DISINTEGRIN VARIANTS AND PHARMACEUTICAL USES THEREOF

20200010516 ยท 2020-01-09

    Inventors

    Cpc classification

    International classification

    Abstract

    Disintegrin variants that bind specifically to one or more of 51 and v integrins, such as v=1, v3, v5, v6 and v8, but with reduced binding activity to IIb3, are described. Also described are uses of the disintegrin variants for the treatment or prevention of a disease associated with an v integrin or an 51 integrin.

    Claims

    1. A polynucleotide encoding a disintegrin variant of rhodostomin comprising the amino acid sequence of SEQ ID NO: 1, wherein the disintegrin variant comprises: a mutant RGD loop, wherein the amino acid sequence at positions 46 to 53 of SEQ ID NO: 1 is substituted with an amino acid sequence selected from the group consisting of SEQ ID NOs: 329, 330, 331, 353, and 354, and at least one selected from the group consisting of: (a) a mutant linker, wherein the amino acid sequence at positions 39 to 45 of SEQ ID NO: 1 is substituted with an amino acid sequence selected from the group consisting of SEQ ID NO: 306 to SEQ ID NO: 318; and (b) a mutant C-terminus, wherein the amino acid sequence at positions 65 to 68 of SEQ ID NO: 1 is substituted with an amino acid sequence selected from the group consisting of SEQ ID NOs: 319, 323, 324, 326, 327, 328, 337, and 352, wherein the disintegrin variant has an increased selectivity for at least one of v1, v3, v5, v6, v8 and 51 integrins over IIb3 integrin as compared to wild-type rhodostomin having the amino acid sequence of SEQ ID NO: 1.

    2. The polynucleotide of claim 1, wherein the disintegrin variant comprises the mutant RGD loop, the mutant linker and the mutant C-terminus.

    3. The polynucleotide of claim 1, wherein the disintegrin variant comprises a mutant RGD loop of SEQ ID NO: 331 and a mutant linker of SEQ ID NO: 313.

    4. The polynucleotide of claim 1, wherein the disintegrin variant comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 120, 121, 123, 124, 129-144, 147, 149, 160, 166, 169, 171, 339, 347, and 349.

    5. The polynucleotide of claim 1, wherein the disintegrin variant comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 123, 124, 147, 149 and 171.

    6. The polynucleotide of claim 1, wherein the disintegrin variant is pegylated or conjugated with albumin or Fc.

    7. A recombinant host cell comprising the polynucleotide of claim 1.

    8. A method for treating a disease associated with at least one integrin selected from the group consisting of v1, v3, v5, v6, v8 and 51 integrins in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising a disintegrin variant of rhodostomin comprising the amino acid sequence of SEQ ID NO: 1, and a pharmaceutically acceptable carrier, wherein the disintegrin variant comprises: a mutant RGD loop, wherein the amino acid sequence at positions 46 to 53 of SEQ ID NO: 1 is substituted with an amino acid sequence selected from the group consisting of SEQ ID NOs: 329, 330, 331, 353, and 354, and at least one selected from the group consisting of: (a) a mutant linker, wherein the amino acid sequence at positions 39 to 45 of SEQ ID NO: 1 is substituted with an amino acid sequence selected from the group consisting of SEQ ID NO: 306 to SEQ ID NO: 318; and (b) a mutant C-terminus, wherein the amino acid sequence at positions 65 to 68 of SEQ ID NO: 1 is substituted with an amino acid sequence selected from the group consisting of SEQ ID NOs: 319, 323, 324, 326, 327, 328, 337, and 352, wherein the disintegrin variant has an increased selectivity for at least one of v1, v3, v5, v6, v8 and 51 integrins over IIb3 integrin as compared to wild-type rhodostomin having the amino acid sequence of SEQ ID NO: 1.

    9. The method of claim 8, wherein the disintegrin variant comprises the mutant RGD loop, the mutant linker and the mutant C-terminus.

    10. The method of claim 8, wherein the disintegrin variant comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 120, 121, 123, 124, 129-144, 147, 149, 160, 166, 169, 171, 339, 347, and 349.

    11. The method of claim 8, wherein the disintegrin variant comprises a mutant RGD loop of SEQ ID NO: 331 and a mutant linker of SEQ ID NO: 313.

    12. The method of claim 8, wherein the disintegrin variant is pegylated or conjugated with albumin or Fc.

    13. The method of claim 8, wherein the integrin-associated disease is an angiogenesis-related eye disease selected from the group consisting of age-related macular degeneration, diabetic retinopathy, corneal neovascularizing diseases, ischaemia-induced neovascularizing retinopathy, high myopia, and retinopathy of prematurity.

