Method of whitening skin using tranexamic acid-peptide having skin whitening activity
10532018 ยท 2020-01-14
Assignee
Inventors
- Sang Moon KANG (Daejeon, KR)
- Seock Yeon Hwang (Daejeon, KR)
- Mi Hye Lim (Yongin-si, KR)
- Chung Park (Daejeon, KR)
- Eun Jin Shin (Cheongju-si, KR)
- Kee-young Lee (Cheongju-si, KR)
- Un Kyu Park (Daejeon, KR)
- Hyun Ji Lim (Daejeon, KR)
- Dong Hyun Yang (Daegu, KR)
- Sang Joo CHA (Goyang-si, KR)
Cpc classification
C07K19/00
CHEMISTRY; METALLURGY
A61K8/64
HUMAN NECESSITIES
C07C223/04
CHEMISTRY; METALLURGY
International classification
A61K8/64
HUMAN NECESSITIES
Abstract
A skin whitening method including: administering to a subject a cosmetic composition including a tranexamic acid-peptide having skin whitening activity selected from the group consisting of Tranexamil-AS, Tranexamil-AT, Tranexamil-AP, Tranexamil-GP, Tranexamil-ES, Tranexamil-KK, Tranexamil-HK, Tranexamil-MY, Tranexamil-GH, Tranexamil-MA, Tranexamil-AH, Tranexamil-CC, Tranexamil-SA, Tranexamil-WA, Tranexamil-WE, Tranexamil-KD, Tranexamil-NA, Tranexamil-TS, Tranexamil-SS, Tranexamil-EC, Tranexamil-TA, Tranexamil-PF, Tranexamil-VS, Tranexamil-VV, Tranexamil-VP, Tranexamil-AA, Tranexamil-PS, Tranexamil-HA, Tranexamil-GK, Tranexamil-KV, Tranexamil-AR, Tranexamil-RP, Tranexamil-PQ, Tranexamil-QG, Tranexamil-PP, Tranexamil-VR, Tranexamil-SV, Tranexamil-ET, Tranexamil-CG and Tranexamil-NT.
Claims
1. A skin whitening method, comprising: administering to a subject a cosmetic composition comprising a tranexamic acid-peptide having skin whitening activity selected from the group consisting of Tranexamil-AS, Tranexamil-AT, Tranexamil-AP, Tranexamil-GP, Tranexamil-ES, Tranexamil-KK, Tranexamil-HK, Tranexamil-MY, Tranexamil-GH, Tranexamil-MA, Tranexamil-AH, Tranexamil-CC, Tranexamil-SA, Tranexamil-WA, Tranexamil-WE, Tranexamil-KD, Tranexamil-NA, Tranexamil-TS, Tranexamil-SS, Tranexamil-EC, Tranexamil-TA, Tranexamil-PF, Tranexamil-VS, Tranexamil-VV, Tranexamil-VP, Tranexamil-AA, Tranexamil-PS, Tranexamil-HA, Tranexamil-GK, Tranexamil-KV, Tranexamil-AR, Tranexamil-RP, Tranexamil-PQ, Tranexamil-QG, Tranexamil-PP, Tranexamil-VR, Tranexamil-SV, Tranexamil-ET, Tranexamil-CG and Tranexamil-NT.
2. The method of claim 1, wherein the tranexamic acid-peptide inhibits melanin synthesis.
3. The method of claim 1, wherein the tranexamic acid-peptide inhibits the activity of tyrosinase.
4. The method of claim 1, wherein the tranexamic acid-peptide inhibits the expression of microphthalmia-associated transcription factor (MITF).
5. The method of claim 1, wherein the tranexamic acid-peptide has a skin whitening effect at a concentration of 0.01% to 5.0%.
6. The method of claim 1, wherein the tranexamic acid-peptide has increased stability by the tranexamic acid at its N-terminus.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
DETAILED DESCRIPTION
(11) Hereinafter, the present invention will be described in more detail with reference to examples.
(12) These embodiments are only intended to further illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention.
