COMPOSITION FOR INHIBITING GROWTH OF BACTERIUM HAVING MENAQUINONE SYNTHESIS PATHWAY THROUGH FUTALOSINE OR FUTALOSINE DERIVATIVE
20200016106 ยท 2020-01-16
Inventors
Cpc classification
A61P1/04
HUMAN NECESSITIES
A61K31/201
HUMAN NECESSITIES
A61P17/02
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K31/20
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
A61P7/04
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
Abstract
The present invention provides a composition for inhibiting proliferation of a bacterium provided with a menaquinone synthesis route via futalosine or a futalosine derivative, which contains a fatty acid having 18 carbon atoms and a hydroxyl group at the 10-position as an active ingredient. Furthermore, the present invention provides a composition for preventing or treating a disease caused by a bacterium provided with a menaquinone synthesis route via futalosine or a futalosine derivative.
Claims
1.-13. (canceled)
14. A method for inhibiting proliferation of a bacterium provided with a menaquinone synthesis route via futalosine or a futalosine derivative, comprising administering a fatty acid having 18 carbon atoms and a hydroxyl group at the 10-position to a subject.
15. A method for preventing or treating a disease selected from the group consisting of acute gastritis, chronic gastritis, nodular gastritis, gastric ulcer, duodenal ulcer, stomach cancer, stomach MALT lymphoma, diffuse large B-cell lymphoma, idiopathic thrombocytopenic purpura, childhood hypoferric anemia, chronic urticaria, Parkinson's disease, Campylobacter food poisoning and Guillain-Barre syndrome, comprising administering a fatty acid having 18 carbon atoms and a hydroxyl group at the 10-position to a subject.
16.-21. (canceled)
22. The method according to claim 14, wherein the fatty acid has a cis double bond at at least the 12-position.
23. The method according to claim 22, wherein the fatty acid is at least one selected from the group consisting of 10-hydroxy-cis-12-octadecenoic acid, 10-hydroxy-cis-12,cis-15-octadecadienoic acid and 10-hydroxy-cis-6,cis-12-octadecadienoic acid.
24. The method according to claim 23, wherein the fatty acid is 10-hydroxy-cis-12-octadecenoic acid.
25. The method according to claim 14, wherein the bacterium is Helicobacter bacterium.
26. The method according to claim 25, wherein the Helicobacter bacterium is selected from the group consisting of Helicobacter pylori and Helicobacter suis.
27. The method according to claim 14, wherein the bacterium is Campylobacter bacterium.
28. The method according to claim 27, wherein the Campylobacter bacterium is selected from the group consisting of Campylobacter jejuni and Campylobacter coli.
29. The method according to claim 15, wherein the fatty acid has a cis double bond at at least the 12-position.
30. The method according to claim 29, wherein the fatty acid is at least one selected from the group consisting of 10-hydroxy-cis-12-octadecenoic acid, 10-hydroxy-cis-12,cis-15-octadecadienoic acid and 10-hydroxy-cis-6,cis-12-octadecadienoic acid.
31. The method according to claim 30, wherein the fatty acid is 10-hydroxy-cis-12-octadecenoic acid.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
DESCRIPTION OF EMBODIMENTS
[0045] The present invention provides a composition for inhibiting proliferation of a bacterium provided with a menaquinone synthesis route via futalosine or a futalosine derivative, which contains a fatty acid having 18 carbon atoms and a hydroxyl group at the 10-position (hereinafter to be also referred to as the composition of the present invention).
[0046] The composition of the present invention contains a fatty acid having 18 carbon atoms and a hydroxyl group at the 10-position (hereinafter to be also referred to as the hydroxylated fatty acid in the present invention). The hydroxylated fatty acid in the present invention may be a saturated fatty acid or an unsaturated fatty acid. When it is an unsaturated fatty acid, an unsaturated fatty acid having at least one double bond selected from the group consisting of a cis double bond at the 6-position, a cis double bond at the 12-position, a cis double bond at the 15-position and a trans double bond at the 11-position is preferable, an unsaturated fatty acid having a cis double bond at at least the 12-position is more preferable.