    14. The method of claim 8, wherein the integrin-associated disease is a cancer selected from the group consisting of metastatic melanoma, metastatic prostate cancer, metastatic breast cancer, colorectal carcinoma, liver cancer, ovarian cancer, cervical cancer, pancreatic cancer, non-small-cell lung cancer, and glioblastoma multiforme.

    15. The method of claim 8, wherein the integrin-associated disease is selected from the group consisting of osteoporosis, bone tumor or cancer growth and symptoms related thereto, angiogenesis-related tumor growth and metastasis, tumor metastasis in bone, malignancy-induced hypercalcemia, Paget's disease, and arthritis.

    16. A method for treating a disease associated with at least one integrin selected from the group consisting of v1, v3, v5, v6, v8 and 51 integrins in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising a disintegrin variant of rhodostomin, and a pharmaceutically acceptable carrier, wherein the disintegrin variant comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 123, 124, 147, 149 and 171.

    17. The method of claim 16, wherein the disintegrin variant is pegylated or conjugated with albumin or Fc.

    18. The method of claim 16, wherein the integrin-associated disease is an angiogenesis-related eye disease selected from the group consisting of age-related macular degeneration, diabetic retinopathy, corneal neovascularizing diseases, ischaemia-induced neovascularizing retinopathy, high myopia, and retinopathy of prematurity.

    19. The method of claim 16, wherein the integrin-associated disease is a cancer selected from the group consisting of metastatic melanoma, metastatic prostate cancer, metastatic breast cancer, colorectal carcinoma, liver cancer, ovarian cancer, cervical cancer, pancreatic cancer, non-small-cell lung cancer, and glioblastoma multiforme.

    20. The method of claim 16, wherein the integrin-associated disease is selected from the group consisting of osteoporosis, bone tumor or cancer growth and symptoms related thereto, angiogenesis-related tumor growth and metastasis, tumor metastasis in bone, malignancy-induced hypercalcemia, Paget's disease, and arthritis.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0031] The foregoing summary, as well as the following detailed description of the invention, will be better understood when read in conjunction with the appended drawings. It should be understood that the invention is not limited to the precise embodiments shown in the drawings.

    [0032] In the drawings:

    [0033] FIGS. 1A and 1B illustrate the interaction map of rhodostomin: FIG. 1A is an illustration of the interactions among the linker region, RGD loop, and C-terminal region of rhodostomin; and FIG. 1B shows the amino acid sequences of the regions involved in the interactions between rhodostomin and integrins, where the residues that can be mutated in a disintegrin variant according to an embodiment of the invention are marked as X;

    [0034] FIGS. 2A, 2B, and 2C show the inhibitory activity of various tested agents on the migration of A375 human melanoma cells: FIG. 2A is the wild-type Rho, FIG. 2B is AR-NP protein (KKART-ARGRGDNP, SEQ ID NO: 350), a disintegrin variant according to an embodiment of the invention, and FIG. 2C is phosphate buffered saline (PBS);

    [0035] FIG. 3A are photographs showing a reduced blood vessel density in MATRIGEL plugs from C57BL/6 mice treated with AR-NP protein or ARLDDL protein (SEQ ID NO: 351), in comparison with untreated control mice;

    [0036] FIG. 3B is a graph showing a reduced hemoglobin content in MATRIGEL plugs from C57BL/6 mice treated with AR-NP protein or ARLDDL protein (SEQ ID NO: 351) twice daily after 5 days in comparison with untreated control mice;

    [0037] FIG. 3C is a graph showing a reduced hemoglobin content in MATRIGEL plugs from C57BL/6 mice treated with AR-NP protein or ARLDDL protein (SEQ ID NO: 351) administrated once daily for 5 days in comparison with untreated control mice;

    [0038] FIG. 4A are photographs showing angiogenesis in a mouse model of retinopathy of prematurity (ROP), and reduced angiogenesis in a ROP mouse treated with AR-NP protein, arrows indicate blood vessel profiles (BVPs) of new vessels;

    [0039] FIG. 4B is a graph showing reduced BVPs of the new vessels in a mouse model of retinopathy of prematurity (ROP) treated with AR-NP protein;

    [0040] FIG. 4C is a graph showing reduced BVPs of the endothelial cells in a mouse model of retinopathy of prematurity (ROP) treated with AR-NP protein;

