METHODS OF RAPID LIGATION-INDEPENDENT CLONING OF DNA AND USES THEROF

Abstract

The present invention generally relates to improved methods of assembly of two or more DNA fragments, methods of rapid ligation-independent cloning, and kits for rapid ligation-independent cloning and their uses.

Claims

1. A method of cloning DNA using an exonuclease comprising: a) combining linear DNA fragments having terminal sequence homologies of between 10 and about 100 nucleotides; b) generating single stranded recesses by adding said exonuclease and incubating for between about 5 seconds and about 30 seconds; c) inactivating said exonuclease activity by a heat treatment between about 50 C. and 95 C. for between 2 s and 10 minutes followed by reducing temperature to about 37 C.; and optionally d) transforming a host bacteria with the DNA of step c).

2. The method of claim 1 wherein the heat inactivation of step c) is between about 50 C. and below 55 C.

3. The method of claim 1 wherein the heat inactivation of step c) is between about 50 C. and below 60 C.

4. The method of claim 1 wherein the heat inactivation of step c) is between about 50 C. and below 65 C.

5. The method of claim 1, wherein the said exonuclease is a proof reading DNA polymerase with aft exonuclease activity.

6. The method of claim 5, wherein said exonuclease is selected from T4 DNA polymerase, E. coli poll, vaccinia virus DNA polymerase, lambda exonuclease, exonuclease III, and T7 exonuclease.

7. The method of claim 6, wherein the DNA polymerase is T4 DNA polymerase.

8. The method of claim 1, wherein step c) is carried out in the presence of a single-stranded DNA binding protein.

9. The method of claim 8, wherein the single stranded DNA binding protein is selected from E. coli SSB, RecA and its homolog RAD51 in human, Tth RecA, human replication protein hRPA, herpes simplex virus 1CP8 protein, yRPA, vaccinia virus single strand binding protein, and ET SSB.

10. The method of claim 9, wherein the single-stranded DNA binding protein is Tth RecA and no ATP is present in the reaction.

11. The method of claim 10, further comprising ATP.

12. The method of claim 1 wherein the duration of the heat inactivation of step c) is longer than about 2 seconds and shorter than 10 minutes.

13. The method of claim 1 wherein the duration of the heat inactivation of step c) is longer than about 2 seconds and shorter than 5 minutes.

14. The method of claim 1 wherein the duration of the heat inactivation of step c) is longer than about 2 seconds and shorter than 1 minute.

15. The method of claim 1 wherein the duration of the heat inactivation of step c) is longer than about 2 seconds and shorter than 30 seconds.

16. The method of claim 1 wherein none of the terminal sequence homologies have a melting temperature (Tm) estimated by nearest-neighbor calculations above 65 C. under conditions classically used for PCR reactions with a sodium concentration of about 50 mM and a DNA fragment concentration between about 0.2 M and about 0.25 M.

17. A kit with an exonuclease comprising: a) the heat inactivation step of c) and b) instructions for use of said kit.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0025] FIG. 1A is a schematic representation of the rapid LIC method of the present invention.

[0026] FIG. 1B is an illustration of the temperature ramp and timeline for the rapid LIC reaction.

[0027] FIG. 2 summarizes four panels with distinct applications of the rapid LIC method. Panel A illustrates the cloning of a PCR fragment amplified by primers P1 and P2 or a synthetic DNA fragment into an open vector. Panel B illustrates the Complementary Hemi-PCR (CH-PCR) reaction where the 2 halves of a vector are amplified by PCR and recombined with modifications and/or mutations at the overlapping junctions. Panel C illustrates the cloning of 2 short complementary oligonucleotides. Panel D illustrates the cloning of multiple PCR fragments into an open vector. Shared regions of sequence homology are highlighted by small areas with different shades at the ends of DNA fragments; the replication of origin is indicated by a box with the symbol Rep.

[0028] FIG. 3 is an electrophoresis gel showing the results from Example 1 of the present specification. FIG. 3 shows the inactivation at different target temperatures of the T4 DNA polymerase exonuclease activity. Each lane shows DNA digested by T4 DNA polymerase exonuclease activity after treatment at different temperatures. The far left and right lanes show DNA ladders. Lane 1 is a control with no T4 DNA polymerase showing the undigested DNA. Lane 2 shows T4 DNA polymerase exonuclease activity when the target temperature was 30 C. Lanes 3-12 show the exonuclease activity after the T4 DNA polymerase reached target temperatures 35 C., 40 C., 45 C., 50 C., 55 C., 60 C., 65 C., 70 C., 75 C., and no heat respectively.

[0029] FIG. 4 is an electrophoresis gel showing the results of Example 2 of the present specification. FIG. 4 shows the rate of T4 DNA polymerase exonuclease inactivation by a heat pulse. Panel A shows the rate of inactivation at 75 C. The far left lane shows a DNA ladder and Lane 1 shows DNA with no T4 DNA polymerase added; Lane 2 shows DNA with T4 polymerase and no heat, Lane 3 to Lane 9 shows DNA with T4 DNA polymerase raised to 75 C. for 5 seconds, 15 seconds, 30 seconds, 1 minute, 2 minutes, 5 minutes, and 10 minutes, respectively. Panel B shows the rate of inactivation for a 10 s heat pulse at varied temperatures. The far left lane shows a DNA ladder and Lane 1 shows DNA with no T4 DNA polymerase added; Lane 2 shows DNA with T4 polymerase and no heat, Lane 3 to Lane 15 shows DNA with T4 DNA polymerase raised for 10 s at 35 C., 40 C., 45 C., 50 C., 55 C., 60 C., 65 C., 70 C., 75 C., 80 C., 85 C., 90 C. and 95 C., respectively.

[0030] FIG. 5 is a graph of the blue cfu and white cfu colony data from the blue-white screening assay in Example 3. These data show the effect of a variable pre-heat inactivation 37 C. plateau on cloning efficiency of 0 seconds, 30 seconds, 1 minute, 2 minutes, and 4 minutes, respectively.

[0031] FIG. 6 is a graph of the blue cfu and white cfu colony data from the blue-white screening assay in Example 4. These data show the effect of a variable post-heat inactivation 37 C. temperature plateau on cloning efficiency.

[0032] FIG. 7 is a graph of the blue cfu and white cfu colony data from the blue-white screening assay in Example 5.

[0033] FIG. 8 is a graph of the cloning efficiency from the Complementary Hemi-PCR (CH-PCR) assay in Example 6.

DETAILED DESCRIPTION OF THE INVENTION

[0034] Detailed descriptions of preferred embodiments are provided herein. It is to be understood however, that the present invention may be embodied in various forms. Therefore, specific reference to various forms are provided as a basis for the claims and for teaching one skilled in the present art to employ the present invention in appropriate system, structure, or manner. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, the preferred methods, devices and materials are now described.

A. Definitions

[0035] For clarity of disclosure, and not by way of limitation, the detailed description of the present invention is divided into the subsections that follow.

[0036] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this invention belongs. All patents, applications, and other publications referred to herein are incorporated by reference in their entirety. If a definition set forth in this section is contrary to or otherwise inconsistent with a definition set forth in the patents, application, published applications, and other publications that are herein incorporated by reference, the definitions set forth in this section prevail over the definition that is incorporated by reference.