[0047] More specifically, examples of the hydroxylated fatty acid in the present invention include 10-hydroxy-cis-12-octadecenoic acid (hereinafter to be also referred to as HYA), 10-hydroxy-cis-12,cis-15-octadecadienoic acid (hereinafter to be also referred to as HYA), 10-hydroxy-cis-6,cis-12-octadecadienoic acid (hereinafter to be also referred to as HYA), 10-hydroxy-cis-6,cis-12,cis-15-octadecatrienoic acid (hereinafter to be also referred to as sHYA), 10,12-dihydroxyoctadecanoic acid (hereinafter to be also referred to as rHYA), 10-hydroxy-trans-11-octadecenoic acid (hereinafter to be also referred to as HYC), 10-hydroxy-trans-11,cis-15-octadecadienoic acid (hereinafter to be also referred to as HYC), 10-hydroxy-cis-6,trans-11-octadecadienoic acid (hereinafter to be also referred to as HYC), 10-hydroxy-cis-6,trans-11,cis-15-octadecatrienoic acid (hereinafter to be also referred to as sHYC) and the like. It is preferably 10-hydroxy-cis-12-octadecenoic acid, 10-hydroxy-cis-12,cis-15-octadecadienoic acid or 10-hydroxy-cis-6,cis-12-octadecadienoic acid, further preferably 10-hydroxy-cis-12-octadecenoic acid.
[0048] The hydroxylated fatty acid in the present invention can be prepared by a known means and, for example, a production method is also described in WO 2013/168310. In addition, 10-hydroxy-cis-12-octadecenoic acid can be prepared by reference to Biochemical and Biophysical Research Communications, 416(2011), p. 188-193, and the like.
[0049] The hydroxylated fatty acid in the present invention has a proliferation inhibitory effect on a bacterium provided with a menaquinone synthesis route via futalosine or a futalosine derivative (hereinafter to be also referred to as futalosine synthesis bacterium). In the present invention, the futalosine synthesis bacterium is a bacterium provided with, in a metabolism pathway for biosynthesizing menaquinone, a metabolism pathway for biosynthesizing menaquinone from chorismic acid via futalosine or a futalosine derivative (hereinafter to be also referred to as futalosine pathway). As used herein, the futalosine derivative is, for example, aminodeoxyfutalosine, dehypoxanthinyl futalosine, cyclic dehypoxanthine futalosine or 1,4-dihydroxy-6-naphtoic acid. In the futalosine pathway, futalosine is synthesized from chorismic acid and inosine. Aminodeoxyfutalosine is synthesized from chorismic acid and adenosine. Futalosine or aminodeoxyfutalosine is metabolized into dehypoxanthinyl futalosine, dehypoxanthinyl futalosine is metabolized into cyclic dehypoxanthine futalosine, cyclic dehypoxanthine futalosine is metabolized into 1,4-dihydroxy-6-naphtoic acid, and finally, 1,4-dihydroxy-6-naphthoic acid is metabolized into menaquinone.
