Programmable Oncolytic Virus Vaccine System and Method
20200017881 ยท 2020-01-16
Assignee
Inventors
Cpc classification
C12N2710/10034
CHEMISTRY; METALLURGY
C12N2710/10334
CHEMISTRY; METALLURGY
A61K35/768
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
C12N2710/10043
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
Abstract
An expression system, comprising: a first nucleic acid molecule having a cell-specific promoter; a second nucleic acid molecule which encodes a transcriptional activator; a third nucleic acid molecule having a first recognition sequence of the transcriptional activator; a fourth nucleic acid molecule having a first promoter and a first regulatory element; a fifth nucleic acid molecule which encodes a first regulatory protein; a sixth nucleic acid molecule having a second recognition sequence of the transcriptional activator; a seventh nucleic acid molecule having a second promoter and a second regulatory element; an eighth nucleic acid molecule which encodes a second regulatory protein; as well as a ninth nucleic acid molecule which is configured to conditionally inhibit the expression of the first regulatory protein, and a tenth nucleic acid molecule which is configured to conditionally inhibit the expression of the second regulatory protein; the first regulatory element is adapted to inhibit the function of the first promoter by means of binding to the second regulatory protein, and the second regulatory element is adapted to inhibit the function of the second promoter by means of binding to the first regulatory protein.
Claims
1. An expression system comprising: a first nucleic acid molecule, incorporating a cell-specific promoter; a second nucleic acid molecule, operably linked to the first nucleic acid molecule and encoding a transcriptional activator; a third nucleic acid molecule, incorporating a first recognition sequence of the transcriptional activator; a fourth nucleic acid molecule, operably linked to the third nucleic acid molecule and incorporating a first promoter and a first regulatory element; a fifth nucleic acid molecule, operably linked to the fourth nucleic acid molecule and encoding a first regulatory protein; a sixth nucleic acid molecule, incorporating a second recognition sequence of the transcriptional activator; a seventh nucleic acid molecule, operably linked to the sixth nucleic acid molecule and incorporating a second promoter and a second regulatory element; an eighth nucleic acid molecule, operably linked to the seventh nucleic acid and encoding a second regulatory protein; and at least one selected from the group consisting of: a ninth nucleic acid molecule, operably linked to the fifth nucleic acid molecule and configured to conditionally inhibit expression of the first regulatory protein; a tenth nucleic acid molecule, operably linked to the eighth nucleic acid molecule and configured to conditionally inhibit expression of the second regulatory protein, wherein the first regulatory element is adapted to inhibit the function of the first promoter by binding to the second regulatory protein, and the second regulatory element is adapted to inhibit the function of the second promoter by binding to the first regulatory protein.
2. The expression system according to claim 1, wherein the cell-specific promoter is a tumor cell-specific promoter, and the tumor cell-specific promoter is at least one selected from the group consisting of an alpha-fetoprotein-specific promoter, a Survivin promoter, a human telomerase reverse transcriptase gene promoter, a cholecystokinin A receptor gene promoter, a carcinoembryonic antigen promoter, a proto-oncogene human epidermal growth factor receptor 2 promoter, a prostaglandin endoxygenase reductase 2 promoter, a chemokine receptor-4, an E2F-1 gene promoter, a mucin promoter, a prostate specific antigen, a human tyrosinase-related protein 1, and a tyrosinase promoter.
3. The expression system according to claim 1, wherein the transcriptional activator is at least one selected from the group consisting of Gal4VP16, Gal4vp64, dCas9-VPR, dCas9-VP64, dCas9-VP16, dCas9-VTR, and rtTA.
4. The expression system according to claim 1, wherein the first recognition sequence and the second recognition sequence are each independently selected from at least one of 5UAS, 7tetO and a target sequence of dCas9.
5. The expression system according to claim 1, wherein the first promoter and the second promoter are each independently selected from a miniCMV and a TATA box.
6. The expression system according to claim 1, wherein the first regulatory protein and the second regulatory protein are each independently selected from at least one of Lad, tetR, zinc finger, KRAB, tetR-KRAB and dCas9-KRAB.
7. The expression system according to claim 6, wherein the first regulatory element and the second regulatory element are each independently selected from at least one of a tetO, a LacO, a zinc finger target site, and a target sequence of dCas9.
8. The expression system according to claim 7, wherein the first regulatory protein is LacI, and the second regulatory element comprises a plurality of repeated LacO sequences, wherein at least one of the pluralities of repeated LacO sequences is set downstream of the second promoter.
9. The expression system according to claim 6, wherein the second regulatory protein is tetR-KRAB, and the first regulatory element comprises a plurality of repeated tetO sequences, wherein at least one of the pluralities of repeated tetO sequences is set downstream of the first promoter.
10. The expression system according to claim 1, wherein at least one of the fifth nucleic acid molecule and the ninth nucleic acid molecule further comprises a sequence encoding a protein of interest.
11. The expression system according to claim 10, wherein the fifth nucleic acid molecule comprises a sequence encoding the protein of interest, and the protein of interest comprises at least one selected from the group consisting of a viral replication and packaging protein and an immune effector.
12. The expression system according to claim 11, wherein the virus replication and packaging protein comprises at least one selected from the group consisting of an adenovirus E1 gene, an adenovirus E1A gene, an adenovirus E1B gene, an adenovirus E2 gene and an adenovirus E4 gene.
13. The expression system according to claim 11, wherein the immune effector comprises at least one sequence selected from the group consisting of an inhibitory sequence that antagonizes PD-1 gene, an inhibitory sequence that antagonizes PD-L1 gene, an inhibitory sequence that antagonizes CTLA4 gene, an inhibitory sequence that antagonizes Tim-3 gene, GM-CSF, IL-2, IL-12, and IL-15.
14. The expression system according to claim 10, wherein the protein of interest and the first regulatory protein are expressed in a form of a fusion protein, and the protein of interest and the first regulatory protein are linked by a cleavable linker peptide.
15. The expression system according to claim 1, wherein the ninth nucleic acid molecule and the tenth nucleic acid molecule independently inhibit expression of the first regulatory protein or the second regulatory protein, respectively, by RNA interference.
16. The expression system according to claim 15, wherein the ninth nucleic acid molecule comprises a nucleic acid sequence specifically recognized by a first microRNA, the tenth nucleic acid molecule comprises a nucleic acid sequence specifically recognized by a second microRNA, the first microRNA is a normal cell-specific microRNA, and the second microRNA is an abnormal cell-specific microRNA.
17. The expression system according to claim 16, wherein the first microRNA comprises at least one selected from the group consisting of miR199a, miR95, miR125, miR25b, Let-7, miR143, miR145, and miR200C.
18. The expression system according to claim 16, wherein the second microRNA comprises at least one selected from the group consisting of miR21, miR223, miR224, miR221, miR18, miR214, miR146a, and miR1792.
19. The expression system according to claim 1, wherein the first nucleic acid molecule and the second nucleic acid molecule are loaded in a first expression vector; the third nucleic acid molecule, the fourth nucleic acid molecule, the fifth nucleic acid molecule and optionally the ninth nucleic acid molecule are loaded in a second expression vector; and the sixth nucleic acid molecule, the seventh nucleic acid molecule, the eighth nucleic acid molecule and optionally the tenth nucleic acid molecules are loaded in a third expression vector.
20. The expression system according to claim 19, wherein the first expression vector, the second expression vector and the third expression vector are each independently selected from at least one of a plasmid, a virus, a nanomaterial, a liposome, a molecularly coupled vector, naked DNA, a chromosomal vector, and a polymer.
21-40. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
DETAILED DESCRIPTION
[0126] Embodiments of the present disclosure are described in detail below. The embodiments described below are illustrative only and are not to be construed as limiting the present disclosure.
[0127] Expression System
[0128] In a first aspect of the present disclosure, provided in embodiments is an expression system. According to an embodiment of the present disclosure, the expression system comprises:
[0129] a first nucleic acid molecule, incorporating a cell-specific promoter;
[0130] a second nucleic acid molecule, operably linked to the first nucleic acid molecule and encoding a transcriptional activator;
[0131] a third nucleic acid molecule, incorporating a first recognition sequence of the transcriptional activator;
[0132] a fourth nucleic acid molecule, operably linked to the third nucleic acid molecule and incorporating a first promoter and a first regulatory element;
[0133] a fifth nucleic acid molecule, operably linked to the fourth nucleic acid molecule and encoding a first regulatory protein;
[0134] a sixth nucleic acid molecule, incorporating a second recognition sequence of the transcriptional activator;
[0135] a seventh nucleic acid molecule, operably linked to the sixth nucleic acid molecule and incorporating a second promoter and a second regulatory element;
[0136] an eighth nucleic acid molecule, operably linked to the seventh nucleic acid and encoding a second regulatory protein; and
[0137] at least one selected from the group consisting of:
[0138] a ninth nucleic acid molecule, operably linked to the fifth nucleic acid molecule and configured to conditionally inhibit expression of the first regulatory protein;
[0139] a tenth nucleic acid molecule, operably linked to the eighth nucleic acid molecule and configured to conditionally inhibit expression of the second regulatory protein,
[0140] wherein
[0141] the first regulatory element is adapted to inhibit the function of the first promoter by binding to the second regulatory protein, and
[0142] the second regulatory element is adapted to inhibit the function of the second promoter by binding to the first regulatory protein.
[0143] With the expression system according to the embodiment of the present disclosure, the gene of interest can be specifically expressed under a specific cellular environment while being regulated in a mutual repression way, with strong control, high efficiency and specificity.
[0144] According to an embodiment of the present disclosure, the cell-specific promoter is a tumor cell-specific promoter. The tumor cell-specific promoter is at least one selected from the group consisting of an alpha-fetoprotein-specific promoter (AFP), a Survivin gene promoter (SUR), a human telomerase reverse transcriptase (hTERT) gene promoter, a cholecystokinin A receptor gene promoter (CCKAR promoter), a carcinoembryonic antigen promoter (CEA promoter), a proto-oncogene human epidermal growth factor receptor 2 promoter (Human epidermal growth factor receptor-2, HER2), a prostaglandin oxidase reductase 2 promoter (Cyclooxygenase 2, COX2), a chemokine receptor-4 (CXCR4), an E2F-1 gene promoter (E2F-1 promoter), a mucin promoter (Mucin1MUC1), a prostate specific antigen (PSA), a human tyrosine related protein 1 (TRP1) and a tyrosinase (Tyr) promoter. The expression system in the embodiment can be initiated in the microenvironment of specific tumor cells under the control of the tumor cell-specific promoters described as above, thereby further enhancing the specificity of gene expression and regulation.
[0145] According to an embodiment of the present disclosure, the transcriptional activator is at least one selected from the group consisting of Gal4VP16, Gal4esn, Gal4VP64, dCas9-VP16, dCas9-VP64, dCas9-VPR, dCas9-VTR and rtTA. The yeast Ga14-UAS gene expression system is one of the most well understood transcriptional regulatory systems of eukaryotic cells, and the Gal4 gene encodes a transcriptional activator protein in yeast (Saccharomyces cerevisiae). Gal4 can recognize a 17 bp of sequence in the upstream activation sequence (UAS) of gene promoter, that is, 5-CGGRNNRCYNYNYNCNCCG-3 (R represents purine, Y represents pyrimidine, and N represents any deoxynucleotide). Gal4 interacts with Ga180 which binds to galactose metabolites. Gal4 comprises two domains (a DNA binding domain (N-terminal domain) and an activation domain (C-terminal domain)) and further comprises a zinc cluster domain (specifically a Zn(2)-Cys(6) dual core cluster domain), which usually functions in a form of a homodimer. The core sequence in the UAS sequence that binds to the GAL4 protein is a four-copy tandem repeat, each copy containing 17 base pairs (i.e. the sequence 5-CGGAGTACTGTCGTGGG-3). Ga14, present in mammalian cells, activates target genes only when UAS is recognized, thus initiating the transcription of downstream genes, with good specificity and inducibility. The activation domain of Gal4 protein can be replaced with the activation domain of herpes simplex virus VP16 protein or 4 copies of VP16 (VP64). The formed fusion transcription factor increases the transcriptional activation activity of Gal4 protein while maintaining the binding specificity of Gal4 protein. The tetracycline-inducing system is a bacterial-derived transcriptional activation system for eukaryotic cells, including tetracycline response elements and tetracycline-inducing proteins. The Tet response element (TRE) contains 7 repeats of 19-nucleotide tetracycline operon sequence (i.e. 5-TCCCTATCAGTGATAGAGA-3), which can be recognized by tetracycline-inducing proteins. The tetracycline-inducing system includes a tetracycline-inducing repression system and a tetracycline-inducing activation system. The tetracycline-inducing repression system comprises a tetracycline response element and a tetracycline repressor tetR. When tetracycline is absent, the expression of downstream genes is activated by the binding of the repressor to the response element; and when tetracycline is present, the repressor binds to tetracycline, thus inhibiting the expression of downstream genes. The tetracycline-inducing activation system comprises a tetracycline response element and a reverse tetracycline-controlled transactivator rtTA. When tetracycline is absent, rtTA cannot bind to the TRE element, thus cannot activate the expression of downstream genes; while when tetracycline is present, rtTA binds to TRE under the action of tetracycline, thus activating the expression of downstream genes.
