MUTANT YEAST STRAIN CAPABLE OF PRODUCING MEDIUM CHAIN FATTY ACIDS

Abstract

Embodiments of the present disclosure relate to mutant yeast strains, in particular mutant Yarrowia strains, capable of producing medium chain fatty acids compared to the parent oleaginous yeast strain from which said mutant oleaginous yeast strain derives. Embodiments of the present disclosure also relate to means and methods for obtaining these mutant yeast strains.

Claims

1. A method for increasing the ratio of fatty acids having a hydroxycarbon chain length consisting of 16 carbons (C16 fatty acids) to fatty acids having a hydroxycarbon chain consisting of 18 carbons (C18 fatty acids) and/or for increasing the amount of medium chain length fatty acids (C8-C15 fatty acids), produced by a yeast strain, compared to the parent yeast strain from which said yeast strain derives, comprising expressing in said yeast strain a mutated fatty acid synthase subunit alpha (FAS), wherein the amino acid residue of said FAS corresponding to the amino acid residue at position 1220 in SEQ ID NO: 1 is substituted with a larger steric hindrance amino acid residue.

2. The method according to claim 1, wherein: when the amino acid residue corresponding to the amino acid residue at position 1220 in SEQ ID NO: 1 of the non-mutated FAS is isoleucine (I) then it is substituted with an amino acid residue selected from the group consisting of phenylalanine (F), histidine (H), methionine (M), tryptophan (W) and tyrosine (Y), when the amino acid residue corresponding to the amino acid residue at position 1220 in SEQ ID NO: 1 of the non-mutated FAS is valine (V) then it is substituted with an amino acid residue selected from the group consisting of isoleucine (I) phenylalanine (F), histidine (H), methionine (M), tryptophan (W) and tyrosine (Y), and when the amino acid residue corresponding to the amino acid residue at position 1220 in SEQ ID NO: 1 of the non-mutated FAS is methionine (M) then it is substituted with an amino acid residue selected from the group consisting of phenylalanine (F), histidine (H), tryptophan (W) and tyrosine (Y).

3. The method according to claim 1, wherein the amino acid sequence of the non-mutated FAS has at least 50% identity, or by order of increasing preference at least 51%, 55%, 60%, 65%, 70%, 75%, 82%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, 99% or 100% identity, with the amino acid sequence of Yarrowia lipolytica FAS of SEQ ID NO: 1.

4. The method according to claim 3, wherein the mutated FAS is derived from the consensus amino acid sequence SEQ ID NO: 11, wherein the amino acid residue corresponding to the amino acid residue at position 1220 in SEQ ID NO: 1 is substituted with a larger steric hindrance amino acid residue.

5. The method according to claim 1, wherein the mutated FAS is derived from FAS selected from the group consisting of FAS of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 and 9.

6. The method according to claim 20, wherein the amino acid residue at position 1305 of said FAS is substituted with threonine (T).

7. The method according to claim 1, wherein the ratio of fatty acids having a hydroxycarbon chain length consisting of 12 or 16 carbons (C12 or C16 fatty acids), to fatty acids having a hydroxycarbon chain consisting of 18 carbons (C18 fatty acids) is increased and/or the amount of medium chain fatty acids having a hydroxycarbon chain length consisting of 12 carbons or 14 carbons (C12 or C14 fatty acids) is increased.

8. The method according to claim 7, wherein the fatty acid having a hydroxycarbon chain length consisting of 14 carbons is myristic acid (tetradecanoic acid) and the fatty acid having a hydroxycarbon chain length consisting of 12 carbons is lauric acid (dodecanoic acid).

9. The method according to claim 7, wherein the substitution of the amino acid residues corresponding to the amino acid residues at position 1220 of said FAS is obtained by site-directed mutagenesis of the FAS gene targeting the codon encoding the amino acid residues corresponding to the amino acid residues at said positions 1220.

10. The method according to claim 1, wherein the method further comprises inhibiting in said yeast strain the expression and/or the activity of one or more endogenous elongase proteins, wherein the endogenous elongase protein is elongase 1 (ELO1; EC 2.3.1.199) having at least 50% identity or by order of increasing preference at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identity, with the polypeptide of sequence SEQ ID NO: 12 (YALI_ELO1) and/or of the endogenous elongase 2 (EL02; EC2.3.1.199) having at least 50% identity or by order of increasing preference at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identity, with the polypeptide of sequence SEQ ID NO: 13 (YALI_EL02).

11. The method according to claim 1, wherein the method further comprises inhibiting in said yeast strain the expression and/or the activity of the endogenous fatty acid synthase subunit alpha (EC 2.3.1.86).

12. The method according to claim 10, wherein said inhibition is obtained by genetically transforming the yeast strain with a disruption cassette of the endogenous gene encoding said FAS and of the endogenous gene encoding said elongase 1 or of the endogenous gene encoding said elongase 2.

13. A recombinant DNA expression cassette, comprising a polynucleotide encoding a mutated FAS as defined in claim 1 under the control of a suitable promoter.

14. A recombinant vector comprising a recombinant DNA expression cassette of claim 13.

15. A host cell comprising a recombinant DNA expression cassette of claim 13.

16. A mutant yeast strain able to produce an increased ratio of fatty acids having a hydroxycarbon chain length consisting of 16 carbons (C16 to fatty acids) to fatty acids having a hydroxycarbon chain consisting of 18 carbons (C18 fatty acids) and/or an increased amount of medium chain length fatty acids (C8-C15 fatty acids) compared to the parent oleaginous yeast strain from which said mutant yeast strain derives, wherein said mutant yeast strain expresses a mutated FAS as defined in claim 1.