    [0041] FIG. 5 shows the inhibition of mice aortic ring by AR-NP protein (0.1 M) for 7 days in comparison with untreated control: upper panel: images taken at magnification 20; Lower panel: image taken at magnification 100;

    [0042] FIG. 6 shows that both ARLDDL (SEQ ID NO: 351) (0.1 M & 1 M) and AR-NP (0.1 M & 1 M) inhibited colony formation of 4-T1 breast cancer cells;

    [0043] FIGS. 7A, 7B, 7C, and 7D show that AR-NP protein or ARLDDL protein inhibited RANKL-induced osteoclastogenesis in comparison with untreated control: AR-NP protein (FIGS. 7B and 7C); ARLDDL protein (SEQ ID NO: 351) (FIG. 7D); control (FIG. 7A);

    [0044] FIG. 8 shows that both ARLDDL (SEQ ID NO: 351) (0.1 M) and AR-NP (0.1 M) markedly inhibited glioma invasion;

    [0045] FIGS. 9A and 9B show that AR-NP at 5 mg/kg did not significantly affect blood pressure and heart rate in Wistar rat;

    [0046] FIG. 10 shows the inhibition of A375 melanoma growth by AR-NP in SCID mice, scale bar: 1 cm;

    [0047] FIG. 11 shows the inhibition of tumor growth by AR-NP (KG) in K-rasG12D transgenic mice; and

    [0048] FIG. 12 shows the inhibition of brain tumor growth in U87-bearing mice by AR-NP (KG).

    DETAILED DESCRIPTION OF THE INVENTION

    [0049] Various publications, articles and patents are cited or described in the background and throughout the specification; each of these references is herein incorporated by reference in its entirety. Discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is for the purpose of providing context for the invention. Such discussion is not an admission that any or all of these matters form part of the prior art with respect to any inventions disclosed or claimed.

    [0050] Unless defined otherwise, all technical and scientific terms used herein have the same meaning commonly understood to one of ordinary skill in the art to which this invention pertains. Otherwise, certain terms used herein have the meanings as set in the specification. All patents, published patent applications and publications cited herein are incorporated by reference as if set forth fully herein. It must be noted that as used herein and in the appended claims, the singular forms a, an, and the include plural reference unless the context clearly dictates otherwise.

    [0051] As used herein, a disintegrin refers to a class of cysteine-rich proteins that are potent soluble ligands of integrins and are involved in regulating many processes such as cell-cell and cell-extracellular matrix adhesion, migration and invasion, cell cycle progression, differentiation and cell type speciation during development of many metazoan organisms, cell death and apoptosis. The amino acid motif RGD (Arg-Gly-Asp) is conserved in most monomeric disintegrins and is located at the tip of a flexible loop, the integrin-binding loop, which is stabilized by disulfide bonds and protruding from the main body of the polypeptide chain. All disintegrins purified from snake venom selectively bind to or target the fibrinogen receptors, such as v-integrins, 51 integrin, and integrin IIb3, the binding of which results in the inhibition of fibrinogen-dependent platelet aggregation as well as other biological activities mediated by these fibrinogen receptors. Examples of disintegrins useful in the invention include, but are not limited to, rhodostomin, triflavin, rchistatin trimucrin, elegantin, trigramin and applaggin. Exemplary peptide sequences of disintegrins useful in the invention are provided in SEQ ID NOs: 1 to 6.

    [0052] As used herein, a disintegrin variant refers to an engineered, functionally active protein, or a polypeptide or any derivatives thereof, that comprises an amino acid sequence derived or modified or mutated from a wild-type disintegrin. A disintegrin variant contains one or more mutations compared to a naturally occurring disintegrin. The one or more mutations can be a substitution, deletion, or insertion of one or more amino acids to the naturally occurring disintegrin. In one embodiment, a disintegrin variant has a reduced binding activity to IIb3 integrin as compared to the naturally occurring disintegrin not having the one or more mutations. More preferably, a disintegrin variant binds specifically to one or more of integrins v1, v3, v5, v6 and v8, and integrin 51. Most preferably, the disintegrin variant has increased binding activity to one or both of integrin v3 and integrin 51 as compared to the naturally occurring disintegrin without the one or more mutations.

    [0053] In certain embodiments, a disintegrin variant comprises a modified Rho protein from venom that contains at least one amino acid substitution, insertion or deletion compared with the naturally occurring Rho. Modified Rho variants and/or different disintegrin can further comprise post translational modifications.