[0037] As used herein, a or an means at least one or one or more. The use of or means and/or unless stated otherwise. For illustration purposes, but not as a limitation, X and/or Y can mean X or Y or X and Y. The use of comprise, comprises, comprising, include, includes, and including are interchangeable and not intended to be limiting. Furthermore, where the description of one or more embodiments uses the term comprising, those skilled in the art would understand that, in some specific instances, the embodiment or embodiments can be alternatively described using the language consisting essentially of and/or consisting of. The term and/or means one or all of the listed elements or a combination of any two or more of the listed element.

[0038] The section headings used herein are for organizational purposes only and are not to be construed as limiting the described subject matter in any way. All literature cited in this specification, including but not limited to, patents, patent applications, articles, books, and treatises are expressly incorporated by reference in their entirety for any purpose. In the event that any of the incorporated literature contradicts any term defined herein, this specification controls. While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.

[0039] The practice of the present invention may employ conventional techniques and descriptions of bacteriology, molecular biology (including recombinant techniques), cell biology, and biochemistry, which are within the skill of the art. Such conventional techniques include PCR, extension reaction, oligonucleotide synthesis and oligonucleotide annealing. Specific illustrations of suitable techniques can be had by reference to the example herein below. However, other equivalent conventional procedures can, of course, also be used. Such conventional techniques and descriptions can be found in standard laboratory manuals such as Genome Analysis: A Laboratory Manual Series (Vols. I-IV), PCR Primer: A Laboratory Manual, and Molecular Cloning: A Laboratory Manual (all from Cold Spring Harbor Laboratory Press, 1989), Gait, Oligonucleotide Synthesis: A Practical Approach 1984, IRL Press, London, Nelson and Cox (2000), Lehninger, Principles of Biochemistry 3rd Ed., W. H. Freeman Pub., New York, N.Y. and Berg et al. (2002) Biochemistry, 5th Ed., W. H. Freeman Pub., New York, N.Y. all of which are herein incorporated in their entirety by reference for all purposes.

[0040] As used herein, amplify refers to the process of enzymatically increasing the amount of a specific nucleotide sequence. This amplification is not limited to but is generally accomplished by PCR. As used herein, denaturation refers to the separation of two complementary nucleotide strands from an annealed state. Denaturation can be induced by a number of factors, such as, for example, ionic strength of the buffer, temperature, or chemicals that disrupt base pairing interactions.

[0041] As used herein, the term amplifying refers to a process whereby a portion of a nucleic acid is replicated using, for example, any of a broad range of primer extension reactions. Exemplary primer extension reactions include, but are not limited to, PCR. Unless specifically stated, amplifying refers to a single replication or to an arithmetic, logarithmic, or exponential amplification.

[0042] As used herein, annealing refers to the specific interaction between strands of nucleotides wherein the strands bind to one another substantially based on complementarity between the strands as determined by Watson-Crick base pairing. It is not necessary that complementarity be 100% for annealing to occur.

[0043] The terms amplification cycle and PCR cycle are used interchangeably herein and as used herein refers to the denaturing of a double-stranded polynucleotide sequence followed by annealing of a primer sequence to its complementary sequence and extension of the primer sequence.

[0044] The terms polymerase and nucleic acid polymerase are used interchangeably and as used herein refer to any polypeptide that catalyzes the synthesis or sequencing of a polynucleotide using an existing polynucleotide as a template.

[0045] The term polynucleotide refers in particular to double-stranded DNA, double-stranded RNA, hybrid DNA/RNA duplex, single-stranded DNA and single-stranded RNA.

[0046] As used herein, DNA polymerase refers to a nucleic acid polymerase that catalyzes the synthesis or sequencing of DNA using an existing polynucleotide as a template.

[0047] As used herein, the term exonuclease refers to any polypeptide that catalyzes the sequential cleavage of nucleotides one at a time from one end of a polynucleotide chain.

B. Rapid Ligation-Independent Cloning (LIC)

[0048] The present invention relates to a novel method to clone DNA by LIC using rapid heat inactivation of the exonuclease enabling the joining of two or more DNA fragments in a very short experimental time. This invention is a direct improvement of the LIC method developed by Yang and collaborators (Yang et al. 1993 and U.S. Pat. No. 5,580,759).

[0049] In the most common application of DNA cloning by the Yang method, two DNA molecules share sequence homologies so that the ends of one fragment are complementary to the ends of the other fragment. These DNA fragments can be generated either by digestion with restriction enzymes of larger fragments, PCR of a DNA template, or direct synthesis with no other sequence requirements than the terminal sequence homologies. The method consists in a controlled digestion of each fragment by a strand-specific exonuclease (e.g. 3-5 exonuclease activity of T4 DNA polymerase) creating single stranded DNA overhangs on each end. Following inactivation of the exonuclease activity by prolonged heat treatment, the overhangs are then annealed together respectively of their sequence complementarity to create circular joined DNA molecules that can be used to transform bacterial host and clone the DNA. The initial assumption that gaps left by imperfect annealing could be repaired by the bacterial host, thus omitting in vitro fill-in reaction and ligation, has been verified experimentally since.

[0050] The method of the present invention is called rapid LIC. The principle of rapid LIC and its timeline are illustrated on FIGS. 1A and 1B. In the most common application, the rapid LIC method will join two DNA molecules for the purpose of DNA cloning. The first step incorporates two DNA molecules sharing sequence homologies so that each end of one fragment is homologous to one end of the other fragment. The second step utilizes an exonuclease to create strand-specific recessed ends on both ends of each DNA fragment; the exonuclease is then rapidly inactivated by a short heat pulse. The third step consists of an annealing reaction to create circular close DNA molecules and is followed by a transformation of a bacterial host to initiate DNA repair and replication.

[0051] FIG. 2 illustrates the main applications of rapid LIC. In one embodiment (Panel A) one DNA fragment is a vector opened by digestion with restriction enzymes and the other DNA fragment is a PCR product. The primers P1 and P2 are made of two separate areas; the 5 terminal regions are homologous to the DNA sequence to amplify and the 3 proximal region share sequence homologies with the vector sequence on either side of the restriction cuts. Instead of a PCR product, the fragment to insert in the vector could be also a synthetic DNA fragment or the product of the assembly by SOE-PCR of multiple PCR fragments. In another embodiment (Panel B), the DNA fragments are amplified from a single vector and a new vector is created by the rapid LIC method; by carefully choosing the proximal and distal regions of the primers, it is possible to create a deletion, introduce a mutation or insert new sequences in the original vector. This method is called, the CH-PCR for Complementary Hemi-PCR. In another embodiment (Panel C), one DNA fragment is a vector open after digestion with restriction enzymes and the other results from the annealing of two partially overlapping oligonucleotides. Most if not all DNA cloning methods using exonuclease recession cannot clone small oligonucleotides because of their rapid disappearance from the reaction mixture; because the rapid LIC method is very fast, it is still efficient to run it twice back to back; during the first run the cut vector is added and recessed ends are generated; after adding the two oligonucleotides, the reaction is run again but the oligonucleotides are not destroyed because the exonuclease activity has been inactivated. In another embodiment (Panel D), multiple DNA fragments are cloned at once in an open vector. Each DNA fragment, including the vector itself, is terminated by a small sequence that is homologous to the beginning of the next fragment; indeed all homology regions taken two by two among all DNA fragments create a unique close circular DNA molecule after conjoint annealing.