[0146] Nuclease deactivated Cas9 (dCas9) is a mutant form of Cas9, which can recognize a target sequence via gRNA mediation, only with specific recognition and binding on DNA and without cleavage activity on target sequence. When dCas9 is fusion-expressed along with activation elements, the expression of target genes can be effectively activated.
[0147] According to an embodiment of the present disclosure, the first recognition sequence and the second recognition sequence are each independently selected from at least one of 5UAS, 7tetO and a target sequence of dCas9. 5UAS is 5 copies of response elements of Gal4VP16 regulatory system. The core sequence in the UAS sequence that binds to the Gal4 protein is a four-copy tandem repeat, each copy containing 17 base pairs (sequence 5-CGGAGTACTGTCGTGGG-3). 7tetO is 7 copies of TREs which are a response element of tetracycline regulatory system. The Tet response element (TRE) contains 7 repeats of 19-nucleotide tetracycline operon sequence (5-TCCCTATCAGTGATAGAGA-3), which can be recognized by tetracycline-inducing proteins.
[0148] According to an embodiment of the present disclosure, the first promoter and the second promoter are miniCMV. 5UAS-miniCMV is a synthetic inducible promoter. 5UAS is a recognition sequence of Gal4 protein, and miniCMV is a part of promoter sequence of Cytomegalovirus. TRE is also an inducible promoter. For 7tetO-miniCMV, tetO is a recognition sequence of the response element of tetracycline system.
[0149] According to an embodiment of the present disclosure, the first regulatory protein and the second regulatory protein are each independently selected from at least one of LacI, tetR, zinc finger, KRAB and dCas9-KRAB. Lactose repressor (LacI) binds to the major groove of lactose operon (LacO) through recognizing specific sequences via the helix-turn-helix element of its own DNA-binding domain, as well as tightly binding to base sequence on the minor groove of LacO via symmetry-related -helix residues. Such a tight binding causes high affinity binding of RNA polymerase to promoter region and prevents DNA extension, thereby inhibiting mRNA transcription and expression of downstream genes. The tetracycline repressor (TetR) contains a conserved helix-turn-helix DNA binding region (forming a homodimer) which binds to the tetracycline operon (tetO), thus the transcriptional expression of downstream genes is inhibited. Zinc finger protein consists of a ring containing about 30 amino acids and a Zn.sup.2+ coordinated to 4 Cys proteins (or 2 Cys) and 2 His proteins on the ring, forming a structure in a shape of a finger. Zinc finger proteins are a class of proteins that play an important role in gene regulation. Zinc finger proteins can be mainly classified into C2H2 type, C4 type and C6 type depending to their conserved domains. Zinc finger can regulate gene expression, cell differentiation and embryonic development at transcriptional and translational levels by specifically binding to target sequences of DNA, RNA, DNA-RNA molecules, or to its own or other zinc finger proteins. The Krppel associated box (KRAB) domain is a class of transcriptional repression regions which is present in nearly 400 zinc finger proteins in humans. KRAB generally consists of 75 amino acid residues and its smallest effective inhibition region consists of 45 amino acids, which plays its role through amphipathic helical connection between proteins. KRAB can be divided into two regions (A box and B box) which are encoded by different exons, where A box plays a central role in transcriptional repression, and B box enhances the transcriptional repression of A box.
[0150] Nuclease deactivated Cas9 (dCas9) is a mutant form of Cas9, which can recognize a target sequence via gRNA mediation, only with specific recognition and binding activities on DNA sequences and without cleavage activity on target sequences. When dCas9 is fusion-expressed along with repression regions, the expression of target genes can be effectively inhibited.
[0151] According to an embodiment of the present disclosure, the first regulatory element and the second regulatory element are each independently selected from at least one of a tetO, a LacO, a zinc finger target site, and a target sequence of dCas9. The tetracycline operon (tetO) can be recognized by tetracycline repressors to inhibit the expression of downstream genes. The lactose operon (LacO) can be recognized by lactose repressors (Lad) to inhibit the expression of downstream genes. The zinc finger target site can be recognized by zinc finger proteins to regulate the expression of downstream genes. The dCas9 target sequence can be recognized by dCas9-KRAB with the aid of a complementary gRNA to inhibit the expression of downstream genes.
[0152] According to an embodiment of the present disclosure, the first regulatory protein is LacI, and the second regulatory element comprises a plurality of repeated LacO sequences, at least one of the pluralities of repeated LacO sequences being set downstream of the second promoter. The expressed LacI can specifically bind to LacO sequence, thereby inhibiting the function of the second promoter. According to the LacI/LacO repression system of the embodiment of the present disclosure, Lactose repressor (Lad) binds to the major groove of lactose operon (LacO) through recognizing specific sequences via the helix-turn-helix element of its own DNA-binding domain, as well as tightly binds to base sequence on the minor groove of LacO via symmetry-related -helix residues. Such a tight binding causes high affinity binding of RNA polymerase to promoter regions and prevents DNA extension, thereby inhibiting mRNA transcription and expression of downstream genes. According to an embodiment of the present disclosure, two sides of miniCMV sequence in 5UAS-miniCMV promoter are each inserted with LacO by the inventors, which can effectively inhibit the expression of downstream genes of the promoter as shown by experiments. However, the inventors do not exclude other repression systems which can be used at those locations.
[0153] According to an embodiment of the present disclosure, the second regulatory protein is tetR-KRAB, and the first regulatory element comprises a plurality of repeated tetO sequences, at least one of the pluralities of repeated tetO sequences being set downstream of the first promoter. According to the tetR-KRAB/tetO repression system in the embodiment of the present disclosure, the tetracycline repressor (TetR) contains a conserved helix-turn-helix DNA binding region (forming a homodimer), which binds to tetracycline operon (tetO) to inhibit the transcriptional expression of downstream genes. In this embodiment, two sides of miniCMV sequence in 5UAS-miniCMV promoter are each inserted with tetO by inventors, which can effectively inhibit the expression of downstream genes of the promoter as shown by experiments. The switch system comprising the first regulatory protein and the second regulatory protein can effectively respond to corresponding input signals, thus effectively distinguishing different cell lines. However, the inventors do not exclude other repression systems which can be used at those locations.
[0154] According to an embodiment of the present disclosure, at least one of the fifth nucleic acid molecule and the ninth nucleic acid molecule further comprises a sequence encoding a protein of interest. With the expression system according to the embodiment of the present disclosure, the protein of interest can be specifically expressed in a specific cellular microenvironment, while being regulated in a mutual repression way. According to a specific embodiment of the present disclosure, the expression system exhibits a significant increased specificity and regulation on the expression of the protein of interest.
[0155] According to an embodiment of the present disclosure, the fifth nucleic acid molecule comprises a sequence encoding the protein of interest, and the protein of interest comprises at least one selected from the group consisting of a viral replication and packaging protein, and an immune effector. The viral replication and packaging protein can effectively ensure the survival and replication of the expression system vector in a host. The expression of the immune effector can effectively activate the immune system in body, thereby promoting the immune killing to specific cells, such as tumor cells.
[0156] According to an embodiment of the present disclosure, the virus replication and packaging protein comprises at least one selected from the group consisting of an adenovirus E1 gene, an adenovirus E1A gene, an adenovirus E1B gene, an adenovirus E2 gene and an adenovirus E4 gene. According to the timing of transcription, adenoviral genes are mainly divided into early expression genes (E14) and late expression genes (L15). After the adenoviral genome enters the nucleus, the cellular transcription factor firstly binds to the enhancer located upstream of the E1A region, expressing E1A protein which regulates cellular metabolism and makes the viral DNA replicated in cells more easily. The E1A protein also can activate promoters of other early genes (E1B, E2A, E2B, E3 and E4), where E2B drives the expression of three additional transcriptional units of early genes involving in viral replication (i.e. a precursor terminal protein (pTP), a single-stranded DNA binding protein (ssDBP) and a DNA polymerase (DNA pol)). Expression products of these three genes are tightly bound to be a complex, which interacts with at least three cellular proteins to initiate viral genome replication. The expression products of E1 region gene are divided into E1A and E1B. E1A mainly consists of two components, that is 289R (or 13S) and 243R (or 12S). The main function of the E1A protein is in regulating cellular metabolism, thus making cells more susceptible to viral replication. E1B19K is homologous to the expression product of Bcl-2 gene, and can prevent cells from apoptosis or necrosis by inactivating and clearing Bax family members. The E1B55K gene product can down-regulate the transcription level of p53 gene, with other adenoviral genes (such as E4 or f6) involved. The E1B55K gene product is also involved in viral replication, transcription of viral late mRNAs, and transportation of viral RNAs. The expression products of E2 region gene are divided into E2A and E2B, where E2A is a DNA binding protein (DBP), and E2B mainly has two products (i.e. a precursor terminal protein (pTP) and a viral DNA polymerase (pol) respectively). Such three proteins at least interact with three intracellular factors to initiate adenoviral DNA replication as well as transcription and translation of viral late genes. The gene products of E4 region gene are usually referred as orf 1 to 6/7, mainly involving in metabolism of viral messenger RNA, as well as promoting viral DNA replication and shutting down protein synthesis in a host. Studies have found that some E4 products can bind to DNA-activated protein kinases to prevent viral DNA from concatenating. Since this kinase can activate p53 gene, it is believed that some products of E4 region gene can inhibit cell apoptosis. Many products of E1B and E4 genes are involved in antagonizing the E1A protein. For example, E4 inhibits the activation of E2F promoter via E1A.