[0050] Menaquinone is an essential component in the electron transport system of bacteria, and two kinds of routes are known as synthesis routes in the bacteria. One is a route for synthesizing menaquinone from chorismic acid via succinylbenzoic acid (hereinafter to be also referred to as succinylbenzoic acid route), and it is provided in Escherichia coli, lactobacillus, bifidobacteria, Enterococcus, Salmonella, Shigella, Listeria, Yersinia, Bacillus subtilis and the like. The other is a futalosine pathway clarified by genetic analysis in recent years. As a bacterium having the both pathways of succinylbenzoic acid pathway and futalosine pathway, Stackebrandtia nassauensis DSM 44728 which is one species of actinomycetes is known to date. Except this bacterium, a bacterium provided with a metabolism pathway for biosynthesizing menaquinone is only provided with any one route of the above-mentioned routes. Therefore, the hydroxylated fatty acid in the present invention capable of inhibiting the futalosine pathway can specifically inhibit proliferation of futalosine synthesis bacterium. In the present invention, the futalosine synthesis bacterium is not particularly limited as long as it is provided with a futalosine pathway, and a bacterium not provided with a succinylbenzoic acid pathway is preferable. Examples of the futalosine synthesis bacterium include Helicobacter bacterium, Campylobacter bacterium, Chlamydia bacterium, Thermus bacterium, Wolinella bacterium, Streptomyces bacterium, Acidothermus bacterium, Kitasatospora bacterium, Bacillus bacterium and the like. In the present invention, examples of the Helicobacter bacterium include Helicobacter pylori, Helicobacter heilmannii sensu lato (including Helicobacter suis, Helicobacter felis, Helicobacter salomonis, Helicobacter bizzozeronii, Helicobacter baculiformis, Helicobacter cynogastricus, Helicobacter heilmannii sensu stricto), Helicobacter anseris, Helicobacter acinonychis, Helicobacter bilis, Helicobacter brantae, Helicobacter canadensis, Helicobacter canis, Helicobacter cholecystus, Helicobacter cinaedi, Helicobacter hepaticus, Helicobacter muridarum, Helicobacter mustelae, Helicobacter pametensis, Helicobacter rodentium, Helicobacter trogontum and the like, preferably, Helicobacter pylori and Helicobacter suis. In the present invention, examples of the Campylobacter bacterium include Campylobacter coli, Campylobacter concisus, Campylobacter fetus, Campylobacter jejuni, Campylobacter sputorum, Campylobacter mucosalis, Campylobacter rectus and the like, preferably, Campylobacter jejuni and Campylobacter coli. In the present invention, examples of the Chlamydia bacterium include Chlamydia muridarum, Chlamydia suis, Chlamydia trachomatis and the like. In the present invention, examples of the Thermus bacterium include Thermus antranikianii, Thermus aquaticus, Thermus igniterrae, Thermus thermophilus and the like. In the present invention, examples of the Wolinella bacterium include Wolinella curva, Wolinella succinogenes, Wolinella recta and the like. In the present invention, examples of the Streptomyces bacterium include Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces scabies, Streptomyces lividans and the like. In the present invention, examples of the Acidothermus bacterium include Acidothermus cellulolyticus and the like. In the present invention, examples of the Kitasatospora bacterium include Kitasatospora setae and the like. In the present invention, examples of the Bacillus bacterium include Bacillus cereus, Bacillus subtilis, Bacillus thuringiensis and the like.
[0051] The hydroxylated fatty acid in the present invention can inhibit proliferation of futalosine synthesis bacterium, and thus can be used, when the futalosine synthesis bacterium is a bacterium that infects human or animals other than human and cause a disease (hereinafter to be also referred to as pathogenic futalosine synthesis bacterium), for the prophylaxis or treatment of the disease. Examples of the pathogenic futalosine synthesis bacterium include Helicobacter bacterium, Campylobacter bacterium, Chlamydia bacterium, Wolinella bacterium, Bacillus bacterium and the like. When the pathogenic futalosine synthesis bacterium is Helicobacter bacterium, examples of the disease that can be prevented or treated by the composition of the present invention include gastric diseases such as acute gastritis, chronic gastritis, nodular gastritis, gastric ulcer, duodenal ulcer, stomach cancer, gastric MALT lymphoma and the like, non-gastric diseases such as diffuse large B-cell lymphoma, idiopathic thrombocytopenic purpura, childhood hypoferric anemia, chronic urticaria and the like, Parkinson's disease and the like, preferably, gastric diseases such as acute gastritis, chronic gastritis, nodular gastritis, gastric ulcer, duodenal ulcer, stomach cancer, gastric MALT lymphoma and the like. When the pathogenic futalosine synthesis bacterium is Campylobacter bacterium, examples of the disease that can be prevented or treated by the composition of the present invention include Campylobacter food poisoning, Guillain-Barre syndrome and the like. When the pathogenic futalosine synthesis bacterium is Chlamydia bacterium, examples of the disease that can be prevented or treated by the composition of the present invention include Chlamydia infections, trachoma, pneumonia, parrot disease and the like. When the pathogenic futalosine synthesis bacterium is Wolinella bacterium, examples of the disease that can be prevented or treated by the composition of the present invention include periodontitis and the like. When the pathogenic futalosine synthesis bacterium is Bacillus bacterium, examples of the disease that can be prevented or treated by the composition of the present invention include food poisoning, bacteremia, pneumonia, endocarditis, ocular infections, opportunistic infection and the like.
