DROPLET GENERATING APPARATUS, SYSTEM, AND METHOD
20200010873 ยท 2020-01-09
Inventors
Cpc classification
B01L2200/0673
PERFORMING OPERATIONS; TRANSPORTING
B01L2400/02
PERFORMING OPERATIONS; TRANSPORTING
B01L3/0268
PERFORMING OPERATIONS; TRANSPORTING
B01L3/021
PERFORMING OPERATIONS; TRANSPORTING
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
Abstract
A droplet generating method includes: providing a micro-pipe for dispensing a first liquid and a container containing a second liquid; providing a moving and locating device for positioning the micro-pipe over the container; providing a liquid driving device connecting to the micro-pipe through a connecting tube; providing a vibrating equipment connected to the micro-pipe for vibrating the micro-pipe; forming a relative periodic vibration between the micro-pipe and the container so that the outlet end of the micro-pipe is displaced to touch the second liquid in the container during a relative periodic vibration; and dispensing the first liquid in the micro-pipe out from the outlet end of the micro-pipe during the relative periodic vibration to generate a plurality of droplets of the first liquid in the second liquid which is induced by a force of the second liquid imposed on the first liquid at the outlet end.
Claims
1. A droplet generating method, comprising: providing a micro-pipe for dispensing a first liquid and a container containing a second liquid, wherein the first liquid is immiscible with the second liquid; providing a moving and locating device for positioning the micro-pipe over the container; providing a liquid driving device connecting to the micro-pipe through a connecting tube for driving the first liquid through the micro-pipe and out from an outlet end of the micro-pipe; providing a vibrating equipment connected to the micro-pipe for vibrating the micro-pipe; forming a relative periodic vibration between the micro-pipe and the container so that the outlet end of the micro-pipe is displaced to touch the second liquid in the container during a relative periodic vibration; and dispensing the first liquid in the micro-pipe out from the outlet end of the micro-pipe during the relative periodic vibration to generate a plurality of droplets of the first liquid in the second liquid which is induced by a force of the second liquid imposed on the first liquid at the outlet end.
2. The droplet generating method according to claim 1, wherein the vibrating equipment is adapted to vertically vibrate the micro-pipe between a highest position and a lowest position, and the second liquid includes a liquid surface disposed at a position located between the highest position and the lowest position.
3. The droplet generating method according to claim 1, wherein the vibrating equipment is adapted to vibrate the micro-pipe between a first position and a second position, and the second liquid includes a liquid surface disposed at a position located above both the first position and the second position.
4. The droplet generating method according to claim 1, wherein the moving and locating device is configured to substantially maintain a distance between a farthest position of the outlet end and the liquid surface of the second liquid unchanged when a position of the liquid surface of the second liquid is changed, thereby substantially maintaining a generating conditions of the droplets unchanged to form uniform droplets.
5. The droplet generating method according to claim 1, wherein the relative periodic vibration between the micro-pipe and the container containing the second liquid is controlled with a constant amplitude, a constant frequency, and a velocity curve of periodic reciprocation with varying acceleration.
6. The droplet generating method according to claim 5, wherein during the relative periodic vibration, the waveform of velocity curve of the micro-pipe is in a sine wave, a square wave, a triangular wave, or a combination of the above waves.
7. The droplet generating method according to claim 5, wherein periodic vibration between the micro-pipe and the container containing the second liquid leads to periodic generation of droplets of the first liquid, with a generation rate of 0.5, 1, or 2 droplets in each period of vibration.
8. The droplet generating method according to claim 1, wherein in the relative periodic vibration, the outlet end of the micro-pipe periodically goes across a liquid surface of the second liquid to detach the first liquid driven out from the outlet end of the micro-pipe under a dynamic viscous shearing force of the second liquid thereby forming the plurality of droplets of the first liquid.
9. The droplet generating method according to claim 8, wherein the dynamic viscous shearing force of the second liquid comprises a viscous drag force, an interfacial tension, and an interfacial force.
10. The droplet generating method according to claim 1, wherein during the relative periodic vibration, the micro-pipe is periodically vibrating along a direction perpendicular to a longitudinal axis of the outlet end thereof, and the outlet end of the micro-pipe swings under a liquid surface of the second liquid to detach the first liquid driven out from the outlet end of the micro-pipe under the force of the second liquid thereby forming the plurality of droplets of the first liquid.
11. The droplet generating method according to claim 10, wherein droplets of the first liquid attached on the outlet end of the micro-pipe can be periodically detached from the micro-pipe by the force of the second liquid due to periodic vibration.
12. The droplet generating method according to claim 1, further comprising means for controlling a volume of each of the plurality of droplets by controlling a vibration frequency, vibration amplitude and vibration waveform of the relative periodic vibration, and a flow speed of the first liquid in the micro-pipe; the volume of each droplet of the first liquid is in a range from about 20 pL to about 100 nL.
13. The droplet generating method according to claim 1, wherein a vibration frequency of the relative vibration is in a range from about 10 Hz to about 5000 Hz, and an amplitude of the relative vibration is in a range from about 0.5 mm to about 10 mm.
14. The droplet generating method according to claim 1, wherein the micro-pipe comprises a liquid storage cavity on an upper end of a micro-tube.
15. The droplet generating method according to claim 14, wherein a bottom of the liquid storage cavity can be tapered, an upper end of the liquid storage cavity is configured to detachably connect to the connecting tube, and can have an inner diameter corresponding to an outer diameter of the connecting tube.