17. A mutant yeast strain able to produce an increased ratio of fatty acids having a hydroxycarbon chain length consisting of 16 carbons (C16 to fatty acids) to fatty acids having a hydroxycarbon chain consisting of 18 carbons (C18 fatty acids) and/or an increased amount of medium chain length fatty acids (C8-C15 fatty acids) compared to the parent oleaginous yeast strain from which said mutant yeast strain derives, wherein said mutant yeast strain expresses a mutated FAS as defined in claim 1, and wherein the mutant yeast strain comprises, stably integrated in its genome, a recombinant DNA expression cassette comprising a polynucleotide encoding a mutated FAS as defined in claim 1 under the control of a suitable promoter.

18. The method according to claim 1, wherein the yeast strain belongs to the genus selected from the group consisting of Candida, Cryptoccocus, Lipomyces, Rhodosporidium, Rhodotorula, Trichosporon, Saccharomyces and Yarrowia.

19. The method or the mutant yeast strain according to claim 18, wherein the oleaginous yeast strain is selected from the group consisting of a Y. lipolytica, Y. galli, Y. yakushimensis, Y. alimentaria and Y. phangngensis strain.

20. The method of claim 1, wherein the amino acid residue of said FAS corresponding to the amino acid residue at position 1305 in SEQ ID NO: 1 is substituted with any other amino acid.

21. The method according to claim 4, wherein the amino acid residue corresponding to the amino acid residue at position 1305 in SEQ ID NO: 1 is substituted with any other amino acid.

22. The method accordingly to claim 20, wherein the substitution of the amino acid residues corresponding to the amino acid residues at position 1305 of said FAS is obtained by site-directed mutagenesis of the FAS gene targeting the codon encoding the amino acid residues corresponding to the amino acid residues at said position 1305.

Description

[0097] The present invention will be understood more clearly from the further description which follows, which refers to non-limitative examples illustrating the expression of a mutated fatty acid synthase in Y. lipoytica.

[0098] FIG. 1 shows the fatty acid profile in mg/1 for the mutated strains FAS+FASI1220F clone A, B and C after 5 days of culture in minimum medium.

[0099] FIG. 2 shows the fatty acid profile in mg/mL for the strain FAS transformed with FASwt or with mutated FAS after five days of culture in minimum medium complemented or not with Oleic acid (AO). /: Minimum medium non-inoculated complemented with oleic acid; IW: strain FAS+FASI1220W; IWST: strain FAS+FAS 11220W/S1305T; MM AO: minimum medium complemented with oleic acid; wt: strain FAS+FASwt; MM: minimum medium with no complementation.

[0100] FIG. 3 shows the fatty acid profile in mg/mL for FAS strain transformed with FASwt or with mutated FAS after five days of culture in minimum medium. Wt: strain FAS+FASwt; I1220F: strain FAS+FASI1220F; I1220M: strain FAS+FASI1220M; I1220F/S1305T: strain FAS+FAS I1220F/S1305T.

[0101] FIG. 4 shows the plasmid map of the shuttle plasmid JMP62Leu2expTEF including the FAS gene of Y. lipolytica.

[0102] FIG. 5 shows the plasmid map of the shuttle plasmid pL68BT.

[0103] FIG. 6 shows the plasmid map of the shuttle plasmid pU18BT.

[0104] FIG. 7 shows the plasmid map of the shuttle plasmid pL68TAL_KSl.

[0105] FIG. 8 shows the plasmid map of the shuttle plasmid pU18TAL_KSr.

[0106] FIG. 9 shows the plasmid map of the shuttle plasmid TOPO-ELO1-PUT.

[0107] FIG. 10 shows the plasmid map of the shuttle plasmid TOPO-ELO2-PLT.

[0108] FIG. 11 shows the plasmid map of the shuttle plasmid pUB4-CRE.

[0109] FIG. 12 shows the FA profile in mg/mL for each mutant (the letter stands for the amino acid replacing the residue I in position 1220. For example, E: mutant I1220E). Fatty acids were extracted from the cells and medium.

[0110] FIG. 13: shows the FA profile in mg/mL for each mutant (the letter stands for the amino acid replacing the residue I in position 1220. For example, Y: mutant I1220Y). Fatty acids were extracted from the cells and medium.

[0111] FIG. 14: shows FA profile in mg/mL for the strain JMY1233_FAS after 5 days of culture in minimum medium supplemented with either methylC14 (MM mC14) or Oleic acid (MM AO). Fatty acids were extracted from the cells.

[0112] FIG. 15: FA profile in mg/mL for the strain JMY1233_FASI1220F (IF) and the strain JMY1233_Elo1Elo2_FASI1220F after 5 days of culture in minimum medium. Fatty acids were extracted from the cells and medium.