[0052] The composition of the present invention can be used as, for example, pharmaceutical product, food, feed and the like, or by blending with them.
[0053] When the composition of the present invention is used as a pharmaceutical product, the dosage form of the pharmaceutical product includes dispersion, granule, pill, soft capsule, hard capsule, tablet, chewable tablet, quick-disintegrating tablet, syrup, liquid, suspension, suppository, ointment, cream, gel, adhesive, inhalant, injection and the like. A preparation thereof is prepared according to a conventional method.
[0054] Examples of the additives that can be used for forming preparations include animal and plant oils such as soybean oil, safflower oil, olive oil, germ oil, sunflower oil, beef tallow, sardine oil and the like, polyvalent alcohols such as polyethylene glycol, propylene glycol, glycerol, sorbitol and the like, surfactants such as sorbitan fatty acid ester, sucrose fatty acid ester, glycerin fatty acid ester, polyglycerol fatty acid ester and the like, excipients such as purified water, lactose, starch, crystalline cellulose, D-mannitol, lecithin, gum arabic, sorbitol solution, carbohydrate solution and the like, sweetener, colorant, pH adjuster, flavor and the like. A liquid preparation may be dissolved or suspended in water or other suitable medium when in use. Also, tablet and granules may be coated by a well-known method.
[0055] For administration in the form of an injection, intravenous, intraperitoneal, intramuscular, subcutaneous, transdermal, intraarticular, intrasynovial, intrathecal, intraperiosteum, sublingual, oral administrations and the like are preferable, and intravenous administration or intraperitoneal administration is particularly preferable. The intravenous administration may be any of drip administration and bolus administration.
[0056] When the composition of the present invention is used as a food or food additive, the food of the present invention is not particularly limited as long as it permits oral ingestion, such as solution, suspension, powder, solid formed article and the like. Specific examples include supplements (dispersion, granule, soft capsule, hard capsule, tablet, chewable tablet, quick-disintegrating tablet, syrup, liquid etc.), drinks (carbonic acid drinks, lactic acid drinks, sport drinks, fruit juice drinks, vegetable drinks, soymilk drinks, coffee drinks, tea drinks, powder drinks, concentrated drinks, nutrition drinks, alcohol drinks etc.), confectionery (gummy, jelly, gum, chocolate, cookie, candy, caramel, Japanese confectionery, snack etc.), instant food (instant noodles, retort food, can, microwavable foods, instant soup, miso soups, freeze-dried food etc.), oil, fats and oils food (mayonnaise, dressing, butter, cream, margarine etc.), wheat powder products (bread, pasta, noodle, cake mix, bread crumb etc.), seasoning (sauce, tomato processing seasoning, flavor seasoning, cooking mixture, soup etc.), processed meat products (meat ham, sausage and the like).
[0057] The above-mentioned foods can contain, where necessary, various nutrients, various vitamins (vitamin A, vitamin B1, vitamin B2, vitamin B6, vitamin C, vitamin D, vitamin E, vitamin K etc.), various minerals (magnesium, zinc, iron, sodium, potassium, selenium etc.), dietary fiber, dispersing agent, stabilizer such as emulsifier and the like, sweetener, flavor components (citric acid, malic acid etc.), flavor, royal jelly, propolis, Agaricus and the like.
[0058] When the composition of the present invention is used as a feed or feed additive, the feed of the present invention is, for example, pet food, stock raising or aquaculture feed additive and the like.