16. The droplet generating method according to claim 14, wherein an inner diameter of the outlet end of the micro-pipe can be in a range from about 50 m to about 200 m, an outer diameter of the straight micro-tube can be in a range from about 200 m to about 500 m.
17. The droplet generating method according to claim 14, wherein an inner diameter of the liquid storage cavity can be in a range from about 0.5 mm to about 10 mm, a volume of the liquid storage cavity can be in a range from about 10 L to about 1000 L.
18. A droplet generating method comprising: providing a micro-pipe having an outlet end; providing a liquid driving device to generate a flow of a first liquid; locating and positioning the micro-pipe which extends along a vertical longitudinal axis; connecting the liquid driving device with the micro-pipe so that the first liquid flows and is emitted out from the outlet end; providing a container, which is positioned at least in-part below the micro-pipe and adapted to contain a second liquid including a liquid surface disposed at a position located between a highest and a lowest position; and vertically vibrating the micro-pipe along the longitudinal axis between a highest position and a lowest position, and thereby forming a plurality of droplets of the first liquid emitted from the outlet end.
19. A droplet generating method comprising: providing a micro-pipe having an outlet end; providing a liquid driving device which is connected with the micro-pipe to generate a flow of a first liquid; locating and positioning the micro-pipe which extends along a vertical longitudinal axis; connecting the liquid driving device with the micro-pipe so that the first liquid flows and is emitted out from the outlet end; providing a container, which is positioned at least in-part below the micro-pipe and adapted to contain a second liquid including a liquid surface, the outlet end of the micro-pipe is under the liquid surface of the second liquid; and horizontally vibrating the micro-pipe with its outlet end swinging between a first position and a second position, and thereby forming a plurality of droplets of the first liquid emitted from the outlet end.
20. The droplet generating method according to claim 1, wherein the container comprises a plurality of containers, the micro-pipe comprises a plurality of micro-pipes, and the outlet ends of the plurality of micro-pipes are respectively positioned in the plurality of containers.
21. The droplet generating method according to claim 20, wherein an array of flow channels is defined in the connecting tube, or the liquid driving device comprises an array of connecting tubes each defining one flow channel to be respectively connected with the plurality of micro-pipes.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0074] Implementations are described by way of example only with reference to the attached figures.
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
DETAILED DESCRIPTION
[0108] A detailed description with the above drawings is made to further illustrate the present disclosure.
[0109] A droplet generating apparatus and a droplet generating method are provided in the present disclosure based on a relative movement of a micro-pipe and a container. A first liquid can flow out from an outlet end of the micro-pipe quantitatively. During the relative movement, when the outlet end of the micro-pipe goes across a liquid surface of a second liquid contained in the container, an interfacial energy and a fluid shear force can be generated; or when the outlet end of the micro-pipe swings in the second liquid, the fluid shear force can be generated. Under the action of the interfacial energy and the fluid shear force, the first liquid on the outlet end of the micro-pipe can overcome a surface tension and an adhesive force with an orifice of the outlet end of the micro-pipe, and be released smoothly from the micro-pipe to form a droplet precisely and accurately in the second liquid. Multitudinous droplets (e.g. droplets containing a biochemical sample) can be generated quickly, effectively, and precisely through a continuous flow of the first liquid from the outlet end of the micro-pipe and the high frequency relative movement of the micro-pipe and the container. Furthermore, quantitative droplets with controllable volume and number can be directly produced in a dispersant liquid (the second liquid), thereby eliminating a contamination and evaporation of the droplets, and simplifying an extraction and storage of the droplets.
[0110] The first liquid is configured to form the droplets. The second liquid is configured to accept or disperse the droplets. The first liquid can be different from the second liquid. The first liquid and the second liquid can be soluble with, insoluble with or partially soluble with each other. An interfacial reaction can be carried out by the first liquid and the second liquid. The droplets can be liquid droplets formed by the first liquid, or micro-capsules containing the first liquid inside or microspheres formed by the reaction between the first liquid and the second liquid.
[0111] The first liquid and the second liquid can be insoluble with each other. In one embodiment, the first liquid can be an aqueous solution, the second liquid can be an oily liquid insoluble with the aqueous solution. The second liquid can be at least one of petroleum oil (e.g. n-tetradecane), vegetable oil, silicone oil, and perfluorinated alkane. The droplets can be formed by the aqueous solution. In one embodiment, the first liquid can be a hydrophobic organic phase, the second liquid can be an oil phase or aqueous phase insoluble with the hydrophobic organic phase. In one embodiment, the first liquid and the second liquid can both be aqueous phase insoluble with each other. For example, the first liquid can be a dextran aqueous solution, and the second liquid can be a polyethylene glycol aqueous solution.
[0112] An interfacial reaction can be existed between the first liquid and the second liquid. In one embodiment, the first liquid can be a sodium alginate aqueous solution, the second liquid can be a calcium chloride aqueous solution (e.g. 1% of mass percentage), and the droplets can be calcium alginate gel microspheres.
[0113] A third liquid can be covered on the second liquid. The first liquid, the second liquid, and the third liquid can be immiscible with each other. The micro-pipe can be vibrated up and down to go across the liquid-liquid interface between the second liquid and the third liquid repeatedly. In one embodiment, the first liquid can be an aqueous solution, the second liquid can be a perfluorinated oil (e.g. 3M fluorinert FC40), and the third liquid can be a mineral oil. The perfluorinated oil can be covered on the mineral oil due to its lower density. The micro-pipe can be vibrated up and down with respect to an interface between the perfluorinated oil and the mineral oil, and output the first liquid. The droplets formed by the aqueous solution can enter into the perfluorinated oil. The droplets do not sink and can float under a liquid surface of the perfluorinated oil due to its lower density.