(13) The present inventors have examined the skin whitening effect of a tranexamic acid-peptide fusion in a peptide, to which tranexamic acid is linked, and have performed the experiments. As a result, they have discovered that some peptides in the tranexamic acid-peptide library inhibit melanin production and thus exhibit the skin whitening effect thereby completing the present invention.
(14) Accordingly, an aspect of the present invention discloses tranexamic acid-peptides, exhibiting skin whitening effect, selected from the group consisting of Tranexamil-AS, Tranexamil-AT, Tranexamil-AP, Tranexamil-GP, Tranexamil-ES, Tranexamil-KK, Tranexamil-HK, Tranexamil-MY, Tranexamil-GH, Tranexamil-MA, Tranexamil-AH, Tranexamil-CC, Tranexamil-SA, Tranexamil-WA, Tranexamil-WE, Tranexamil-KD, Tranexamil-NA, Tranexamil-TS, Tranexamil-SS, Tranexamil-EC, Tranexamil-TA, Tranexamil-PF, Tranexamil-VS, Tranexamil-VV, Tranexamil-VP, Tranexamil-AA, Tranexamil-PS, Tranexamil-HA, Tranexamil-GK, Tranexamil-KV, Tranexamil-AR, Tranexamil-RP, Tranexamil-PQ, Tranexamil-QG, Tranexamil-PP, Tranexamil-VR, Tranexamil-SV, Tranexamil-ET, Tranexamil-CG, and Tranexamil-NT.
(15) The present inventors have prepared various libraries of tranexamic acid-peptides containing tranexamic acid at their N-terminus, and have screened peptides with excellent inhibitory activity against melanin production among candidate peptides, and as a result, provide the tranexamic acid-peptides of the present invention.
(16) As used herein, the term peptide refers to a linear molecule formed of amino acid residues linked together by peptide bonds, and a tranexamic acid-peptide refers to a form in which tranexamic acid is bound to the N-terminus of the peptide.
(17) According to a preferred embodiment of the present invention, the peptide of the present invention can induce a modification by linking tranexamic acid to the N-terminus of the peptide. Through such modification, the peptide of the present invention can have a high half-life due to increased stability in vivo.
(18) According to a preferred embodiment of the present invention, a modification may be induced by linking an amino group to the C-terminus of a peptide.
(19) The above-mentioned modification of amino acids acts to significantly improve the stability of the peptide of the present invention. As used herein, the term stability not only refers to in vivo stability, but also storage stability (e.g., storage stability at room temperature). The above-mentioned protecting group acts to protect the peptides of the present invention from the attack of a protein cleaving enzyme in vivo.
(20) According to a preferred embodiment of the present invention, the peptides of the present invention did not exhibit toxicity to human-derived cells, and thus is highly useful as a peptide for skin whitening. According to the present invention, when HaCat cells and NIH3T3 cells were treated with the tranexamic acid-peptide at a concentration of 100 ng/mL to 1,000 g/mL, no significant cytotoxicity was measured, and even when shapes of these cells were confirmed by visual inspection, no significant change was observed (
(21) According to the present invention, the tranexamic acid-peptides showed excellent thermal stability even at a temperature of 50 C. and it was confirmed to be stable even in the sunlight condition (
(22) According to a preferred embodiment of the present invention, the peptides of the present invention have the ability to inhibit melanin production. According to the present invention, when melanocytes were treated with -MSH to induce melanin production, treated with the tranexamic acid-peptides of the present invention, treated with the tranexamic acid-peptides of the present invention, cultured, and the amount of melanin production was compared, the melanin production was shown to be inhibited to a level of about 50% at maximum compared to that of the control group (Table 1).
