Modified L-Nucleic Acid

Abstract

A modified L-nucleic acid, containing an L-nucleic acid part conjugated to a non-L-nucleic acid part is described. The conjugate has extended retention time in and demonstrates a delayed elimination from an organism.

Claims

1. (canceled)

2. A modified L-nucleic acid, comprising a L-nucleic acid part and a non-L-nucleic acid part, wherein the L-nucleic acid part is conjugated with the non-L-nucleic acid part, and the conjugation of the L-nucleic acid part with the non-L-nucleic acid part leads to an increased retention time in an organism or a retarded excretion from an organism compared to a L-nucleic acid comprising only the L-nucleic acid part, and wherein said L-nucleic acid part is a spiegelmer.

3. The modified L-nucleic acid of claim 2, wherein the non-L-nucleic acid part has a molecular weight of more than about 300 Da.

4. The modified L-nucleic acid of claim 2, wherein the modified L-nucleic acid has a molecular weight of about 600 to 500,000 Da.

5. The modified L-nucleic acid of claim 2, wherein the L-nucleic acid part has a molecular weight of 300 to 50,000 Da.

6. The modified L-nucleic acid of claim 2, wherein the non-L-nucleic acid part is linked to the L-nucleic acid part via a functional group of the L-nucleic acid part, wherein the functional group is selected from the group consisting of terminal and non-terminal phosphates, terminal and non-terminal sugar portions, natural and non-natural purine bases, and natural and non-natural pyrimidine bases.

7. The modified L-nucleic acid of claim 6, wherein the linkage of the non-L-nucleic acid part with the L-nucleic acid part is via the 2-OH, 3-OH, 5-OH-group or a derivative therefrom, or one or more sugars of the L-nucleic acid part.

8. The modified L-nucleic acid of claim 6, wherein the linkage is via at least one of the positions 5 or 6 of a pyrimidine base.

9. The modified L-nucleic acid of claim 6, wherein the linkage is via a purine base.

10. The modified L-nucleic acid of claim 6, wherein the linkage is at one or more of the exocyclic amine groups, endocyclic amine groups or keto groups of a purine or pyrimidine base or a basic position.

11. The modified L-nucleic acid of claim 2, wherein the non-nucleic acid part is selected from the group consisting of linear poly (ethylene) glycol, branched poly (ethylene) glycol, hydroxyethyl starch, a peptide, a protein, a polysaccharide, a sterol, polyoxypropylene, polyoxyamidate, poly (2-hydroxyethyl)-L-glutamine and polyethylene glycol.

12. The modified L-nucleic acid of claim 2, wherein a linker is arranged between the L-nucleic acid part and the non-L-nucleic acid part.

13. The modified L-nucleic acid of claim 2, wherein said linker is a 6-aminohexylphosphate at the 5-OH end.

14. The modified L-nucleic acid of claim 13, wherein polyethylene glycol is coupled to the free amine of the aminohexylphosphate linker.

15. The modified L-nucleic acid of claim 2, wherein the molecular weight is more than about 20,000 Da.

16. The modified L-nucleic acid of claim 2, wherein the molecular weight is more than 40,000 Da.

17. The modified L-nucleic acid of claim 9, wherein said linkage occurs at the 8 position.

18. A pharmaceutical composition comprising the modified L-nucleic acid of claim 2 and a pharmaceutically acceptable carrier, excipient or diluent.

19. A method for preparing the modified L-nucleic acid of claim 2, comprising the steps: (a) providing an L-nucleic acid; (b) providing a non-L-nucleic acid; (c) reacting the L-nucleic acid from (a) and the non-L-nucleic acid from (b); and (d) optionally isolating the modified L-nucleic acid obtained in step (c) wherein the L-nucleic acid part is a Spiegelmer.

20. The method of claim 19, wherein the L-nucleic acid in step (a) comprises a linker.

21. The method of claim 19, wherein after providing the L-nucleic acid in step (a), a linker is provided.

Description

[0071] In the following, the invention is illustrated further by the figures and examples from which further advantages, embodiments and features of the invention ensue.

[0072] FIG. 1 shows an hexylamine linker, that has a linear spacer (means for distance keeping) consisting of six carbon atoms as well as a terminal amino group and a terminal phosphate residue. The substitution denoted with R may present here also a nucleic acid, and the L-nucleic acid part of a modified L-nucleic acid, respectively. Via the amino group the non-L-nucleic acid part may be coupled onto the L-nucleic acid part and thus the modified L-nucleic acid according to the invention be formed.

[0073] FIG. 2 shows further linkers, wherein the structures referred to as (2), (4), and (6) correspond to linker according to (1), (3) and (5), wherein in the latter the phosphate part provided with residue R represents preferably the L-nucleic acid part, and the non-L-nucleic acid part of the modified L-nucleic acid is coupled via the functional group called X onto the L-nucleic acid. The term oligo stands exemplaryly for an oligonucleotide, wherein it is within the scope of the present invention, that this and the L-nucleic acid or the L-nucleic acid parts, respectively, herein may be generally L-polynucleotides. The various substituents refer herein to the following reactive groups, that are individual and each independent from each other: [0074] XOH, NH.sub.2, HS, Hal, CHO, COOH [0075] YO, NH, NMe, S, CH.sub.2 [0076] Z.sub.1, Z.sub.2, Z.sub.3, Z.sub.4, Z.sub.5 and Z.sub.6 H, Me, Alkyl, HO(CH.sub.2), HO, H.sub.2N(CH.sub.2).sub.n, H.sub.2N, F, wherein n is an integer between 1 and 20 and wherein Alkyl refers to linear and branched hydrocarbon chains with preferably 1-20 C-atoms, more preferably 1 to 4 C-atoms and/or (CH.sub.2).sub.nH, CH[(CH.sub.2).sub.nH][(CH.sub.2).sub.mH], C[(CH).sub.nH][(CH.sub.2).sub.mH][(CH.sub.2).sub.lH], (CH.sub.2).sub.n(CH).sub.m[(CH.sub.2).sub.lH][(CH.sub.2).sub.kH], (CH.sub.2).sub.n(C).sub.m[(CH.sub.2) H][(CH.sub.2).sub.kH][(CH.sub.2).sub.jH], wherein n, m, l, k und j are integers independent from each other between 1 and 8, preferably 1 to 4 C-atoms.