[0114] Referring to
[0115] The liquid driving device 4 is configured to drive the first liquid 5 in the micro-pipe 1 continuously or intermittently. The liquid driving device 4 can be connected to an end of the micro-pipe 1. The liquid driving device 4 can be selected from a peristaltic pump, a syringe pump, a pressure pump, a pneumatic pump, and an electroosmotic pump. In
[0116] The flow rate of the first liquid depends on an inner diameter of the outlet end of the micro-pipe 1, a vibration frequency of the micro-pipe 1, a volume of each droplet, and properties of the first liquid and the second liquid. In the present disclosure, the flow rate of the first liquid can be substantially equal to a product of the vibration frequency of the micro-pipe 1 and a volume of each droplet. In one embodiment, the vibration frequency of the micro-pipe 1 is 50 Hz, the volume of each droplet is 50 picoliter (pL), and the flow rate can be about 50 Hz50 pL=2.5 nanoliter (nL).
[0117] The micro-pipe can have two open ends. One of the two open ends is an inlet end of the micro-pipe 1 and can be connected to the liquid driving device 4, and the other one is the outlet end of the micro-pipe 1. The first liquid can flow into the micro-pipe 1 through the inlet end, and flow out the micro-pipe 1 through the outlet end. The micro-pipe 1 can be selected from a single core capillary, a multi-core capillary, a bundle of capillaries, a capillary array, and a microfluidic channel. In one embodiment, an upper end of the capillary is enlarged to form a liquid storage cavity (similar to a needle of a syringe). In one embodiment, the micro-pipe 1 can be the single core capillary or the capillary array, which is simpler and more cost-effective compared with chips used in microfluidics.
[0118] The micro-pipe 1 can be disposable. The micro-pipe 1 is usually difficult to wash due to its tiny inner diameter. The disposable micro-pipe 1 can decrease the cost of the droplet generating apparatus. In one embodiment, the micro-pipe 1 can be detachably connected to the liquid driving device 4.
[0119] The two open ends of the micro-pipe 1 comprising the inlet and the outlet end can be both cylindrical. The outlet end of the micro-pipe 1 can also be tapered. Sizes of the two open ends, especially a size of the outlet end can be in a range from about 1 m to about 0.5 mm, such as from about 5 m to about 0.25 mm. In one embodiment, an inner diameter of the outlet end can be in a range from about 5 m to about 250 m, and an outer diameter of the outlet end can be in a range from about 10 m to 500 m. To generate smaller droplets, the micro-pipe 1 having a smaller inner diameter is required. In one embodiment, the micro-pipe 1 with an inner diameter of about 100 m and an outer diameter of about 200 m is stretched to form a tapered outlet end with an inner diameter of about 30 um and an outer radius of about 50 m. The specific structure and size of the micro-pipe 1 are not limited and can be varied to meet actual need.
[0120] A surface of the outlet end of the micro-pipe 1 can have a low surface energy to release the droplets 7 more smoothly, thereby increasing the precision of volumes of the droplets 7 and improving uniformity of the droplets 7. The surface of the outlet end of the micro-pipe 1 can be modified to decrease its surface energy. The surface of the outlet end of the micro-pipe 1 can be coated with a low surface coating or silanized.
[0121] The liquid driving unit can further comprise a connecting tube 9 configured to transport the first liquid from the liquid driving device 4 to the micro-pipe 1. The liquid driving device 4 can be air-tight connected to the micro-pipe 1 through the connecting tube 9. One end of the connecting tube 9 can be connected to the liquid driving device 4, and the other end of the connecting tube 9 can be connected to the micro-pipe 1. The connecting tube 9 can be made of polytetrafluoroethylene or Teflon, silicon rubber, polyethylene, or poly vinyl chloride. One single flow channel can be defined in one connecting tube 9, or a plurality of flow channels can be defined in one connecting tube 9. The connecting tube 9 can also comprise a plurality of connecting tubes assembled together. The connecting tube 9 can be an airtight tube defining the plurality of flow channels prepared by micromachining or micropackaging.
[0122] The connecting tube 9 can be fixed to or detachably connected to the liquid driving device 4. When the connecting tube 9 contacts the first liquid during droplets generation, the connecting tube 9 can be detachably connected to the liquid driving device 4, so that the connecting tube 9 can be conveniently replaced according to the different type of the first liquid. When the connecting tube 9 cannot contact the first liquid during the droplet's generation, the connecting tube 9 can be fixed to the liquid driving device 4 to ensure connection between the connecting tube 9 and the liquid driving device 4 is air-tight.
[0123] A connecting port can be defined on the end of the connecting tube 9 connected to the micro-pipe 1. The micro-pipe 1 can be connected with the connecting port by a threaded connection, a clamping connection, an interference fit, or a plug connection. In one embodiment, a structure of the outlet end of the micro-pipe 1 and a structure of the connecting port of the connecting tube 9 are mutually complementary, so that the micro-pipe 1 can be connected to the micro-pipe 1 quickly when replacing the disposable micro-pipe 1. An inner diameter of the connecting tube 9 can be matched with the outer diameter of the micro-pipe 1. The micro-pipe 1 can be directly connected to the connecting port. A connecting joint of the micro-pipe 1 and the connecting tube 9 can be sealed by an adhesive to prevent leakage of the first liquid.