[0157] According to an embodiment of the present disclosure, the immune effector comprises at least one sequence selected from the group consisting of an inhibitory sequence that antagonizes the PD-1 gene, an inhibitory sequence that antagonizes the PD-L1 gene, an inhibitory sequence that antagonizes the CTLA4 gene, an inhibitory sequence that antagonizes the Tim-3 gene, GM-CSF, IL-2, IL-12, IL-15 or a fusion expression form of these factors. Programmed death 1 (programmed death receptor 1, PD-1) is an important immunosuppressive molecule belonging to a member of the CD28 superfamily, which is originally cloned from apoptotic mouse T cell hybridoma 2B4.11. PD-1 is an important inhibitory molecule on the surface of T cells, and its intracellular domain comprises an immunoreceptor tyrosine inhibitory motif (ITIM) and an immunoreceptor tyrosine transfer motif (ITSM). ITSM mediates the recruitment of protein tyrosine phosphatase family phosphatase and the inhibition of T cell activation signals. Ligands of ITSM are PD-L1 and PD-L2, which mainly play a major role in inhibiting activation of T cells in the tumor microenvironment during immune responses of immune system. Programmed cell death 1 ligand (PD-L1), also known as a cluster of differentiation 274 (CD274) or a B7 homolog (B7 homolog 1, B7-H1), is a human protein in body that is encoded by CD274 gene. PD-L1 is expressed inductively in a variety of tumor cells and hematopoietic cells in tumor cell microenvironments, and its expression level is positively correlated with the malignancy of tumors. PD-1 antibody and PD-L1 antibody can block the binding of PD-1 to PD-L1. However, tumor cells in tissues can escape from immune system through the PD-1/PD-L1 pathway. Cytotoxic T lymphocyte associate protein-4, short for CTLA-4, is a type of co-stimulatory molecule expressed on the surface of T cells. CTLA-4 is capable of specifically binding to CD80/CD86 on the surface of APC to activate downstream signals during activation of T cells, similar to the function of CD28. Studies have found that cells that predominantly express CTLA-4 among T cells are regulatory T cells (Treg), which is a class of T cells that negatively regulates cellular immunity. In the absence of CTLA-4 receptor, mice exhibit T cell overexpression, thus accompanied with severe autoimmune diseases. The above results show that Treg needs CTLA-4 to exercise its function. In addition, CTLA-4 is also expressed in conT cells, which plays a role in inhibiting the signaling of T cell activation. T cell immunoglobulin and mucin-domain containing molecule (TIM) gene family is a novel gene family discovered by Mclntire in 2001 in search of mouse asthma susceptibility genes, which is further identified by genomic analysis and positional cloning. The TIM family gene contains immunoglobulin V region and mucin region. Tim-3 is an important member of the TIM family and expresses a negative regulatory molecule on the surface of activated Th1 cells. Currently, it is found that TIM3 is expressed in CD8.sup.+ T cells, Th17 cells, Treg, NK cells and other lymphocyte subsets. Granulocyte-macrophage Colony Stimulating Factor (GM-CSF) is a monomeric glycoprotein cytokine secreted by macrophages, T cells, NK cells and the like, which stimulates stem cells to produce granules cells (neutrophils, eosinophils, basophils and monocytes). GM-CSF also affects mature cells in the immune system, such as inhibiting the transfer of neutrophils and altering expression of receptor on the cell surface. This factor also can inhibit fungal infections by activating macrophages. Interleukin 2 (IL-2) can mediate cytokines between white blood cells and white blood cells as well as between white blood cells and other cells. IL-2 is mainly produced by activated T cells, and acts on local target cells in a manner of autocrine and paracrine, which is a major cytokine involving in immune response, thus exhibiting a significant immune effect. IL-2 can also promote T cell proliferation and produce cytokines, promote B cell proliferation and secrete Ig, activate macrophages and enhance activation and proliferation of NK cells. In addition, IL-2 also has a negative regulation effect, which can induce apoptosis of T cells which activate Ag, limit the intensity of immune response, and avoid obvious immune damage. Interleukin-12 (IL-12) is a kind of interleukin produced by dendritic cells, macrophages, neutrophils and human B lymphoblasts (nc-37) in response to antigen stimulation. IL-12, called T cell stimulating factor, participates in differentiation of naive cells into Th1 cells, and stimulates the production of interferon gamma (IFN-) and tumor necrosis factor alpha (TNF-). IL-12 plays an important role in regulating the activities of natural killer cells and T lymphocytes. IL-12 mediates enhanced cytotoxic activity of NK cells and CD8+ cytotoxic T lymphocytes. IL-12 also has anti-angiogenic activity, indicating it can block the formation of new blood vessels. IL-12 increases the production of gamma-interferon (INF-) thus increasing the induction of protein 10 (IP-10 or CXCL10), where IP-10 mediates anti-angiogenesis. IL-12 has been tested as a potential anti-cancer drug because of its ability of inducing immune response and anti-angiogenesis. IL-15 is a factor recently discovered which can be produced by a variety of cells, such as activated monocytes-macrophages, epidermal cells, fibroblasts and the like. The molecular structure of IL-15 is much similar to that of IL-2, thus IL-15 is capable of exerting a biological activity similar to IL-2 based on the binding of -chain and -chain of IL-2 receptor to target cells. IL-15 can induce proliferation and differentiation of B cells, which is the only cytokine that can partially substitute IL-2 to induce initial antibody production. IL-15 can stimulate proliferation of T cells and NK cells, induce LAK cell activity, and can also interact with IL-12 to synergistically stimulate NK cells so as to produce IFN-.
[0158] According to an embodiment of the present disclosure, the protein of interest and the first regulatory protein are co-expressed under the control of one same promoter, and the protein of interest and the first regulatory protein are linked by a cleavable linker peptide. The protein of interest and the first regulatory protein are regulated and expressed under the one same promoter, and are further cleaved at the linker peptide after expression. The protein of interest is separated from the first regulatory protein, and the protein of interest and the first regulatory protein function independently of each other.
[0159] According to an embodiment of the present disclosure, the ninth nucleic acid molecule and the tenth nucleic acid molecule independently inhibit expression of the first regulatory protein or the second regulatory protein, respectively, via RNA interference. MicroRNA is a specific microRNA expressed in different cellular microenvironments, and the ninth or tenth nucleic acid molecule is a specific target sequence of microRNA. The specific effect between the microRNA expressed in a specific microenvironment and its target sequence can be realized via RNA interference, thereby specifically regulating the expression of the first regulatory protein or the second regulatory protein. MicroRNAs (miRNAs) are a class of endogenous small RNAs having about 20-24 nucleotides, and several miRNAs can regulate one same gene. The expression of a gene can be finely regulated by a combination of several miRNAs. MicroRNA has many forms, including a pri-miRNA in an original form, which is of a length of about 300-1000 bases; a pre-miRNA, in a form of microRNA precursor, which is formed by processing of the pri-miRNA and is of a length of about 70-90 bases; and a mature miRNA of about 20 to 24 nt, which is generated by digestion of the pre-miRNA with Dicer. The RNA-induced silencing complex (RISC) inhibits the expression of target genes. The effect of microRNA-RISC on mRNAs of target genes has always been largely dependent on the complementation degree between the microRNA-RISC and the target gene transcript sequence, which is performed in three ways. In a first way, the mRNA molecules of target gene are cleaved, that is the miRNAs which are completely complementary to a target gene (having closely similar mechanism and function to those of siRNAs) are cleaved. In plants, most of miRNAs of target genes are cleaved by the method described above, and the molecules without poly(A) are added with Uracils (Us) at the 3 end and are rapidly degraded while the molecules with poly(A) can be stably present for a time period (such as Arabidopsis miR-171). Currently, one miRNA is found to be completely complementary to three potential target genes in plants, even although it is unclear whether these genes are targets of the miRNA. However, it is found for the first time that miRNA can be completely complementary to its potential targets, suggesting miRNA may have a mechanism similar as siRNA. In a second way, the translation of target gene is inhibited. miRNAs are not completely complement to target genes, thus inhibiting the translation of target genes, without affecting the stability of mRNAs. Such a miRNA is the most widely discovered miRNA, like nematode lin-4, however few miRNAs in plants inhibit target genes in this way. The third way refers to binding inhibition, that is incorporating the two mechanisms in the above two ways. When miRNAs are completely complementary to target genes, they are cleaved directly. When miRNAs are not completely complementary to target genes, they participate in regulation of gene expression.
[0160] According to an embodiment of the present disclosure, the ninth nucleic acid molecule comprises a nucleic acid sequence specifically recognized by a first microRNA, and the tenth nucleic acid molecule comprises a nucleic acid sequence that specifically recognized by a second microRNA, where the first microRNA is a normal cell-specific microRNA, and the second microRNA is an abnormal cell-specific microRNA. Further, the first regulatory protein is expressed in abnormal cells and is not expressed or low-expressed in normal cells, while the second regulatory protein is expressed in normal cells and is not expressed or low-expressed in abnormal cells.
[0161] According to still another specific embodiment of the present disclosure, the first microRNA comprises at least one selected from the group consisting of miR199a, miR95, miR125, miRamir25b, Let-7, miR143, miR145 and miR200C. The microRNA as described above is expressed in normal liver cells.
[0162] According to still another specific embodiment of the present disclosure, the second microRNA comprises at least one selected from the group consisting of miR21, miR223, miR224, miR221, miR18, miR214, miR146a and miR1792 expressed in hepatoma cells (HepG2, Huh7 and PLC). The second microRNA described above is a microRNA specifically expressed in a hepatoma cell. Further, the first regulatory protein is expressed in liver cancer cells and is not expressed or low-expressed in normal cells, while the second regulatory protein is expressed in normal cells and is not expressed or low-expressed in liver cancer cells.
[0163] According to an embodiment of the present disclosure, the first nucleic acid molecule and the second nucleic acid molecule are loaded in a first expression vector; the third nucleic acid molecule, the fourth nucleic acid molecule, the fifth nucleic acid molecule, and optionally the ninth nucleic acid molecule are loaded in a second expression vector; and the sixth nucleic acid molecule, the seventh nucleic acid molecule, the eighth nucleic acid molecule, and optionally the tenth nucleic acid molecule are loaded in a third expression vector. The first, second and third expression vectors serve as a loading vector for the expression system to regulate the specific expression of the gene of interest in a suitable microenvironment, such as a cell.
[0164] The selection of the expression vector is not particularly limited as long as the function of the expression system in a suitable microenvironment can be achieved. According to a particular embodiment of the present disclosure, the first expression vector, the second expression vector and the third expression vector are each independently selected from at least one of the following:
[0165] plasmids, viruses, stable cell lines, and other material carriers such as nano-materials, liposomes, molecular-conjugated vectors, naked DNAs, chromosomal vectors and polymers. The liposome carrier is a liposome-DNA complex formed by packaging DNA with an artificial bilayer phospholipid. The liposome carrier is non-toxic and non-antigenic, has a large capacity, and can prevent target gene from nuclease degradation due to the encapsulation of liposome carrier. Such a liposome carrier can be used alone or in combination with other carriers, and target gene can be introduced into a specific site by intravenously injecting the liposome carrier encapsulating the target gene, with disadvantages of short duration of expression and unable to pass through cell membrane barrier. The molecular-conjugated vector consists of three parts: DNA, DNA binding factor and ligand.
[0166] According to an embodiment of the present disclosure, the virus comprises at least one selected from the group consisting of an adenovirus, a vaccinia virus and a retrovirus.
[0167] According to an embodiment of the present disclosure, the first expression vector, the second expression vector and the third expression vector are one same vector. According to a specific embodiment of the present disclosure, the components of the expression system in the present disclosure are loaded into the one same expression vector by the present inventors through the Cascade Golden-Gate Gibson/Gateway Assemble Method, thus effectively solving the problem of very low transfection efficiency when a plurality of large fragments are transfected.
[0168] According to an embodiment of the present disclosure, the one same vector is an adenovirus. Adenovirus as a gene therapy vector has the following advantages. 1) Adenovirus can be used on a wide range of hosts and has low pathogenicity to humans, thus adenoviral vector systems are widely used for the expression of human and non-human proteins. Further, adenoviruses can infect a range of mammalian cells and therefore can be useful in expression of recombinant proteins in most mammalian cells and tissues. It is particularly noted that adenoviruses are epitheliophilic, and most of human tumors are derived from epithelial cells. In addition, the replication genes and pathogenic genes of adenovirus are clear enough and the antibody against adenovirus has been prevalent in human populations (70-80% of adults having neutralizing antibodies against adenovirus). Humans produce slight self-limiting symptoms only after infected with wild-type adenovirus, and the treatment with ribavirin is effective. 2) Adenovirus can infect and express gene in proliferating and non-proliferating cells. Retrovirus can only infect proliferating cells, and DNA transfection cannot be performed in non-proliferating cells, thus cells are necessary to be kept in incubation. Adenovirus can infect almost all cell types, except for some lymphoma cells against adenovirus. Adenovirus is the best system for studying gene expression in non-proliferating primary cells, which allows direct comparison between the results obtained from transformed cells and primary cells. 3) Adenovirus can effectively proliferate and has a high titer. The adenovirus system can produce a titer from 10.sup.10 to 10.sup.11 VP/mlL and can be up to 10.sup.13VP/mL after concentration, thus this feature makes it very suitable for gene therapy. 4) Adenovirus is homologous to human genes. Human viruses are generally used as vectors and human cells are used as hosts for adenoviral vector systems, which provide an ideal environment for accurate post-translational processing and proper folding of human proteins. Most of human proteins can achieve high expression levels and are fully functioning. 5) Adenovirus does not integrate into chromosomes and does not cause mutagenicity after insertion. Retrovirus will be randomly integrated into the host's chromosome(s), causing gene inactivation or oncogene activation. However, adenovirus does not integrate into the chromosome in almost all known cells except for egg cells, and thus does not interfere with other genes in hosts. The egg cell integrated with a single copy of adenovirus is a good system for producing transgenic animals with specific characteristics. 6) Adenovirus can be amplified in suspension culture medium. 293 cells can be adjusted for suspension culture, thus allowing large amplification of adenovirus. A large number of facts have shown that suspension of 293 cells can express recombinant proteins in a 1-20 L bioreactor. 7) Adenovirus has the ability of expressing multiple genes simultaneously. This is the first expression system which is designed to express multiple genes in a same cell line or tissue. The simplest method for construction of the expression system comprises inserting a double-expression cassette containing two genes into an adenoviral transfer vector, or co-transfecting a cell strain of interest with different recombinant viruses to express proteins respectively. Relative co-expression of individual recombinant proteins can be correctly estimated by determining the MOI ratio of different recombinant viruses.