[0077] FIG. 3 shows an overview of different linkers, that are coupled to different positions of the nucleobases. Thereby, it is notable that the sugar portion of the nucleoside shown in each case may be a ribose, a deoxyribose or a modified ribose and modified deoxyribose, respectively, and the residue X may be H, HO, H.sub.2N, MeO, EtOH or alkoxy. Thereby, alkoxy, in particular, refers to linear and branched oxyhydrocarbon chains with 1-20 C-atoms, preferably 1 to 4 C-atoms and/or O(CH.sub.2).sub.nH, CH[(CH.sub.2).sub.nH][(CH.sub.2).sub.mH], OC[(CH).sub.nH][(CH).sub.mH][(CH.sub.2).sub.lH], O(CH.sub.2).sub.n(CH).sub.m[(CH.sub.2).sub.lH][(CH.sub.2).sub.kH], (CH.sub.2).sub.n(C).sub.m[(CH.sub.2).sub.lH][(CH).sub.kH][(CH.sub.2).sub.jH], wherein n, m, l, k und j are integers independent from each other between 1 and 8, preferably 1 to 4 C-atoms. The actual linker structure is X.sub.1-[X].sub.n in all four nucleosides (1), (2), (3) and (4) shown, wherein n is an integer between 0 and 20. X.sub.1 represents a functional group that is selected from the group comprising HO, H.sub.2N, HRN, HS, SSR, Hal, CHO, COOH, COOR and COHal. In the linkers denoted as structural formulas (5-12) n is an integer between 0 and 20 as well, and Z means independently from other substituents either O, NH, NR or S, wherein R stands for alkyl as defined herein.

[0078] FIG. 4 shows possible linkers at position 5 of pyrimidine nucleosides and nucleotides, respectively. With regards to residues R, R and R basically applies what was said herein in the context of FIG. 5. The linker R has the structure [Y].sub.nX.sub.1 and may preferably acquire the forms shown in structures (2) to (9), wherein Z may mean 0, NH, NHR or S here too, independently of the choice of the other substituents, and n may be an integer between 1 and 20. The functional group X.sub.1 is preferably selected from the group that has HO, H.sub.2N, HRN, HS, SSR, Hal, CHO, COOH, COOR, COHal.

[0079] FIG. 5 shows in 1 the basic structure of cytosine, which may have different linker structures at its exocyclic amine. Thereby R refers to a L-nucleic acid or a L-polynucleotide, OH, or phosphate, R to a L-nucleic acid or a L-polynucleotide, OH or phosphate and R to H, OH, OMe, OEt, NH.sub.2. The residue R refers thereby to the linker, which has the basic structure [Y].sub.nX.sub.1 and may have the structural formulas shown in (2) to (9), wherein ZO, NH, NR, S and n may be an integer between 1 and 20. The functional group X.sub.1 is preferably selected from the group that has HO, H.sub.2N, HRN, HS, SSR, Hal, CHO, COOH, COOR, COHal.

[0080] FIG. 6 shows the formation of a modified L-nucleic acid according to the invention by reaction of PEG-NHS with a L-nucleic acid provided with a linker. After successful coupling the modified L-nucleic acid is present, that comprises in the present case PEG as the non-L-nucleic acid part and in this actual case an oligonucleotide as L-nucleic acid, wherein a linker or a spacer, respectively, carrying an amino group is inserted between both, and it comes to an acid amid binding between the linker and the PEG. Apart from the modified L-nucleic acid the N-hydroxysuccinimide split off the PEG is obtained as a further reaction product. As possible residues R, H, CH.sub.3 and in general alkyl chains with a length of 1-20 are preferred. The functional group may in principle be the product of any one of the reactions explained herein above. Insofar, the embodiments of the linker described in association with the further figures, in particular FIGS. 2 and 3, apply also to this context. The same applies to the substituents and control variables like n depicted in the formula.

[0081] FIG. 7 shows the conversion of different PEG derivatives with different linkers. Here, the two reactions (1) and (2) differ only in that in reaction (1) the carboxyl group is present at the PEG and in reaction (2) the carboxyl group is present at a L-oligonucleotide provided with a linker. The functional group of the respective corresponding reaction partner, i.e. in the case of reaction (1) the L-nucleic acid provided with a linker, and in the case of reaction (2) the PEG provided with an amine group. Thus the statement is confirmed, that was made in the context of the different reactions as above, which are possible between a L-nucleic acid part and a non-L-nucleic acid part, if applicable with participation of one or more inserted linkers, that in principle the mentioned reactive groups may be present in all reaction partners that are involved. The finally obtained structures will differ from each other correspondingly, so that in case of reaction (1), where an acid amide group is present at the PEG, and in the case of reaction (2), where the acid amide binding is present at the construct from linker and oligonucleotide, i.e. the L-nucleic acid. With regard to the substituents R applies what was said in the context of FIG. 6, correspondingly.

[0082] FIG. 8 shows the reaction of a halogenide with a thioester, that are attached either to the non-L-nucleic acid part or to the L-nucleic acid part, respectively. In the reactions (1) to (3) it is intended that the L-nucleic acid, here as in all figures abbreviated as oligo, is provided with a linker, and that the linker carries a halogenide, as for example I, Br, Cl. This derivatised L-nucleic acid is thereupon reacted with a PEG provided with a thiol group, preferably a terminal thiol group. In the case of reaction (1) a thioether bond between linker and PEG will occur. By oxidation it may result, as depicted in reaction (2), in the formation of a sulphoxide or a sulphone, respectively. In the reactions according to (4) to (6) also a reaction between a thiol and a halogenide occurs, wherein in these cases the L-nucleic acid is provided with the thiol group, and the linker carries the halogenide. Correspondingly, a formation of compounds occurs, wherein the sulphur is arranged between the L-nucleic acid and the linker, and it may be oxidised, as shown in the reactions (5) and (6), again into the corresponding derivatives.

[0083] FIG. 9 shows the reaction of the PEG provided with a maleimide group with a L-nucleic acid, there referred to as oligo, that has an linker carrying a thiol group. The reaction product is a thioether.

[0084] FIG. 10 shows the reaction of a L-nucleic acid carrying a phosphate group with a PEG, which is provided with a linker carrying a thiol group. The reaction product is a phosphothioate.

[0085] FIG. 11 shows the reaction of a L-nucleic acid provided with a phosphate residue, terminal if applicable, with a PEG, which is provided with a linker having an amine. The reaction product is a phosphoamidate. Regarding the residue R it applies what was elaborated on in the context of FIG. 6.

[0086] FIG. 12 shows the insertion of a reactive amino or thiol group, respectively, into a L-nucleic acid using an activate phosphate group, preferably a terminal phosphate group of the L-nucleic acid. Here, a phosphorimidazolide (I) is made in a first step, which leads to the formation of a 2-aminoethylene-1-phosphoramidate (II) in the case of reaction (2) using an ethylenediamine, or in the case of the reaction (3) using cysteamine to 2-thioethylene-1-phosphoamidate (III), respectively. The compounds according to (II) and (III) may be reacted thereupon with non-L-nucleic acids, particularly with those disclosed herein.