C. Rapid Exonuclease Inactivation

[0052] It is widely reported in the literature that heat inactivation of T4 DNA polymerase requires exposure of between 10 and 20 min at temperatures between 70 C. and 75 C. For example, 10 min at 70 C. is reported in U.S. Pat. No. 5,580,759; New England Biolabs (Ipswich, Mass.), a reference company in the field of molecular biology, indicates 75 C. for 20 min for inactivation, while Thermo Fisher Scientific Inc. and Promega Corporation (Fitchburg, Wis.) recommend 10 min at 75 C.; the lowest temperature reported is 65 C. for 10 min by EURx Ltd. (Poland), a molecular biology supplier. It was discovered that T4 DNA polymerase exonuclease activity was instead inactivated at temperatures as low as 50 C.; that is 15 C. to 20 C. below most recommend temperatures for inactivation (Example 1). It is not excluded that in these conditions, the 5->3 polymerase activity still remains potent. Therefore, the exonuclease activity of T4 DNA polymerase appears extremely sensitive to elevated temperature. This novel characteristic led to the analysis of the inactivation of T4 DNA polymerase exonuclease activity by brief heat pulse. Time-course experiments revealed that complete inactivation was occurring between 5 s and 15 s exposure of the exonuclease at 75 C. (Example 2, Panel A); for a constant heat pulse of 10 s, inactivation appears at 50 C. and above (Example 2, Panel B). This represents up to a two-log difference with what is currently accepted in the field. Because a major trend in modern molecular biology is the shortening of experimental time, this discovery opens the possibility to shorten dramatically the time required for cloning DNA.

[0053] The DNA polymerases that may be used in the method of the invention include all DNA polymerases having intrinsic exonuclease activity, preferably 3->5 exonuclease activity, that can be inactivated rapidly by heat in the conditions indicated in the above embodiments. Such polymerases may be easily identified by assaying the heat-induced inactivation of the exonuclease activity as described in Example 1 and Example 2A and 2B. This group includes but is not limited to T4 DNA polymerase, E. coli poll, Klenow fragment, vaccinia virus DNA polymerase, lambda exonuclease, exonuclease III, and T7 exonuclease.

D. Length of Homology

[0054] The length of the complementary nucleotide sequences located on the ends of each DNA molecule may be between 5 and about 100 nucleotides, preferably between about 10 and about 35 nucleotides, and most preferably between 15 and 20 nucleotides.

[0055] In some embodiments, the length of the complementary nucleotide sequences is between 15 and 20 nucleotides with a melting temperature (Tm) equal or lower than 65 C. The Tm is defined as the temperature at which the folded fraction is 0.5 (Mergny and Lacroix 2003). The conditions to determine Tm are those classically used for preparing a PCR with a sodium concentration of 50 mM and a primer concentration between 0.2 M and 0.25 M; Tm of short oligonucleotides between 10 and 100 nucleotides can be estimated with good accuracy using nearest neighbor calculations (Breslauer et al. 1986; SantaLucia J Jr. 1998). Tools to do these calculations are widely available; for example OligoAnalyzer is made available by Integrated Technologies, Inc. and OligoCalc is a free and widely available oligonucleotide properties calculator software (Kibbe 2007). In this range of Tm, the corresponding folded heterodimers are melted at 75 C. Taking the examples of this invention and estimating Tm using OligoAnalyzer and enthalpies using OligoCalc, it was determined that the unfolded fraction at 75 C. using the equations reported by Bttcher et al. (2005) (Table I). All sequences in this range of lengths and temperatures have an unfolded fraction near 100%; oligonucleotides longer than 20 with Tm lower than 65 C. are still almost completely unfolded while those with a Tm above 65 C., in this a case the model oligonucleotides polyG(15) and polyG(20), have a significant folded fraction. It should also be noted that because of the experimental difficulties of analyzing melting curves, it is virtually impossible to measure folded fractions experimentally above 97% (Mergny and Lacroix 2003). Because of the much lower concentration of DNA fragments in the rapid LIC reaction mixture than in a PCR reaction, the actual Tm is in fact lower than the values used in these calculations, which are in consequence underestimating the exact unfolded fraction. Therefore, successful cloning events using the rapid LIC invention in this embodiment will result from annealing events that occurred after the heat pulse and full denaturation of all DNA fragments.

E. Costimulatory Factors

[0056] Some embodiments of the present invention further comprise costimulatory factors. In some embodiments of the present invention, the costimulatory factors are single strand DNA binding proteins (SSB). Examples of SSB include, but are not limited to, RecA in E. coli and its homolog RAD51 in human. RecA is an ssDNA-dependent ATPase that catalyses the pairing and exchange of DNA strands bearing sequence homologies; its association with DNA is tighter in the presence of ATP (reviewed in Kowalczykowski 1992). It was also discovered that the rate of rapid LIC by homologous recombination is increased by RecA alone and further enhanced after adding ATP. In some embodiments of the present invention, the costimulatory factor is Tth RecA, the RecA homolog isolated from Thermus thermophilus, a thermostable RecA whose activity can survive a heat pulse at 75 C. In some embodiments the invention further comprises ATP. In some embodiments the present invention provides a kit for cloning comprising T4 DNA polymerase, thermostable RecA, and ATP.

F. Overall Method

[0057] A rapid LIC cloning reaction will contain two fragments or more of DNA to assemble, T4 DNA polymerase, Tth RecA and ATP. Both DNA fragments are sharing homologous sequences, between 5 and about 100 nucleotides on both ends, preferably between about 10 and about 35 nucleotides, and most preferably between 15 and 20 nucleotides, with a Tm each equal or lower than 65 C. The Tm are estimated as described previously using nearest-neighbor calculations in PCR conditions. The reagents are combined on ice in a PCR tube and placed on a thermal cycler (or thermocycler or PCR machine) pre-cooled at 4 C. A short program, overall less than 3-min long, consists in a 1 s plateau at 75 C. followed by a 1 min plateau at 37 C. before the temperature is cooled back at 4 C. (FIG. 1B). The ramp from 4 C. to 75 C. takes about 30 seconds (s) and is long enough to create recessed ends of all DNA fragments. The time to go back and forth between 70 C. and 75 C. is about 10 s, long enough to inactivate of the exonuclease and separate all ssDNA homologous tails. The ramp between 75 C. and 37 C. takes about 30 s during which Tth RecA associates with ssDNA. Finally, the mixture is incubated for 1 min at 37 C. to allow assembly of homologous ssDNA tails and cooled at back at 4 C. to stop the reaction. The overall reaction from the start of the temperature ramp to the return at 4 C. is no longer than 3 min (see timing chart below). The reaction mixture can be used immediately to transform competent bacteria to isolate recombinant clones containing the DNA fragments properly assembled. It is possible to replace the thermal cycler by short heat pulses using pre-heated water baths and complete the reaction in shorter times. Inactivation of T4 DNA polymerase will occur after 10-15 s treatment at 50 C. and above; melting of ssDNA tails will occur above 65 C., at best around 75 C. in a few seconds. Association with Tth RecA will be optimal between 65 C. and 75 C. while annealing between complementary ssDNA tails will mostly occur below 65 C.

Timing Chart.

[0058] Time was counted from the start of the temperature raise and measured at passage at 75 C. (time 1), start of 1 minute plateau at 37 C. (time 2), end of 37 C. plateau (time 3) and program arrest (back to 4 C., time 4) on varied instruments:

TABLE-US-00001 Instrument Time 1 Time 2 Time 3 Time 4 Total PCR Machine 1 36 s 70 s 127 s 165 s 2:45 min PCR Machine 2 32 s 60 s 118 s 157 s 2:37 min Average 34 s 65 s 122.5 s 161 s 2:41 min

G. Kits

[0059] Also provided are kits. Such kits can include the compositions of the present invention and, in certain embodiments, instructions for administration. Such kits can facilitate performance of the methods described herein. When supplied as a kit, the different components of the composition can be packaged in separate containers and mixed immediately before use. Components include, but are not limited to DNA fragments, a vector, an exonuclease, an SSB, ATP, and a concentrated reaction buffer, each as described herein. Such packaging of the components separately can, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the composition. The pack may, for example, comprise metal or plastic foil such as a blister pack. Such packaging of the components separately can also, in certain instances, permit long-term storage without losing activity of the components.