[0169] According to a specific embodiment of the present disclosure, the adenovirus as described above was injected into a tumor mouse model by the present inventors, with significant inhibition to the growth of mouse tumor. The adenovirus as described above can be used as a safe and effective oncolytic virus vaccine so as to specifically kill related tumors in a safe and effective way.
[0170] According to an embodiment of the present disclosure, the adenovirus is obtained by steps: removing the adenoviral E1 gene and a part of adenoviral E3 gene associated with adenoviral replication and packaging from an adenoviral vector; inserting the adenoviral E1A gene into a gene circuit by a stepwise Golden Gate method; and incorporating the gene circuit into the adenoviral vector by the Gateway or Gibson method. Specifically, the gene circuit recognizing cancer cells is inserted into an adenoviral vector by the present inventors through three steps. First, marker elements associated with distinguishing of cancer cells from normal cells (such as a tumor-specific promoter, a gene circuit-related repression element, and a cancer cell-distinguishing miRNA recognition sequence) are constructed into a primary vector plasmid, thereby forming a primary element library, where two ends of the primary elements are each inserted with the recognition site of Esp3I so as to make multiple primary elements constructed into one secondary expression system by the Golden Gate method. Second, an expression system library is constructed, where multiple primary elements selected from the primary element library are assembled into three expression systems by the Golden Gate method, such three expression systems including a tumor-specific promoter system, a first regulatory element-mediated repression system and a second regulatory element-mediated repression system, with two ends of each expression system inserted with the recognition site of BsaI endonuclease. Third, a complete gene circuit is formed by randomly assembling the three expression systems through the Golden Gate method. Two ends of the gene circuit are each inserted with Gibson homologous sequence or Gateway recognition site for further experiments. Finally, the gene circuit is constructed into an adenoviral vector (with E1 gene and part of E3 gene removed) by the Gibson or Gateway method. The method of obtaining an adenovirus as described above ensures rapid modification of a complex oncolytic adenoviral vector with large fragments.
[0171] Recombinant Virus
[0172] In a second aspect of the present disclosure, provided in embodiments is a recombinant virus. According to an embodiment of the present disclosure, the recombinant virus comprises:
[0173] a first nucleic acid molecule, comprising a tumor cell-specific promoter, the tumor cell-specific promoter being an alpha-fetoprotein-specific promoter;
[0174] a second nucleic acid molecule, operably linked to the first nucleic acid molecule and encoding a transcriptional activator, the transcriptional activator being Gal4VP16;
[0175] a third nucleic acid molecule, comprising a first recognition sequence of the transcriptional activator, the first recognition sequence being 5UAS;
[0176] a fourth nucleic acid molecule, operably linked to the third nucleic acid molecule and comprising a first promoter and a first regulatory element, wherein the first promoter is a miniCMV, and the first regulatory element comprises a plurality of repeated tetO sequences, and at least one of the pluralities of repeated tetO sequences is set downstream of the first promoter;
[0177] a fifth nucleic acid molecule, operably linked to the fourth nucleic acid molecule and encoding a first regulatory protein, the first regulatory protein being LacI,
[0178] wherein the fifth nucleic acid molecule further comprises a sequence encoding a protein of interest, the protein of interest comprises a viral replication protein and an immune effector,
[0179] wherein the immune effector and the viral replication protein are co-expressed, the immune effectors are linked by a cleavable linker peptide, the protein of interest and the first regulatory protein are regulated and co-expressed by one same promoter, and the protein of interest and the first regulatory protein are linked by a cleavable linker peptide;
[0180] a sixth nucleic acid molecule, comprising a second recognition sequence of the transcriptional activator, the second recognition sequence being 5UAS;
[0181] a seventh nucleic acid molecule, operably linked to the sixth nucleic acid molecule and comprising a second promoter and a second regulatory element, wherein the second promoter is a miniCMV, the second regulatory element comprises a plurality of repeated LacO sequences, at least one of the pluralities of repeated LacO sequences is inserted downstream of the second promoter;
[0182] an eighth nucleic acid molecule, operably linked to the seventh nucleic acid molecule and encoding a second regulatory protein, the second regulatory protein being tetR-KRAB;
[0183] a ninth nucleic acid molecule, operably linked to the fifth nucleic acid molecule and configured to conditionally inhibit expression of the first regulatory protein, wherein the ninth nucleic acid molecule comprises a nucleic acid sequence specifically recognized by a first microRNA, the first microRNA being a normal cell-specific microRNA; and
[0184] a tenth nucleic acid molecule, operably linked to the eighth nucleic acid molecule and configured to conditionally inhibit expression of the second regulatory protein, wherein the tenth nucleic acid molecule comprises a nucleic acid sequence specifically recognized by a second microRNA, the second microRNA being a tumor cell-specific microRNA,
[0185] wherein the first regulatory element is adapted to inhibit the function of the first promoter by binding to the second regulatory protein, and the second regulatory element is adapted to inhibit the function of the second promoter by binding to the first regulatory protein.
[0186] With the recombinant virus according to the embodiment of the present disclosure, the first regulatory protein Lad and the protein of interest are specifically expressed in tumor cells and the second regulatory protein tetR-KRAB is not expressed or low-expressed specifically in tumor cells under the co-regulation of the alpha-fetoprotein-specific promoter, the ninth nucleic acid molecule and the tenth nucleic acid molecule, thus the tetR-KRAB-mediated inhibition mechanism on the first promoter miniCMV is released, therefore the first regulatory protein Lad and the protein of interest are effectively expressed under the control of the first promoter miniCMV, and the function of the second promoter miniCMV is effectively inhibited via the LacI-mediated inhibition mechanism, and the expression of tetR-KRAB is further inhibited. Further, proteins (like the protein of interest E1A and the first regulatory protein Lad) are more specifically expressed in tumor cells and the proteins like the second regulatory protein tetR-KRABs are not specifically expressed in tumor cells by using the recombinant virus according to the embodiment of the present disclosure, with high efficiency and specificity.
[0187] According to an embodiment of the present disclosure, the recombinant virus is at least one selected from the group consisting of a retrovirus, an adenovirus, a herpes virus and a vaccinia virus. (1) Retroviral vector has characteristics such as a similar structure and infection process to those of common retrovirus, stable expression of gene of interest in transformed target cells, no spread after infection of target cells, high efficiency of pseudovirus in infecting target cells, and no infection of non-proliferating cells. (2) Adenoviral vector has characteristics of a wide range of hosts, no dependence on host proliferation at expression of adenoviral protein, high virus titer, stable recombinant, no induction to tumor, high safety, no envelope protein, not easily inactivated by complement, direct application in body and no integration into chromosome. (3) Herpes simplex virus vector has characteristics of high titer, large capacity, infection into both proliferating and non-proliferating cells, non-integration, and long-term existence and stable expression.
[0188] According to an embodiment of the present disclosure, the recombinant virus is an adenovirus. As mentioned above, adenovirus as a gene therapy vector has many advantages.
[0189] 1. Adenovirus is useful for a wide range of hosts and has low pathogenicity to humans, thus adenoviral vector systems are widely used for the expression of human and non-human proteins. Further, adenovirus can infect a range of mammalian cells and therefore can be useful in expression of recombinant proteins in most mammalian cells and tissues. It is particularly noted that adenoviruses are epitheliophilic, and most of human tumors are derived from epithelial cells. In addition, the replication genes and pathogenic genes of adenovirus are clear enough and the antibody against adenovirus has been prevalent in human population (70-80% of adults having neutralizing antibodies against adenovirus). Human produces slight self-limiting symptoms only after infected with wild-type adenovirus, and the treatment with ribavirin is effective.
[0190] 2. Adenovirus can infect and express gene in proliferating and non-proliferating cells. Retrovirus can only infect proliferating cells, and DNA transfection cannot be performed in non-proliferating cells, thus cells are necessary to be kept in incubation. Adenovirus can infect almost all cell types, except for some lymphoma cells against adenovirus. Adenovirus is the best system for studying gene expression in non-proliferating primary cells, which allows direct comparison between the results obtained from transformed cells and primary cells.
[0191] 3. Adenovirus can effectively proliferate and has a high titer. The adenovirus system can produce a titer from 10.sup.10 to 10.sup.11 VP/mlL and can be up to 10.sup.13VP/mL after concentration, thus this feature makes it very suitable for gene therapy.
[0192] 4. Adenovirus is homologous to human genes. Human viruses are generally used as vectors and human cells are used as hosts for adenoviral vector systems, which provide an ideal environment for accurate post-translational processing and proper folding of human proteins. Most of human proteins can achieve high expression level and are fully functioned.
[0193] 5. Adenovirus does not integrate into chromosomes and does not cause mutagenicity after insertion. Retrovirus will be randomly integrated into the host's chromosome(s), causing gene inactivation or oncogene activation. However, adenovirus does not integrate into the chromosome in almost all known cells except for egg cells, and thus does not interfere with other genes in hosts. The egg cell integrated with a single copy of adenovirus is a good system for producing transgenic animals with specific characteristics.
[0194] 6. Adenovirus can be amplified in suspension culture medium. 293 cells can be adjusted for suspension culture, thus allowing large amplification of adenovirus. A large number of facts have shown that suspension of 293 cells can express recombinant proteins in a 1-20 L bioreactor.
[0195] 7. Adenovirus has the ability of expressing multiple genes simultaneously. This is the first expression system which is designed to express multiple genes in a same cell line or tissue. The simplest method for construction of the expression system comprises inserting a double-expression cassette containing two genes into an adenoviral transfer vector, or co-transfecting a cell strain of interest with different recombinant viruses to express proteins respectively. Relative co-expression of individual recombinant proteins can be correctly estimated by determining the MOI ratio of different recombinant viruses.