EXAMPLE 1: YARROWIA LIPOLYTICA MUTANTS WITH ENGINEERED FATTY ACID SYNTHASE TO PRODUCE MEDIUM CHAIN FATTY ACIDS

[0113] 1. Materials and Methods

[0114] a. Media

[0115] Rich medium YPD (Yeast extract 10 g/L, bactopeptone 10 g/L, glucose 10 g/L) was used for growing cells prior genomic extraction and for start cultures. Minimal medium YNB (glucose 10 g/L, YNB w/o AA 1.7 g/l, NH.sub.4Cl 5 g/L, Phosphate buffer pH 6,8 50 mM, agarose 15 g/l) was used to select colonies after transformation. When necessary, Oleic Acid prepared in Tween 40 was added at 0.1% final. To grow cells for analysis of lipid content, the specific minimal medium for lipid accumulation was used (glucose (80 g/L), ammonium sulfate (1.5 g/L), Phosphate buffer (100 mM), oligo elements: CoCl.sub.2 0.5 mg/L, CuSO.sub.4 0.9 mg/L, Na.sub.2MoO.sub.4 0.06 mg/L, CaCl.sub.2 23 mg/L, H.sub.3BO.sub.3 3 mg/L, MnSO.sub.4 3.8 mg/L, MgSO.sub.4 10 mg/L, ZnSO.sub.4 40 mg/L, FeSO.sub.4 40 mg/L, vitamins (D-biotin 0.05 mg/L, Panthotenate 1 mg/L, nicotinic acid 1 mg/L, Myo inositol 25 mg/L, Thiamine hydrochloride 1 mg/L, Pyridoxol hydrochloride 1 mg/L, p-aminobenzoic acid 0.2 mg/L). For mutants that required oleic acid to grow, 0.1% was added.

[0116] b. Strains

[0117] The strain JMY3776 (Genotype MATa URA3-302 Leu2-270 xpr2-322 phd1 mfe tg14+TEF ylDGA2+TEF GPD1) disclosed in International Application WO 2014136028 A1 was deleted of its FAS gene (SEQ ID NO: 10) by homologous recombination leading to the FAS strain JMY4368 (Genotype MATa URA3-302 Leu2-270 xpr2-322 phd1 mfe tg14+TEF ylDGA2+TEF GPD1+PTFAS2). The deletion cassette of sequence SEQ ID NO: 16 were typically generated by PCR amplification according to Fickers et al. (2003).

[0118] c. Plasmids

[0119] Gene were cloned into the shuttle plasmid JMP62Leu2expTEF (Beopoulos et al., 2014) harboring a replicative origin and a kanamycine resistance gene for plasmid proliferation and selection in E. coli and the gene encoding for LEU2 protein for selection in Y. lipolytica.

[0120] The plasmid map of the shuttle plasmid JMP62Leu2expTEF including the FAS gene of Y. lipolytica (JMP62Leu2expTEFaFAS) in shown in FIG. 4.

[0121] d. Expression Cassette and Transformation

[0122] In parallel, the whole FAS gene (SEQ ID NO: 10; amplified from genomic DNA of the PO1d strain; Barth and Gaillardin, 1996 with the FAS F and FAS R primers) was cloned in the JMP62Leu2expTEF plasmid using in-Fusion technic leading to JMP62Leu2expTEFFAS plasmid. To generate the cassette for random genomic integration of the FAS gene in the strain, the plasmid JMP62Leu2expTEFaFAS was digested with NotI and used for transformation into the FAS strain. Transformations were plated on YNB medium for a selection by integration of the Leucine marker. Transformation was performed using the Frozen-EZ Yeast Transformation II Kit (Zymoresearch) following manufacturer instructions.