(23) According to a preferred embodiment of the present invention, the peptides of the present invention increase the melanin production in a concentration-dependent manner. According to the present invention, when cells were treated with the tranexamic acid-peptide (NA-PS) and the peptides, to which tranexamic acid was not bound, at various concentrations (1, 10, 100, and 250), cultured for 3 days, and the amount of melanin production in these cells was confirmed by visual inspection, it was confirmed that the amount of melanin production was decreased in a concentration-dependent manner (
(24) According to a preferred embodiment of the present invention, the peptides of the present invention inhibit the activity of tyrosinase. According to the present invention, when L-tyrosine, peptides, or tranexamic acid-peptides was reacted with tyrosinase, and the inhibitory rate against tyrosinase was confirmed by measuring the absorbance at 475 nm, it was confirmed that the treatment with the tranexamic acid-peptides showed a significant inhibitory effect against the activity of tyrosinase, compared to the treatment with peptides, to which tranexamic acid was not bound, and Arbutin (
(25) According to a preferred embodiment of the present invention, the peptides of the present invention inhibit the expression of microphthalmia-associated transcription factor (MITF). Melanin is produced by a series of enzymatic reactions (Olivares et al., Pigment Cell Melanoma Res 22(6): 750-760(2009)), and the major mechanism of melanin production is cell proliferation and increase of enzyme activity of tyrosinase. The most important enzyme in melanin production is tyrosinase, which is a rate-controlling factor that catalyzes the early stage in melanin biosynthesis, and tyrosine is converted into 3,4-dihydroxy-phenylalanine (DOPA) and DOPA quinone by tyrosinase, and thereby red-based melanin (pheomelanin) and brown-based eumelanin are synthesized (Lopezet et al., J Biol Chem 267: 381-390(1992)). Two other enzymes which are important in the formation of eumelanin are TRP-1 and TRP-2. Additionally, the microphthalmia-associated transcription factor (MITF) is an important element in charge of the transcription of tyrosinase and related enzymes (TRPs), and once the expression of MITF is inhibited and the production of melanin is supposed to be inhibited.
(26) According to the present invention, melanocytes were treated with -MSH and peptides (PS, VS); or -MSH and tranexamic acid-peptides (Tranexamyl-AP, Tranexamyl-HK, Tranexamyl-VS, Tranexamyl-PS) at various concentrations (1, 10, and 50), cultured for 4 days, and mRNAs were obtained from the cells and subjected to RT-PCR. As a result, it was confirmed that the treatment with the tranexamic acid-peptides inhibited the expression of the gene (MITF) associated with the melanin production (
(27) Additionally, in the case of a composition containing the peptides of the present invention, it may be used very effectively for skin whitening using various formulations.
(28) To confirm the skin whitening effect of the tranexamic acid-peptides, creams containing the tranexamic acid-peptides were prepared and subjected to clinical tests. As a result, it was confirmed that tranexamic acid-peptides have an excellent whitening effect compared to pure tranexamic acid or the control group in clinical conditions (
(29) Additionally, the second aspect of the present invention provides a skin whitening composition containing a tranexamic acid-peptide selected from the group consisting of Tranexamil-AS, Tranexamil-AT, Tranexamil-AP, Tranexamil-GP, Tranexamil-ES, Tranexamil-KK, Tranexamil-HK, Tranexamil-MY, Tranexamil-GH, Tranexamil-MA, Tranexamil-AH, Tranexamil-CC, Tranexamil-SA, Tranexamil-WA, Tranexamil-WE, Tranexamil-KD, Tranexamil-NA, Tranexamil-TS, Tranexamil-SS, Tranexamil-EC, Tranexamil-TA, Tranexamil-PF, Tranexamil-VS, Tranexamil-VV, Tranexamil-VP, Tranexamil-AA, Tranexamil-PS, Tranexamil-HA, Tranexamil-GK, Tranexamil-KV, Tranexamil-AR, Tranexamil-RP, Tranexamil-PQ, Tranexamil-QG, Tranexamil-PP, Tranexamil-VR, Tranexamil-SV, Tranexamil-ET, Tranexamil-CG, and Tranexamil-NT.
(30) The composition of the present invention may be prepared as a cosmetic composition.