[0196] According to an embodiment of the present disclosure, the immune effector comprises at least one sequence selected from the group consisting of an inhibitory sequence that antagonizes PD-1 gene, an inhibitory sequence that antagonizes PD-L1 gene, an inhibitory sequence that antagonizes CTLA4 gene, an inhibitory sequence that antagonizes Tim-3 gene, IL-2, IL-12, IL-15 and GM-CSF, or a fusion expression form of these factors. Programmed death 1 (programmed death receptor 1, PD-1) is an important immunosuppressive molecule belonging to a member of CD28 superfamily, which is originally cloned from apoptotic mouse T cell hybridoma 2B4.11. PD-1 is an important inhibitory molecule on the surface of T cells, and its intracellular domain comprises an immunoreceptor tyrosine inhibitory motif (ITIM) and an immunoreceptor tyrosine transfer motif (ITSM). ITSM mediates the recruitment of protein tyrosine phosphatase family phosphatase and the inhibition of T cell activation signals. Ligands of ITSM are PD-L1 and PD-L2, which mainly play a major role in suppressing activation of T cells in the tumor microenvironment during immune response of immune system. Programmed cell death 1 ligand (PD-L1), also known as cluster of differentiation 274 (CD274) or B7 homolog (B7 homolog 1, B7-H1), is a human protein in body that is encoded by CD274 gene. PD-L1 is expressed inductively in a variety of tumor cells and hematopoietic cells in tumor cell microenvironments, and its expression level is positively correlated with the malignancy of some tumors. PD-1 antibody and PD-L1 antibody can block the binding of PD-1 to PD-L1. However, tumor cells in tissues can escape from immune system through the PD-1/PD-L1 pathway. Cytotoxic T lymphocyte associate protein-4, short for CTLA-4, is a type of co-stimulatory molecule expressed on the surface of T cells. CTLA-4 is capable of specifically binding to CD80/CD86 on the surface of APC to activate downstream signals during activation of T cells, similar to the function of CD28. Studies have found that cells that predominantly express CTLA-4 among T cells are regulatory T cells (Treg), which is a class of T cells that negatively regulate cellular immunity. In the absence of CTLA-4 receptor, mice exhibit T cell overexpression, thus accompanied with severe autoimmune diseases. The above results show that Treg needs CTLA-4 to exercise its function. In addition, CTLA-4 is also expressed in conT cells, which plays a role in inhibiting the signaling of T cell activation. T cell immunoglobulin and mucin-domain containing molecule (TIM) gene family is a novel gene family discovered by Mclntire in 2001 in search of mouse asthma susceptibility genes, which is further identified by genomic analysis and positional cloning. The TIM family gene contains immunoglobulin V region and mucin region. TIM-3 is an important member of the TIM family and expresses a negative regulatory molecule on the surface of activated Th1 cells. Currently, it is found that TIM3 is expressed in CD8.sup.+ T cells, Th17 cells, Treg, NK cells and other lymphocyte subsets. Granulocyte-macrophage Colony Stimulating Factor (GM-CSF) is a monomeric glycoprotein cytokine secreted by macrophages, T cells, NK cells and the like, which stimulates stem cells to produce granules cells (neutrophils, eosinophils, basophils and monocytes). GM-CSF also affects mature cells in the immune system, such as inhibiting the transfer of neutrophils and altering expression of receptor on the cell surface. This factor also can inhibit fungal infections by activating macrophages. Interleukin 2 (IL-2) can mediate cytokines between white blood cells and white blood cells as well as between white blood cells and other cells. IL-2 is mainly produced by activated T cells, and acts on local target cells in a manner of autocrine and paracrine, which is a major cytokine involving in immune response, thus exhibiting a significant immune effect. IL-2 can also promote T cell proliferation and produce cytokines, promote B cell proliferation and secrete Ig, activate macrophages and enhance activation and proliferation of NK cells. In addition, IL-2 also has a negative regulation effect, which can induce apoptosis of T cells which activate Ag, limit the intensity of immune response, and avoid obvious immune damage. Interleukin-12 (IL-12) is a kind of interleukin produced by dendritic cells, macrophages, neutrophils and human B lymphoblasts (nc-37) in response to antigen stimulation. IL-12, called T cell stimulating factor, participates in the differentiation of naive cells into Th1 cells, and stimulates the production of interferon gamma (IFN-) and tumor necrosis factor alpha (TNF-). IL-12 plays an important role in regulating the activities of natural killer cells and T lymphocytes. IL-12 mediates enhanced cytotoxic activity of NK cells and CD8+ cytotoxic T lymphocytes. IL-12 also has anti-angiogenic activity, indicating it can block the formation of new blood vessels. IL-12 increases the production of gamma-interferon (INF-) thus increasing the induction of protein 10 (IP-10 or CXCL10), where IP-10 mediates anti-angiogenesis. IL-12 has been tested as a potential anti-cancer drug because of its ability of inducing immune response and anti-angiogenesis. IL-15 is a factor recently discovered which can be produced by a variety of cells, such as activated monocytes-macrophages, epidermal cells, fibroblasts and the like. The molecular structure of IL-15 is much similar to that of IL-2, thus IL-15 is capable of exerting a biological activity similar to IL-2 based on the binding of -chain and -chain of IL-2 receptor to target cells. IL-15 can induce proliferation and differentiation of B cells, which is the only cytokine that can partially replace IL-2 to induce initial antibody production. IL-15 can stimulate proliferation of T cells and NK cells, induce LAK cell activity, and can also interact with IL-12 to synergistically stimulate NK cells so as to produce IFN-.
[0197] Recombinant Cell
[0198] In a third aspect of the present disclosure, provided in embodiments is a recombinant cell. According to an embodiment of the present disclosure, the recombinant cell comprises an expression system as described above. The recombinant cell according to the embodiment of the present disclosure can effectively activate the systemic immune response in the human body, and attacks xenogeneic cells such as tumor cells, with high safety and specificity.
[0199] According to an embodiment of the present disclosure, at least a portion of the expression system is integrated into the genome of the recombinant cell. The expression system replicates as the recombinant cell genome replicates, and the expression system can regulate the expression of proteins of interest constantly and effectively.
[0200] Use in the Preparation of a Medicament
[0201] In a fourth aspect of the present disclosure, provided in embodiments is use of the aforementioned expression system, the aforementioned recombinant virus, and the aforementioned recombinant cell in the preparation of a medicament for treating a cancer. The expression system described in the present disclosure can specifically express a protein of interest in tumor cells. The drug according to the embodiment of the present disclosure can treat cancers in a more effective, specific and safer way. In this embodiment, the present inventors have designed a gene circuit in response to multiple targets to regulate the expression of the key gene E1A associated with adenoviral transcription according to the concept of synthetic biology. At the same time, such a co-expression can activate cytokine or antibody gene which is related to a systemic immune response. First, the gene circuit designed by the present inventors can regulate the packaging of adenoviruses at multiple levels, unlike traditional oncolytic adenoviruses. In the first step, a tumor-specific promoter is used by the present inventors to regulate the expression of the master switch Gal4VP16 in the gene circuit. In the second step, the target sequence of microRNA in the gene circuit can distinguish tumor cells from non-tumor cells in response to microRNA expression in different cell lines. In the third step, a stable mutually repressive switch is used in the designed gene circuit by the present inventors, which can efficiently respond to external input signals such as cell-specific promoters and microRNA signals, and the gene circuit can further enlarge the difference of input signals and be more efficient in distinguishing tumor cells from non-tumor cells. In the fourth step, the expression system in the adenoviral vector designed by the present inventors does not comprise the adenoviral E1B gene, where the E1B gene can interact with the P53 gene in normal cells to ensure the successful adenovirus proliferation in normal cells. The adenovirus without the E1B gene could not proliferate in normal cells expressing P53, while it can still efficiently proliferate in tumor cells lacking the P53 gene. Therefore, the adenoviral vector in the embodiment is more specific and safer than the traditional oncolytic adenovirus through multi-level regulation. In addition, this engineered adenovirus is used as a vector to carry genes expressing a variety of cytokines and antibodies in the embodiment. Thus, the adenovirus not only exhibits the oncolytic effect, but also can activate the systemic immune response by using the co-expressed factors, with improved efficacy of oncolytic adenovirus.
[0202] Specifically, the present application constructs a gene circuit to regulate the specific expression and packaging of oncolytic adenovirus in hepatocellular carcinoma cells by synthetic biology means. Except for having oncolytic efficacy, the adenovirus constructed by the present inventors is also loaded with genes expressing cytokines which can activate immune response in the body. Such a cytokine once expressed can stimulate immune response inhibiting tumor growth to treat tumors. The expression system designed in the present application has great innovation and technical advantages as follows.
[0203] Efficient and safe: The gene circuit designed in this application can respond to biomarkers distinguishing normal cells from cancer cells at multi-levels and comprises a mutually repressive close-loop gene circuit to regulate the replication of adenovirus in different cells, thus is capable of responding to microenvironments in different cell lines more sensitively while reducing the effects of gene expression noise.
[0204] Efficient: The gene circuit in this application is loaded with genes expressing a variety of cytokines and/or antibodies, thus an effective immune response can be induced in the cells of interest.
[0205] Modularization of gene circuit: Biomarkers involved in the gene circuit are modularized to modules, which are each modelled into different module libraries containing biomarkers against different diseases, thus a disease-specific gene circuit can be constructed by assembling relative modules rapidly.
[0206] Accuracy: It is possible for inventors to replace different tumor markers based on rapid assembly technology, thus gene circuits directing different patients can be designed for precise treatment.
[0207] According to an embodiment of the present disclosure, the cancer comprises liver cancer, lung cancer, colorectal cancer, melanoma, breast cancer or prostate cancer. The inventors have found that the drug in the embodiment of the present disclosure has a more remarkable therapeutic effect on liver cancer, lung cancer, colorectal cancer, melanoma, breast cancer and prostate cancer.
[0208] According to a specific embodiment of the present disclosure, the inventors have found that the expression of microRNAs in different tumor cell lines is shown in Table 1. The upward arrow indicates microRNAs that are highly expressed in cancer cells compared to normal cells, while the downward arrow indicates microRNAs that are low-expressed in cancer cells compared to normal cells.
TABLE-US-00005 TABLE 1 Hepatocellular carcinoma miR-21, 18, 224, 199, 195, 200, 125 Lung cancer Let-7, miR-17-92 Breast cancer miR125b, 145, 21, 155 Brain tumor miR-21, 221, 181, Colorectal cancer miR143, 145 Lymphoma miR155, miR-17-92 Melanoma miR21, 221, 214146a137200clet-7
[0209] Method of Expressing a Protein of Interest by Using an Expression System
[0210] In a fifth aspect of the present disclosure, provided in embodiments is a method of expressing a protein of interest by using an expression system. The expression system is the expression system as described above. According to an embodiment of the present disclosure, the method comprises: (1) providing a fifth nucleic acid molecule which comprises a nucleic acid sequence encoding the protein of interest; and (2) inhibiting expression of a second regulatory protein by a tenth nucleic acid molecule so as to express the protein of interest. With the method of expressing a protein of interest by using an expression system in the embodiment, the second regulatory protein-mediated inhibition mechanism on the first promoter is released, thus the protein of interest is effectively expressed in specific cells under the co-action of the cell-specific promoter and the first promoter.
[0211] According to an embodiment of the present disclosure, the expression is carried out in cells. The cells can provide a microenvironment for the expression of proteins of interest, thus the proteins of interest can be expressed in cells more efficiently.
[0212] According to an embodiment of the present disclosure, the tenth nucleic acid molecule comprises a nucleic acid sequence specifically recognized by the second microRNA, and the method further comprises contacting the second microRNA with the tenth nucleic acid molecule in the step (2). MicroRNAs (miRNAs) are a class of endogenous small RNAs having about 20-24 nucleotides, and several miRNAs can regulate one same gene. The expression of a gene can be finely regulated by a combination of several miRNAs. MicroRNA has many forms, including a pri-miRNA in an original form, which is of a length of about 300-1000 bases; a pre-miRNA, in a form of microRNA precursor, which is formed by processing of the pri-miRNA and is of a length of about 70-90 bases; and a mature miRNA of about 20 to 24 nt, which is generated by digestion of the pre-miRNA with Dicer. The RNA-induced silencing complex (RISC) inhibits the expression of target genes. The effect of microRNA-RISC on target gene mRNA has always been largely dependent on the complementation degree between the microRNA-RISC and the target gene transcript sequence, which is performed in three ways. In a first way, the mRNA molecules of target gene are cleaved, that is the miRNAs which are completely complementary to target gene (having closely similar mechanism and function to those of siRNAs) are cleaved. In plants, most of miRNAs of target genes are cleaved by the method described above, and the molecules without poly(A) are added with Uracils (Us) at the 3 end and are rapidly degraded while the molecules with poly(A) can be stably present for a time period (such as Arabidopsis miR-171). Currently, one miRNA is found to be completely complementary to three potential target genes in plants, even although it is unclear whether these genes are targets of the miRNA. However, it is found for the first time that miRNA can be completely complementary to its potential targets, suggesting miRNA may have a mechanism similar as siRNA. In a second way, the translation of target gene is inhibited. MiRNAs are not completely complement to target genes, thus inhibiting the translation of target genes, without affecting the stability of mRNAs. Such a miRNA is the most widely discovered miRNA, like nematode lin-4, however few miRNAs in plants inhibit target genes in this way. The third way refers to binding inhibition, that is incorporating the two mechanisms in the above two ways. When miRNAs are completely complementary to target genes, they are cleaved directly. When miRNAs are not completely complementary to target genes, they participate in regulation of gene expression.
[0213] In a sixth aspect of the present disclosure, provided in embodiments is a method of expressing a protein of interest by using an expression system. The expression system is the expression system as described above. According to an embodiment of the present disclosure, the method comprises: (1) providing an eighth nucleic acid molecule which comprises a nucleic acid sequence encoding a first protein of interest, and providing a fifth nucleic acid molecule which comprises a nucleic acid sequence encoding a second protein of interest; and (2) inhibiting expression of the first regulatory protein by the ninth nucleic acid molecule so as to express the first protein of interest; or inhibiting expression of the second regulatory protein by the tenth nucleic acid molecule so as to express the second protein of interest. With the method of expressing a protein of interest by using an expression system in the embodiment, the second regulatory protein-mediated inhibition mechanism on the first promoter is released, thus the second protein of interest is effectively expressed in specific cells under the coaction of the cell-specific promoter and the first promoter, or the first regulatory protein-mediated inhibition mechanism on the second promoter is released, thus the first protein of interest is effectively expressed in specific cells under the coaction of the cell-specific promoter and the second promoter.