TABLE-US-00002 TABLE2 Primersusedinthisstudy SEQID Primer Sequence(5-3) NO: alphaFASF ACCCGAAGGATCCCACAATGCACCCCGAAGTCGAACAAGAAC 20 alphaFASR ACCACAGACACCCTAGGCTACTCGGCAACAGCAACAGCCA 21 FAS_S1305TF atgatttccaggaggagacttctcaggagtttgca 22 FAS_S1305TR tgcaaactcctgagaagtctcctcctggaaatcat 23 FAS_M1217F_F ctgttccggttccggtttcggtggtatcaccg 24 FAS_M1217F_R cggtgataccaccgaaaccggaaccggaacag 25 FAS_M1217Y_F aactgttccggttccggttacggtggtatcaccgcc 26 FAS_M1217Y_R ggcggtgataccaccgtaaccggaaccggaacagtt 27 FAS_I1220MF tccggtatgggtggtatgaccgccctg 28 FAS_I1220MR cagggcggtcataccacccataccgga 29 FAS_I1220FF ccggtatgggtggtttcaccgccctgc 30 FAS_I1220FR gcagggcggtgaaaccacccataccgg 31 FAS_I1220WF tccggttccggtatgggtggttggaccgccctgcg 32 FAS_I1220WR cgcagggcggtccaaccacccataccggaaccgga 33 KS-T7_F TGGATGGGATGCCCGACGATA 34 KS-T7_R GAGTGATCTCGGTCTCAGCGTT 35 HRscreening_R GGTCCTTaAACATaCCtCtg 36 WTscreening_R GGTCCTTGAACATGCCTCGC 37 KS_P1 GTCGTTGAGAACAAGGCTGTTTCTG 38 KS_T2 GAATTTGGATAGTAGGGGCCACAGT 39 MatrixKS-TALEN1F AACGGTGGCTTCCAGTACATTCC 40 MatrixKS-TALEN4R TTGGATGGCTCCGTTGAGCATCCA 41 MatrixKSI1220L3F ATGGGTGGTCTGACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 42 MatrixKSI1220L2R AGGGCGGTCAGACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 43 MatrixKSI1220V3F ATGGGTGGTgtcACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 44 MatrixKSI1220V2R AGGGCGGTgAcACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 45 MatrixKSI1220S3F ATGGGTGGTtccACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 46 MatrixKSI1220S2R AGGGCGGTGGAACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 47 MatrixKSI1220P3F ATGGGTGGTcccACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 48 MatrixKSI1220P2R AGGGCGGTGGgACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 49 MatrixKSI1220T3F ATGGGTGGTaccACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 50 MatrixKSI1220T2R AGGGCGGTGGtACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 51 MatrixKSI1220A3F ATGGGTGGTgccACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 52 MatrixKSI1220A2R AGGGCGGTGGcACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 53 MatrixKSI1220Y3F ATGGGTGGTtacACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 54 MatrixKSI1220Y2R AGGGCGGTGtAACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 55 MatrixKSI1220H3F ATGGGTGGTcacACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 56 MatrixKSI1220H2R AGGGCGGTGtgACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 57 MatrixKSI1220Q3F ATGGGTGGTcagACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 58 MatrixKSI1220Q2R AGGGCGGTctgACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 59 MatrixKSI1220N3F ATGGGTGGTaacACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 60 MatrixKSI1220N2R AGGGCGGTGttACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 61 MatrixKSI1220K3F ATGGGTGGTaagACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 62 MatrixKSI1220K2R AGGGCGGTcttACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 63 MatrixKSI1220D3F ATGGGTGGTgacACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 64 MatrixKSI1220D2R AGGGCGGTGtcACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 65 MatrixKSI1220E3F ATGGGTGGTgagACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 66 MatrixKSI1220E2R AGGGCGGTctcACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 67 MatrixKSI1220C3F ATGGGTGGTtgcACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 68 MatrixKSI1220C2R AGGGCGGTGcaACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 69 MatrixKSI1220M3F ATGGGTGGTATGACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 70 MatrixKSI1220M2R AGGGCGGTCATACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 71 MatrixKSI1220W3F ATGGGTGGTtggACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 72 MatrixKSI1220W2R AGGGCGGTccaACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 73 matrixKSI1220F3F ATGGGTGGTTTCACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 74 matrixKSI1220F2R AGGGCGGTGAaACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 75 MatrixKSI1220R3F ATGGGTGGTcgaACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 76 MatrixKSI1220R2R AGGGCGGTtcgACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 77 MatrixKSI1220G3F ATGGGTGGTggcACCGCCCTcaGaGGtATGTTtAAGGACCGGTTCATGGAC 78 MatrixKSI1220G2R AGGGCGGTgccACCACCCATgCCGGAtCCaGAgCAGTTACCGACCTCGGA 79 FAS_S1305VF cgatgatttccaggaggaggtttctcaggagtttgcaaac 80 FAS_S1305VR gtttgcaaactcctgagaaacctcctcctggaaatcatcg 81

[0123] e. Construction of the Mutated Strain

[0124] Site directed mutagenesis was performed on position I1220 and M1217 in vitro using the QuickChange Site-Directed Mutagenesis kit from Agilent, using the plasmid JMP62LEU2expTEFFAS as DNA template and the primers listed in Table 2. After transformation in E. coli, plasmid extraction and sequencing, the plasmid was digested with NotI and used for transformation in Y. lipolytica. Clones were selected for Leucine integration on minimum medium. Due to the Fatty acid auxotrophy of the FAS and the length of the integration cassette (8.6 kb), efficiency of transformation was usually low (around 20 cfu/g plasmid). Gene integration was verified by amplification of the FAS gene from genomic DNA of the selected clones followed by sequencing. Validated mutants were then evaluated for their ability to grow on medium without fatty acid (Oleic acid) and for their fatty acid profile after cultivation.

[0125] f. DNA Extraction

[0126] Plasmids were extracted from E. coli cells and genomic DNA from Y. lipolytica using QIAprep Spin Miniprep kit (QIAGEN) after the cells were grown overnight in LB Kanamycin or YPD respectively.

[0127] g. Sequencing

[0128] Sequencing was performed by Sanger method (GATC-Biotech, LIGHTRUN).

[0129] h. Growth and Fatty Acid Analysis

[0130] Mutants were grown in 50 mL of minimum medium required for lipid accumulation at 28 C. for 5 days. 2 mL samples were collected after 5 days for a measure of the growth and were lyophilized for further analysis. FA profile was analyzed after transmethylation. 2 mL of a solution of Methanol with 2.5% sulfuric acid is added to the dried sample in addition to 1 mL of toluene. Samples are heated at 80 C. for 3h. Once the samples are cooled down, biphasic liquid extraction takes place using 1.5 mL NaCl and 1.5 mL hexane. Samples are mixed and centrifuged to separate organic to water phase. Analyses are performed on organic phase with a gas chromatography coupled with Mass Spectrometry (GC-MS) TRACE1310. For all the mutants tested, fatty acids were extracted both from the supernatant and the cells. However, the amount detected in the supernatant represented less than 1% of total FA extracted.

[0131] 2. Results

[0132] Analysis Per Mutant

[0133] Table 3 below summarizes the mutants constructed and their fatty acid profile. The position chosen for mutagenesis, the number of clones validated for each construct, the requirement in fatty acid for growth and their ability to produce medium chain length fatty acid are also indicated.