(31) The tranexamic acid-peptides used as an active ingredient in the composition of the present invention are composed of 2 to 6 amino acid residues and has a very small molecular weight and thus has excellent skin permeability. Accordingly, when the composition of the present invention is topically applied to the skin, a skin whitening effect can be achieved due to a high skin penetration rate. The composition of the present invention inhibits the production of melanin, and thus it brightens skin color, keeps skin tone constant, and is effective in eliminating skin pigments and eliminating age spots. The tranexamic acid-peptides of the present invention inhibit the production of melanin pigments in keratinocytes by several processes, exhibit the effect of brightening the color of stratum corneum by preventing or weakening the release of melanin generated in keratinocytes.
(32) The composition containing the tranexamic acid-peptides according to the present invention as an active ingredient may be applied to a pharmaceutical composition in a gel type, skin type, cream type, ointment type, etc., and a cosmetic composition, but the applicable types are not limited thereto. The above composition may be appropriately prepared by a known method, by adding a conventional softener, emulsifier, thickener, or other materials known in the art.
(33) The gel-type composition may be prepared by adding a softener (e.g., trimethylolpropane, polyethylene glycol or glycerin, etc.), a solvent (e.g., propylene glycol, ethanol, isocetyl alcohol, etc.), purified water, etc.
(34) The skin-type composition may be prepared by adding fatty alcohol (e.g., stearyl alcohol, myristyl alcohol, behenyl alcohol, arachidyl alcohol, isostearyl alcohol, isocetyl alcohol, etc.), butylene glycol, glycerin, allantoin, methylparaben, edetate-2-sodium, xanthan gum, dimethicone, polyethylene glycol-60 hydrogenoate castor oil, polysorbate 60, distilled water, etc.
(35) The cream-type composition may be prepared by adding fatty alcohol (e.g., stearyl alcohol, myristyl alcohol, behenyl alcohol, arachidyl alcohol, isostearyl alcohol, isocetyl alcohol, etc.), lipids (e.g., lecithin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, etc.), derivatives thereof, emulsifiers (e.g., glyceryl stearate, sorbitan palmitate, sorbitan stearate, etc.), natural fat or oil (e.g., avocado oil, apricot oil, babassu oil, borage oil, camellia oil, etc.), a solvent (e.g., propylene glycol, etc.), distilled water, etc.
(36) The ointment-type composition may be prepared by adding a softener, an emulsifier, and waxes (e.g., microcrystalline wax, paraffin, ceresin, beeswax, spermaceti, vaseline, etc.).
(37) Additionally, the present invention may also be provided as a formulation containing one or more pharmaceutically acceptable carriers or excipients and the compositions as active ingredients.
(38) Accordingly, the formulation may include a pharmaceutically acceptable carrier, diluent, excipient, or a combination thereof, as needed. These agents facilitate the administration of the active ingredient into an organism.
(39) Hereinafter, the present invention will be described in further detail with reference to the following examples. However, the following examples are intended to illustrate the present invention and the scope of the present invention is not limited thereto.
EXAMPLES
Example 1: Synthesis of Library of Peptides
(40) To synthesize a library of peptides, chlorotrityl of chloride resin, to which nsc-amino acid (nsc-Ala, nsc-Arg(pbf), nsc-Asp(OtBu), nsc-Asn(trt), nsc-Gly, nsc-Glu(OtBu), nsc-Gln (trt), nsc-His (trt), nsc-Ser (tBu), nsc-Thr (tBu), nsc-Tyr (tBu), nsc-Trp (Boc), nsc-Leu, nsc-Ile, nsc-Val, nsc-Phe, nsc-Met, nsc-Lys(Boc), nsc-Pro) are attached (CTL resin, Novabiochem Cat No. 01-64-0021), was added to each of 19 lines of a 96-well Teflon reactor per series, and 1 mL of methylene chloride (MC) was added thereto, and stirred for 3 minutes. After removing the solution, 1 mL of dimethylformamide (DM) was added thereto and stirred for minutes, and the solvent was removed again. The prepared tranexamic acid-peptidyl resin was washed 3 times with DMF, MC, and methanol, dried by slowing flowing nitrogen gas thereto, and then completely dried in vacuum under reduced pressure over P205. 30 mL of a mixed solution [including trifluroacetic acid: TFA) 81.5%, distilled water 5%, thioanisole 5%, phenol 5%, EDT (1,2-Ethanedithiol) 2.5%, and triisopropylsilane (TIS) 1%] was added to the prepared resin, and the reaction was maintained in an ice bath for 1 hour while intermittently shaking at room temperature. The resin was filtered, washed with a small amount of TFA solution, and combined with the mother liquid. Then, tranexamic acid-peptides were obtained.