[0060] Kits may also include reagents in separate containers such as, for example, sterile water or saline to be added to a lyophilized active component packaged separately. For example, sealed glass ampoules may contain a lyophilized component and in a separate ampoule, sterile water, sterile saline or sterile each of which has been packaged under a neutral non-reacting gas, such as nitrogen. Ampoules may consist of any suitable material, such as glass, organic polymers, such as polycarbonate, polystyrene, ceramic, metal or any other material typically employed to hold reagents. Other examples of suitable containers include bottles that may be fabricated from similar substances as ampoules, and envelopes that may consist of foil-lined interiors, such as aluminum or an alloy. Other containers include test tubes, vials, flasks, bottles, syringes, and the like. Containers may have a sterile access port, such as a bottle having a stopper that can be pierced by a hypodermic injection needle. Other containers may have two compartments that are separated by a readily removable membrane that upon removal permits the components to mix. Removable membranes may be glass, plastic, rubber, and the like.

[0061] In certain embodiments, kits can be supplied with instructional materials. Instructions may be printed on paper or other substrate, and/or may be supplied as an electronic-readable medium, such as a floppy disc, mini-CD-ROM, CD-ROM, DVD-ROM, Zip disc, videotape, audio tape, and the like. Detailed instructions may not be physically associated with the kit; instead, a user may be directed to an Internet web site specified by the manufacturer or distributor of the kit.

EXAMPLES

[0062] The following examples are offered to illustrate, but not to limit the claimed invention.

[0063] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference herein in their entirety for all purposes.

Example 1

Heat-Mediated T4 DNA Polymerase Exonuclease Inactivation

[0064] This example demonstrates the rapid inactivation of T4 DNA polymerase exonuclease activity by exposure to heat above 50 C. and below 70 C. It is widely accepted and taught in the literature that T4 DNA polymerase requires at minimum 10 minutes of incubation at 70 C. to become inactive. These previously reported values are believed to be relevant for both polymerase and exonuclease activities. This experiment tested variable target temperature values programmed into a PCR machine initially set at 4 C. After loading the samples containing only T4 DNA polymerase, the thermal cycler rose to a target temperature value and after a one (1) second plateau, samples were rapidly cooled back to 4 C. A test DNA fragment was then added to each sample and after 15 min incubation at 37 C., the DNA was analyzed by electrophoresis on a 1.5% agarose gel. Any remaining exonuclease activity would digest the DNA from both ends, thus creating a smear on the gel, while no exonuclease activity would leave the test DNA intact as a discrete band on the gel.

[0065] The test DNA fragment added was Z900. Z900 was generated by amplifying a 966 bp fragment from pUC119 vector with the primers laczbw_r and laczbw_s. The PCR product was re-suspended in water at 50 ng/l after purification over a NucleoSpin column from Macherey Nagel (Germany).

TABLE-US-00002 laczbw_s 5-TACTCGCGGCCCAGCAGTAACAATTTCACACAGGAAACAGCTATGAC laczbw_r 5-CCACCGCCTTGGCCTCGCGCGTTTCGGTGATGA

[0066] The T4 DNA polymerase mix was prepared by mixing the following on ice:

TABLE-US-00003 Component Volume Buffer 10x 10 l T4 DNA Polymerase 10 l (New Englands Biolabs, Ipswich, MA) H2O 80 l

[0067] The mixture was distributed into PCR tubes by 15 l aliquot; the tubes were then successively placed in a PCR machine pre-cooled at 4 C. and the temperature was rapidly increased to one of the variable target temperatures (30 C., 35 C., 40 C., 45 C., 50 C., 55 C., 60 C., 65 C., 70 C., 75 C., no heat). Once the temperature had reached the expected value, the samples were brought back to 4 C. after a one (1) second-long plateau and then placed on ice.

[0068] Then 0.5 l 10 reaction buffer and 4.5 l purified Z900 DNA (200 ng) were mixed with 5 l of reaction buffer for each of the variable target temperature points and incubated for 15 minutes at 37 C. The digested DNA was then analyzed by electrophoresis on a 1.5% agarose gel.

[0069] The results from this experiment are shown in the gel electrophoresis in FIG. 3. The lanes are numbered from left (lane 1) to right (lane 12) and flanked by DNA ladders. The DNA fragment was clearly visible in the absence of T4 DNA polymerase (lane 1) and exhibited significant digestion in absence of heat treatment (lane 12). Exonuclease activity was easily visible at 30 C. to 45 C. and showed a clear transition around 50 C. (lane 6). At 55 C. and above no exonuclease activity was detectable.

[0070] This experiment shows that the exonuclease activity of T4 DNA polymerase was rapidly and irreversibly inactivated above 50 C.

Example 2

Measure of the Rate of Inactivation of T4 DNA Polymerase Exonuclease Activity

[0071] This experiment was designed to analyze the rate of heat inactivation of T4 DNA polymerase exonuclease activity.

[0072] First a mixture containing T4 DNA polymerase 5 l, 10 buffer 5 l and water 40 l was kept on ice. For each time measurement, 5 l were aliquoted into a tube and incubated for a given period of time in a thermostated block and put back on ice. Then 5 l of a mixture containing purified Z900 DNA, 10 buffer 6 l and water 30 l was added to each tube and assayed for exonuclease activity after 15 minutes at 37 C. before analysis by gel electrophoresis (100 ng DNA per tube, 1 tube per lane). Results are shown in FIG. 4, Panel A. The time points measured were no heat, 5 seconds, 15 seconds, 30 seconds, 1 minute, 2 minutes, 5 minutes, and 10 minutes with no T4 DNA polymerase and no heat as controls. The electrophoresis gel in FIG. 4, Panel A shows in its lanes respectively 1) no T4 DNA polymerase, 2) T4 DNA polymerase with no temperature increase, 3) T4 DNA polymerase 5 seconds at 75 C., 4) T4 DNA polymerase 15 seconds at 75 C., 5) T4 DNA polymerase 30 seconds at 75 C., 6) T4 DNA polymerase 1 minute at 75 C., 7) T4 DNA polymerase 2 minutes at 75 C., 8) T4 DNA polymerase 5 minutes at 75 C., 9) T4 DNA polymerase 10 minutes at 75 C. Inactivation of the exonuclease activity occurred rapidly between 5 s and 15 s exposure to 75 C.

[0073] Second, the same experiment was repeated using a constant heat exposure of 10 seconds and a variable target temperature between 35 C. and 95 C. by 5 C. increment. FIG. 4, Panel B shows the result of the analysis by gel electrophoresis. Inactivation of the exonuclease activity was observed at 50 C. and was complete at 55 C. and above.

Example 3

Influence of Incubation Time before Inactivation of the Exonuclease

[0074] In this experiment, the influence of the length of incubation at 37 C. before heat inactivation of the T4 DNA exonuclease activity on the efficiency of cloning was analyzed. A blue-white colony assay was used following the approach developed by Thieme (Thieme et al. 2001) and used a PCR machine to control temperature.