TABLE-US-00003 TABLE 3 Mutations tested in Yl_FAS,. For each mutant, requirement in fatty acid for growth and their ability to increase the ratio of fatty acids having a hydroxycarbon chain length consisting of 16 carbons (C16 fatty acids) to fatty acids having a hydroxycarbon chain consisting of 18 carbons (C18 fatty acids) and/or to increase the amount of medium chain length fatty acids (C8-C15 fatty acids). Increase of ratio C16/C18 FA and/or increase Fatty acid of the amount of Medium Mutations auxotrophy chain length FA WT no no M1217F no no M1217Y yes no I1220F no yes I1220M no yes I1220W yes yes I1220F S1305V yes no I1220W S1305T yes yes I1220F S1305T no yes

[0134] For each position to assess, several variants were obtained (Table 3) and were first tested separately. It was found a good reproducibility in term of FA profile between the 2 or 3 variants carrying the same mutation. A difference in quantity of FA accumulated could nonetheless be found among the variants.

[0135] Example for the Mutant custom-characterFAS+FASI1220F

[0136] The results obtained for the mutant FAS+FASI1220F are shown in FIG. 1. Three different variants (A, B and C) were validated for the FASI1220F integration after transformation in the FAS strain. Oleic acid complementation was not necessary for their growth meaning that the FAS mutated at position I1220 was retaining enough activity to allow the normal growth of the strain. The 3 variants were cultivated and the FA content was analyzed in term of quantity (FIG. 1). As mentioned previously, it was found a good reproducibility in term of FA species repartition: 50% of total FA was C18 species with a majority of C18:1, 40% was C16 species and interestingly around 10% was the medium chain length Fatty acid C14. The amount of C14 reached 0.2 mg/mL for the three variants. Because variant C is capable of producing the highest percentage of C14 it was chosen for further experiment.

[0137] In order to compare the mutants, it was decided to choose for each mutated position the clone that showed the highest percentage of medium chain length Fatty acids.

[0138] Results for Mutants Auxotrophic for Fatty Acid

[0139] The clones harboring the mutations I1220W and M1217Y were not capable of growing without fatty acid complementation. This result suggests that whether the mutated FAS is completely inactive and cannot produce any fatty acid or it is active but it produces fatty acid species that cannot support the growth of the strain (short or medium chain length FA). To answer this question, the variants were cultivated in the presence of oleic acid to support their growth. For lipid content analysis, cells were washed out of the medium containing the added oleic acid before transmethylation. After separation on GC-MS, it could not be detected any short or medium chain length FAs for the mutant M1217Y. However, for the mutants FAS+FAS I1220W and FAS+FAS I1220W, S1305T, C14 was produced and seemed to be the only FA specie neosynthesized (FIG. 2).

[0140] Result for the Mutant that Behaves Like the Control Strain

[0141] The mutant FAS+FASM1217F was grown without any fatty acid complementation and analyzed as indicated above. It could not be found any difference of FA content between these clones and the control strain FAS+FASwt, indicating that this particular mutation does not seem to have an impact on the FAS activity.

[0142] Comparison Between Mutants Producing MCFA

[0143] For each mutant producing C14, one representative mutant was tested and compared for their FA profile (FIG. 3)

[0144] The mutants were cultivated without oleic acid complementation along with the control strain FAS+FASwt expressing a wild type copy of the FAS gene. It was found that the mutant FAS+FASI1220F produced the highest percentage and quantity of C14 (9% of total FA and 0.2 mg/mL). The percentage of C18 species was greatly reduced compared to the wild type (68% to 57%) whereas the percentage of C16 species did not change significantly. This suggests that C14 species are produced at the expense of C18 FAs. The mutant FAS+FASI1220M also produced C14 but to a level of 2% of total FAs and at the amount of 0.05 mg/mL. However, the relative amount of C16 FAs produced was enhanced to 48% of total FA extracted compared to the control strain that reached 32%. No significant difference was found for the double mutated strain FAS+FASI1220FS1305T compared to the single mutated strain FAS+FASI1220F. The single mutant FAS+FASI1220W and the double mutated strain FAS+FASI1220WS1305T could not grow without FA complementation. Cultivated in medium supplemented with Oleic acid, they were capable of producing C14 FA at a level of 0.15 mg/mL and 0.05 mg/mL respectively after 5 days (FIG. 2).

EXAMPLE 2: MUTANT STRAINS OF YARROWIA LIPOLYTICA WITH MODIFIED LIPID PROFILE AND PRODUCING MEDIUM CHAIN LENGTH FATTY ACID

[0145] 1. Materials and Methods

[0146] TALENs Design and Plasmids

[0147] The replacement of the wild type FAS by a mutated FAS has been done via homologous recombination-mediated by engineered nuclease. A TALE-Nuclease (described and used to simulate targeted gene modifications (Christian et al., 2010 and Cermak et al., 2011)) has been designed to generate a double-strand break centered on the 11220 Codon position. The TALE-Nuclease_KS encoded by the TAL_KSr (SEQ ID NO: 17) and the TAL_KSl (SEQ ID NO: 18) plasmids was designed to cleave the DNA sequence (5-TGTTCCGGTTCCGGTATgggtggtatcaccgcCCTGCGAGGCATGTTCA-3. The sequences of the corresponding TAL_KS l and TAL_KS r were synthesized following the Golden Gate TALEN kit (Addgene) and cloned into a shuttle plasmid designed and constructed for usage in Yarrowia lipolytica. The empty plasmids pL68 and pU18 harbor a yeast origin of replication (ARS68 and ARS18 respectively), a selection marker (LEU2 or URA3 respectively) in addition to an origin of replication in E. coli and the Kanamycin resistance encoding gene. Shuttle plasmids pL68BT and pU18BT were built from the empty plasmids pL18 and pU18 by insertion of the N-terminal and C-terminal sequences for optimal TALEN scaffolding in between the constitutive promoter pTEF and the Lip2 terminator. Subsequently, TAL_KSr and TAL_KSl were cloned into pU18BT and pL68BT plasmids giving respectively pU18TAL_KSr and pL68TAL_KSl (FIGS. 7 and 8). Plasmids were amplified in E. coli, extracted and sequences checked before further utilization in Yarrowia lipolytica.