(41) As a result of synthesis and purification, 40 kinds of tranexamic acid-peptides to which peptides of mutually-different sequences were bound were obtained (Table 1). The yield of the synthesized tranexamic acid-peptides varied by the difference in physical properties due to the difference in peptide sequence, and the average yield was about 10%. During the column separation, although the elution time varied, the peak was found at the time zone of 8 minutes.
Example 2: Screening of Tranexamic Acid Peptides
(42) B16F1 cells, which are mouse melanocytes, were cultured in Dulbecco's modified Eagle's media (DMEM, Sigma), to which 10% fetal bovine serum (FBS, Sigma) was added, under 37 C. CO.sub.2 conditions. The cells were cultured in a 24-well plate at a concentration of 110.sup.5 cells/well, and the attachment of cells was confirmed. Then, the control group was not treated with anything but only a solvent was added thereto, whereas a-MSH (20 g/mL) was added to the positive control group. The remaining dishes were treated with -MSH (20 g/mL), 40 kinds of tranexamic acid-peptides, and the control group with Arbutin and AA2G, to a concentration of 1 g/mL, 10 g/mL, 100 g/mL, and 250 g/mL, respectively. Test materials were added to each dish and cultured for 3 days. After 3 days, the culture was removed by centrifugation, and the cells were lysed and intracellular melanin was collected, and observed at 490 nm to measure the amount of intracellular melanin production.
(43) 40 kinds of tranexamic acid-peptides were treated according to concentration, and their inhibitory effect against melanin production was measured. It was confirmed that the amount of melanin was rapidly reduced in the group treated with peptides to which tranexamic acid was bound, compared to the comparative group in which tranexamic acid was not bound to peptides. Additionally, in the case of 4 kinds of synthesized tranexamic acid-peptides (Tranexamil-AP, -HK, -VS, and -PS) with excellent inhibitory effect against -MSH (%), these tranexamic acid-peptides were shown to be superior to Arbutin and AA2G, which are the existing materials with a whitening function (
(44) The candidate peptides which showed good titers by screening were classified into a separate group and prepared on a large scale and subjected to experiments. Table 1 shows the results of screening the tranexamic acid-peptides.
(45) TABLE-US-00001 TABLE 1 -MSH Inhibitory No. Species Ability (%) 1 Control (No Treatment) 100 2 Dipeptide-1 AS 98 3 Dipeptide-2 AT 88 4 Dipeptide-3 AP 41 5 Dipeptide-4 GP 80 6 Dipeptide-5 ES 80 7 Dipeptide-6 KK 83 8 Dipeptide-7 HK 32 9 Dipeptide-8 MY 78 10 Dipeptide-9 GH 70 11 Dipeptide-10 MA 56 12 Dipeptide-11 AH 82 13 Dipeptide-12 CC 83 14 Dipeptide-13 SA 81 15 Dipeptide-14 WA 65 16 Dipeptide-15 WE 78 17 Dipeptide-16 KD 81 18 Dipeptide-17 NA 79 19 Dipeptide-18 TS 75 20 Dipeptide-19 SS 80 21 Dipeptide-20 EC 61 22 Dipeptide-21 TA 76 23 Dipeptide-22 PF 89 24 Dipeptide-23 VS 24 25 Dipeptide-24 VV 72 26 Dipeptide-25 VP 69 27 Dipeptide-26 AA 92 28 Dipeptide-27 PS 28 29 Dipeptide-28 HA 87 30 Dipeptide-29 GK 96 31 Dipeptide-30 KV 83 32 Dipeptide-31 AR 93 33 Dipeptide-32 RP 87 34 Dipeptide-33 PQ 71 35 Dipeptide-34 QG 85 36 Dipeptide-35 PP 85 37 Dipeptide-36 VR 70 38 Dipeptide-37 SV 64 39 Dipeptide-38 ET 52 40 Dipeptide-39 CG 92 41 Dipeptide-40 NT 84 42 TXA 45
Example 3: Experiment for Confirming Stability of Tranexamic Acid-Peptides
(46) To confirm the thermal stability and photostability of the prepared peptides, Tranexamyl-AP, Tranexamyl-HK, Tranexamyl-VS, and Tranexamyl-PS, which have high purity of at least 98% purified using HPLC, were dissolved in 50 mM Tris-HCl (pH 8.0) buffer to have a concentration of 100 g/mL, aliquoted into glass vials, and stored at 50 C. for 7, 14, 21, 28, 35, 42, and 60 days, and the loss of peptides by heat was measured, and the stability was measured under the sunlight condition using the same method (