[0087] FIG. 13 shows the reaction of a PEG provided with a sulphonyl chloride group with a L-nucleic acid that has a linker carrying an amine group. The reaction product is a sulphonamide. Regarding the residue R it applies what was-elaborated on in the context of FIG. 6.

[0088] FIG. 14 shows the reaction of a PEG provided with an epoxide group with a L-nucleic acid that has a linker carrying an amine group forming an amine. Regarding the residue R it applies what was elaborated on in the context of FIG. 6.

[0089] FIG. 15 shows the reaction of a PEG provided with an epoxide group with a L-nucleic acid that has a linker provided with a thiol group. The reaction product is a thioether.

[0090] FIG. 16 shows the reaction of a PEG provided with an isothiocyanate group with a L-nucleic acid that has a linker carrying an amine group. The reaction product is an isothiourea. Regarding the residue R it applies what was elaborated on in the context of FIG. 6.

[0091] FIG. 17 shows the reaction of a PEG provided with an isocyanate group with a L-nucleic acid that has a linker carrying an amine group forming an isourea. Regarding the residue R it applies what was elaborated on in the context of FIG. 6.

[0092] FIG. 18 shows the reaction of a PEG provided with an isocyanate group with a L-nucleic acid that carries a free OH group, that may directly come from the L-nucleic acid, as for example from a phosphate group or the sugar moiety of the nucleoside, i.e. the positions 2-OH, 3-OH, or 5-OH. Alternatively, the OH group may be linked to the L-nucleic acid via a suitable linker. The reaction product is a carbamate.

[0093] FIG. 19 shows the reaction of an aldehyde or keto group with an amino group, which is present in each case either at the non-L-nucleic acid part. (reaction (1)), in the case shown at PEG; or at the L-nucleic acid part (reaction (2)). Preferably here, the L-nucleic acid part has a linker carrying the respective reactive group, i.e. the amino group or the carbonyl group. In the case of the reaction (1) the PEG carries a amino group, whereas the L-nucleic acid has a linker carrying the carbonyl group. The reaction product obtained directly, imine, is converted thereupon into an amine by reduction. In case of the reaction (2) the PEG carrying a carbonyl group is reacted with L-nucleic acid, that carries a linker having an amino group. The reaction product imine is reduced and leads to an amine. Regarding the residue R it applies what was elaborated on in the context of FIG. 6.

[0094] FIG. 20 shows the reaction of a PEG provided with a thiol group with a L-nucleic acid carrying a linker provided with a thiol group as well. The reaction product is a modified L-nucleic acid, that has a disulphide group between the PEG and the L-nucleic acid, strictly speaking the linker attached to it.

[0095] FIG. 21 shows the reaction of a PEG provided with a hydrazine group with a L-nucleic acid that carries a linker comprising a carbonyl group. In a fist step of the reaction a hydrazone is obtained, which is thereupon converted reductively into a substituted hydrazine. Regarding the residue R it applies what was elaborated on in the context of FIG. 6.

[0096] FIG. 22 shows in reaction (1) the conversion of a PEG provided with a conjugated diene with a L-nucleic acid that carries a linker with a so-called dienophilic group. The dienophile consists of a CC-double bond, which in turn has a substituent Z comprising an electron-withdrawing group. These may be preferably NO.sub.2, CH.sub.2Cl, COOR, CN or maleimide. Regarding the residue R it applies what was elaborated on in the context of FIG. 6. Due to this reaction the formation of a modified L-nucleic acid occurs that has a hexeneyl group between the PEG and the L-nucleic acid provided with a linker. The Diels-Alder reaction shown in reaction (2) starts with a PEG which has a dienophile with a substituent Z that reacts with a L-nucleic acid comprising a linker which carries, a conjugated diene. Regarding the substituent Z it applies what was elaborated on in the context of reaction (1). The reaction product in this reaction (2) is also a L-nucleic acid conjugate linked via a hexeneyl group.

[0097] FIG. 23 shows the structure of the branched and linear mPEG-NHS ester that were used.

[0098] FIG. 24 shows in (1) the basic assembly of an abasic L-nucleoside, which instead of the nucleobase may have either a hydrogen atom or one or more optionally different linker structures. Here R denotes a L-nucleic acid or a L-polynucleotide, OH or phosphate, R a L-nucleic acid or a L-polynucleotide, OH or phosphate and XH, OH, OMe, OEt, NH.sub.2. The residue R denotes either the hydrogen atom instead of the nucleobase or the linker, which may have the structural formulas shown in (2) to (8), wherein ZCH.sub.2, O, NH, NR, S and n may be an integer between 1 and 20. The functional group X.sub.1 is preferably selected from the group that has HO, H.sub.2N, HRN, HS, SSR, Hal, CHO, COOH, COOR, COHal.

[0099] FIG. 25 shows an activity test of a PEGylated DNA spiegelmer binding GnRH in male orchidectomised rats.

[0100] FIG. 26a shows an activity test of a PEGylated DNA spiegelmer binding GnRH in vitro.

[0101] FIG. 26b shows an activity test of a non-PEGylated and PEGylated DNA spiegelmer binding GnRH in vitro.

[0102] FIG. 27 shows the pharmacokinetics of a PEGylated DNA spiegelmer binding GnRH in rats.

[0103] FIG. 28a shows a pharmacokinetical profile of PEGylated L-RNA after intravenous dose in rate.

[0104] FIG. 28b shows a pharmacokinetical profile of non-PEGylated L-RNA after intravenous dose in rats.

[0105] FIG. 28c shows a pharmacokinetical profile of PEGylated L-RNA after subcutaneous dose in rats.

[0106] FIG. 28d shows a pharmacokinetical profile of non-PEGylated L-RNA after subcutaneous dose in rats.

[0107] FIG. 29 shows an activity test of a DNA spiegelmer binding GnRH in male orchidectomised rats in vivo.