[0124] If the micro-pipe 1 is a single core capillary or a multi-core capillary, one connecting tube 9 can be used. If the micro-pipe 1 is the capillary array in which a plurality of capillaries do not contact with each other, the plurality of connecting tubes each defining one flow channel can be used, or one connecting tube defining the plurality of flow channels can be used (referring to
[0125] The arrangement of the plurality of flow channels can be corresponding to a well array of a microplate in common use such as 96-well microplate, 384-well microplate, and 1536-well microplate, thereby decreasing the cost of the droplet generating apparatus, and increasing universality of the generating apparatus. In addition, the droplet generating apparatus can be used in combination with other detection devices. In one embodiment, the micro-pipe is a chip defining a plurality of microchannels. An inlet opening is defined at one end of the microchannel. An inner diameter of the inlet opening can be in a range from about 0.5 mm to about 2 mm. The connecting tube 9 can be directly inserted into the inlet opening of the chip. An outlet opening can be defined on the other end of the microchannel. The chip can be made of an elastic material (e.g. polydimethyl siloxane). The outer diameter of the connecting tube can be only slightly larger than the inner diameter of the inlet opening, thereby sealing the connecting tube and the inlet opening without the adhesive. When the chip is made of a rigid material such as glass and plastic, a joint between the connecting tube and the inlet opening can be sealed by the adhesive.
[0126] The vibrating equipment 3 is configured to drive the micro-pipe 1 vibrating with respect to the container 2. Referring to
[0127] The vibrating equipment 3 can drive the reciprocating vibration with a small amplitude and a high vibration frequency. The vibrating equipment 3 can be an electromagnetic vibrating equipment, a piezoelectric ceramic vibrating equipment, or an eccentric rotating mass (ERM) vibration equipment.
[0128] The vibration frequency of the vibrating equipment 3 can be fixed, variable, or hierarchical. The vibration frequency of the vibrating equipment 3 can be in a range from about 0.1 Hz to about 5000 Hz, such as from about 1 Hz to about 500 Hz, from about 10 Hz to about 250 Hz, from about 30 Hz to about 200 Hz. In one embodiment, the vibration frequency of the vibrating equipment 3 is 50 Hz.
[0129] The amplitude of the vibrating equipment 3 can be adjusted by regulating an input voltage of the vibrating equipment 3. The input voltage of the vibrating equipment 3 can be regulated by an electromagnetic vibrator, a linear motor, an actuating motor, or a stepping motor. The amplitude can be in a range from about 0.5 mm to about 10 mm, such as from about 1 mm to about 5 mm, and from about 2 mm to about 4 mm. If the amplitude is too small, the outlet end of the micro-pipe 1 cannot completely separate from the liquid surface of the second liquid when moving away from the container 2. If the amplitude is too large, the precision of the volumes of the droplets can be decreased. The outlet end of the micro-pipe 1 can reach a highest position and a lowest position during the vibration. The liquid surface of the second liquid can be located between the highest position and the lowest position. In one embodiment, a distance between the highest position and the liquid surface can be in a range from about 5% of the amplitude to about 95% of the amplitude, such as from about 50% of the amplitude to about 80% of the amplitude.
[0130] If the container 2 is small, the liquid surface of the second liquid can be elevated while constantly generating the droplets in the second liquid. The droplet generating apparatus can further comprise a moving and locating device 10. The moving and locating device 10 is configured to substantially maintain the distance between the highest position of the outlet end of the micro-pipe 1 and the liquid surface of the second liquid when the position of the liquid surface of the second liquid is changed, thereby substantially maintaining the generating conditions of the plurality of droplets to form uniform droplets. The moving and locating device 10 can be a moving support, which can move in a direction parallel with a vibration direction of the micro-pipe 1. If the micro-pipe 1 is vertically positioned, the moving and locating device 10 can be a vertical lifting support. The moving and locating device 10 can further move in a 2D plane or a 3D space, thereby generating droplets in each container of the containers array one by one.
[0131] In one embodiment, the moving and locating device 10 can directly or indirectly drive the micro-pipe 1 to move. Referring to
[0132] The moving and locating device 10 can have a function of automatically locating, for example, by detecting a distance to the liquid surface of the second liquid.
[0133] The container 2 is configured to contain the second liquid 6, and accept the droplets 7 formed by the first liquid 5. The container 2 can further configured to storage and transfer the droplets 7.
[0134] The container 2 can store microliter liquid or nanoliter liquid. The container 2 can store at least one droplet, that is, the container can store a single droplet, or a plurality of droplets. The container 2 can be in form of a single container, a one-dimensional array of containers, or a two-dimensional array of containers. The container 2 can be a microplate, such as a standard 96-well ELISA microplate, a standard 96-well polymerase chain reaction microplate, a 384-well ELISA microplate, or a 384-well polymerase chain reaction microplate. The container array can store multitudinous droplets having specific amount and specific volumes, and the droplets containing specific components. Mixture and reaction of the droplets with the specific components can be taken in the container array. A bottom of the container 2 can be flat, rounded, or tapered.
[0135] Referring to
[0136] Referring to
[0137] It is noted that the relative movement between the micro-pipe 1 and the container 2 essentially refers to a relative movement between the outlet end of the micro-pipe 1 and the container 2. The vibrating equipment 3 can only drive the container 2 to move, the micro-pipe 1 to move, or both the container 2 and the micro-pipe 1 to move cooperatively and in coordination.