Example 4: Confirmation of Whitening Effect of Tranexamic Acid-Peptides
(47) Tranexamic acid-peptides were treated according to concentration and their inhibitory effect against melanin production was measured. The mouse melanocytes were cultured in Dulbecco's modified Eagle's media (DMEM, Sigma) containing 10% fetal bovine serum (BSA, Sigma) under 37 C. CO.sub.2 conditions.
(48) The cells were cultured in a 24-well plate at a concentration of 110.sup.5 cells/well, and the attachment of cells was confirmed. Then, the control group was not treated with anything but only a solvent was added thereto, whereas a-MSH (20 j) was added to the positive control group. The remaining dishes were treated with -MSH (20 g/mL), 4 kinds of tranexamic acid-peptides, and the control group with Arbutin and AA2G, to a concentration of 1 g/mL, 10 g/mL, 100 g/mL, and 250), respectively. Test materials were added to each dish and cultured for 3 days. After 3 days, the culture was removed by centrifugation, and the amount of intracellular melanin production was confirmed by visual inspection.
(49)
Example 5: Decrease of Tyrosinase Activity by Tranexamic Acid-Peptides
(50) Tyrosinase, an enzyme known to be involved in the biosynthesis of melanin, acts as a catalyst in the process of melanin biosynthesis starting from L-tyrosine, and in the oxidation processes of from tyrosine to 3,4-dihydroxy-L-phenylananine (DOPA) and from DOPA to dopaquinone. Since the subsequent reactions after these two oxidation reactions occur spontaneously, the reactions in which tyrosinase is involved determine the entire reaction rate. For this reason, tyrosinase inhibitory activity is a very important factor in evaluating whitening activity. In this experiment, in vitro tyrosinase inhibitory activity of synthesized tranexamic acid dipeptides was compared (
(51) L-tyrosin, as a substrate, was dissolved in a phosphate buffer (0.05 M, pH 6.8) to a concentration of 1.5 mM, and the resulting solution (0.01 mL) was added to a 0.3 mL spectrophotometer cuvette and 0.01 mL of L-DOPA (cofactor), which was prepared at a concentration of 0.06 mM, was added thereto. The peptides of the present invention were added thereto and the phosphate buffer solution was added to 0.1 mL. The reaction was performed by adding thereto 0.1 mL of an enzyme solution, in which tyrosinase was dissolved in a phosphate buffer at 60 U/mL. Additionally, each of Arbutin, tranexamic acid-peptides, and peptides, to which tranexamic acid is not bound, was added in an amount of 100 ppm to perform a comparative experiment. In particular, as the control group (blank), only 0.1 mL of a buffer was added instead of tyrosinase. The reaction was performed at 37 C. for 10 minutes, and the absorbance was measured at 475 nm using a spectrophotometer (Beckman DU-7500) to obtain the inhibition rate against tyrosinase (
Example 6: Experiment on Cytotoxicity
(52) To confirm whether the peptides of the present invention had cytotoxicity in the keratinocytes, the cytotoxicity was evaluated using the MTT assay. HACAT cells and 3T3 cells were seeded to each well of a 24-well plate at a concentration of 410.sup.4 cells/24 well, and cultured at a constant temperature under 37 C. CO.sub.2 conditions. The culture was washed twice with PBS, cultured, and treated with the synthesized tranexamic acid dipeptides at various concentrations (1 mg/mL to 1 g/mL), and cultured at the constant temperature for 24 hours. After the cultivation, the MTT 0.5% in DPBS was mixed with culture medium at 1:9 (v/v) ratio and added thereto, and cultured in a CO.sub.2 incubator for 2 hours. The produced formazan was dissolved in DMSO and its absorbance was measured at 570 nm by ELISA. As can be seen in
(53) From the above results, it was confirmed that tranexamic acid-peptides have no cytotoxicity on skin-related cells, and thus, it can be expected that these peptides of the present invention can be safely administered to the skin without causing any serious effect.
