cytosolic granules, which has been linked to motor neuron disease. Neuron-specific HuR-deficient mice have a motor neuron deficiency phenotype accompanied by both neuropathology and molecular signatures manifested in ALS patients.
REFERENCES
[0081] 1. Taylor, et al., Cleveland. 2016. Decoding ALS: from genes to mechanism. Nature 539: 197-206. [0082] 2. Zarei et ak., 2015. A comprehensive review of amyotrophic lateral sclerosis. Surg. Neurol. Int. 6. [0083] 3. Petrov, et a., 2017. ALS Clinical Trials Review: 20 Years of Failure. Are We Any Closer to Registering a New Treatment? Front. Aging Neurosci. 9. [0084] 4. Xu, Z.-S. 2012. Does a loss of TDP-43 function cause neurodegeneration? Mol. Neurodegener. 7: 27. [0085] 5. Brennan, C. M., and J. A. Steitz. 2001. HuR and mRNA stability. Cell. Mol. Life Sci. CMLS 58: 266-277. [0086] 6. Schoenberg, D. R., and L. E. Maquat. 2012. Regulation of cytoplasmic mRNA decay. Nat. Rev. Genet. 13: 246-259. [0087] 7. Herjan, et al., 2013. HuR is required for IL-17-induced Actl-mediated CXCL1 and CXCLS mRNA stabilization. J. Immunol. Baltim. Md. 1950 191: 640-649. [0088] 8. Lu et al., 2014. Hu antigen R (HuR) is a positive regulator of the RNA-binding proteins TDP-43 and FUS/TLS: implications for amyotrophic lateral sclerosis. J. Biol. Chem. 289: 31792-31804. [0089] 9. Lu, et al., 2009. Amyotrophic lateral sclerosis-linked mutant SOD1 sequesters Hu antigen R (HuR) and TIA-1-related protein (TIAR): implications for impaired posttranscriptional regulation of vascular endothelial growth factor. J. Biol. Chem. 284: 33989-33998. [0090] 10. Milani, et al., 2013. Posttranscriptional regulation of SOD1 gene expression under oxidative stress: Potential role of ELAV proteins in sporadic ALS. Neurobiol. Dis. 60: 51-60. [0091] 11. Dangond, et al., 2004. Molecular signature of late-stage human ALS revealed by expression profiling of postmortem spinal cord gray matter. Physiol. Genomics 16: 229-239. [0092] 12. Abdelmohsen et al., 2009. Ubiquitin-mediated proteolysis of HuR by heat shock. EMBO J. 28: 1271-1282. [0093] 13. Cohen et al., An acetylation switch controls TDP-43 function and aggregation propensity. Nat. Commun. 6: 5845. [0094] 14. Dewey, et al., 2012. TDP-43 aggregation in neurodegeneration: are stress granules the key? Brain Res. 1462: 16-25. [0095] 15. Magran, et al., 2014. Abnormal mitochondrial transport and morphology are common pathological denominators in SOD1 and TDP43 ALS mouse models. Hum. Mol. Genet. 23: 1413-1424. [0096] 16. Peters et al., 2015. Emerging mechanisms of molecular pathology in ALS. J. Clin. Invest. 125: 1767-1779. [0097] 17. Rowland et al., 2001. Amyotrophic lateral sclerosis. N. Engl. J. Med. 344: 1688-1700. [0098] 18. Skliris et al., 2015. Neuroprotection requires the functions of the RNA-binding protein HuR. Cell Death Differ. 22: 703-718. [0099] 19. D'Amico et al., 2013. Clinical perspective on oxidative stress in sporadic amyotrophic lateral sclerosis. Free Radic. Biol. Med. 65: 509-527. [0100] 20. Nagase et al., 2016. Increased oxidative stress in patients with amyotrophic lateral sclerosis and the effect of edaravone administration. Redox Rep. Commun. Free Radic. Res. 21: 104-112. [0101] 21. Pollari et al., 2014. The role of oxidative stress in degeneration of the neuromuscular junction in amyotrophic lateral sclerosis. Front. Cell. Neurosci. 8. [0102] 22. Meyerowitz et al., 2011. C-Jun N-terminal kinase controls TDP-43 accumulation in stress granules induced by oxidative stress. Mol. Neurodegener. 6: 57. [0103] 23. Amor et al., 2010. Inflammation in neurodegenerative diseases. Immunology 129: 154-169. [0104] 24. McCombe et al., 2011. The Role of Immune and Inflammatory Mechanisms in ALS. Curr. Mol. Med. 11: 246-254. [0105] 25. Philips and Rothstein. 2014. Glial cells in Amyotrophic Lateral Sclerosis. Exp. Neurol. 262PB: 111-120. [0106] 26. Heurich, et al., 2011. Complement upregulation and activation on motor neurons and neuromuscular junction in the SOD1 G93A mouse model of familial amyotrophic lateral sclerosis. J. Neuroimmunol. 235: 104-109. [0107] 27. Humayun et al., 2009. The complement factor C5a receptor is upregulated in NFL/ mouse motor neurons. J. Neuroimmunol. 210: 52-62. [0108] 28. Lee, et al., 2013. Dysregulation of the complement cascade in the hSOD1G93Atransgenic mouse model of amyotrophic lateral sclerosis. J. Neuroinflammation 10: 119. [0109] 29. Lobsiger et al., Cleveland. 2007. Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc. Natl. Acad. Sci. U.S.A 104: 7319-7326. [0110] 30. Takeuchi et al., 2010. Induction of protective immunity by vaccination with wild-type apo superoxide dismutase 1 in mutant SOD1 transgenic mice. J. Neuropathol. Exp. Neurol. 69: 1044-1056. [0111] 31. Woodruff, et al., 2008. The complement factor C5a contributes to pathology in a rat model of amyotrophic lateral sclerosis. J. Immunol. Baltim. Md. 1950 181: 8727-8734. [0112] 32. Julien, et al., 2006. Transgenic mouse models of amyotrophic lateral sclerosis. Biochim. Biophys. Acta BBAMol. Basis Dis. 1762: 1013-1024. [0113] 33. Chiu, et al., 2008. T lymphocytes potentiate endogenous neuroprotective inflammation in a mouse model of ALS. Proc. Natl. Acad. Sci. U.S.A 105: 17913-17918.
[0114] All publications and patents mentioned in the specification and/or listed below are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the relevant fields are intended to be within the scope described herein.