[0075] Blue-white cloning assay

[0076] The PCR product Z900 was treated by DpnI restriction enzyme to remove the DNA template and re-suspended in water at 10 ng/l after purification over a Macherey Nagel NucleoSpin column. The primer laczbw_s contains a 15 nucleotides overlap with the sequence of the pADL-10b phagemid vector (Antibody Design Labs, San Diego, Calif.) on the peptide leader pelB side of the first Bg1I site with a melting temperature of 58.4 C. (OligoAnalyzer 3.1, Integrated DNA Technologies, Inc., Coralville, Iowa) and the primer laczbw_r overlaps on the other side of the second Bg1I site with a melting temperature of 59 C. pADL-10b was cut by Bg1I and re-suspended at 20 ng/l in pure water after purification over a Macherey Nagel NucleoSpin column.

[0077] The following reaction was prepared on ice in a PCR tube:

TABLE-US-00004 Component Amount Volume Buffer 10x 3 l pADL10b BglI-cut (20 ng/l) 40 ng 2 l Z900 DNA fragment (10 ng/l) 100 ng 10 l T4 DNA polymerase 0.5 l (New England Biolabs, Ipswich, MA) Water 14.5 l Total Volume 30.0 l

[0078] The temperature was first raised to a plateau at 37 C. of variable length, followed by a one second plateau at 75 C., and a 10 minute plateau at 37 C. before the reaction was cooled down to 4 C. 50 l of XL10-Gold bacteria (Agilent Technologies, San Diego, Calif.) made chemically-competent were transformed with 2 l of the reaction mixture. After 30 min incubation on ice, the cells were heat-shocked for 30 seconds at 42 C., 150 l of SOC medium were added and after 1 hour incubation at 37 C., 100 l of each transformation were plated in duplicate on agar plates supplemented with ampicillin 100 g/ml, IPTG and X-gal. Blue and white colonies were counted the day after.

[0079] The results of this experiment are depicted on FIG. 5. The shorter the incubation at 37 C., the higher is the number of blue colonies. Longer incubations resulted in lower cloning efficiency. This result clearly indicated that very short incubation times prior to heat inactivation of T4 DNA polymerase exonuclease activity gave the best conditions for an efficient rapid LIC method.

Example 4

Time Dependence of Annealing

[0080] The same reaction was performed from Example 3 with a 30 second plateau at 37 C. before the heat-mediated inactivation followed by an annealing plateau at 37 C. of variable length. The influence of RecA, a mediator of ssDNA annealing was also studied. Tth RecA, a thermostable form of RecA that survives the heat pulse at 75 C. was used (0.5 l Tth RecA from New England Biolabs per reaction).

[0081] The experimental results are shown in FIG. 6. There was no apparent difference in cloning efficiency between no plateau at all and up to 10 min incubation at 37 C. These data clearly indicated that a short annealing plateau at 37 C. is sufficient to achieve significant cloning efficiency. As expected, in the presence of Tth RecA, the cloning efficiency was higher by about 70% in this experiment.

Example 5

Influence of RecA and ATP on Cloning Efficiency

[0082] The influence of Tth RecA was further studied with the same assay using a short temperature cycle consisting of a plateau of one second at 75 C. starting from a PCR machine pre-cooled and equilibrated at 4 C. and a one minute plateau at 37 C. before cooling the reaction back at 4 C. The overall cycle was completed between 2 and 3 min from the start of the temperature cycle to its return at 4 C. Also analyzed was the influence of ATP 1 mM which regulates the interaction of RecA with single-stranded DNA.

[0083] The experiment was done in tetraplicate (2 duplicates) and the data are shown as a graph on FIG. 7. A significant increase in the number of blue transformant was observed; 66% increase on average in the presence of RecA, further increased by another 47% in the presence of ATP. The overall increase in the presence of RecA and ATP was 145% higher than the control without RecA and ATP.

Example 6

Complementary Hemi-PCR Assay

[0084] In this example, a CH-PCR assay was performed by amplifying by PCR two halves of a phage DNA. The two fragments were joined in the conditions of Example 5 and the success of the reaction was quantified by a plaque assay after transformation in a bacterial host.

[0085] VCSM13 phage DNA was amplified with primer m13g5_s and m13g2_r (fragment V, 7270 bp) and phage CM13.9 was amplified with primers m13g2_s and m13g5_r (fragment C, 1448 bp). CM13.9 is a single mutant of M13KO7 containing the ir1A mutation (G->A mutation at position 8247).

[0086] Primer sequence and Tm estimation (OligoAnalyzer 3.1)

TABLE-US-00005 Primer Sequence Length Tm m13g5_s 5-GAATATTTATGACGATTCCGCAGTATTG 28 54.4 C. ml3g5_r 5-CAATACTGCGGAATCGTCATAAATATTC 28 54.4 C. m13g2_r 5-CGCGTTAAATTTTTGTTAAATCAGCTC 27 54.2 C. m13g2_s 5-GAGCTGATTTAACAAAAATTTAACGCG 27 54.2 C.

[0087] Polymerase chain reaction conditions

TABLE-US-00006 Component Volume Phusion 5x buffer 10.0 l dNTP (2 mM) 5.0 l DNA template 5 ng 1.0 l Primer sense (10 M) 1.5 l Primer reverse (10 M) 1.5 l Hot Start Phusion polymerase 0.5 l (New England Biolabs, Ipswich, MA) Water 30.5 l Total Volume 50.0 l

[0088] The final volume of the PCR reaction was 50 l. After amplification for 25 cycles with annealing temperature at 57 C. and 3 min elongation, the template DNA was digested overnight at 37 C. after addition of DpnI restriction enzyme 1 l directly in the PCR tube. Minigel analysis confirmed the amplification the two DNA fragments at the expected size. After purification over a Macherey Nagel NucleoSpin column and elution in water, the final DNA concentration was measured by UV spectrophotometry.

[0089] Rapid LIC reaction:

TABLE-US-00007 Component Volume Fragment V (60 ng) or water 3.0 l Fragment C (60 ng) or water 2.0 l Buffer 10x 1.5 l T4 DNA polymerase 0.5 l (New England Biolabs, Ipswich, MA) Water 8.0 l Total Volume 15 l

[0090] The final volume of the LIC reaction was 15 l. After mixing all reagents on ice, the tubes were placed in PCR machine pre-cooled at 4 C. The temperature cycle was first a plateau at 37 C. of variable length, a plateau at 75 C. for 1 second, a plateau for 10 min at 37 C., then the temperature was brought back 4 C. XL10-Gold chemically competent bacterial cells 50 l were transformed with 2 l of the reaction by heat shock; 150 l of SOB medium were added and the mixture was further incubated for 1 h at 37 C. 100 l of the cells were mixed with 5 l of TG1 Phage Competent cells (Antibody Design Labs, San Diego, Calif.) and 3 ml melted top agar at 50 C. and poured on a pre-warmed bottom agar plates. Plates were done in duplicate and plaques were counted the following morning.

[0091] The results are shown in FIG. 8. The cloning by LIC using our method resulted in a very large number of plaques only when the two complementary pieces of DNA were present in the reaction with very few plaques in both negative controls. There was no detectable influence of the length of the plateau in the timeframe that was tested; therefore, the shortest time is the preferred for the fastest reaction, similarly to the results in Example 3.