[0059] As the subject to be administered with or that ingests the composition of the present invention, human and animals other than human (e.g., dog, cat, mouse, rat, hamster, guinea pig, rabbit, swine, bovine, chicken, parakeet, hill myna, goat, horse, sheep, monkey etc.) can be mentioned.
[0060] While the dose or ingestion amount of the composition of the present invention varies depending on the subject of administration or ingestion, target disease, symptom, administration or ingestion route and the like, for example, a daily dose or ingestion amount of the fatty acid contained in the composition of the present invention is generally 0.02-100 mg/kg body weight, preferably 0.2-50 mg/kg body weight, more preferably 0.5-20 mg/kg body weight, which can be administered or ingested orally or parenterally. Plural divided portions may be administered or ingested per day. The dose may be increased or decreased according to the symptom.
[0061] The present invention is explained in more detail in the following by referring to Examples. The Examples are mere exemplifications of the present invention and do not limit the scope of the present invention in any manner.
EXAMPLES
Strain
[0062] The strains used in this Example are as follows. Helicobacter pylori SS1 strain is an experimental strain isolated from a patient with a stomach disease and adapted to infect mice. Helicobacter pylori TN2GF4 strain, NCTC11637 strain, ATCC43579 strain, TK1029 strain, TY281 strain and TY1345 strain are isolated from gastric biopsy specimens of patients with stomach diseases. Helicobacter pylori RC-1 strain is isolated from a gastric biopsy specimen of a patient with a stomach disease and is clarithromycin resistant. Helicobacter suis TKY strain is isolated from Macaca fascicularis. Helicobacter suis SNTW101 strain is isolated from a patient who developed nodular gastritis. Campylobacter jejuni ATCC33560 strain is a standard strain of Campylobacter jejuni isolated from bovine feces. Campylobacter coli ATCC33559 strain is a standard strain of Campylobacter coli isolated from swine feces.
Manufacture or Preparation of Fatty Acids
[0063] The fatty acid having 18 carbon atoms and a hydroxyl group or a carbonyl group at the 10-position (10-hydroxyoctadecanoic acid (hereinafter to be also referred to as HYB), 10-oxo-cis-12-octadecenoic acid (hereinafter to be also referred to as KetoA) and 10-oxo-trans-11-octadecenoic acid (hereinafter to be also referred to as KetoC)) to be used in this Example were prepared according to the method of WO 2013/168310. In addition, HYA, HYA, HYA were prepared by reference to the report in Biochemical and Biophysical Research Communications 416 (2011) p. 188-193, and the like. The stearic acid, oleic acid, linoleic acid, ricinoleic acid, DHA and EPA to be used in this Example were purchased from Nacalai Tesque, INC. The ricinoleic acid to be used in this Example was purchased from Sigma-Aldrich Co. LLC.
Example 1 Proliferation Inhibitory Effect (In Vitro) on Helicobacter pylori TK1029 Strain by ED.SUB.50 .Measurement
[0064] Helicobacter pylori TK1029 strain (clinical isolate) was cultured in Brucella broth containing 10% FCS and 110.sup.6 CFU of bacteria were respectively added to 3 mL of Brain-Heart Infusion Broth (BHI) media (previously added with free fatty acid (stearic acid, oleic acid, linoleic acid, ricinoleic acid, HYA) at 0, 0.5, 5, 50, 500 g/mL) containing 2% FCS in a 6-well plate. Shaking culture was performed under conditions of temperature 37 C., humidity 100%, microaerobic (5% O.sub.2, 10% CO.sub.2, 85% N.sub.2), the culture medium (0.1 mL) from each well was applied to NISSUI plate, Helicobacter agar medium 15 hr and 25 hr later, and the number of colonies formed after microaerobic culture for 3 days was counted. This viable count is expressed as a logarithm and, on the logarithmic graph where the detection limit of viable count is 10.sup.2, the concentration at which the number of viable cells in the medium added with free fatty acid is half the number of viable cells in the medium not added with free fatty acid was taken as the ED.sub.50 value, (ED.sub.50 value is a concentration at which the viable count of the medium added with free fatty acid is {10(viable count of the medium not added with free fatty acid).sup.1/2}). As a result, HYA already showed an anti-Helicobacter pylori effect at 15 hr after culturing as evidenced by ED.sub.50 value about 1000-100 times lower than that of fatty acid having 18 carbon atoms and not having a hydroxyl group (stearic acid, oleic acid, linoleic acid), and showed an anti-Helicobacter pylori effect as evidenced by ED.sub.50 value about 10 times lower than that of ricinoleic acid which is a fatty acid having 18 carbon atoms and a hydroxyl group (Table 1). Even at 25 hr after culturing, HYA showed an anti-Helicobacter pylori effect with ED.sub.50 values remarkably lower than or the same level as those of the above-mentioned fatty acids.