Example 7: Inhibition of Melanin-Producing Markers
(54) To more clearly verify the whitening activity of tranexamic acid-peptides in mouse melanoma cells induced melanin production by -MSH treatment, the RNA production of microphthalmia-associated transcription factor (MITF) was confirmed by real-time reverse transcription polymerase chain reaction (qRT-PCR).
(55) First, the B16F10 cells cultured in Example 2 were treated with two kinds of tranexamic acid-peptides (TXA-VS and TXA-PS) at a concentration of 0.1% and 0.05%, respectively. Then, for the real-time PCR measurement, RNA samples were extracted as follows.
(56) The extraction was performed using intron RNA extraction kit (Intron Inc., Korea). Specific experimental methods are as follows.
(57) (1) 110.sup.6 cells in a 1.5 mL tube
(58) (2) Remove medium by centrifugation at 13,000 rpm for 10 seconds, and
(59) (3) Add 1 mL of a lysis buffer.
(60) (4) Vigorously vortex.
(61) (5) Add 200 L of chloroform and vortex.
(62) (6) Centrifuge at 13,000 rpm at 4 C. for 10 minutes. Transfer 400 L to an empty tube.
(63) (7) Add 400 L of a binding buffer along with a Mix, and smoothly pipettes 2 or 3 times
(64) (8) Place onto a column.
(65) (9) Centrifuge at 13,000 rpm for 30 seconds.
(66) (10) Wash with 700 L of buffer A
(67) (11) Close the cap of the tube and centrifuge at 13,000 rpm for 30 seconds.
(68) (12) Repeat 10 to 11 times with buffer B.
(69) (13) Dry at 13,000 rpm for 1 to 2 minutes.
(70) (14) Add 50 L of an elution buffer to the column and incubate at room temperature for 1 minute.
(71) (15) Centrifuge at 13,000 rpm for 1 minute.
(72) Real-time PCR was performed to confirm the expression amount of MITF using the extracted RNA, and the reagents and conditions used in the experiment are as follows.
(73) Real-time PCR reagent: RealMODgreen qRT-PCR Mix (INTRON Inc.)
(74) Primer: MITF, GAPDH (prepared by Bioneer Corporation)
(75) PCR primer sequence, PCR mix composition, and PCR reaction conditions are shown in Tables 2, 3, and 4, respectively.
(76) TABLE-US-00002 TABLE 2 Primer name SEQUENCE (5-.fwdarw.3) fMITF GGCCAAGGCAGAGCAACTT (SEQ ID NO: 1) rMITF GCCCATGGTGGCAAGCT (SEQ ID NO: 2) fGAPDH ATCCCATCACCATCTTCCAG (SEQ ID NO: 3) rHAPDH CCATCACGCCACAGTTTCC (SEQ ID NO: 4)
(77) TABLE-US-00003 TABLE 3 1x qRT-PCR 10 10 E.sub.n2 Mix 0.4 0.4 primer 1 1 primer 2 1 RNA 1 1 Water 8.6 6.6 Total 20 L
(78) TABLE-US-00004 TABLE 4 temp. ( C.) times cycles cDNA synthesis 42 15 mins 1 Enzyme activation 95 10 mins 1 Denaturation 95 15 sec 45 annealing/extension 45 60 sec 45
(79) As a result of the experiment, as shown in
Example 8: Gel-Type Compositions Containing Tranexamic Acid-Peptides
(80) Gel-type compositions, which contain one or a plurality of tranexamic acid-peptides prepared in Example 2 and consist of the compositions in Table 2 below, were prepared according to the synthesis method of common gel-type compositions.