Example 7

Cloning of a Synthetic DNA Fragment in a Vector

[0092] In this example, a synthetic DNA fragment (scblue01, 885 bp) was cloned in the vector TGEX-FC (Antibody Design Labs, San Diego, Calif.). A 3482 bp-long fragment containing the bacterial origin of replication was amplified by PCR using TGEX-Fc plasmid DNA as a template and the primers bsarem_s and tgex_S3rev. The areas of homology in the scblue01 fragment are underlined in the hereafter table; the homologies are both 22-bp long with a Tm of 60.4 C. and 64.4 C. respectively (OligoAnalyzer 3.1, Integrated DNA Technologies, Inc.). Examination by minigel analysis of the PCR reaction showed a unique band at the expected size; the PCR reaction was purified over a Macherey Nagel NucleoSpin column and eluted in water at the concentration of 20 ng/l.

[0093] Primers and DNA fragment

TABLE-US-00008 Primer Sequence Length bsarem_s 5-TCCAACAAAGCCCTCCCAGC 20 tgex_S3rev 5-GACTGTGACTGGTTAGACGCCT 22 SyntheticDNA scblue01 5-AGGCGTCTAACCAGTCACAGTCGCA 885bp AGTTTAAACGGATCTCTAGCGAATT CGGCTTGGGGATATCCACCATGGAG ACAGACACACTCCTGCTATGGGTAC TGCTGCTCTTAGCGGCCCAGCCGGC CATGGCGCCCAATACGCAAACCGCC TCTCCCCGCGCGTTGGCCGATTCAT TAATGCAGCTGGCACGACAGGTTTC CCGACTGGAAAGCGGGCAGTGAGCG CAACGCAATTAATGTGAGTTAGCTC ACTCATTAGGCACCCCAGGCTTTAC ACTTTATGCTTCCGGCTCGTATGTT GTGTGGAATTGTGAGCGGATAACAA TTTCACACAGGAAACAGCTATGACC ATGATTACGGATTCACTGGCCGTCG TTTTACAACGTCGTGACTGGGAAAA CCCTGGCGTTACCCAACTTAATCGC CTTGCAGCACATCCCCCTTTCGCCA GCTGGCGTAATAGCGAAGAGGCCCG CACCGATCGCCCTTCCCAACAGTTG CGCAGCCTGAATTAAAATAGATAGG GCCCGGGAGGCCCCGAGCCCAAATC TTCTGACAAAACTCACACATGCCCA CCGTGCCCAGCACCTGAACTCCTGG GGGGACCGTCAGTCTTCCTCTTCCC CCCAAAACCCAAGGACACCCTCATG ATCTCCCGGACCCCTGAGGTCACAT GCGTGGTGGTGGACGTGAGCCACGA AGACCCTGAGGTCAAGTTCAACTGG TACGTGGACGGCGTGGAGGTGCATA ATGCCAAGACAAAGCCGCGGGAGGA GCAGTACAACAGCACGTACCGTGTG GTCAGCGTCCTCACCGTCCTGCACC AGGACTGGCTGAATGGCAAGGAGTA CAAGTGCAAGGTGTCCAACAAAGCC CTCCCAGCCC

[0094] Rapid LIC reaction

TABLE-US-00009 Component Volume T4 DNA polymerase 10x buffer 2.0 l ATP 10 mM 2.0 l T4 DNA polymerase (New England Biolabs) 0.25 l Th Rec A (New England Biolabs) 0.25 l scblue01 20 ng/l 0.6 l PCR product 20 ng/l 2.5 l water 12.4 l Total 20 l
All components were mixed on ice in a single PCR tube and the tube transferred to a PCR machine pre-cooled at 4 C. A temperature cycle made of a 1 second plateau at 75 C. followed by a 1 min plateau at 37 C. before cooling back at 4 C. was then initiated; the cycle was completed in 3 min. Chemically competent XL10-gold bacteria were transformed and plated on an agar plate supplemented with ampicillin. The day after, three colonies were picked and grown overnight at 37 C. with shaking. Sequence analysis revealed the presence of the synthetic DNA sequence properly inserted in all 3 colonies.

Example 8

Cloning of a PCR Fragment in a Vector

[0095] In this example, the HyHEL-10 scFv was cloned into the TGEX-SCblue vector build in Example 7. The HyHEL-10 scFv fragment was amplified from a phagemid clone derived from the pADL-10b vector (Antibody Design Labs, San Diego, Calif.) with the HyHEL-10 scFv sequence inserted in the double SfiI cloning site using the primers scFvblue_s and scFvblue_r. A single band at the expected size was found by minigel analysis. After treatment by DpnI to cut the methylated template DNA, the PCR product was purified over a Macherey Nagel NucleoSpin column and eluted in water at the concentration of 10 ng/l. TGEX-SCblue vector was cut by SfiI; the reaction mixture was purified over a Macherey Nagel NucleoSpin column and eluted in water at the concentration of 75 ng/1.

[0096] Primers and PCR fragment; Tm estimation (OligoAnalyzer 3.1) are given for the sequence overlaps with the cut vector (underlined).

TABLE-US-00010 Homologies Primer Sequence Length Tm scFvblue_s 5-tgctgctcttagcggcccagccggccatggcg 18 60.8 C. GATATTGTGCTAACTCAGTC scFvblue_r 5-aagatttgggctcggggcctcccgggcc 20 61.9 C. TGCAGAGACAGTGACCAGAG DNAFragment HyHEL-10scFv 5-GATATTGTGCTAACTCAGTCTCCAG CCACCCTGTCTGTGACTCCAGGAAATAG CGTCAGTCTTTCCTGCAGGGCCAGCCAA AGTATTGGCAACAACCTACACTGGTATC AACAAAAATCACATGAGTCTCCAAGGCT TCTCATCAAGTATGCTTCCCAGTCCATC TCTGGGATCCCCTCCAGGTTCAGTGGCA GTGGATCAGGGACAGATTTCACTCTCAG TATCAACAGTGTGGAGACTGAAGATTTT GGAATGTATTTCTGTCAACAGAGTAACA GCTGGCCTTACACGTTCGGAGGGGGGAC CAAGCTGGAAATAAAAGGTGGTGGTGGT TCTGGTGGTGGTGGTTCTGGCGGCGGCG GCTCCGGTGGTGGTGGATCCGACGTGCA GCTTCAGGAGTCAGGACCTAGCCTCGTG AAACCTTCTCAGACTCTGTCCCTCACCT GTTCTGTCACTGGCGACTCCATCACCAG TGATTACTGGAGCTGGATCCGGAAATTC CCAGGGAATAGACTTGAGTACATGGGGT ACGTAAGCTACAGTGGTAGCACTTACTA CAATCCATCTCTCAAAAGTCGAATCTCC ATCACCCGAGACACATCCAAGAACCAGT ACTACCTGGATTTGAATTCTGTGACTAC TGAGGACACAGCCACATATTACTGTGC AAACTGGGACGGTGATTACTGGGGCCA AGGGACTCTGGTCACTGTCTCTGCA

[0097] Rapid LIC reaction

TABLE-US-00011 Component Volume T4 DNA polymerase 10x buffer 2.0 l ATP 10 mM 2.0 l T4 DNA polymerase (New England Biolabs) 0.25 l Th Rec A (New England Biolabs) 0.25 l HyHEL-10 scFv 10 ng/l 3.5 l TGEX-SCblue SfiI cut 75 ng/l 1 l Water 11 l Total 20 l

[0098] The rapid LIC method was identical to the procedure in Example 7. Fifty microliter (50 l) of chemically competent XL10-gold cells were transformed by heat shock with 2 l of the reaction, resuspended in 200 l SOC medium and, after 1 hour incubation at 37 C. with shaking, plated on agar plates supplemented with amplicillin, IPTG and X-gal. The day after, around half of the colonies were white. Four white colonies were picked, grown overnight in 3-ml 2xYT medium supplemented with ampicillin, and sequence analysis of two colonies showed proper insertion of the scFv PCR fragment.