[0138] Referring to
[0139] In one embodiment, the micro-pipe 1 can be vertically disposed, and the outlet end of the micro-pipe 1 can be vibrated up and down with respect to the liquid surface of the second liquid. A distance between the highest position of the outlet end and the liquid surface can be in a range from about 5% of the amplitude to about 95% of the amplitude, such as from about 50% of the amplitude to about 80% of the amplitude, for example, from about 0.5 mm to about 2 mm. In one embodiment, the micro-pipe 1 can be vertically disposed, and the outlet end of the micro-pipe 1 can be vibrated horizontally under the liquid surface of the second liquid. In one embodiment, the micro-pipe 1 can be horizontally disposed, and the outlet end of the micro-pipe 1 can be vibrated horizontally under the liquid surface of the second liquid.
[0140] In one embodiment, the vibrating equipment 3 can be connected to the container 2, and directly drive the container 2 to vibrate with respect to the micro-pipe 1. The container 2 can be vibrated up and down, or back and forth by the vibrating equipment 3 to contact the liquid surface of the second liquid with the outlet end of the micro-pipe 1, and to accept the droplets formed by the first liquid.
[0141] A plurality of droplets with different components and volumes can be successively generated by changing components of the first liquid, by which not only multitudinous high-throughput screening of the micro-liquid, but also ultramicro biochemical reaction and detection with multi-steps can be realized.
[0142] The first liquid can be filled with the micro-pipe 1. The first liquid can be injected into the micro-pipe 1 continuously or intermittently by the liquid driving device 4. In one embodiment, the first liquid can be injected into the micro-pipe 1 continuously in coordinating with the vibration of the outlet end of the micro-pipe 1. In one embodiment, the first liquid can be injected into the micro-pipe 1 at a predetermined flow rate for a predetermine time when the micro-pipe 1 reaches a predetermined position.
[0143] Referring to
[0144] Diameters and volumes of the droplets can be controlled by regulating the flow rate of the first liquid in the micro-pipe 1, the volume of the first liquid in the micro-pipe 1, the size of the outlet end of the micro-pipe 1, and the vibration frequency and amplitude of the micro-pipe 1. The volumes of the droplets can be controlled in a wide range from about 20 pL to about 10 nL.
[0145] In the present disclosure, the micro-pipe 1 can be filled with the first liquid, or at least the outlet end can be filled with the first liquid. The micro-pipe 1 can be disposed above the liquid surface of the second liquid in the container, and then moved towards the liquid surface of the second liquid until contact with and entering into the second liquid. When the first liquid flow out from the outlet end of the micro-pipe 1, the micro-pipe 1 can be moved away from the liquid surface of the second liquid vertically or horizontally until the outlet end is exiting out from the second liquid, during which the first liquid flowing out from the outlet end of the micro-pipe 1 can be separated from the micro-pipe 1, and form one droplet in the second liquid. An interfacial energy and a fluid shear force can be generated when the outlet end of the micro-pipe 1 goes across the liquid surface of the second liquid to overcome a surface tension and an adhesion force between the first liquid and the surface of the outlet end of the micro-pipe 1, so that the first liquid can be released from the micro-pipe 1 smoothly and quantitatively to form the droplets with controllable sizes and volumes. Furthermore, by regulating a vibration frequency of the micro-pipe 1 in which the first liquid is continuously injected into and flowed out, multitudinous droplets (e.g. droplets containing a biochemical sample) with fixed volumes can be generated quickly, effectively, and precisely. As the droplets can be directly generated in a second liquid, an evaporation of the droplets can be avoided, and the extraction and storage of the droplets can be simplified.
[0146] An analysis apparatus based on single molecule or single cell comprising the droplet generating apparatus is disclosed. The analysis apparatus can further comprise a processing device and/or an analysis device.
[0147] In one embodiment, the processing device can be an amplification device used for single molecule (e.g. nucleic acid molecule) amplification. The amplification device can be selected from a polymerase chain reaction device, a temperature control box, a temperature control heating plate, an infrared heater with a temperature control device, or a wind heater with a temperature control device.
[0148] The amplification device and the droplet generating apparatus can be independent from each other, or integrated as one apparatus.
[0149] In one embodiment, the amplification device and the droplet generating apparatus are independent from each other, each with their own respective advantages. The droplet generating apparatus can be used as a micro pipette for adding trace amounts of reagents for biological reaction or chemical reaction. The amplification device can be used to carry out an amplified reaction. The container wherein the generated droplets are stored can be transferred to the amplification device. A support for supporting the container during droplet generation can be used to transfer the container and the droplets. The support for supporting the container can be a moving support or a band carrier. The container and the droplets can be transferred to the amplification device smoothly to prevent the fusing of the droplets induced by a vibration of the container.
[0150] In another embodiment, the amplification device and the droplet generating apparatus are integrated as one apparatus. After the droplets are generated, the amplified reaction can be carried out directly in the container, thereby avoiding the vibration of the container, and increasing the use convenience of the analysis apparatus.
[0151] The amplification device can comprise a temperature controller. The temperature controller is configured to provide a temperature corresponding to each reaction step of the amplified reaction.
[0152] The analysis apparatus can further comprise a detection device. The detection device is configured to collect and process signals of the droplets after the amplified reaction, and output detection results.
[0153] The detection device can comprise a signal collecting device, a signal processing device, and an output device. The signal collecting device is configured to collect product signals (e.g. fluorescence signals, ultraviolet signals or turbidity signals) after the amplified reaction. The signal processing device can process the product signals according to droplet generating conditions such as the flow rate of the first liquid and the vibration frequency to calculate a quantitative result. The output device is configured to output the detection results.