[0214] Experimental embodiments of the present disclosure are described in detail below. The embodiments described below are illustrative only and are not to be construed as limiting the present disclosure. Where specific techniques or conditions are not indicated in the examples, they are carried out according to the techniques or conditions described in the literature in the art or in accordance with the product specifications. The used reagents or instruments not indicated by the manufacturer are all conventional products that can be obtained commercially.
[0215] Experimental Materials and Methods
[0216] 1. Cell Culture and Transfection
[0217] HEK293 (293-H) cell line was purchased from Invitrogen Co., Ltd. Human hepatoma cell line HepG2, normal liver cells Chang and Hepa1-6 were purchased from ATCC. Human hepatoma cell line Huh7 was purchased from BeNa Co., Ltd. The cells were cultured in high-glucose Dulbecco's Modified Eagle's Medium containing 4.5 g/L glucose, 0.045 unit/mL penicillin, 0.045 g/mL streptomycin and 10% FBS (purchased from the Invitrogen Co., Ltd.) (i.e. DMEM complete medium) at 37 C., 100% humidity and 5% CO.sub.2 concentration.
[0218] Cell transfection was conducted as follows. About 7.510.sup.4 HEK293 cells in 0.5 mL of the high-glucose DMEM complete medium were seeded into individual wells of 24-well plates (Falcon) and incubated for 24 hours, followed by replacing the medium with fresh DMEM complete medium and addition of Attractene transfection reagent (Qiagen) or Lipofectamine LTX (Life Technologies) for transfection. Specifically, 1.5 L of Attractene was added into an amount of mixed DNA plasmids, stood at room temperature for 15 minutes, and then added into corresponding wells if Attractene was used. However, if Lipofectamine LTX was used, an appropriate amount of Plus reagent was firstly added into mixed DNA plasmids and stood at room temperature for 5 minutes, then 1.25 L of Lipofectamine LTX was added and stood at room temperature for another 25 minutes prior to transferred into the 24-well plates. pDT7004 (pUBI-linker-NOS), which contains a maize ubiquitin promoter (UBI) followed by a NOS terminator with no protein-coding sequences between UBI and NOS, was used to ensure that the amount of plasmid DNA in different experiment groups was equal. Cells after transfection were cultured for 48 hours before flow cytometry analysis or some experiments related to cytokine detection.
[0219] 2. Adenoviral Vector
[0220] Two initial adenoviral vector sequences are used in this example, that is ViraPower Adenoviral Gateway Expression Kit (K49300 Invitrogen) and Adeno-X-Adenoviral System 3 (632266 Clontech). The structures of the two adenoviral vectors are shown in
[0221] 3. Plasmid Construction
[0222] The plasmids related to truncated AFP promoter derivatives were constructed. AFP enhancer and AFP promoter sequences were directly obtained from the genome of hepatoma cell line under specifically designed PCR primers via PCR amplification. Point mutations in the AFP promoter sequence were obtained by using the overlap extension PCR method. The AFP enhancer and AFP promoter sequences were constructed into an entry clone, with a specifically designed recognition sequence of LR Clonase at both ends of the entry clone. The specific promoter and the activator gene Gal4VP16 were constructed into one same vector by the LR reaction. The target sequence of microRNA was inserted into the CMV-EYFP vector (XbaI/SalI) through primer annealing, enzyme digestion and ligation. The primary element library of the expression system was constructed through the Golden Gate method. The type IIs restriction enzyme (such as BsaI, BbsI, BsmBI, SapI and the like) is a specific class of restriction enzyme where its recognition site is a non-palindromic and symmetrical sequence and its cleavage site is located outside the recognition site, which is different from the type II restriction enzyme most commonly used in molecular biology where its recognition site is a palindromic and symmetrical sequence and its cleavage site overlaps with the recognition sequence. Thus, when two fragments digested by the type IIs restriction enzyme are ligated in subsequent digestion and ligation reactions, they will not be cleaved again due to the absence of previous recognition sites, thus achieving the effect of welding. For the Golden Gate cloning method, different cleavage site sequences are artificially designed outside the recognition sequences because of such a characteristic of the type IIs restriction enzyme, by which one same type IIs restriction enzyme is capable of generating different sticky ends, thereby ensuring of assembling multiple fragments at one time, and thus overcoming the deficiency of traditional multi-fragment assembly such as use of multiple different restriction enzymes. The biggest feature of this Golden Gate cloning method is in that no additional scar is introduced and thus achieving the seamless ligation of DNA fragments, compared with the traditional digestion-ligation method. The type IIs restriction enzyme used in the primary element library in this example is Esp3I. A second logic circuit library of the expression system was also constructed by the Golden Gate method, with the type IIs restriction enzyme BsaI used. The second logic circuit was then inserted into the adenoviral vector sequence of the ViraPower Adenoviral Gateway Expression Kit by the Gateway method, or inserted into the adenoviral vector sequence of Adeno-X Adenoviral System 3 by Gibson cloning. The Gateway technique is based on the well-studied phage site-specific recombination system (attBattP.fwdarw.attLattR), which consists of BP and LR reactions. The BP reaction is a recombination reaction between an attB DNA fragment or an expression clone and an attP donor vector, thus creating an entry clone. The LR reaction is a recombination reaction between an attL entry clone and an attR destination vector, which is used to insert a sequence of interest into one or more destination vectors in parallel reactions. The present inventors employed the LR reaction in this example. Gibson assembly technique, also known as Gibson thermostatic one-step assembly method, is a DNA assembly method created by Gibson et al. at the J. CraigVenter Institute in the United States of America, where a plurality of DNA fragments having overlapping end sequences are assembled in vitro under the synergistic effect of T5 exonuclease, DNA polymerase and ligase. Among them, T5 exonuclease has 5.fwdarw.3 exonuclease activity, and can cleave the DNA fragment having overlapping end sequences from the 5 end of one strand of the DNA fragment, thus generating an overhanging end having the overlapping sequence at the 3 end of the complementary strand which is specifically annealed at 50 C. (T5 exonuclease is gradually inactivated at this temperature), and finally a complete DNA molecule is formed in the presence of DNA polymerase and Taq ligase, achieving seamless assembly.
[0223] 4. Cellular RNA Extraction, Reverse Transcription and Quantitative PCR Reaction
[0224] Cellular RNA was extracted by the Trizol method. 1 mL of Trizol was added into 510.sup.6 cells pelleted by centrifugation, followed by repeatedly pipetting with a pipette or vigorous shaking to lyse cells. After standing at room temperature of 15-30 C. for 5 minutes, 0.2 mL of chloroform was added, and the mixture was shaken vigorously for 15 seconds, kept at room temperature for another 2 to 3 minutes, and centrifuged at 12,000g and 4 C. for 15 minutes. 0.5 mL of isopropanol was added into the separated upper aqueous layer, left at room temperature for 10 minutes, and centrifuged at 12,000g and 4 C. for 10 minutes, followed by adding 1 mL of 75% ethanol, vortexed and centrifugation at 7500g and 4 C. for 5 minutes. The supernatant was discarded, and the precipitated RNA was naturally dried at room temperature. The dried RNA was dissolved in RNase-free water. The reverse transcription experiment was performed by using the QuantiTect Rev. Transcription Kit (Cat No./ID: 205310 QIAGEN). The quantitative PCR primers are qAFP for: CAAAGCTGAAAATGCAGTTGAATG (SEQ ID NO: 15), qAFP rev: TTCCCCATCCTGCAGACAATCC (SEQ ID NO: 16), GAPDH for: AGAAGGCTGGGGCTCATTTG (SEQ ID NO: 17), and GAPDH rev: AGGGGCCATCCACAGTCTTC (SEQ ID NO: 18). Fluorescent dye is PowerUp SYBR Green Master Mix (A25741Thermo Fisher).
[0225] 5. Packaging, Purification and Titration of Adenovirus
[0226] The endotoxin-free recombinant adenoviral plasmid with high purity was extracted. HEK293 cells were transfected with the linearized adenovirus DNA which was digested by PacI overnight, followed by replacing the culture medium with the complete medium. Cells along with 1 mL of culture medium were collected into a 15 mL centrifuge tube after one week of culture (fresh medium added depending on the cell growth state during the culture), which were then lysed with three consecutive freeze-thaw cycles at 37 C. via liquid nitrogen, and centrifuged at 2000 rpm for 5 minutes. The supernatant was obtained as the primary virus solution. After three consecutive generations of transfection, the obtained adenoviruses were seeded into 10 of 15 cm plates for amplification, and further purified by the combination of CsCl density gradient centrifugation and dialysis. The CsCl density gradient was prepared by adding 2 mL of a CsCl solution in a density of 1.4 g/mL, further adding 3 mL of a CsCl solution in a density of 1.3 g/mL slowly, and then adding 5 mL of the virus suspension. After centrifugation at 20000 rpm and 4 C. for 10 hours, the adenoviruses concentrated in the CsCl solution in a density between 1.3 g/mL and 1.4 g/mL were collected into dialysis bags which have been boiled with 10 mM EDTA-Na.sub.2 for 10 minutes before use. The dialysis buffer is prepared by using 50 g sucrose, 10 mL 1 M Tris-HCl and 2 mL 1 M MgCl.sub.2, made up to 1 L with water and adjusted to pH 8.0. After stirring at 4 C. overnight and changing the dialysis buffer twice, the adenovirus was collected for determination of virus titer. The viral titer was detected by quantifying the viral DNA extracted from the infected cells. Specifically, about 210.sup.6 HeLa cells/well were seeded into 6-well tissue culture plates (with the cell coverage rate reaching up 90-100% after one day of incubation) and infected with 5 L of the virus stock diluted with 500 L of serum-free medium in duplicate, followed by incubation at 37 C. for 3 to 6 hours, removal of culture medium, and washed twice with 1 mL PBS. The cells were lysed by adding 500 L of fresh NP-40 lysis buffer (including 0.65% NP-40 (Calbiochem, Billerica, Mass., USA), 150 mM NaCl, 10 mM Tris, pH 8.0), incubating at room temperature for 5-10 minutes with pipetting up and down 10-15 times for fully lysis, and then centrifuging at 2000g for 3 minutes for virus precipitation. After the supernatant was discarded, 1 mL of NP-40 lysis buffer was added followed by vortexed briefly and centrifugation at 2000g for 3 minutes. The supernatant was discarded again and the precipitate was suspended in 200 L of PBS. During the DNA isolation and purification, DNAs were extracted by using the DNeasy Blood & Tissue Kit (QIAgen, Valencia, Calif., USA) for subsequent quantitative reactions. The quantitative primers are L2 Forward Primer: TTGTGGTTCTTGCAGATATGGC (SEQ ID NO: 19), and L2 Reverse Primer: TCGGAATCCCGGCACC (SEQ ID NO: 20).
[0227] A standard curve was prepared. The PCR L2 target sequence was constructed into T vectors, which were diluted to 110.sup.9 to 110.sup.2 copy/L as a standard sequence. The dilution formula is shown as: [Plasmid concentration (g/L)Avogadro's number10-6]/[number of nucleotideslbp molecular weight]=particle copies/L
[0228] 6. Cell Experiment
[0229] Adenovirus was detected for its recognition and killing abilities to different cells. Chang cells (110.sup.4 cells/well), and HepG2 and Huh7 cells (510.sup.4 cells/well respectively) were seeded into 96-well plates and infected with adenoviral vectors at seven Multiplicity of Infection (MOI) gradients in ten-fold dilutions from 10.sup.2 to 10.sup.4, with cell viability measured by the MTS method after six days of observation.
[0230] 7. MTS Detection
[0231] The number of cells was measured by the MTS method. 20 L of MTS/PMS mixture (Promega) was added to individual wells of 96-well plates containing the cells to be tested, then mixed, and incubated at 37 C. for 1 to 4 hours. The plate was shaken for 10 seconds after color development to get uniform color. The absorbance (OD value) at a wavelength of 490 nm was measured by using a microplate reader. A standard curve was established. The number of cells of interest was detected by reference of the standard curve.
[0232] 8. Cytokine Detection
[0233] The biological activity of cytokines can be detected via proliferation of cytokine-dependent cell line. The biological activities of IL-2, mGM-CSF and hGM-CSF were detected by using CTLL-2, FDC-P1 and TF-1 cell lines, respectively. After collected, 110.sup.4 cytokine-dependent cells to be tested were seeded in 96-well plates, infected with the sample containing the cytokine to be tested, and thermostatically cultured at 37 C. for 24 hours or 48 hours. The amplified cells were measured by the MTS method. A dose-proliferation standard curve was established. The bioactivity of cytokine in the measured sample was estimated by using the standard curve.