EXAMPLE 1: SYNTHESIS OF PEG CONJUGATES OF L-NUCLEIC ACIDS

[0108] The conditions for the synthesis of PEG conjugates of L-nucleic acids were examined starting from the L-nucleic acid depicted in SEQ ID NO: 2 and PEG, wherein the PEG was modified such that it was present either as a NHS ester or as a primary amine for the coupling onto an amine and a phosphate, respectively. It was proceeded in a way that the nucleic acid was dissolved in an aqueous system. The pH was adjusted to pH 6.5-9.0 by different buffers or bases like, for example NaHCO.sub.3, NaH.sub.2PO.sub.4/Na.sub.2HPO.sub.4, HEPES, MOPS, NH.sub.4OAc, triethylamine. The influence of addition of different organic solvents, as for example DMF, DMSO, acetonitrile and others was tested, wherein the portion of the organic solvent was varied between 0-100%. Subsequently the addition of different PEG derivatives occurred, as for example branched mPEG.sub.2-NHS ester, linear mPEG-NHS eater or mPEG-NH.sub.2 (Shearwater Corporations) of different molecular weights between 10,000 Da und 40,000 Da. The addition of PEG-NHS ester may be done in different ways. Thus, PEG-NHS eater may be dissolved for example in an acid of low concentration such as, for example 0.01 N HCl, or may be added in drops being dissolved in an organic solvent such as DMF or added as a solid. The preferred way of adding PEG-NHS is as a solid in portions. Further, the influence of the reaction temperature between 4 C.-65 C. was tested. As nucleic acids were used nucleic acids with the following sequence 5-NH.sub.2-TAT TAG AGA C-3 (SEQ ID NO: 2), and 5-PO.sub.4-TAT TAG AGA C-3 (SEQ ID NO: 3) as well as the nucleic acid according to SEQ ID NO: 1. The yields of the reactions summarised above were between 5-78%.

[0109] The preferred variant of reaction was the addition of two equivalents each of solid PEG-NHS eater in intervals of around 30 minutes, six times altogether, to a nucleic acid dissolved in a solvent consisting of 60 parts H.sub.2O and 40 parts DMF adding NaHCO.sub.3 (0.2 M), a pH of 8.0 and 37. The reaction conditions lead to a yield of 78%.

EXAMPLE 2: SYNTHESIS OF A PEG CONJUGATE OF A L-NUCLEIC ACID PHOSPHOAMIDATE

[0110] Starting from a L-nucleic acid with the sequence 5-PO.sub.4-TAT TAG AGA C-3 (SEQ ID NO: 3) a corresponding phosphoamidate PEG conjugate was made. The L-nucleic acid (10 OD) was reacted with PEG-NH.sub.2 (20,000 Da, linear, 1-10 equivalents) in aqueous solution with EDCI at 50 C. to a PEG conjugate of a L-nucleic acid phosphoamidate. The analysis and purification was done analogously to that of the PEGylation of L-nucleic acids with PEG-NHS, as described in example 1. The reaction conditions were not optimised and led to a yield of <8%.

EXAMPLE 3: PEGYLATION OF A GNRH SPIEGELMER LIGAND

[0111] The peptide hormone GnRH I (gonadotropin releasing hormone, gonadoliberine), which is generally referred to as GnRH, is a dekapeptide made in the hypothalamus which stimulates the secretion of the gonadotropin hormones luteinising hormone and follicle stimulating hormone (FSH) by the pituitary gland. GnRH is secreted from the neurons of the hypothalamus in a pulsating manner and then binds to a receptor on the cell surface of the pituitary gland. The ligand receptor complex is internalised, whereby a release of FSH and LH occurs, which in turn stimulate the production of sexual hormones such as estrogen, progesteron or testosteron. A spiegelmer, i.e. a L-nucleic acid could be produced that binds specifically to GnRH and has the following sequence:

TABLE-US-00001 (SEQIDNO:1) 5-CCAAGCTTGCGTAAGCAGTCTCCTCTCAGGGGAGGT TGGGCGGTGCGTAAGCACCGGTTTGCAGGGG-3

[0112] The synthesis of the spiegelmer of the sequence shown above was performed on an Amersham Pharmacia Biotech Oligopilot II DNA synthesiser in 780 pMol scale on a 1,000 CPG solid phase (Controlled Pored Glass) according to the 2-cyanoethyl-phosphoramidit chemistry (Sinha et al. NAR, 12, 1984, p. 4539ff). Subsequently, a 6-(monomethoxytritylamino)-hexyl-(2-cyanoethyl)-(N,N-diiospropyl)-phosphoramidit was linked to the 5 end of the spiegelmer (5-MMT-aminohexyl spiegelmer), to allow the post-synthesis conjugation with PEG.

[0113] After completion of the synthesis the 5-MMT aminohexyl spiegelmer was cleaved from the solid phase by an 8 hour incubation in 33% ammonia solution at 65 C., and deprotected completely, afterwards concentrated to dryness, taken up into 10 mM NaOH and purified by means of RP-HPLC. The cleavage of the monomethoxytrityl protection group occurred with 0.4% trifluoracetic acid (TFA) in 30 min at RT. TFA was removed by twofold coevaporation with ethanol and the 5-aminohexyl spiegelmer according to SEQ ID NO: 1 was purified by precipitation in ethanol (yield: 5.000 OD, 7.5 mol). The product peak was collected and desalted by means of size-exclusion chromatography via a Sephadex G10 column or by ultrafiltration (Labscale TFF System, Millipore).

[0114] The GnRH spiegelmer 5amino-modified in such a way (5,000 OD, 7.5 mol) was prepared in 0.2 M NaHCO.sub.3, pH 8.5/DMF 60:40 (v/v) (125 mL), warmed to 37 C. and powdery N-hydroxysuccinimidyl (NHS) activated eater of branched 40.000 Da poly (ethylen) glycol was added in portions (2 eq (equivalents) every 30 min, altogether 12 eq, (6600 mg, 180 mol). The progress of the reaction was monitored by analytical gelectrophoresis (88 polyacrylamide, 8.3 M urea). The raw product was purified initially by ion exchange HPLC from excess PEG (Source Q 30; solvent A: H.sub.2O, solvent B: 2 MN NaCl; low rate 20 mL/min; loading of the column and elution of free PEG with 10% B; elution of the PEG-GnRH spiegelmer conjugate with 50% B), subsequently GnRH spiegelmer PEGylated by RP-HPLC was separated from non PEGylated GnRH spiegelmer (Source RPC 15; solvent A: 100 mM triethylammonium acetate (TEAA), solvent B: 100 mM TEAA in H.sub.2O/acetonitril 5:95; flow rate 40 mL/min; loading of the column with 10% B; gradient from 10% to 70% B in 10 column volumes, elution of PEG-GnRH spiegelmer at 45-50% B), salt exchanged (Source Q 30; solvent A: H.sub.2O, solvent B: 2 M NaCl; flow rate 20 mL/min; loading of the column and elution of free PEG with 10% B; elution of PEG-GnRH spiegelmer with 50% B) and subsequently desalted by gel filtration (Sephadex G10; solvent H.sub.2O; flow rate 5 mL/min) or ultrafiltration (Labscale TFF Pystem, Millipore). By lyophilisation the desired product was obtained as a white powder (3.900 OD, 375 mg, 78%).