[0154] The signal collecting device, the signal processing device, and the output device is not limited in the present disclosure. The detection device can be an optical microscopic imaging system, a fluorescence scanner, or an integrated imaging sensor. In one embodiment, the detection device is a fluorescence microscopic imaging system, wherein a fluorescence phenomenon of the droplets can be observed, and a number of templates DNA in reaction liquid of the amplified reaction can be obtained by counting fluorogenic droplets. In one embodiment, the droplets can be imaged by the optical microscopic imaging system to obtain all signals of the droplets at one time.
[0155] The amplified droplets can further be extracted and used for whole genome sequencing, single nucleotide polymorphism analysis, copy number variation, gene site mutation, and multi-gene expression.
[0156] The amplification device and the detection device can be independent from each other, or integrated as one apparatus.
[0157] In the analysis apparatus, the first liquid can comprise target molecules or target cells. The first liquid can further comprise reactants for the amplified reaction. The first liquid can be an aqueous solution. In one embodiment, the first liquid can comprise nucleic acid templates, a buffered aqueous solution, deoxyribonucleoside triphosphate (dNTP), a primer, a polymerase, and marking materials of the product of the amplified reaction (e.g. fluorescent material). The first liquid can also be a positive control reaction liquid or a negative control reaction liquid.
[0158] The sample to be detected can be micro-quantity of liquid containing a few nucleic acid molecules. The sample can be micro body fluid (e.g. blood), small amount of epidermis, or small amount of mucosa. The sample can comprise a few microorganism (e.g. bacteria, virus, or plasmid) whose quantitative analysis can be realized by detecting specific DNA fragment or RNA fragment of chromosome of the microorganism.
[0159] The reaction liquid for the amplified reaction can be nucleic acid amplification reaction liquid (DNA amplification reaction liquid) with deoxyribonucleic acid (DNA) as template, reverse transcription nucleic acid amplification reaction liquid (RNA reverse transcription reaction liquid) with ribonucleic acid as template, or other nucleic acid amplification reaction liquid such as loop-mediated isothermal amplification reaction liquid. The DNA amplification reaction liquid can comprise deoxyribonucleoside triphosphate, buffer solution, inorganic ions, polymerase, primer, and DNA template. The DNA amplification reaction liquid can further comprise marking material for detection such as fluorochrome or fluorescence probe. The RNA reverse transcription reaction liquid can comprise reverse transcriptase, RNA inhibitor, buffer solution, inorganic ions, primer, and RNA template.
[0160] The marking material can be fluorochrome or fluorescence probe which can indicate the DNA amplification. The fluorochrome can be combined with DNA, such as SYBR Green. The fluorescence probe can be oligosaccharide probe with fluorophore and quenching group, such as TaqMan fluorescence probe. The marking material can also be nano fluorescent granules, or light absorption material.
[0161] The reaction liquid can be pre-mixed uniformly in another container such as a centrifuge tube, and then the marking material can be added to the reaction liquid.
[0162] The first liquid can be prepared and diluted before the amplification to ensure that the droplets with predetermined volume comprise at most one molecule to be amplified. That is, each droplet either comprises one molecule to be amplified, or does not comprise any molecule to be amplified. A number ratio of the molecule to be amplified to the droplets can be in a range from about 0.01 to about 0.5, or from about 0.1 to about 0.3.
[0163] The first liquid and the second liquid can be insoluble with each other. In one embodiment, the first liquid can be an aqueous solution, and the second liquid can be an oil phase. The second liquid can be a non-volatile liquid with stable chemical property, not react with the first liquid, and have no fluorescence interference. The second liquid can be at least one of mineral oil (e.g. n-tetradecane), vegetable oil, silicon oil, and perfluorinated alkane.
[0164] The second liquid can further comprise a surfactant to prevent fusing of the droplets. The surfactant can be inert. A volume ratio of the surfactant to the second liquid can in a range from about 0.01% to about 20% (v/v), such as from about 2% to about 10% (v/v). The surfactant can be at least one of nonionic surfactant, cationic surfactant, anionic surfactant, and ampholytic ionic surfactant, such as Span 40, Span 80, and Span 83. In one embodiment, the surfactant is 5% (v/v) of Span 80.
[0165] The second liquid can supply the fluid shear force for the first liquid to form the droplets, and an environment in which the droplets can be preserved stably and isolated from external environment during explicated reaction, thereby avoiding contamination and volatilization of the droplets, and increasing precision of the single molecule analysis apparatus or the single cell analysis apparatus.
[0166] In one embodiment, the specific gravity of the first liquid is larger than the specific gravity of the second liquid. The droplets can sink to the bottom of the container and form the droplet array. One layer or a plurality of layers of the droplets can be formed at the bottom of the container. One layer of the droplets is preferred due to detection convenience. In one embodiment, the specific gravity of the first liquid is substantially equal to the specific gravity of the second liquid, the droplets can be dispersed in the second liquid freely. In one embodiment, the specific gravity of the first liquid is smaller to the specific gravity of the second liquid, the droplets can float at an upper portion of the second liquid.