Example 9

Insertion of Two Complementary Oligonucleotides in a Vector

[0099] In this example a large loop in a DNA sequence was inserted. This type of cloning project is known to be difficult because of the presence of secondary structures. The recipient vector contained a lambda t1 terminator (lt1) where the terminator loop had been replaced by an XbaI site (underlined):

TABLE-US-00012 5-CAGTCACTATGAATCAACTACTTAGATGGTATTAGTGACCTGTATCT AGAATTTTTTGTCATCAAACCTGTCGCACTCC

[0100] Two oligonucleotides containing homology areas with the truncated lt1 sequence on each side of the XbaI site and complementary on their 3 ends were designed to complete the entire lt1 terminator sequence after insertion in the XbaI site. Below, the sequence homologies with the vector are underlined while the complementary sequence between the two oligonucleotides have been boxed (length 18, Tm 45.1 C.).

[0101] Primers

TABLE-US-00013 Homology Primer Sequence Length Tm lt1loopA_s 5-TGGTATTAGTGACCTGTA 18 46.2 C. [00001] lt1loopB_r 5-GTTTGATGACAAAAAAT 17 39.7 C. [00002]

[0102] Three hundred nanogram (300 ng) of the recipient vector 23C1HH10S.2 were digested in a 10 l reaction volume with XbaI for 3 hours. The cut vector was purified over a Macherey Nagel NucleoSpin column and eluted in 15 l of water.

[0103] Rapid LIC reaction

TABLE-US-00014 Component Volume T4 DNA polymerase 10x buffer 2.0 l ATP 10 mM 2.0 l T4 DNA polymerase (New England Biolabs) 0.5 l Th Rec A (New England Biolabs) 0.5 l 23C1HH10S.2 cut 12 l Water 2 l Total 19 l

[0104] The rapid LIC method was identical to the procedure in Example 7. After completion of the temperature cycle, 1 l of an equimolar mixture of the two oligonucleotides at 1 M each in water was added to the reaction and the temperature cycle used in Example 7 was run a second time. Clone analysis after bacterial transformation revealed a high proportion of parental clones; colony PCR followed by restriction analysis with XbaI of 16 colonies found 2 colonies missing the XbaI site. Sequence analysis of these two clones found the proper insertion of the two oligonucleotides, thus creating a complete lt1 terminator.

Example 10

Insertion of Two DNA Fragments in a Vector

[0105] In this example, the variable human heavy chain domain of a human antibody was cloned together with a modified CH1 domain of human IgG1 into the backbone of the TGEX-HC vector (Antibody Design Labs, San Diego, Calif.). The resulting plasmid in association with a light chain expressing vector can be used to express a recombinant Fab fragment.

[0106] Primers and DNA fragments

TABLE-US-00015 Homology Primer Sequence Length Tm tgexhug1ch1_s [00003] 20 61.6 C. tgexhug1hgtht_r [00004] 16 56.6 C. TGTGTGAGTTTTGTCACAAGATTTGG GCTCAACTTTCTTGTCC

TABLE-US-00016 DNA Fragments Characteristics Length Vector TGEX-HC, BssHII-NotI cut, gel 3292 bp purified V Domain Synthetic DNA fragment 395 bp CH1 domain DNA fragment prepared by PCR 349 bp amplification using the above primers and TGEX-HC as template

TABLE-US-00017 Homologies Length Tm Vector/VDomain 5 TTCTGTGTTCTCTCCACAGG 20 53.1 C VDomain/CH1 5-GCATCCACCAAGGGCCCATC 20 61.6 C. CH1/Vector 5-GCAGATCCCCCGACCT 16 56.6 C.

[0107] Rapid LIC reaction

TABLE-US-00018 Component Volume/Quantity T4 DNA polymerase 10x buffer 2.0 l ATP 10 mM 2.0 l T4 DNA polymerase (New England Biolabs) 0.5 l Th Rec A (New England Biolabs) 0.5 l vector 50 ng V Domain 18.8 ng CH1 Domain 24 ng Water 2 l Total 20 l

[0108] The rapid LIC method was identical to the procedure in Example 7. Fifty microliter (50 l) of chemically competent XL10-gold cells were transformed by heat shock with 2 l of the reaction, resuspended in 200 l SOC medium and, after 1 hour incubation at 37 C. with shaking, plated on agar plates supplemented with amplicillin, IPTG and X-gal. The day after, around half of the colonies were white. Four colonies were picked, grew overnight in 3-ml 2xYT medium supplemented with ampicillin, and sequence analysis of two colonies showed proper assembly of the 2 fragments in the DNA vector.

Example 11

Manual Rapid LIC Reaction with a Heated Water Bath

[0109] In this example, the cloning efficiency was analyzed by incubating the rapid LIC reaction in a heated water bath for varied periods of time.

[0110] Rapid LIC reaction

TABLE-US-00019 Component Amount Volume Buffer 10x 2 l ATP 10 mM 2 l pADL10b BglI-cut (25 ng/l) 50 ng 2 l Z900 DNA fragment (25 ng/l) 50 ng 2 l T4 DNA polymerase (New England Biolabs) 0.5 l Th Rec A (New England Biolabs) 0.5 l Water 11 l Total Volume 20.0 l
All components were mixed on ice in a single PCR tube and immersed for a short period of time in a water bath pre-heated at 75 C. before being brought back on ice. Each assay was done in duplicate as well as a control with the help of a PCR machine as described in Example 7. Chemically competent XL10-gold bacteria were transformed and plated on agar plates supplemented with ampicillin, IPTG and X-gal and incubated overnight at 37 C. The morning after, blue and white colonies were counted.

[0111] Results. Average blue and white colony counts are given for incubation in a 75 C. water bath for 2 s, 5 s, 10 s and for a rapid LIC reaction made using a PCR machine. The percentage of blue colonies, resulting from the proper insertion of the alpha fragment of the beta-galactosidase in the vector, were close to 80% on average, below the percentage observed for a reaction done with a PCR machine (95%), but still in the range of a very satisfying cloning efficiency.

TABLE-US-00020 Time (s) Blue Colonies White Colonies Percentage Blue 2 58 17.5 77% 5 32.5 9 78% 10 34 9 79% PCR 55 3 95%

TABLE-US-00021 TABLE1 SequenceUnfoldingat75 C. H.sup.1 Sequence Kcal/ C. Tm.sup.2 Source Unfolded.sup.3 Length mol (salt) % polyA(15) 15 112 28.4 100.0 polyA(20) 20 152 37.3 100.0 polyG(15) 15 152.6 69.3 89.9 polyG(20) 20 207.1 78.7 36.7 Example3 tactcgcggcccagc 15 134 58.4 99.4 ccaccgccttggcct 15 134.3 59 99.3 Example6 gaatatttatgacgattccgcagtattg 28 218 54.4 100.0 gagctgatttaacaaaaatttaacgcg 27 215 54.2 100.0 Example7 aggcgtctaaccagtcacagtc 22 183.1 58.7 99.9 tccaacaaagccctcccagccc 22 192.7 64.4 99.1 Example8 tgctgctcttagcggccc 18 152.7 60.8 99.4 aagatttgggctcggggcct 20 173.4 61.9 99.5 Example9 tggtattagtgacctgta 18 139.4 46.2 100.0 ctttgatgacaaaaaat 17 128.2 39.7 100.0 .sup.1Enthalpy values were estimated using OligoCal (Kibbe 2007). .sup.2Tm values were estimated using OligoAnalyzer 3.1 (www.idtdna.com/calc/analyzer). .sup.3Unfolded fractions were calculated according to Batcher et al. (2005).