TABLE-US-00001 TABLE 1 fatty acid 15 hr later (g/mL) 25 hr later (g/mL) stearic acid 500 >500 oleic acid 50 >50 linoleic acid 50 50 ricinoleic acid 5 0.5 HYA 0.5 0.5
Example 2 Proliferation Inhibitory Effect (In Vitro) of HYA on 20 Helicobacter pylori
[0065] Helicobacter pylori SS1 strain, TN2GF4 strain, ATCC43579 strain, NCTC11637 strain, TY281 strain, TY1345 strain were each inoculated to a 6-well plate containing 3 mL of a liquid medium (Brucella broth added with 10% FCS), and fatty acid (200 M or 1000 M) and menaquinone (MK-4) 100 g/mL were added. After static culture for 3 days at temperature 37 C., microaerobic conditions (5% O.sub.2, 10% 00.sub.2, 85% N.sub.2), the culture medium was applied on a Helicobacter agar plate, cultured for 3 days and the resulting colonies were counted (
Example 3 Proliferation Inhibitory Effect (In Vitro) of Low Concentration HYA on Helicobacter pylori
[0066] Helicobacter pylori SS1 strain, TN2GF4 strain, TK1029 strain, RC-1 strain were each inoculated to a 6-well plate containing 2 mL of a liquid medium (BHI added with 5% FCS), and fatty acid (20 M) and menaquinone (MK-4) 100 g/mL were added. After shaking culture for 24 hr at temperature 37 C., microaerobic conditions (5% O.sub.2, 10% 00.sub.2, 85% N.sub.2), the culture medium was applied on a Helicobacter agar plate, cultured for 3 days and the resulting colonies were counted (
Example 4 Helicobacter pylori SS1 Strain and TN2GF4 Strain Inhibitory Effect (In Vivo) of Fatty Acid
[0067] A 5-week-old C57BL/6 female mouse was orally infected 3 times with Helicobacter pylori SS1 strain or TN2GF4 strain (1-510.sup.8 CFU) every other day and dissected at 2 weeks from the final infection day, and the number of bacteria in the gastric mucosa was counted. The measurement and the number of bacteria in the gastric mucosa was performed as follows. First, the greater curvature of the stomach of the mouse was incised with scissors for ophthalmology, and the contents were washed away with phosphate buffered saline (pH 7.4, PBS). Next, the mucous membrane was scraped with a slide glass, 1 mL of PBS was added, the mixture was sandwiched between ground glass parts of two glass slides and evenly crushed to prepare a gastric mucosa suspension. The culture medium was applied on a Helicobacter agar plate, cultured for 3 days and the resulting colonies were counted. Water added with fatty acid (200 M) (HYA, HYB, KetoA, KetoC, linoleic acid, oleic acid, DHA, EPA) was given to the mice from 1 week before infection. The control was free of fatty acid addition (
Example 5 Proliferation Inhibitory Effect (In Vivo) of HYA on Helicobacter Bacteria
[0068] A 5-week-old C57BL/6 female mouse was orally infected 3 times with Helicobacter pylori SS1 strain or TN2GF4 strain (1-510.sup.8 CFU) every other day and dissected at 2 weeks from the final infection day, and the number of bacteria in the gastric mucosa was counted. Water added with HYA or linoleic acid (200 M) was given to the mice from 1 week before infection (
[0069] DNA was prepared from a part of the stomach tissue by using DNeasy Blood & Tissue Kit (Qiagen) and real-time PCR (model: CFX96 (Bio-Rad)) was performed. As the primer for Helicobacter suis quantification, the following was used by reference to Diagn. Microbiol. Infect. Dis. 46(1):1-7, 2003.