[0148] Matrix Design

[0149] 19 different matrixes were synthesized by PCR fusion of two overlapping PCR products synthesized using primers carrying the desired mutations substituting the I1220 codon by the 19 other amino acids codons (listed in table 2). In addition, four silent mutations were introduced into each TALEN target site to prevent the TALEN to bind to the matrix. In addition, these silent mutations allowed the design of a matrix specific primer, used consequently for the screening of desired clones, i.e. where the Homologous Recombination (HR) between the matrix and the chromosome occurred. As an example, the matrix DNA sequence corresponding to the mutation 11220F is given in SEQ ID NO: 19.

[0150] Strain and Transformation

[0151] The strain Yarrowia lipolytica JMY1233 (MATa, leu2-270, ura3-302, xpr2-322, pox1-6) was used in this study. It has been deleted of the -oxidation pathway (Beopoulos et al. 2008) and is auxotroph for Uracil and Leucine. This strain is used as a platform for the engineering of strain producing new or original lipids. -oxidation was removed to prevent degradation of any new types of fatty acid produced by the engineered strain. JMY1233 cells were made competent with the Frozen-EZ Yeast Transformation II Kit (Zymoresearch). Transformations were performed as described by the manufacturer using 50 L of competent cells and 500 ng of each of the empty plasmids pU18BT and pL68BT or TALEN plasmids pU18TAL_KSr and pL68TAL_KSl.

[0152] For homologous recombination experiments, 500 ng of matrix of sequence SEQ ID NO: 19 was used in addition of the pU18BT and pL68BT plasmids or the pU18TAL_KSr and pL68TAL_KSl plasmids.

[0153] Transformants were selected on YNB AO plates for the selection of FAS+ and FAS colonies. After transformation, colonies were grown on rich medium and streaked on plates to allow the loss of the replicative plasmids. Genomic DNA was extracted from the cultures and screened for HR event by PCR.

PCR Screening on Genomic DNA

[0154] Primers used for the screening and the sequencing are listed in table 2. Genomic DNA extractions were performed on 2 mL overnight cultures in YPD medium using QIAprep Spin Miniprep (Qiagen). PCR were carried out with 1 L of gDNA. For the screening of NHEJ clones, KS-T7_F and KS-T7_R primers were used to amplify a fragment of 500 pb centered on 11220 codon position. KS-T7_F primer was then used to sequence the PCR product. For the screening of the HR experiment clones, the primers KS_P1 and HR screening_R or WT screening_R were used. KS_P1 and KS_T2 primers were then used to amplify a fragment of 4000 bp and KS-T7_F primer used to sequence this PCR product in order to confirm the introduction of the desired mutation at position 11220.

[0155] 2. Results

[0156] 19 transformations using the desire matrix were carried out and the screening was focused on the small white colonies growing on YNB AO plates that gave the best HR frequency and were present for all the transformations. For 17 mutations, at least 2 clones HR positive could be identified rapidly by PCR screening of less than 10 small white colonies. Regarding the transformation with the matrixes I1200R and I1220D, no small white colonies were detected. These particular amino acids at position 1220 could be deleterious for the FAS activity, leading to FAS phenotype upon HR. Translucent colonies displaying a FAS phenotype were screened on rich medium supplemented with oleic acid and HR positive clones were found.

Analysis of the Mutants

[0157] After the clones were grown overnight in Liquid YPD medium and streaked on YPD plates, 100% of the clones had lost both pU18TAL_KSl and pL68TAL_KSr plasmids. All the clones obtained being URA and LEU, were transformed with the empty plasmid pL68 and pU18 in order to maintain the prototrophy of the strain without maintaining the TALEN. All the clones were grown in minimum medium and lipid content was extracted and analyzed. Results obtained were the following: When Isoleucine in position 1220 was replaced by Arg or Asp, mutants required to be complemented with Oleic acid to grow. This suggests that either the FAS activity is completely lost or the mutated FAS cannot support the synthesis of FA suitable for the growth. Analysis of the FA profile for the cultures grown in the presence of AO to complement the lack of suitable lipids showed that no neo-synthesis of FA occurred. For all other amino acid substitutions at position 1220, the cells were able to grow without addition of exogenous Fatty acid in the medium.

[0158] When Isoleucine 1220 was replaced by Ala, Gly, Val, Leu, Met, Ser, Thr, Cys, Pro or Gln residue, the strain displayed a FA profile overall quite similar to that of the wild type at 8 days (FIG. 12). These mutations did not seem to impact FAS specificity or activity as accumulation was similar to that of the wild type. Nonetheless, amount of C14 for JMY1233_I1220M reached 0.03 mg/mL compare to the 0.007 mg/mL obtained for the wild type strain. When 1220 was replaced by Asn, Glu or Lys, no change of specificity was observed. However, we could notice a lower accumulation of lipids. More interestingly, when I1220 was replaced by aromatic residues Trp, Tyr, Phe or His, FA profile was modified and significant amount of C14 was produced (FIG. 13). C14 reached 0.025 mg/mL for the strain JMY1233_I1220Y, 0.052 mg/mL for JMY1233_I1220H, 0.13 mg/mL for JMY1233_I1220F and 0.16 mg/mL for JMY1233_I1220W. This corresponds respectively to a 4, 7, 17.5 and 29 fold increase of C14 accumulation (of DWC) compared to the wild type FAS. Of note, traces of C12 were also detected for JMY1233_I1220W.