[0115] Analogously, further nucleic acids including the sequence according to SEQ ID NO:1 linked with different PEG (linear 10,000 Dalton, linear 20,000 Dalton, branched 20,000 Dalton, linear 35,000 Dalton), and purified.

EXAMPLE 4: SYNTHESIS OF FITC CONJUGATES OF L-NUCLEIC ACIDS: COUPLING OF FLUORESCEIN ISOTHIOCYANATE ONTO A GNHR SPIEGELMER WITH A 5NH.SUB.2.CG LINKER

[0116] The 5amino-modified GnRH spiegelmer made according to example 3 was prepared in 0.*5 M NaHCO.sub.3 pH 8.5, warmed to 65 C. and an excess of fluorescein isothiocyanate (FITC, 10 eq) was added to the reaction mixture. The reaction was monitored by means of analytical RP-HPLC. It was shaken for 48 h at 65 C., excess FITC separated by Centri-Spin10 (Princeton Separations) and the fluorescein labelled L-nucleic acid was purified with RP-HPLC. Lyophilisation delivered the desired product as a yellowish powder in quantitative yield.

EXAMPLE 5: ACTIVITY TEST OF A GNRH BINDING, PEGYLATED DNA SPIEGELMER IN VIVO IN MALE ORCHIDECTOMISED RATS

[0117] Male rats were orchidectomised, whereby the LH level of the rats increased steadily during the following eight days due to the missing testosteron feedback signal. On day 8 the PEG-GnRH DNA spiegelmer, i.e. the conjugate from PEG and GnRH spiegelmer, was administered intravenously to seven rats (150 mg/kg). Blood samples were taken on day 0 (prior to the orchidectomy), on day 8 (0 hours prior to i. v. application of the PEG-GnRH spiegelmer), 0.5 h, 1.5 h, 3 h, 6 h as well as 24 h post i. v. application and the respective LH level determined using radioimmunoassay (RIA). In parallel, only the vehicle (PBS buffer, pH 7.4) i. v. as a negative control was administered to seven male orchidectomised rats, and the standard antagonist Cetrorelix (100 g/kg) s. c. as a positive control to seven male orchidectomised rats. The result is shown in FIG. 25.

[0118] With the exception of the negative control (in FIG. 25 depicted as triangles) there is a LH level even after 24 h under the influence of the PEG-GnRH spiegelmers, that is comparable to that of the non-orchidectomised rats, and those rats, respectively, which had received the standard antagonist Cetrorelix. This proves the suitability of the PEG-GnRH DNA spiegelmer, to influence lastingly the effect of the GnRH over an extended period of time. That the effect of the PEG-GnRH DNA spiegelmer described above is due to the PEGylation of the GnRH spiegelmer results from the fact that upon application of the GnRH spiegelmer without the corresponding modification with subcutaneous application of 100 mg/kg a reduction of the activity of the GnRH spiegelmer could be observed already after a few hours. The result is shown in FIG. 29 as well.

EXAMPLE 6: ACTIVITY TEST OF GNRH BINDING, PEGYLATED AND NON-PEGYLATED DNA SPIEGELMERS IN CHO CELLS IN VITRO

[0119] The cell culture study described herein was performed on Chinese Hamster Ovary (CHO) cells, which express the human receptor for GnRH. Here the intracellular release of Ca.sup.2+ ions was measured, since this release, important for the signal transduction, occurs after formation of the agonist receptor complex. The Ca.sup.2+ level was then determined by a Ca.sup.2+ sensitive fluorescence dye. The PEG-GnRH DNA spiegelmer and the GnRH spiegelmer, respectively, was to capture the agonist GnRH and thus inhibit its binding to the receptor on the cell membrane. It was done experimentally such that the agonist GnRH (2 nM) was preincubated for 20 min with the GnRH spiegelmer and the PEG-GnRH DNA spiegelmer, respectively, in a concentration range of 100 pM bis 1 M. This solution each was given to the CHO cells loaded with fluorescence dye, and the respective Ca.sup.2+ concentration determined with a Fluorescence Imaging Plate Reader (FLIPR). The result of the PEG-GnRH DNA spiegelmer (filled triangles) and of a standard antagonist (filled squares), used here as a positive control, is shown in FIG. 26a.

[0120] The concentration dependant determination resulted in a sigmoidal activity curve, which indicates that the native, i.e. the non-modified GnRh spiegelmer (filled squares), as well as GnRH-DNA spiegelmer modified with PEG (filled triangles) were able to inhibit the formation of the GnRH receptor complex at 100%. The IC.sub.50 was 20 nM for the GnRH spiegelmer und 30 nM for the PEG-GnRH DNA spiegelmer (FIG. 26b).

EXAMPLE 7: PHARMACOKINETICS OF A GNRH BINDING PEGYLATED DNA SPIEGELMER IN RATS

[0121] Seven male Wistar rats (Tierzucht Schnwalde GmbH, Germany, weight: 250-300 g) were used for the determination of the pharmacokinetical characteristics of the GnRH binding PEGylated DNA spiegelmer. The group was treated in parallel with the groups for the activity tests (see example 6), i.e. castrated after an adaption phase, and after another week the animals received a single dose of 800 nmol/kg PEG-GnRH DNA spiegelmer administered intravenously. The substance was dissolved in 1PBS, pH 7.4 (stock solution: 1 mM).

[0122] For analysis blood samples were taken prior to substance dose (0 h) as well as 1 h, 6 h, and 8 h post substance dose, and analysed as EDTA plasma.

[0123] From the plasma GnRH binding PEGylated DNA spiegelmer was extracted by solid-phase extraction aided by weak anion exchangers. For this 50 l EDTA plasma each were dissolved in buffer A (50 mM NaH.sub.2PO.sub.4 pH 5.5; 0.2 M NaClO.sub.4; 20% (v/v) formamide und 5% (v/v) acetonitril) in a total volume of 1 ml and stored at 4 C. over night or at 20 C. for 4 days maximum, respectively, until extraction. Frozen samples were thawed for at least 2 h at room temperature, mixed and subsequently centrifuged.