TABLE-US-00002 HeilF (SEQIDNO:1) (5 AAGTCGAACGATGAAGCCTA3) HeilR (SEQIDNO:2) (5 ATTTGGTATTAATCACCATTTC3)
[0070] The following were used as the primers for -actin quantification of the mouse by reference to J. Clin. Microbiol. 37:1958-1963, 1999.
TABLE-US-00003 (SEQIDNO:3) 5 TCACCCACACTGTGCCCATCTACGA3 (SEQIDNO:4) 5 GGATGCCACAGGATTCCATACCCA3
[0071] For quantification by real-time PCR, iQTM SYBR Green Supermix was used. The reaction conditions were as follows.
1 cycle
[0072] 95 C. 2 min
40 cycles
[0073] 95 C. 5 sec
[0074] 55 C. 15 sec
[0075] 72 C. 45 sec
[0076] Thereafter, the temperature was increased by 0.5 C. every seconds from 65 C. to 95 C. and the fluorescence was measured. Relative quantification was performed by multiplex reactions (same tube) and comparative CT method (ABI Prism 7700) by converting to numerical values by the heilmannii-suis gene quantitative ratio per -actin gene amount and further adjusting to make the mean of the untreated to 1.
Example 6 Pathology Onset Suppressive Effect (In Vivo) of HYA on Gastric MALT Lymphoma
[0077] Helicobacter suis is suspected to be the cause of the onset of gastric MALT lymphoma. A 5-week-old C57BL/6 female mouse was orally infected only once with a stomach suspension of Helicobacter suis TKY strain-infected mouse and dissected 6 months after the infection, and the number of bacteria in the gastric mucosa was counted according to the method described in Example 5. Water added with HYA (200 M) was given to the mouse from one week before the infection.
(1) Measurement of the Number of Helicobacter suis Bacteria in the Stomach of Infected Mouse
[0078] The measurement of the number of Helicobacter suis bacteria in the stomach of the infected mouse was performed in the same manner as in Example 5. The relative value of the number of bacteria in gastric mucosa when that with HYA non-administration is 1 is shown (
(2) Histochemical Analysis
[0079] Ki-67 is known as a marker for cell proliferation and cell cycle. Proliferated cells in a tumor tissue were detected by immunostaining with anti-Ki-67 antibody. A part of the stomach was fixed with 10% neutral formalin buffer to prepare a paraffin block, serial sections were cut out using a microtome and Hematoxylin Eosin (HE) staining was performed. Ki-67 (Clone SP6) rabbit monoclonal antibody (Thermo Fisher Scientific Inc.) diluted 1:300 was used as a dilution antibody, Histofine Simple Stain mouse MAX-PO (NICHIREI BIOSCIENCES INC., Code:414341) DAB staining (DAKO Inc.) was used as a secondary antibody, and Hematoxylin was used for comparison staining. As the negative control, rabbit IgG antibody (Code No. X 0936 Lot 050 (DAKO Inc.)) was used. The number of Ki-67 positive cells in lymphoid follicle when that with HYA non-administration is 1 is shown (
(3) Quantification of CD19, CD20 Expressions
[0080] CD19 and CD20 are cell surface markers for B-cell lymphoma. Using real-time reverse transcription PCR (real-time RT-PCR), the expression levels of CD19 and CD20 were measured. Using NucleoSpin (registered trade mark) RNA Kit (Takara Bio Inc.), RNA was prepared from mouse gastric mucosa. Using PrimeScript RT Reagent Kit (Takara Bio Inc.), cDNA was prepared from RNA. For real-time RT-PCR, KAPA SYBR Fast ROX Low qPCR kit (KAPA BIOSYSTEMS Inc.) and QuantStudio7 Flex Real-time PCR System (Thermo Fisher Scientific Inc.) were used.