Conclusion:

[0159] Using targeted engineering approach leads to the generation of Yarrowia lipolityca strains harboring mutated FAS (I1220F or I1220W) which are both able to produce an increase amount of medium fatty acids chains.

EXAMPLE 3: YARROWIA LIPOLYTICA ELONGASES ELO1 AND ELO2 ARE INVOLVED IN ELONGATION OF C14 AND C16 FATTY ACIDS SPECIES. A STRAIN OF YARROWIA LIPOLYTICA WITH A MUTATED FAS AND DELETED OF THE ELONGASES ELO1 AND ELO2 SHOWS A LIPID PROFILE SHIFTED TOWARD SHORTER CHAINS

[0160] 1. Materials and Methods

[0161] The strain JMY1233 (MATa, leu2-270, ura3-302, xpr2-322, pox1-6 (Beopoulos et al. (2008)) was used to delete the two Elongase genes ELO1 (YALI0B20 1696p) and ELO2 (YALI0F06754p). The respective disruption cassette ELO1-PUT and ELO2-PLT were designed as described by Fickers et al., using the marker URA3 and LEU2 respectively. JMY1233 was made competent and was transformed by the Lithium acetate method. Disruption cassettes ELO1-PUT and ELO2-PLT were cloned into TOPO vector. Plasmids were digested with the restriction enzyme NotI HF/PmeI and used for transformation.

[0162] To excise selection markers, the strain was made competent and transformed with the PUB4-Cre plasmid. This plasmid carries the Cre recombinase allowing the marker excision by recombination of the LoxR and LoxP sites (flanking the URA3 or LEU2 marker).

Media:

[0163] Strains were grown in 50 mL of minimum medium required for lipid accumulation at 28 C. for 5 days. When necessary, medium was complemented with 0.2% Oleic acid or 0.2% methyl myristate (mC14) prepared at 20% in Tergitol. Along the culture, 2 mL samples were collected after 5 days for a measure of the growth and were lyophilized for further analysis. FA profile was analyzed after transmethylation. 2 mL of a solution of Methanol with 2.5% sulfuric acid is added to the dried sample in addition to 1 mL of toluene. Samples are heated at 80 C. for 3h. Once the samples are cooled down, biphasic liquid extraction takes place using 1.5 mL NaCl and 1.5 mL hexane. Samples are mixed and centrifuged to separate organic to water phase. Analyses are performed on organic phase with a gas chromatography coupled with Mass Spectrometry (GC-MS) TRACE 1310. Fatty acids were extracted only from the cells.

[0164] 2. Results:

Strain JMY1233_custom-characterELO1custom-characterEL02:

[0165] The strain was made from the parental strain JMY1233 (URA LEU). ELO1 gene was first deleted using the disruption cassette ELO1-PUT giving the strain JMY1233_ELO1 (URA+ LEU). Subsequently, this strain was used for the deletion of the second gene ELO2 using the disruption cassette ELO2-PLT, giving the strain JMY1233_ELO1ELO2 (URA+ LEU+). LEU2 and URA3 markers were excised from this strain leading to the strain JMY1233_ELO1ELO2 (URA LEU).

Strain JMY1233_custom-characterEL01custom-characterEL02_FAS

[0166] JMY1233_ELO1ELO2 (URALEU) were made competent and were transformed with the plasmid PL68TAL-KSl and PU18TAL-KSr as described in example 2. Transformation was plated on YNB AO to allow the growth of the FAS clones (FAS gene disrupted by NHEJ). The phenotype of the FAS clones is easily noticeable since it shows a growth delay in medium supplemented with AO. One clone was selected, disruption of the FAS gene was verified by PCR and the selected clone was grown in rich medium complemented with AO in order to loose both replicative plasmids carrying the TALEN. The strains JMY1233_FAS and JMY1233_ELO1ELO2_FAS were then cultured in minimum or rich medium with methyl-C14 (mC14) as unique source of Fatty acid. These two strains are deficient in FAS activity hence are not capable of making their own fatty acid. The medium needs to be supplemented with Fatty acid.

[0167] When we used Oleic acid to complement the medium in FA, both strains were capable of growing at the same rate. However, when mC14 was used to complement the medium, only the strain JMY1233_FAS was capable of growing. Lipids extraction and analysis showed that C16 species and C18 species were produced from the mC14 provided in the medium (FIG. 14). The strain FAS deleted of the two Elongase genes could not grow in C14. These results suggest that C14 must be elongated to C16 and C18 to be used by the FAS cells and the Elongase genes are responsible for this elongation.

Strain JMY1233_custom-characterELO1custom-characterELO2_FASI1220F

[0168] JMY1233_ELO1ELO2 (URALEU) were made competent and were transformed with the plasmid PL68TAL-KSl and PU18TAL-KSr in addition to the matrix I1220Fm as described in example 2. Small white colonies were screened by PCR to verify the homologous recombination. One clone identified as HR positive was selected, mutation I1220F was verified by sequencing and the clone was cultivated in rich medium in order to loose both replicative plasmids carrying the TALENs.