[0124] For solid-phase extraction dimethylaminopropyl-anion exchanger columns (DMA 3 ml/200 mg column material, Macherey & Nagel, Diren) on a Baker spe-12G vakuum apparatus (Mallinckrodt Baker, Griesheim) was used. The buffers used consisted of: buffer A (50 mM NaH.sub.2PO.sub.4, pH 5.5; 0.2 M NaClO.sub.4; 20% (v/v) formamide und 5% (v/v) acetonitril and buffer B (80 mM NaH.sub.2PO.sub.4, pH 6.0; 50 mM Na.sub.2HPO.sub.4, 2 M NaClO.sub.4; 20% (v/v) formamide und 5% (v/v) acetonitril), wherein the two buffers A and B were mixed in a specific ratio for the preparation of the wash and the elution buffer, such that the desired salt concentrations were achieved. The anion exchangers were flushed with 2 ml of buffer A. The samples were added applying 100 mbar and washed with 2 ml of buffer A as well as 2 ml of wash buffer (0.4 M NaClO.sub.4). After drying the column material for 5 min by applying 200 mbar, the PEGylated GnRH binding DNA spiegelmer was eluted with 30.5 ml elution buffer (0.9 M NaClO.sub.4), wherein the buffer was heated to 70 C. prior to elution. The eluates were stored at 4 C. until gel filtration.

[0125] As an internal standard an 30mer DNA spiegelmer had been added to the samples prior to extraction, which was bound to a 40 kDa polyethyleneglycol molecule (PEG) at the 5-end. The internal standard was brought with buffer to a volume of 360 l at a concentration of 1 pg/l, and 10 l each thereof were added to each sample.

[0126] To desalt the samples prior to the HPLC analysis NAP-25 columns (Amersham Pharmacia Biotech) were used. The eluates obtained were dried under vacuum and dissolved in 100 ml of 10 mM Tris-HCl, pH 8.0.

[0127] The identification and quantification of the PEGylated spiegelmer was done by means of anion exchange chromatography using a Waters Alliance 2695 HPLC system and detection at 254 nm. The conditions were as follows:

precolumn: DNAPac PA-100 (504 mm, Dionex)
main column: DNAPac PA-100 (2504 ma, Dionex)
eluent A: 10 mM NaOH, 1 mM EDTA, 10% (v/v) acetonitril in water
eluent B: 375 mM NaCl.sub.4 in eluent A
temperature: 25 C.
injection volume: 20 l
gradient und flow rates: 0-1 min 10% eluent B with 0.5 ml/min; 1-2 min 10% eluent B with 2 ml/min; 2-3 min 30% eluent B with 2 ml/min; 3-13 min 60% eluent B with 2 ml/min; 13-19 min 10% eluent B with 2 mil/min.

[0128] The concentration of PEGylated GnRH binding DNA spiegelmer at the different points in time of sampling is shown in FIG. 27. The half time of the PEGylated GnRH binding DNA spiegelmer upon intravenous injection is about 4 hours in rats.

EXAMPLE 8: PHARMACOKINETICS PROFILE OF UNMODIFIED AND PEGYLATED L-RNA IN RATS

[0129]

TABLE-US-00002 nucleotidesequences: L-RNA,40mer(NOX_M039) (SEQIDNO:4) 5 uaaggaaacucggucugaugcgguagcgcugugcag agcu3 40kDaltonPEG-L-RNA,40mer(NOX_M041) (SEQIDNO:5) PEG5uaaggaaacucggucugaugcgguagcgcugug cagagcu3

[0130] The pharmacokinetical profile of the non-PEGylated L-RNA (NOX_M0039) and PEGylated L-RNA (NOX_M041) was examined in male rats (CD, Charles River Germany GmbH; weight 280-318 g). After a 7 day settling-in period, 3 animals per substance received a single dose of 0.150 mmol/kg applied intravenously 4 rats each per substance received 150 mmol/kg each as a single subcutaneous dose. The substances were dissolved in 1PBS pH 7.4 (stock solution: 383 M). After intravenous dose blood samples were taken for the unmodified L-RNA prior to substance application (0 min) and 5 min, 15 min, 30 min, 1 h, 2 h, 4 h, 6 h after substance application and transferred into EDTA Eppendorf tubes for analysis. After intravenous dose blood samples were taken for the PEGylated L-RNA prior to substance application (0 min) and 5 min, 30 min, 1 h, 3 h, 8 h, 16 h, 24 h, 36 h as well as 48 h after substance application and transferred into EDTA Eppendorf tubes for analysis. In subcutaneously treated animals blood samples were taken for the unmodified L-RNA prior to substance application (0 min) and 5 min, 15 min, 30 min, 1 h, 2 h, 4 h, 6 h after substance application and transferred into EDTA Eppendorf tubes for analysis. In subcutaneously treated animals blood samples were taken for the PEGylated L-RNA prior to substance application (0 min) and 5 min, 30 min, 1 h, 3 h, 8 h, 16 h, 24 h, 36 h and 48 h after substance application and transferred into EDTA Eppendorf tubes for analysis.

[0131] The amount of L-RNA and PEGylated L-RNA in the blood samples was examined by means of a hybridisation assay (see Drolet, D. W. et al. (2000) Pharmacokinetics and safety of an anti-vascular endothelial growth factor aptamer (NX1838) following injection into the vitreous humor of rhesus monkeys. Pharmaceutical Res 17 (12): 1503-1510.). The hybridisation assay is based on the following principle: the L-RNA molecule to be detected is hybridised to an immobilised L-DNA oligonucleotide probe (=capture probe; here: 5-CCG CAT CAG ACC GAG TTT CCT TA T TTT TTT TT-(C7) NH2-3 (SEQ ID NO: 6)) and detected by a biotinylated detection L-DNA probe (=detector probe; here: 5-(BB) TTT TTT TT A GCT CTG CAC AGC GCT-3 (SEQ ID NO: 7)). For this a streptavidine alkaline phosphatase conjugate is bound to the complex in a further step. After addition of a chemiluminescence substrate, light is generated and measured in a luminometer.

[0132] Immobilisation of the oligonucleotide probe: 100 g of the capture probe (0.75 pmol/l in coupling buffer: 500 mM Na.sub.2HPO.sub.4 pH 8.5, 0.5 mM EDTA) per well were transferred into DNA BIND plates (COSTAR) and incubated over night at 4 C. Subsequently, it was washed with 3200 l coupling buffer each and incubated for 1 h at 37 C. with 200 l blocking buffer (0.5% (w/v) BSA in coupling buffer) each. After renewed washing with 200 l coupling buffer and 3200 l hybridisation buffer 1 (0.5SSC pH 7.0, 0.5% SDS (w/v)) the plates may be used for detection.