[0234] 9. Co-Immunoprecipitation Assay
[0235] Co-immunoprecipitation was performed as follows. An appropriate amount of protein lysis buffer (Biyuntian Co., Ltd.) was added into the collected cells to be tested, and centrifuged to remove cell debris. A small amount of the protein lysis buffer was left for subsequent Western blot analysis. The remaining protein lysis buffer plus 10-30 L of protein A/G-agarose beads conjugated with corresponding tag antibody (Thermo Fisher Scientific Co., Ltd.) was added into the obtained cell lysate, and incubated at 4 C. overnight with slightly shaking, then centrifuged to remove the supernatant. After the precipitated beads were washed three times, the antibody and captured protein were eluted from the agarose beads by using an eluent, followed by addition of SDS-PAGE loading buffer (Shanghai Shenggong Co., Ltd.) and boiled. The enrichment of related proteins was detected by the Western blot method.
[0236] 10. Animal Studies
[0237] The experimental animals were purchased from HuafuKang Co., Ltd. or Weitonglihua Co., Ltd. The tumor model was constructed by using 6-week old male or female mice, kept in SPF environment. For the human tumor model, six-week old nude mice were subcutaneously injected with 110.sup.7 human hepatoma cells HepG2 in matrigel (BD Co., Ltd.) on the right flank. For the mouse tumor model, 110.sup.6 mouse hepatoma cells Hepa1-6 were subcutaneously injected into the right flank of six-week old wild-type C57BL/6J mice. Subcutaneous tumor size was measured by vernier calipers every 3 days, and calculated by using the formula: Volume=0.5lengthwidth. After tumor volume exceeded 100 mm.sup.3, oncolytic adenoviruses or control treatment was administrated. Tumor-bearing mice were euthanized after the tumor size reached 15 mm in diameter, according to the requirements of animal experiment ethics.
[0238] Experimental Results
[0239] 1. Construction of Mutually Repressive Switch in Response to Various Biomarkers to Distinguish Cancer Cells from Non-Cancer Cells by Use of Synthetic Biology
[0240] Related studies in recent years have shown that oncolytic viruses are very effective for treating a cancer, thus many clinical studies on oncolytic adenovirus have been developed. According to the existing clinical research results, there is a relatively high proportion of leakage on oncolytic adenovirus, so how to improve the safety of oncolytic adenovirus in clinical stage is an important issue. Based on the analysis of existing oncolytic adenoviruses, most oncolytic adenoviruses are regulated depending on a single biomarker, such as a tumor-specific promoter that regulates the expression of gene E1 key to adenoviral replication. However, only one single biomarker may cause a relatively high probability of leakage. Therefore, the present inventors have designed a mutually repressive switch in response to a variety of biomarkers and to regulate the expression of adenovirus E1A gene at various levels in this example, thereby improving the specificity of the oncolytic adenovirus on recognition and enhancing safety.
[0241] As shown in
[0242] 2. Verification and Analysis of Biomarkers Distinguishing Hepatoma Cells from Normal Cells
[0243] 2.1 Construction of Hepatoma-Specific Alpha-Fetoprotein (AFP) Promoter
[0244] Alpha-fetoprotein (FP or AFP) is mainly synthesized in liver of a fetus, which is not expressed in a normal adult, however it will be expressed again when liver cells become cancerous, and the amount of AFP in serum will increase dramatically with the progress of liver cancer. At present, alpha-fetoprotein is a specific clinical indicator for the diagnosis of primary liver cancer, thus the inventors selected the alpha-fetoprotein promoter as a promoter marker for distinguishing hepatoma cells from non-hepatoma cells in the example.
[0245] The inventors further detected the specific expression of AFP by experiments. First, the expression of human AFP gene in a series of non-hepatoma cells and hepatoma cells was detected by the qPCR method. As shown in
[0246] The currently widely used AFP promoter consists of an enhancer and a promoter. The enhancer contains two sequences which can activate the promoter, i.e. domain A (DA) and domain B (DB). In order to increase the efficiency of the promoter, the inventors mutated guanine (G) at position-119 of the promoter to adenine (A). In addition, the enhancer region was truncated to different extent by the inventors. As shown in
TABLE-US-00006 (SEQIDNO:21) TTTAGAAATATGGGGGTAGGGGTGGTGGTGGGGCCTGGATAAAGCTGAGTGGTAT GAATGAGTTAGAAATATGGGGGTAGGGGTGGTGGTGGTAATTCTGTTTTCTCCCCATAG GTGAGATAAGCATTGGGTTAAATGTGCTTTCTCTCTCTCCCTCTCCTTTCTTAAGAATTA AGGGACAGACTATGGGCTGGAGGACTTTGAGGATGTCTGTCTCATAACACTTGGG TTGTATCTGTTCTATGGGGCTTGTTTTAAGCTTGGCAACTTGCAACAGGGTTCACTGAC TTTCTCCCCAGGCCCAAGGTACTGTCCTCTTTTCATATCTGTTTTGGGGCCTCTGGGGC AATATCTGAGAAAATATAAACATTTCAATAATGTTCTGTGGTGAGATGAGTATGAGAGA TGTGTCATTCATTTGTATCAATGAATGAATGAGGACAATTAGTGTATAAATCCTTAGTAC AACAATCTGAGGGTAGGGGTGGTACTATTCAATTTCTATTTATAAAGATACTTATTTCTAT TTATTTATGCTTGTGACAAATGTTTTGTTCGGGACCACAGGAATCACAAAGATGAGTCT TTGAATTTAAGAAGTTAATGGTCCAGGAATAATTACATAGCTTACAAATGACTATGATAT ACCATCAAACAAGAGGTTCCATGAGAAAATAATCTGAAAGGTTTAATAAGTTGTCAAA GGTGAGAGGGCTCTTCTCTAGCTAGAGACTAATCAGAAATACATTCAGGGATAATTATT TGAATAGACCTTAAGGGTTGGGTACATTTTGTTCAAGCATTGATGGAGAAGGAGAGTG AATATTTGAAAACATTTCAACTAACCAACCACCCAATCCAACAAACAAAAAATGAAAA GAATCTCAGAAACAGTGAGATAAGAGAAGGAATTTTCTCACAACCCACACGTATAGCT CAACTGCTCTGAAGAAGTATATATCTAATATTTAACACTAACATCATGCTAATAATGATAA TAATTACTGTCATTTTTTAATGTCTATAAGTACCAGGCATTTAGAAGATATTATTCCATTTA TATATCAAAATAAACTTGAGGGGATAGATCATTTTCATGATATATGAGAAAAATTAAAAA TCAGATTGAATTATTTGCCTGTCATACAGCTAATAATTGACCATAAGACAATTAGATTTA AATTAGTTTTGAATCTTTCTAATACCAAAGTTCAGTTTACTGTTCCATGTTGCTTCTGAG TGGCTTCACAGACTTATGAAAAAGTAAACGGAATCAGAATTACATCAATGCAAAAGCA TTGCTGTGAACTCTGTACTTAGGACTAAACTTTGAGCAATAACACATATAGATTGAGGA TTGTTTGCTGTTAGTATACAAACTCTGGTTCAAAGCTCCTCTTTATTGCTTGTCTTGGAA AATTTGCTGTTCTTCATGGTTTCTCTTTTCACTGCTATCTATTTTTCTCAACCACTCACAT GGCTACAATAACTGTCTGCAAGCTTATGATTCCCAAATATCTATCTCTAGCCTCAATCTT GTTCCAGAAGATAAAAAGTAGTATTCAAATGCACATCAACGTCTCCACTTGGAGGGCT TAAAGACGTTTCAACATACAAACCGGGGAGTTTTGCCTGGAATGTTTCCTAAAATGTG TCCTGTAGCACATAGGGTCCTCTTGTTCCTTAAAATCTAATTACTTTTAGCCCAGTGCTC ATCCCACCTATGGGGAGATGAGAGTGAAAAGGGAGCCTGATTAATAATTACACTAAGT CAATAGGCATAGAGCCAGGACTGTTTGGGTAAACTGGTCACTTTATCTTAAACTAAATA TATCCAAAACTGAACATGTACTTAGTTACTAAGTCTTTGACTTTATCTCATTCATACCAC TCAGCTTTATCCAGGCCTCTAGAAGTTTGAGGAGAATATTTGTTATATTTGCAAAATAAA ATAAGTTTGCAAGTTTTTTTTTTCTGCCCCAAAGAGCTCTGTGTCCTTGAACATAAAAT ACAAATAACCGCTATGCTGTTAATTATTGACAAATGTCCCATTTTCAACCTAAGGAAATA CCATAAAGTAACAGATATACCAACAAAAGGTTACTAGTTAACAGGCATTGCCTGAA AAGAGTATAAAAGAATTTCAGCATGATTTTCCATATTGTGCTTCCACCACTGCCAATAA CAAAATAACTAGCAA. (SEQIDNO:22) CAGATTGAATTATTTGCCTGTCATACAGCTAATAATTGACCATAAGACAATTAGATT TAAATTAGTTTTGAATCTTTCTAATACCAAAGTTCAGTTTACTGTTCCATGTTGCTTCTG AGTGGCTTCACAGACTTATGAAAAAGTAAACGGAATCAGAATTACATCAATGCAAAAG CATTGCTGTGAACTCTGTACTTAGGACTAAACTTTGAGCAATAACACATATAGATTGAG GATTGTTTGCTGTTAGTATACAAACTCTGGTTCAAAGCTCCTCTTTATTGCTTGTCTTGG AAAATTTGCTGTTCTTCATGGTTTCTCTTTTCACTGCTATCTATTTTTCTCAACCACTCAC ATGGCTACAATAACTGTCTGCAAGCTTATGATTCCCAAATATCTATCTCTAGCCTCAATC TTGTTCCAGAAGATAAAAAGTAGTATTCAAATGCACATCAACGTCTCCACTTGGAGGG CTTAAAGACGTTTCAACATACAAACCGGGGAGTTTTGCCTGGAATGTTTCCTAAAATGT GTCCTGTAGCACATAGGGTCCTCTTGTTCCTTAAAATCTAATTACTTTTAGCCCAGTGCT CATCCCACCTATGGGGAGATGAGAGTGAAAAGGGAGCCTGATTAATAATTACACTAAG TCAATAGGCATAGAGCCAGGACTGTTTGGGTAAACTGGTCACTTTATCTTAAACTAAAT ATATCCAAAACTGAACATGTACTTAGTTACTAAGTCTTTGACTTTATCTCATTCATACCA CTCAGCTTTATCCAGGCCACTTATTTGACAGTATTATTGCGAAAACTTCCTATCTAGAAG TTTGAGGAGAATATTTGTTATATTTGCAAAATAAAATAAGTTTGCAAGTTTTTTTTTTCT GCCCCAAAGAGCTCTGTGTCCTTGAACATAAAATACAAATAACCGCTATGCTGTTAATT ATTGACAAATGTCCCATTTTCAACCTAAGGAAATACCATAAAGTAACAGATATACCAAC AAAAGGTTACTAGTTAACAGGCATTGCCTGAAAAGAGTATAAAAGAATTTCAGCATGA TTTTCCATATTGTGCTTCCACCACTGCCAATAACAAAATAACTAGCAA. (SEQIDNO:23) CAGATTGAATTATTTGCCTGTCATACAGCTAATAATTGACCATAAGACAATTAGATT TAAATTAGTTTTGAATCTTTCTAATACCAAAGTTCAGTTTACTGTTCCATGTTGCTTCTG AGTGGCTTCACAGACTTATGAAAAAGTAAACGGAATCAGAATTACATCAATGCAAAAG CATTGCTGTGAACTCTGTACTTAGGACTAAACTTTGAGCAATAACACATATAGATTGAG GATTGTTTGCTGTTAGTATACAAACTCTGGTTCAAAGCTCCTCTTTATTGCTTGTCTTGG AAAATTTGCTGTTCTTCATGGTTTCTCTTTTCACTGCTATCTATTTTTCTCAACCACTCAC ATGGCTACAAAAGCTTCCTGATTAATAATTACACTAAGTCAATAGGCATAGAGCCAGGA CTGTTTGGGTAAACTGGTCACTTTATCTTAAACTAAATATATCCAAAACTGAACATGTAC TTAGTTACTAAGTCTTTGACTTTATCTCATTCATACCACTCAGCTTTATCCAGGCCACTTA TTTGACAGTATTATTGCGAAAACTTCCTATCTAGAAGTTTGAGGAGAATATTTGTTATAT TTGCAAAATAAAATAAGTTTGCAAGTTTTTTTTTTCTGCCCCAAAGAGCTCTGTGT CCTTGAACATAAAATACAAATAACCGCTATGCTGTTAATTATTGACAAATGTCCCATTTT CAACCTAAGGAAATACCATAAAGTAACAGATATACCAACAAAAGGTTACTAGTTAACA GGCATTGCCTGAAAAGAGTATAAAAGAATTTCAGCATGATTTTCCATATTGTGCTTCCA CCACTGCCAATAACAAAATAACTAGCAA. (SEQIDNO:24) CAGATTGAATTATTTGCCTGTCATACAGCTAATAATTGACCATAAGACAATTAGATT TAAATTAGTTTTGAATCTTTCTAATACCAAAGTTCAGTTTACTGTTCCATGTTGCTTCTG AGTGGCTTCACAGACTTATGAAAAAGTAAACGGAATCAGAATTACATCAATGCAAAAG CATTGCTGTGAACTCTGTACTTAGGACTAAACTTTGAGCAATAACACATATAGATTGAG GATTGTTTGCTGTTAGTATACAAACTCTGGTTCAAAGCTCCTCTTTATTGCTTGTCTTGG AAAATTTGCTGTTCTTCATGGTTTCTCTTTTCACTGCTATCTATTTTTCTCAACCACTCAC ATGGCTACAAAAGCTTTCTAGAAGTTTGAGGAGAATATTTGTTATATTTGCAAAATAAA ATAAGTTTGCAAGTTTTTTTTTTCTGCCCCAAAGAGCTCTGTGTCCTTGAACATAAAAT ACAAATAACCGCTATGCTGTTAATTATTGACAAATGTCCCATTTTCAACCTAAGGAAATA CCATAAAGTAACAGATATACCAACAAAAGGTTACTAGTTAACAGGCATTGCCTGAAAA GAGTATAAAAGAATTTCAGCATGATTTTCCATATTGTGCTTCCACCACTGCCAATAACA AAATAACTAGCAA. (SEQIDNO:25) CCTGATTAATAATTACACTAAGTCAATAGGCATAGAGCCAGGACTGTTTGGGTAAA CTGGTCACTTTATCTTAAACTAAATATATCCAAAACTGAACATGTACTTAGTTACTAAGT CTTTGACTTTATCTCATTCATACCACTCAGCTTTATCCAGGCCACTTATTTGACAGTATTA TTGCGAAAACTTCCTATCTAGAAGTTTGAGGAGAATATTTGTTATATTTGCAAAATAAAA TAAGTTTGCAAGTTTTTTTTTTCTGCCCCAAAGAGCTCTGTGTCCTTGAACATAAAATA CAAATAACCGCTATGCTGTTAATTATTGACAAATGTCCCATTTTCAACCTAAGGAAATAC CATAAAGTAACAGATATACCAACAAAAGGTTACTAGTTAACAGGCATTGCCTGAAAAG AGTATAAAAGAATTTCAGCATGATTTTCCATATTGTGCTTCCACCACTGCCAATAACAA AATAACTAGCAA.