[0081] The following were used as the primers for quantification of CD19 expression.
TABLE-US-00004 Fw: (SEQIDNO:5) 5-AGTGACTAGCCTGGACTT-3 Rv: (SEQIDNO:6) 5-ACTGACTGACACCATCTG-3
[0082] The following were used as the primers for quantification of CD20 expression.
TABLE-US-00005 Fw: (SEQIDNO:7) 5-CAGGAAGAGTTTGGTCAA-3 Rv: (SEQIDNO:8) 5-GGTTCACAGTCGTAGATAT-3
[0083] The following were used as the primers for quantification of glyceraldehyde-3-phosphate (GAPDH) expression.
TABLE-US-00006 Fw: (SEQIDNO:9) 5-TGTGTCCGTCGTGGATCTGA-3 Rv: (SEQIDNO:10) 5-TTGCTGTTGAAGTCGCAGGAG-3
[0084] The conditions of 2-step real-time RT-PCR were as follows.
1 cycle
[0085] 95 C. 3 min
40 cycles
[0086] 95 C. 3 sec
[0087] 60 C. 20 sec
[0088] The expression level of CD19 or CD20 relative to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was converted to a numerical value and the value was further adjusted to make the average expression of CD19 or CD20 of the non-infection group 1. The CD20 relative expression levels in the HYA administration group and non-administration group are shown (
Example 7 Proliferation Inhibitory Effect (In Vitro) of HYA on Campylobacter jejuni ATCC33560 Strain and Campylobacter coli ATCC33559 Strain
[0089] Campylobacter jejuni ATCC33560 strain or Campylobacter coli ATCC33559 strain preserved at 80 C. was applied on a CODA agar medium added with SR0155E and cultured for 2 days in an incubator (5% O.sub.2, 10% 00.sub.2, 85% N.sub.2, humidity 100%, 42 C.). The resulting colonies were picked up, inoculated to 10% FBS-added Brucella liquid medium and shaken in the incubator overnight. 2 mL of 5% FBS-added Brucella liquid medium containing Campylobacter jejuni ATCC33560 strain or Campylobacter coli ATCC33559 strain at a concentration of 110.sup.6 CFU/mL was dispensed to each well of a 12-well plate, fatty acid was added at an optional concentration (0, 100, 200, 400 M), and the mixture was shaken in the incubator for 24 hr. After 24 hr, the absorbance (600 nm) of the liquid medium after shaking was measured. On the other hand, the liquid medium at 24 hr after shaking was diluted 110.sup.6-fold with BSG (PBS containing 0.01% gelatin, pH 7.4), 0.1 mL was applied on 10% FBS-added Brucella agar medium, cultured in the incubator for 2 days and the number of the resulting colonies was measured (
[0090] From the above results, it was shown that a fatty acid having 18 carbon atoms and a hydroxyl group at the 10-position has an inhibitory action on the proliferation of a bacterium provided with a menaquinone synthesis route via futalosine or a futalosine derivative such as Helicobacter pylori, Helicobacter suis and the like, a suppressive action on an increase in the number of Ki-67 positive cells, a suppressive action on an increase in the CD19 expression level and CD20 expression level, and a suppressive action on the onset of pathology of gastric MALT lymphoma. In addition, it was shown that a fatty acid having 18 carbon atoms and a hydroxyl group at the 10-position has an inhibitory action on proliferation of Campylobacter jejuni and Campylobacter coli.
INDUSTRIAL APPLICABILITY
[0091] In the present invention, it was found that a fatty acid having 18 carbon atoms and a hydroxyl group at the 10-position inhibits proliferation of a bacterium provided with a menaquinone synthesis route via futalosine or a futalosine derivative. The composition containing the fatty acid can be used in various fields such as pharmaceutical product, food, feed and the like, and is industrially extremely useful.
[0092] This application is based on a patent application No. 2017-053056 filed in Japan (filing date: Mar. 17, 2017), the contents of which are incorporated in full herein.