[0133] Hybridisation and detection: a 20 pmol/l solution of the detection L-DNA probe (=detector probe) in 10 mM Tris-Cl pH 8.0 was prepared. 10 l EDTA plasma (or ddH.sub.2O) were mixed with 90 l hybridisation buffer 1 (0.5SSC pH 7.0, 0.5% (w/v) SDS). Subsequently, 2 l of the detector probe solution (20 pmol/l) were added, mixed and centrifuged. A denaturing step at 95 C. for 10 min in the Thermocycler (MJ Research) followed. The batches were transferred into the DNA-BIND wells prepared accordingly (see above) and incubated for 2 h at 50 C. Thereafter washing steps followed: 2200 l hybridisation buffer 1 (0.5SSC pH 7.0, 0.5% (w/v) SDS) and 3200 l 1TBS/Tween 20 (20 mM Tris-Cl pH 7.6, 137 mM NaCl, 0.1% (v/v) Tween 20). 1 l streptavidine alkaline phosphatase conjugate (Promega) was diluted with 5 ml 1TBS/Tween 20. 100 l of the diluted conjugate were added per well and incubated at room temperature for 30 min. Washing steps followed: 1200 l 1TBS/Tween 20 and 3200 l 1 assay buffer (20 mM Tris-Cl pH 9.8, 1 mM MgCl.sub.2). Finally, 100 l CSPD Ready-To-Use Substrate (Applied Biosystems) were added, incubated 30 min at room temperature, and the chemiluminescence was measured in a POLARstar Galaxy multidetektion plate reader (BMG Labtechnologies).

[0134] The concentration-time-curves of the PEGylated L-RNA upon intravenous and subcutaneous dose are shown in FIG. 28a and FIG. 28c. The concentration profiles of the unmodified L-RNA upon intravenous and subcutaneous dose are shown in FIG. 28b and FIG. 28d. Upon intravenous dose the terminal half time is 50 minutes for the unmodified L-RNA. For the PEGylated substance, by contrast, a half time of around 18 hours results. Upon subcutaneous dose the terminal half time is 84 minutes for the unmodified L-RNA, for the PEGylated substance, by contrast, results a very long elimination phase.

[0135] Thus it is shown, that the modified L-nucleic acid according to the invention is of advantage in comparison with the unmodified L-nucleic acid. This advantage arises also with a view of the state of the art, described for example by Watson S. R. at al., Antisense nucleic acid drug dev. 10. 63-75 (2000). In this publication a 2-F-modified aptamer is examined, which binds to L-selectin. The pharmacokinetical half time of the PEGylated 2-F-aptamer (40 kDa PEG) administered intravenously in vivo in Sprague-Dawley rats is 228 min and is thus clearly shorter than those of the L-nucleic acids modified according to the invention.

EXAMPLE 9: GENERAL METHOD FOR THE PEGYLATION OF L-RIBONUCLEIC ACIDS

[0136] A L-ribonucleic acid was generated for the examination of the pharmacological profile of unmodified and PEGylated L-RNA in rats. The L-RNA has the following sequence:

TABLE-US-00003 (SEQIDNO:4) 5-UAAGGAAACUCGGUCUGAUGCGGUAGCGCUGUGCAG AGCU-3

[0137] The synthesis of the L-RNA with the sequence shown above was performed on an KTA Pilot 10 Synthesizer (Amersham Pharmacia Biotech, Uppsala, Sweden) in a 20 M scale at a 1000 CPG solid phase according to the 2-cyanoethyl phosphoramidit chemistry. Subsequently, 6-(monomethoxytritylamino)-hexyl-(2-cyanoethyl)-(N,N-diiospropyl)-phosphoramidit was coupled to the 5-end of the L-RNA (5-MMT-aminohexyl-L-RNA) to allow the post-synthesis conjugation with PEG.

[0138] After completion of the synthesis the 5-MMT-aminohexyl-L-RNA was cleaved from the solid phase by 30 min incubation in 41% methylamine solution at 65 C., and the nucleobases were deprotected completely. Deprotection of the 2-position was done by incubation in 1.5 ml DMSO, 0.75 ml triethylamine (TEA) and 1 ml TEA 3HP for 2 h at 60 C. A first purification was done by means of RP-HPLC. The cleavage of the monomethoxytrityl protection group was carried out with 80% acetic acid in 70 min at RT. Acetic acid was removed by two time co-evaporation with ethanol, and the 5-aminohexyl-L-RNA according to SEQ ID NO: 4 purified by precipitation in ethanol (yield: 220 OD, 60% pure). The product was taken up into 1 M sodium acetate, pH 8.0, and desalted by means of size exclusion chromatography by a Sephadex G10 column or by Vivaspin 3000 (Vivascience, Hannover, Germany).

[0139] The L-RNA 5-amino modified in such a manner (530 OD, 60% pure) was prepared in aqueous universal buffer according to Theorell and Stenhagen (33 mM sodiumcitrate, 33 mM sodium phosphate, 57 mM sodium borate, pH 7.5) (7.5 ml), warmed to 37 C., DMF (5 ml) added, and powdery N-hydroxysuccinimidyl (NHS)-activated ester of branched 40,000 Da poly (ethylen) glycol was added in portions (2 eq every 45 min, altogether 18 eq). The progress of the reaction was monitored by analytical gelectrophoresis (8% polyacrylamide, 8.3 M urea) or analytical ion exchange HPLC. The raw product was purified initially by ion exchange HPLC from excess PEG (Source Q; solvent A: 10 mM sodium hydrogencarbonate, pH 7.5, solvent B: 10 mM sodium hydrogencarbonate, pH-7.5, 2 M sodium chloride, loading of the column and elution of free PEG with 5% B; flow rate 20 ml/min; separation and elution of the PEG-L-RNA conjugate from non-reacted L-RNA with a gradient up to 35% B over 20 column volumes; flow rate 50 ml/min), subsequently desalted by ultrafiltration (Labscale TFF System, Millipore). By lyophilisation the desired product was obtained as a white powder (254 OD, 48% (80% related to the purity of the starting product)).

[0140] Analogously, further L-nucleic acids including the sequence according to SEQ ID NO:1 were linked with different PEG (linear 10,000 Dalton, linear 20,000 Dalton, branched 20,000 Dalton, linear 35,000 Dalton), and purified.

EXAMPLE 10: ACTIVITY TEST OF A GNRH BINDING DNA SPIEGELMER IN VIVO IN MALE ORCHIDECTOMISED RATS

[0141] Male rats were orchidectomised, whereby the LH level of the rats increased steadily during the following eight days due to the missing testosteron feedback signal. On day 8 the PEG-GnRH DNA spiegelmer (NOX 1255) was administered subcutaneously to five rats (100 mg/kg). Blood samples were taken on day 0 (prior to the orchidectomy), on day 8 (0 hours prior to a. c. application of the GnRH spiegelmer), as well as 0.5 h, 1.5 h, 3 h, 6 h 24 h post s.c. application and the respective LH level determined using radioimmunoassay (RIA). In parallel, only the vehicle (PBS buffer, pH 7.4) as a negative control was administered s.c. to five male orchidectomised rats, and the standard antagonist Cetrorelix (100 g/kg) s. c. as a positive control to five male orchidectomised rats. The result is shown in FIG. 29.