Example 1
[0167] Referring to
[0168] The capillary 1 is vertically disposed and fixed on a vibrator capable of vibrating up and down. The capillary 1 is vibrated up and down by the vibrator with a vibration frequency of 0.1 Hz and an amplitude of 10 mm. In one cycle (a vibration period of 10 seconds), at zero second, an initial position of an outlet end of the capillary 1 is 5 mm above a liquid surface of the mineral oil 6. The capillary 1 is driven by the vibrator move down vertically at a rate of 2 mm/s from the initial position to enter the mineral oil 6 at a depth of 5 mm. Then the capillary 1 is immediately moved up vertically at a rate of 2 mm/s until it is back to the initial position. During the moving, the water 5 is injected into the capillary 1 continuously at a flow rate of 2 nL/s by the syringe pump, driven out from the outlet end of the capillary 1, and detached from the outlet end of the capillary 1 to form one droplet 7 with a volume of 20 nL in the mineral oil 6 at the 9th second. The droplet 7 sinks to a bottom of the container 2 due to its higher specific gravity. A plurality of uniform droplets each having a volume of 20 nL are generated during the vibration.
[0169] The flow rate of the water 5 and the moving speed of the capillary 1 can be increased corresponding to each other to decrease the time for forming the 20 nL droplet.
[0170] The injection of the water 5 and the movement of the capillary 1 are continuous, thereby increasing efficiency of generating droplets. Multitudinous droplets can be generated conveniently in this example.
Example 2
[0171] The method in Example 2 is substantially the same as the method in Example 1, except that the flow rate of the water injected by the syringe pump is 1 nL/s, 5% (v/v) of Span 80 is pre-added to the mineral oil to prevent fusing of the droplets, and each generated droplet has a volume of 10 nL.
[0172] The volume of each droplet can be adjusted by regulating the flow rate of the water.
Example 3
[0173] Referring to
[0174] Three droplets are generated simultaneously in one cycle. Multitudinous droplets can be generated by using the array of capillaries effectively and conveniently.
Example 4
[0175] Referring to
[0176] The microfluidic chip is made of polydimethylsiloxane, and prepared by soft lithography. The microfluidic chip has a thickness of 2 mm, a width of 8.5 mm, and a length of 2 cm. Each microchannel has a depth of 30 m, a width of 100 m, and a length of 1 cm. A spacing between adjacent microchannels in the five parallel microchannels is 1.5 mm Each microchannel corresponds to a tapered outlet end. A diameter of each sample port is 500 m. Each Teflon tube has an inner diameter of 300 m, an outer diameter of 600 m, and a length of 20 cm. Each Teflon tubes can be inserted into each inlet openings made by elastic polydimethylsiloxane with a good air tight seal.
[0177] Five droplets can be generated simultaneously in one cycle. Multitudinous droplets can be generated by using the array of microchannels effectively and conveniently.
Examples 5 to 8
[0178] The methods in Examples 5 to 8 is substantially the same as the method in Example 1, except that the mineral oil 6 is replaced by a tetradecane containing 5% (v/v) of Span 80, the flow rate of the water are respectively 2.4 L/min, 4.8 L/min, 6 L/min, and 12 L/min, the vibration frequency is 50 Hz, the amplitude of the capillary is 3 mm, the initial position of the outlet end of the capillary 1 is 2 mm above a liquid surface of the tetradecane, and the outlet end of the capillary 1 enters into the tetradecane at a depth of 1 mm when moving down.
[0179] Referring to
Examples 9 to 13
[0180] The methods in Examples 9 to 13 is substantially the same as the method in Example 5, except that the flow rates of the water are respectively 0.06 L/min, 0.30 L/min, 0.60 L/min, 1.2 L/min, and 18 L/min.
[0181] Referring to
Example 14
[0182] Referring to
Example 15
[0183] The method in Example 15 is substantially the same as the method in Example 14, except that the amplitude is 3 mm Referring to
Example 16
[0184] The method in Example 16 is substantially the same as the method in Example 14, except that the amplitude is 4 mm Referring to
[0185] It can be seen from
[0186] The size precision of the droplets is influenced by the flow rate of the first liquid and an amplitude of the outlet end of the micro-pipe 1 when the outlet end of the micro-pipe 1 is vibrated horizontally in the second liquid. The droplets can be directly generated in the second liquid, thereby avoiding contact with air, and eliminating the contamination and the evaporation of the droplets.
Example 17
[0187] Sodium alginate microspheres are prepared, and single cell microbe culture is taken in the sodium alginate microspheres in this example.
[0188] The first liquid is a sodium alginate aqueous solution containing 0.9% (w/v) of sodium chloride and 110.sup.8 cell/ml of Escherichia coli cells. The second liquid is a 1% (v/v) of calcium chloride aqueous solution.
[0189] A quartz capillary 1 with an inner diameter of 40 m and an outer diameter of 100 m is previously silanized by a dichloro dimethyl silane to make its surface hydrophobic. The capillary 1 is vertically fixed on a vibrator and vibrated up and down by the vibrator at a vibration frequency of 50 Hz with an amplitude of 2.5 mm During vibration, a distance between an outlet end of the capillary 1 and the liquid surface of the second liquid is 2 mm at highest position above the liquid surface, and 0.5 mm at lowest position under the liquid surface. The first liquid is injected into the capillary 1 at a flow rate of 0.3 L/min to ensure that the capillary 1 is filled with the first liquid. When the first liquid entered into the second liquid along with the outlet end of the capillary 1, the sodium alginate are crosslinked and solidified due to calcium ions to form the sodium alginate microspheres containing Escherichia coli cells, and the sodium alginate microspheres are detached from the outlet end of the capillary 1 due to surface tension and fluid shear force. Referring to
[0190] After the microspheres are generated, 400 L of 5% (v/v) of calcium chloride aqueous solution is added to the container to solidify the microspheres again. The microspheres can be separated from the second liquid by centrifugation at 3000 rpm for 3 min, and put into a LB (luria-bertani) culture medium. The Escherichia coli cells are cultured at a temperature of 37 C. After the culture, the microspheres are observed by a microscope. A micro-colony grown by the Escherichia coli cells is observed. Multitudinous microorganisms can be separated from each other and then be cultured independently by the microspheres. Manipulation, separation, purification, and analysis of the micro-colony are convenient.