[0247] 2.2 Construction of microRNA (miRNA) Fluorescent Plasmid Reporter System for Detection of Expression Levels of Different Cell Lines
[0248] Recent research shows that the formation and growth of a tumor will greatly change the expression level of microRNA (miRNA). As shown in Table 1, various microRNAs are highly expressed in different cancer cells. The inventors selected miR199a as a microRNA marker to characterize the high expression of normal hepatocytes, and correspondingly selected miR21 and miR122 as microRNA markers to characterize the high expression of hepatoma cells based on the analysis of the known research results. First, the inventors have designed and constructed a microRNA fluorescent plasmid reporter system. As shown in
[0249] 2.3 Mutually Repressive Switch can Effectively Respond to microRNA Input Signals and Stably Function in Different Cell Lines
[0250] Because of limited packaging capacity of the oncolytic adenovirus (only 8 K foreign genes can be packaged at most), the inventors have selected short and effective inhibition elements as much as possible in this example. The inventors selected Lad and tetR-KRAB in this example. As shown in
[0251] 2.4 Construction of Oncolytic Adenovirus by Using the CGGA Method
[0252] A large amount of clinical information indicates that the expression of tumor markers varies greatly among different individuals. Therefore, different markers may be chosen by the inventors for different individuals. In order to achieve the precise treatment for individual patients, the inventors need to prepare a variety of oncolytic adenoviruses carrying different biomarkers. However, it is very difficult to rapidly construct these oncolytic adenoviruses through traditional enzyme digestion and ligation method. In the present example, the inventors designed and constructed a three-stage library, and rapidly modified oncolytic adenovirus by the CGGA method (Cascade Golden-Gate Gateway/Gibson Assemble method). First, marker elements associated with distinguishing of cancer cells from normal cells (such as a tumor-specific promoter, a logic circuit-related repression element, and a cancer cell-distinguishing miRNA recognition sequence) are constructed on a primary plasmid, thereby forming a primary element library, as shown in
[0253] 2.5 Detection of Oncolytic Adenovirus on Effectively Killing of Hepatoma Cells at Cellular Level
[0254] In order to detect whether the mutually repressive switch in the oncolytic adenovirus constructed by the inventors can effectively distinguish and kill hepatoma cells, the inventors designed an in vitro cell killing assay for oncolytic adenovirus. Different cell lines were infected with the oncolytic adenovirus in different multiplicity of infection, where Chang cells are normal liver cells, and Huh7 and HepG2 cells are human hepatoma cell lines. The viability of cells was measured by the MTS method after 6 days of incubation. As shown in
[0255] 2.6 In Vitro Detection of Expression Level of Effector Carried by Oncolytic Adenovirus
[0256] The adenoviral vectors currently used in clinical practice are human Ad2 or Ad5 type adenoviruses which are widely present in nature. Further, neutralizing antibodies that antagonize these adenoviruses have been known to exist in the human body. Thus, clinical data showed a poor treatment effect for the tumor treatment relying on the oncolytic effect of adenovirus alone. Therefore, the inventors in the example used the oncolytic adenovirus as a delivery system to carry effector genes to tumor sites, so as to cause a systemic immune response. As shown in
[0257] In the meantime, the activity of the effectors expressed by the effector genes in the adenoviral vector has been also detected by the inventors. As shown in
[0258] 2.7 Detection of Therapeutic Effect of Oncolytic Adenovirus by Animal Studies
[0259] As shown in
[0260] After two weeks or one month of treatment of the tumor-bearing mice with oncolytic adenovirus, tissue samples of various organs of the mice were taken, and the virus DNA was extracted after homogenization. The viral titer was detected by the qPCR method. It is found that the viruses are only replicated in the tumor cells and do not spread into other tissues after virus infection. The results demonstrate that oncolytic adenovirus in vivo has a strong specificity and is safe to normal tissue cells.
[0261] The therapeutic effect of the present oncolytic adenovirus on a C57 mouse model with an immune system is further demonstrated. As shown in
[0262] Tumors of tumor-bearing mice were taken, fixed, sectioned and HE stained for detection of lymphocyte infiltration in tumor tissues. It can be found that lymphocyte infiltration in tumor tissues of mice which is treated with oncolytic adenovirus is significantly increased compared with the PBS control group, demonstrating that the treatment of oncolytic adenovirus can recruit more lymphocytes in tumor tissues. These results indicated that expression of immune stimulators can promote the cytotoxic T cell response during oncolytic virus therapies. The infiltrating lymphocytes in tumors were isolated and purified, and the phenotype of the infiltrating T cells in mouse tumors was detected by the flow cytometry. It is found that a greater proportion of Ki-67.sup.+ cells among infiltrating T cells in tumors of mice treated with oncolytic virus, which indicates treatment with oncolytic adenovirus promotes the proliferation of T cells inside the tumor and triggers a stronger immune response. Tumor-infiltrating lymphocytes were added to RPMI 1640 medium containing PMA (20 ng/mL) and Ionomycin (1 g/ml L), cultured at 37 C. for 4 hours in the presence of Brevedlin A, followed by fixation and staining of cells, and detecting the expression of -interferon in CD4.sup.+ and CD8.sup.+ T cells by flow cytometry. We found a higher expression of -interferon in T cells in tumors of the oncolytic adenovirus treatment group, which changed the immune microenvironment in tumor and promoted the killing of tumor cells, as shown in
[0263] Systemic Anti-Tumor Immune Response by Treatment of Oncolytic Adenovirus
[0264] C57BL/6 mice were subcutaneously injected with mouse hepatoma cells Hepa-1-6 on both left and right flanks. After the formation of tumor mass, the oncolytic adenoviruses expressing cytokine hIL-2, mGM-CSF and anti-PD-1 scFv respectively were injected into the tumor on the right flank, with PBS and AdGFP injections as controls. The tumor growth was measured continuously. The infiltrating lymphocytes in tumors on the left and right flanks of the tumor-bearing mice after 14 days of treatment were isolated and purified, and the phenotype of infiltrating T cells in the tumors was detected by the flow cytometry method. We found a higher proportion of T cells expressing Ki-67.sup.+ T cells or interferon-y are present not only in the tumor injected with oncolytic adenovirus on the right flank but also in the tumor on the left flank without oncolytic adenovirus injection, compared with the control groups. It is demonstrated that the immune response caused by the treatment of oncolytic adenovirus can not only function on the tumor in the injection site, but also on the tumor in the distal side. This suggests that the oncolytic adenovirus not only has therapeutic effect on the tumor in the injection site, but also exhibits therapeutic effect on the tumor in distal metastasis.
[0265] At the same time, in order to detect whether the treatment of oncolytic adenovirus has generated an effective systemic immune response in survived mice, Hepa1-6 was subcutaneously injected again into the mice after treatment by the inventors. It is found that the rejection rate of all the mice is 100%, as shown in
[0266] 2.8 Modeling of the Treatment Process of Oncolytic Adenovirus
[0267] The treatment process of oncolytic adenovirus is abstracted into a tumor-virus-immune system, including uninfected tumor cells, infected tumor cells, free viruses, oncolytic adenovirus antigen activated-immune cells and tumor antigen activated-immune cells, such five components represented by S, I, V, Z.sub.V and Z.sub.T respectively, as shown in
[0268] Without considering the immune system, the final state of the tumor-virus system will be converted from a state of convergence to oscillation with the increase of the virus replication speed. The simulations show the change of the minimal tumor volume in the tumor-virus system from an initial state to a final state over time under different initial virus titer, initial tumor size and viral replication rate. It can be seen from the simulation results that increase of initial viral titer contributes to the control of tumor size. In practical applications, the appropriate initial administration dose can be chose in combination of the initial tumor size and administration dose limit to clean tumors at predicted time points or provide other adjuvant therapies, as shown in
[0269] Tumor size in the tumor-virus-immune system at the final state during the duration of simulation under different inhibition effects of immune cells on tumors and viruses. It can be seen from the simulation results that the system exhibits several dynamic behaviors including tending to complete tumor elimination, tumor growth towards saturation, stable tumor volume, and unstable tumor volume. In general, stronger the inhibition effect of immune cells on tumors is, more tumors are cleaned by the system, while stronger the inhibition effect of immune cells on viruses is, more tumors in the system are out of control. However, the system exhibits non-monotonic changes on the tendencies of stability and non-stability of tumor, as shown in
[0270] In the specification of the present disclosure, the terms an embodiment, some embodiments, a specific embodiment, an example, a specific example, some examples and the like are intended to refer to particular features, structures, materials or characteristics described by way of example or embodiment are contained in at least one embodiment or example of the disclosure. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the particular features, structures, materials or characteristics described may be combined in any suitable manner in one or more embodiments or examples. In addition, various embodiments or examples described in the specification and features of various embodiments or examples may be combined by skilled in the art without contradiction.
[0271] Although embodiments of the present disclosure have been described in detail, it will be understood the embodiments are illustrative and are not to be construed as limiting the scope of the disclosure. Changes, modifications, substitutions and variations can be made in these embodiments by those skilled in the art within the scope of the present disclosure.