(81) TABLE-US-00005 TABLE 5 Ingredient Weight (%) Tranexamic acid-peptide 1 Carboxyvinyl polymer 1.0 Triethanolamine 1.0 Butylene glycol 5.0 Glycerin 10.0 Hydrogenated 1.0 Preservative, Fragrance adequate amount Distilled water remaining amount Total 100
Example 9: Skin-Type Compositions Containing Tranexamic Acid-Peptides
(82) Skin-type compositions, which contain one or a plurality of tranexamic acid-peptides prepared in Example 2 and consist of the compositions in Table 3 below, were prepared according to the synthesis method of common skin-type compositions.
(83) TABLE-US-00006 TABLE 6 Ingredient Weight (%) Tranexamic acid-peptide 1 Concentrated glycerin 10 Propylene glycol 10 Polyoxyethylene 1.0 hydrogenated castor oil (E040) Aqueous solution of 5.0 sodium hyaluronate (1%) Ethanol 5.0 Preservative, Fragrance adequate amount Distilled water remaining amount Total 100
Example 10 Cream-Type Composition Containing Tranexamic Acid-Peptides
(84) Gel-type compositions, which contain one or a plurality of tranexamic acid-peptides prepared in Example 2 and consist of the compositions in Table 4 below, were prepared according to the synthesis method of common gel-type compositions.
(85) TABLE-US-00007 TABLE 7 Ingredient Weight (%) Tranexamic acid-peptide 1 Stearyl alcohol 6.0 Stearic acid 2.0 Concentrated glycerin 1.0 Squalane 9.0 1,3-butylene glycol 6.0 Polysorbate 60 1.5 Polyethylene glycol 1000 4.0 Hydrogenated Lanolin 4.0 Octyldodecanol 10.0 Sorbitan stearate 0.8 Triethanolamine 0.5 Preservative, Fragrance adequate amount Distilled water remaining amount Total 100
(86) Experimental Example: Clinical Test
(87) Among the 4 kinds of tranexamic acid-dipeptides which showed high inhibitory effects against melanin synthesis in Example 2, two kinds (VS and PS) were selected, and thereby two kinds of creams containing 1% of tranexamic acid-dipeptides were prepared to have the same composition as in Example 10 below, and to confirm the skin whitening effect of these peptides, 54 women who had skin pigmentation but without an organic disease were collected. In particular, a cream containing tranexamic acid was used as the positive control group and the standard base cream was used as the negative control group.
(88) The face of each subject was divided into two parts vertically and the two kinds of creams prepared above were applied to each face. The subjects were required to continuously use the creams in the morning and evening, 2 times a day for 8 weeks after washing the face.
(89) For the objective evaluation of changes in skin pigmentation before and after the use of the creams, the changes in pigmentation were measured using the Mexameter (CK, Germany) before the use of the creams, 2 weeks, 4 weeks, 6 weeks, and 8 weeks after the use of the creams. The measurement results are shown in
(90) As shown in
(91) As a result of the above experiment, the tranexamic acid-dipeptide with a greater effect between the two kinds of tranexamic acid-dipeptides, was selected and, as an attempt to reduce the content in the cream, a cream containing 0.5% tranexamic acid-dipeptide was prepared. Ten women subjects were collected and the 8-week clinical experiment was performed in the same manner as described above.
(92) As shown in
(93) Although the particular features of the present invention are described in detail above, it is apparent to those of ordinary skill in the art that these specific descriptions are only preferred embodiments and the scope of the present invention is not limited by these embodiments. Accordingly, the actual scope of the present invention will be defined by the appended claims and equivalents thereof.