Example 18
[0191] The method in Example 18 is substantially the same as the method in Example 1, except that the capillary 1 has an inner diameter of 30 m and an outer diameter of 50 m. The second liquid is a tetradecane containing 5% (v/v) of Span 80, the first liquid is water.
Comparative Example 1
[0192] Referring to
[0193] Referring to
Comparative Example 2
[0194] Referring to
[0195] Referring to
[0196] Referring to
Example 19
[0197] Referring to
Example 20
[0198] Referring to
[0199] 100 L of a mineral oil is added to each pore of the 96 well microplate. 100 L of sample liquid is injected into each flow channel firstly. Each micro-pipe is aligned to each pore of the 96 well microplate. A distance between an outlet end of each micro-pipe and the liquid surface of the mineral oil is 2 mm above the liquid surface.
[0200] The connecting tube 9 is vibrated by a vibrator at a vibration frequency of 50 Hz and with an amplitude of 3 mm. The flow rate of the sample liquid is 100 nL/s. Fifty droplets each having a volume of 2 nL are generated in each pore in each second. The droplets generating can be repeated only be replacing another 96 well microplate.
[0201] The liquid driving device can apply an air pressure on a liquid surface of the sample liquid stored in the liquid storage cavity 1-2 to drive the sample liquid contained in the micro-pipe flow, thereby prevent pollution of the sample liquid to the liquid driving device.
Example 21
[0202] Referring to
Example 22
[0203] Referring to
Example 23
[0204] 300 ng/L of -DNA (bought from TAKARA corporation, extracted from phage) is diluted by a factor of about 10.sup.6, put into a PCR (Polymerase Chain Reaction) device, and denaturalized at 95 C. for 10 min.
[0205] Preparation of LAMP (Loop-mediated isothermal amplification) reaction liquid: supplying 12.5 L of buffer liquid comprising 40 mmoL/L of Tris-HCl, 20 mmol/L of KCl, 16 mmol/L of MgSO.sub.4, 20 mmol/L of (NH.sub.4).sub.2SO.sub.4, 0.2% of Tween 20, 1.6 mol/L of glycine betaine, 2.8 mmol of dNTPs (deoxy-ribonucleoside triphosphate); supplying primers comprising 40 pmol of FIP, 40 pmol of BIP, 20 pmol of Loop-F, 20 pmol of Loop-B, 5 pmol of F3, and 5 pmol of B3; adding the primers, 1 L of Bst DNA polymerase solution, 1 L of Calcein, 1 L of -DNA, 2 mg/mL of bovine serum albumin solution, and sterile water to the buffer liquid to form a 25 L of LAMP reaction liquid.
[0206] The gene sequences of the above primer are respectively listed as:
TABLE-US-00001 FIP: CAGCATCCCTTTCGGCATACCAGGTGGCAAGGGTAATGAGG; BIP: GGAGGTTGAAGAACTGCGGCAGTCGATGGCGTTCGTACTC; F3: GAATGCCCGTTCTGCGAG; B3: TTCAGTTCCTGTGCGTCG; Loop-F: GGCGGCAGAGTCATAAAGCA; Loop-B: GGCAGATCTCCAGCCAGGAACTA
[0207] 150 L of mineral oil comprising a surfactant is added to a pore of a 96 well microplate with a pore volume of 200 L and an inner diameter of 8 mm A capillary with a length of 5 cm, an inner diameter of 30 m, and an outer diameter of 60 m is connected to a syringe filled with 50 L of mineral oil through a Teflon tube with an inner diameter of 300 m, wherein connection joints are sealed by epoxy resin. The 50 L of mineral oil contained in the syringe is injected into the Teflon tube and the capillary by a syringe pump to expel air out the Teflon tube and the capillary.
[0208] The LAMP reaction liquid is sucked into the Teflon tube and the capillary by the syringe. The connection joint of the Teflon tube and the capillary is fixed on a vibrating reed of a vibrator. The capillary is hung upon the liquid surface of the mineral oil contained in the pore of the 96 well microplate. A distance between the outlet end of the capillary and the liquid surface is 1 mm. The capillary is vibrated up and down by the vibrator at a vibration frequency of 50 Hz and with an amplitude of 3 mm. The LAMP reaction liquid is injected into the capillary at a flow rate of 100 nL/s with a total volume of 4 L. After 4 L of the LAMP reaction liquid is injected, 90% of the bottom of the pore of the 96 well microplate is lie with the generated droplets.
[0209] The 96 well microplate is put into the PCR device. The droplets in the 96 well microplate are amplified simultaneously at 63 C. for 1 hours.
[0210] Referring to
Example 24
[0211] The method in Example 24 is substantially the same as the method in Example 23, except that the flow rates of the LAMP reaction liquid are respectively 200 nL/s, 80 nL/s and 10 nL/s to obtain the droplets each having a volume of 4 nL, 1.7 nL, and 0.25 nL.
[0212] Referring to
[0213] Finally, it is to be understood that the above embodiments are intended to illustrate rather than limit the present disclosure. Variations may be made to the embodiments without departing from the spirit of the present disclosure as claimed. Elements associated with any of the above embodiments are envisioned to be associated with any other embodiments. The above-described embodiments illustrate the scope of the present disclosure but do not restrict the scope of the present disclosure.