[0112] The foregoing disclosure of the preferred embodiments of the present subject disclosure has been presented for purposes of illustration and description. It is not intended to be exhaustive or to limit the subject disclosure to the precise forms disclosed. Many variations and modifications of the embodiments described herein will be apparent to one of ordinary skill in the art in light of the above disclosure. The scope of the subject disclosure is to be defined only by the claims appended hereto, and by their equivalents.

[0113] Further, in describing representative embodiments of the present subject disclosure, the specification may have presented the method and/or process of the present subject disclosure as a particular sequence of steps. However, to the extent that the method or process does not rely on the particular order of steps set forth herein, the method or process should not be limited to the particular sequence of steps described. As one of ordinary skill in the art would appreciate, other sequences of steps may be possible. Therefore, the particular order of the steps set forth in the specification should not be construed as limitations on the claims. In addition, the claims directed to the method and/or process of the present subject disclosure should not be limited to the performance of their steps in the order written, and one skilled in the art can readily appreciate that the sequence may be varied and still remain within the spirit and scope of the present subject disclosure.

REFERENCES

[0114] 1. Aslanidis C, de Jong P J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Res. 1990; 18(20):6069-74.

[0115] 2. Aslanidis C, de Jong P J, Schmitz G. Minimal length requirement of the single-stranded tails for ligation-independent cloning (LIC) of PCR products. PCR Methods Appl. 1994; 4(3):172-7.

[0116] 3. Bitinaite J, Rubino M, Varma K H, Schildkraut I, Vaisvila R, Vaiskunaite R. USER friendly DNA engineering and cloning method by uracil excision. Nucleic Acids Res. 2007; 35(6):1992-2002.

[0117] 4. Bttcher A, Kowerko D, Sigel R K. Explicit analytic equations for multimolecular thermal melting curves. Biophys Chem. 2015; 202:32-9.

[0118] 5. Breslauer K J, Frank R, Blcker H, Marky L A. Predicting DNA duplex stability from the base sequence. Proc Natl Acad Sci USA. 1986 June; 83(11):3746-50.

[0119] 6. Cohen, S. N., A. C. Chang, H. W. Boyer and R. B. Helling. Construction of biologically functional bacterial plasmids in vitro. Proc. Nat. Acad. Sci. USA 1973; 70:3204-3244.

[0120] 7. Donahue W F, Turczyk B M, Jarrell K A. Rapid gene cloning using terminator primers and modular vectors. Nucleic Acids Res. 2002; 30(18):e95.

[0121] 8. Gl J, Schnell R, Szekeres S, Klmn M. Directional cloning of native PCR products with preformed sticky ends (autosticky PCR). Mol Gen Genet. 1999; 60(6):569-73.

[0122] 9. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods in Enzymology 2011; 498, 349-61.

[0123] 10. Hamilton M D, Nuara AA , Gammon D B, Buller R M, Evans D H. Duplex strand joining reactions catalyzed by vaccinia virus DNA polymerase. Nucleic Acids Res. 2007; 35(1):143-51.

[0124] 11. Haun, R. S., I. M. Serventi, et al. Rapid, reliable ligation-independent cloning of PCR products using modified plasmid vectors. Biotechniques 1992; 13(4): 515-8.

[0125] 12. Horton R M, Hunt H D, Ho S N, Pullen J K, Pease L R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 1989; 77(1):61-8.

[0126] 13. Hsiao K. Exonuclease III induced ligase-free directional subcloning of PCR products. Nucleic Acids Res. 1993; 21(23):5528-9.

[0127] 14. Jones D H, Howard B H. A rapid method for site-specific mutagenesis and directional subcloning by using the polymerase chain reaction to generate recombinant circles. Biotechniques. 1990; 8(2):178-183.

[0128] 15. Jones D H, Sakamoto K, Vorce R L, Howard B H. DNA mutagenesis and recombination. Nature. 1990; 344(6268):793-794.

[0129] 16. Kaluz S, Klble K, Reid K B. Directional cloning of PCR products using exonuclease III. Nucleic Acids Res. 1992; 20(16):4369-70.

[0130] 17. Kibbe W A. OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Res. 2007; 35:W43-6.

[0131] 18. Kowalczykowski S C. Biochemistry of genetic recombination: energetics and mechanism of DNA strand exchange. Annu Rev Biophys Biophys Chem. 1991; 20:539-75.

[0132] 19. Kuijper J L, Wiren K M, Mathies L D, Gray C L, Hagen F S. Functional cloning vectors for use in directional cDNA cloning using cohesive ends produced with T4 DNA polymerase. Gene 1992; 112(2):147-55.

[0133] 20. Mergny J L, Lacroix L. Analysis of thermal melting curves. Oligonucleotides. 2003; 13(6):515-37.

[0134] 21. SantaLucia J Jr. A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proc Natl Acad Sci USA, 1998; 95(4):1460-1465.

[0135] 22. Stoker A W. Cloning of PCR products after defined cohesive termini are created with T4 DNA polymerase. Nucleic Acids Res. 1990; 18(14):4290.

[0136] 23. Li C, Evans R M. Ligation independent cloning irrespective of restriction site compatibility. Nucleic Acids Res. 1997; 25(20):4165-6.

[0137] 24. Li M Z, Elledge S J. Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC. Nat Methods. 2007; 4(3):251-6.

[0138] 25. Tachibana A, Tohiguchi K, Ueno T, Setogawa Y, Harada A, Tanabe T. Preparation of long sticky ends for universal ligation-independent cloning: sequential T4 DNA polymerase treatments. J Biosci Bioeng. 2009; 107(6):668-9.

[0139] 26. Thieme F, Engler C, Kandzia R, Marillonnet S. Quick and clean cloning: a ligation-independent cloning strategy for selective cloning of specific PCR products from non-specific mixes. PLoS One. 2011; 6(6):e20556

[0140] 27. Tillett D, Neilan B A. Enzyme-free cloning: a rapid method to clone PCR products independent of vector restriction enzyme sites. Nucleic Acids Res. 1999; 27(19):e26.

[0141] 28. Tseng H. DNA cloning without restriction enzyme and ligase. Biotechniques. 1999; 27(6): 1240-4.

[0142] 29. Willer D O, Yao X D, Mann M J, Evans D H. In vitro concatemer formation catalyzed by vaccinia virus DNA polymerase. Virology. 2000 20; 278(2):562-9.

[0143] 30. Yang Y S, Watson W J, Tucker P W, Capra J D. Construction of recombinant DNA by exonuclease recession. Nucleic Acids Res. 1993; 21(8):1889-93.

[0144] 31. Yang J, Zhang Z, Zhang X A, Luo Q. A ligation-independent cloning method using nicking DNA endonuclease. Biotechniques. 2010; 49(5):817-21.

All the references cited herein, including patents, patent applications, and publications, and including references cited in the Bibliography, are incorporated by reference in their entireties.

[0145] Headings are for the convenience of the reader and do not limit the scope of the invention.