[0142] The LH levels are lowered in the GnRH DNA spiegelmer group (in FIG. 29 depicted as circles) and reach their lowest point after 1.5 h, and stay on for around 3 h. This reduction is comparable to non-orchidectomised rats and those rats, respectively, treated with Cetrorelix (standard antagonist). Six hours after GnRH DNA spiegelmer dose the LH levels increase slowly and reach the level of the untreated control group within 24 h.

[0143] Thus the biological effect of the GnRH DNA spiegelmer is observable over a period of 3 hours, while the PEGylated GnRH DNA spiegelmer is active over a period of 24 hours (see example 5).

[0144] The references given in the following correspond to the citations, provided with superscript numbers, given herein.

LITERATURE

[0145] 1. Bragg, P. D. & Hou, C. Subunit composition, function, and spatial arrangement in the Ca2+- and Mg2+-activated adenosine triphosphatases of Escherichia coli and Salmonella typhimurium. Arch Biochem Biophys 167, 311 (1975). [0146] 2. Lomant, A. J. & Fairbanks, G. Chemical probes of extended biological structures: synthesis and properties of the cleavable protein cross-linking reagent [35S] dithio bis(succinimidyl propionate). J Mol Biol 104, 243-261 (1976). [0147] 3. Buter, J. & Kellogg, R. M. Synthesis of macrocyclic and medium ring dithio compounds using cesium thiolates. J Chem. Soc. Chem. Commun., 466-468 (1980). [0148] 4. Buter, J. & Kellogg, R. M. Synthesis of sulfur-containing macrocycles using cesium thiolates. J Org. Chem. 46, 4481-4485 (1981). [0149] 5. Kennedy, R. J. & Stock, A. N. The oxidation of organic substances by potassium peroxymonosulfates. J Org. Chem. 25, 1901-1906 (1960). [0150] 6. Huang, Z., Schneider, K. C. & Benner, S. A. Oligonucleotide analogs with dimethylenesulfide, -sulfoxide, and -sulfone groups replacing phosphodiester linkages. Methods Mol Biol 20, 315-353 (1993). [0151] 7. Connolly, B. A. & Rider, P. Chemical synthesis of oligonucleotides containing a free sulfhydryl group and subsequent attachment of thiol specific probes. Nucleic Acids Res 13, 4485-4502 (1985). [0152] 8. Smyth, D. G., Blumenfeld, O. O. & Konigsberg, W. Reactions of N-ethylmaleimide with peptides and amino acids. Biochem J, 91, 589-595 (1964). [0153] 9. Heitz, J. R., Anderson, C. D. & Anderson, B. M. Inactivation of yeast alcohol dehydrogenase by N-alkylmaleimides. Arch Biochem Biophys 127, 627-636 (1968). [0154] 10. Podhradsky, D., Drobnica, L. & Kristian, P. Reactions of cystine, its derivatives, glutathione coenzyme A, and dihydrolipoic acid with isothiocyanates. Experientia 35, 154-155 (1979). [0155] 11. Vishnyakova, Golubeva & Glebova. Russ. Chem. Rev. 54, 249-261 (1985). [0156] 12. Hazzard, Lammiman, Poon, Satchell & Satchell. J. Chem. Soc. Perkin Trans. 2, 1029 (1985). [0157] 13. Pieken, W. et al. (International Patent, 1998). [0158] 14. Mokhir, A. A., Tetzlaff, C. N., Herzberger, S., Mosbacher, A. & Richert, C. Monitored selection of dna-hybrids forming duplexes with capped terminal c:g base pairs. J Comb Chem 3, 374-386 (2001). [0159] 15. Bischoff, R., Coull, J. M. & Regnier, F. E. Introduction of 5-terminal functional groups into synthetic oligonucleotides for selective immobilization. Anal Biochem 164, 336-344 (1987). [0160] 16. Ghosh, S. S. & Musso, G. F. Covalent attachment of oligonucleotides to solid supports. Nucleic Acids Res 15, 5353-5372 (1987). [0161] 17. Allen, D. J., Darke, P. L. & Benkovic, S. J.

[0162] Fluorescent oligonucleotides and deoxynucleotide triphosphates: preparation and their interaction with the large (Klenow) fragment of Escherichia coli DNA polymerase 1. Biochemistry 28, 4601-4607 (1989). [0163] 18. Pitha, J., Kociolek, K. & Caron, M. G. Detergents linked to polysaccharides: preparation and effects on membranes and cells. Eur J Biochem 94, 11-18 (1979). [0164] 19. Elling, L. & Kula, M. R. Immunoaffinity partitioning: synthesis and use of polyethylene glycol-oxirane for coupling to bovine serum albumin and monoclonal antibodies. Biotechnol Appl Biochem 13, 354-362 (1991). [0165] 20. Wardell in The chemistry of the thiol group (ed. Patai) 246-251 (Wiley, New York, 1974). [0166] 21. Zuckermann, R., Corey, D. & Schutz, P. Efficient methods for attachment of thiol specific probes to the 3-ends of synthetic oligodeoxyribonucleotides. Nucleic Acids Res 15, 5305-5321 (1987). [0167] 22. Teare, J. & Wollenzien, P. Specificity of site directed psoralen addition to RNA. Nucleic Acids Res 17, 3359-3372 (1989). [0168] 23. Ghosh, S. S., Kao, P. M. & Kwoh, D. Y. Synthesis of 5-oligonucleotide hydrazide derivatives and their use in preparation of enzyme-nucleic acid hybridization probes. Anal Biochem 178, 43-51 (1989). [0169] 24. Ivanovskaya, M. G., Gottikh, M. B. & Shabarova, Z. A. Modification of oligo(poly)nucleotide phosphomonoester groups in aqueous solution. Nucleosides Nucleotides 6, 913-934 (1987). [0170] 25. Ralph, R. K., Young, R. J. & Khorana, H. G. The labelling of phosphomonoester end groups in amino acid acceptor ribonucleic acids and its use in the determination of nucleotide sequences. J. Am. Chem. Soc. 84, 1490-1491 (1962). [0171] 26. Chu, B. C., Wahl, G. M. & Orgel, L. E. Derivatization of unprotected polynucleotides. Nucleic Acids Res 11, 6513-6529 (1983). [0172] 27. Shabarova. Z. A. Chemical development in the design of oligonucleotide probes for binding to DNA and RNA. Biochimie 70, 1323-34 (1988).

[0173] The features of the invention disclosed in the description above, the claims as well as the figures may be essential individually as well as in any combination for the realisation of the invention in its different embodiments.