Analysis of the Strains

[0169] After genome edition with TALEN, the clones were URA and LEU. The clones were transformed with the integration cassettes carrying either the URA3 or LEU2 markers. Transformations were plated on YNB. The two strains JMY1233_FASI1220F and JMY1233_ELO1AELO2_FASI1220F were cultivated in Minimum medium for lipid accumulation as described in Example 1. Total FA were extracted after 5 and 12 days, results are given for day 5 in FIG. 15. The % of C14 was unchanged between the two strains. However, the amount of C16/C16:1 accumulated increased from 32% to 74% when Elongases are deleted. Consequently, the amount of C18 FA species decreased from 45% to 15% in the ELO1Elo2_FASI1220F strain. This suggests that Elo1 and Elo2 are likely involved in elongation of C16 species into C18 species.

REFERENCES

[0170] Altschul, S., et al., 1997. Nucleic Acids Res. 25, 3389-3402. [0171] Aggelis G. et al, 1999, Biotechnol Lett, 21, 747-9. [0172] Barth, G. and Gaillardin, C. 1996. Yarrowia lipolytica. In: Nonconventional Yeasts in Biotechnology. Springer Berlin Heidelberg, Berlin, Heidelberg, pp. 313-388. [0173] Beopoulos, A., et al., 2008. Appl. Environ. Microbiol. 74, 7779-7789. [0174] Beopoulos, A., et al., 2009. Prog. Lipid Res. 48, 375-387. [0175] Beopoulos, A., et al., 2014. Applied Microbiology and Biotechnology, 98, 251-262 [0176] Blazeck, J., 2011. Applied and Environmental Microbiology. 77, 7905-7914. [0177] Blazeck, J., 2013. Applied Microbiology and Biotechnology. 97, 3037-3052. [0178] Blazeck, J., et al., 2014. Nature Communications. 5, 3131. [0179] Dulermo R., et al., 2015. Eukayot cell 14(5):511-25 [0180] Edgar, R. C., 2004. BMC Bioinformatics. 5, 113. [0181] Eswar, N., et al., 2006. Comparative protein structure modeling using Modeller. Curr. Protoc. [0182] Bioinforma. Ed. Board Andreas Baxevanis Al Chapter 5, Unit 5.6. [0183] Fernandez-Moya, R., et al., 2015. Biotechnol. Bioeng. 112, 2618-2623. [0184] Fickers, P., et al., 2003. Journal of Microbiological Methods. 55, 727-737. [0185] Gaillardin, C., et al., 1987. Current Genetics. 11, 369-375. [0186] Gysler, C., et al., 1990, Biotechnology Techniques. 4, 285-290. [0187] Ito, H., et al., 1983, Journal of Bacteriology. 153, 163-168. [0188] Jing, F., et al., 2011. BMC Biochem. 12, 44. [0189] Klebe, R. J., et al., 1983, Gene. 25, 333-341. [0190] Lazar Z., et al., 2014, Metab. Eng. 26, 89-99. [0191] Leber, C., and Da Silva, N. A., 2014. Biotechnol. Bioeng. 111, 347-358. [0192] Le Dall, M. T., et al., 1994, Current Genetics. 26, 38-44. [0193] Ledesma-Amaro, R., and Nicaud, J.-M., 2016. Prog. Lipid Res. 61, 40-50. [0194] Leibundgut, M., et al., 2008. Curr. Opin. Struct. Biol. 18, 714-725. [0195] Madzak, C., et al., 2000, Journal of Molecular Microbiology and Biotechnology. 2, 207-216. [0196] Madzak, C., et al., 2004, Journal of Biotechnology. 109, 63-81. [0197] Madzak, C., 2015. Appl. Microbiol. Biotechnol. 99, 4559-4577. [0198] Maftahi, M., et al., 1996, Yeast. 12, 859-868. [0199] Mller, S., et al., 1998. Yeast. 14, 1267-1283. [0200] Nicaud, J-M, et al., 2002. FEMS Yeast Research 2, 371-379. [0201] Nicaud, J.-M., 2012. Yeast. 29, 409-418. [0202] Orr-Weaver, T. L., et al., 1981, Proc Natl Acad Sci USA, 78, 6354-6358. [0203] Papanikolau S. et al, 2006, Curr Microbiol, 52, 134-42. [0204] Ratledge C., 1994. Yeasts, moulds, algae and bacteria as sources of lipids. Technological advances in improved and alternative sources of lipids. B. S. Kamel, Kakuda, Y. London, Blackie academic and professional, 235-291. [0205] Ratledge, C., 2005. Single cell oils for the 21th century, In: Cohen, R. (Eds.), Single cell oils. AOCS Press, Champaign, pp. 1-20. [0206] Rutter, C. D., et al., 2015. Appl. Microbiol. Biotechnol. 99, 7359-7368. [0207] Sangwallek, J., et al., 2013. Arch. Microbiol. 195, 843-852. [0208] Schtt, B. S., et al., 1998. Planta. 205, 263-268. [0209] Stoops J. K. et al., 1978. JBC. 253, 4464-4475. [0210] Wang, H. J., et al., 1999, Journal of Biotechnology. 181, 5140-5148. [0211] Zang 1. et al 2005 JBC, 28, 12422-12429.