    [0054] In one embodiment, a disintegrin variant of the invention comprises a mutant RGD loop. As used herein, a mutant RGD loop or mutant RGD region refers to a peptide comprising one or more mutations in the amino acid sequence that spans the RGD loop of a disintegrin. The RGD loop of a wild-type disintegrin comprises the RGD residues that bind to integrins. For example, the RGD loop of Rho comprises the amino acid sequence of SEQ ID NO: 333 (RIPRGDMP). In preferred embodiments of the invention, a mutant RGD loop comprises at least one mutation at positions 1-3, 5, 7 and 8 of the amino acid sequence of SEQ ID NO: 333. More preferably, a mutant RGD loop comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 329 to 331.

    [0055] In another embodiment, a disintegrin variant of the invention comprises a mutant linker. As used herein, a mutant linker or mutant linker region refers to a peptide comprising one or more mutations in the amino acid sequence that spans the linker region of a disintegrin. The linker region of a disintegrin is located immediately N-terminal to the RGD loop. For example, the linker region of Rho comprises the amino acid sequence of SEQ ID NO:332 (SRAGKIC). In preferred embodiments of the invention, a mutant linker comprises at least one mutation at positions 1 to 5 of the amino acid sequence of SEQ ID NO:332. More preferably, a mutant linker comprises the amino acid sequence selected from the group consisting of SEQ ID NO:306 to SEQ ID NO: 318.

    [0056] In yet another embodiment, a disintegrin variant of the invention comprises a mutant C-terminus. As used herein, a mutant C-terminus or mutant C-terminal region refers to a peptide comprising one or more mutations in the amino acid sequence of the C-terminal region of a disintegrin. The C-terminal region of a disintegrin is located at the carboxyl end of the disintegrin. For example, the C-terminus of Rho comprises the amino acid sequence of SEQ ID NO: 334 (PRYH). In preferred embodiments of the invention, a mutant C-terminus comprises at least one mutation at positions 1-4 of the amino acid sequence of SEQ ID NO:334. More preferably, a mutant C-terminus comprises the amino acid sequence selected from the group consisting of SEQ ID NO:319 to SEQ ID NO: 328.

    [0057] In preferred embodiments, a disintegrin variant of the invention comprises a mutant RGD loop and at least one of a mutant linker and a mutant C-terminus of a disintegrin.

    [0058] In more preferred embodiments, a disintegrin variant of the invention comprises a mutant RGD loop, a mutant linker and a mutant C-terminus of a disintegrin described herein.

    [0059] A disintegrin variant of invention can include naturally-occurring and non-naturally occurring amino acids. Examples of naturally-occurring amino acid include, but are not limited to, any of the twenty primary, naturally occurring amino acids which typically form peptides, polypeptides, and proteins. The following table 1 is a tabulation of 20 naturally occurring amino acids.

    TABLE-US-00001 TABLE 1 Naturally Occurring Amino Acids Three-letter One-letter Amino Acid abbreviation symbol Alanine Ala A Arginine Arg R Asparagine Asn N Aspartic Acid Asp D Cysteine Cys C Glutamine Gln Q Glutamic acid Glu E Glycine Gly G Histidine His H Isoleucine Ile I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine Thr T Tryptophan Trp W Tyrosine Tyr Y Valine Val V

    [0060] Non-naturally occurring amino acids are non-proteinogenic amino acids that either occur naturally or are chemically synthesized. Examples of non-naturally occurring amino acids include, but are not limited to, -amino acids (3 and 2), homo-amino acids, proline and pyruvic acid derivatives, 3-substituted alanine derivatives, glycine derivatives, ring-substituted phenylalanine and tyrosine derivatives, linear core amino acids, N-methyl amino acids, etc.

    [0061] As used herein, conservative substitution is the replacement of an amino acid with another amino acid that has the same net electronic charge and approximately the same size and shape. Amino acids with aliphatic or substituted aliphatic amino acid side chains have approximately the same size when the total number carbon and heteroatoms in their side chains differs by no more than about four. They have approximately the same shape when the number of branches in their side chains differs by no more than one. Amino acids with phenyl or substituted phenyl groups in their side chains are considered to have about the same size and shape. Listed below are five groups of amino acids. Replacing an amino acid in a polypeptide with another amino acid from the same group results in a conservative substitution: Group I: glycine, alanine, valine, leucine, isoleucine, serine, threonine, cysteine, and non-naturally occurring amino acids with C1-C4 aliphatic or C1-C4 hydroxyl substituted aliphatic side chains (straight chained or monobranched); Group II: glutamic acid, aspartic acid and non-naturally occurring amino acids with carboxylic acid substituted C1-C4 aliphatic side chains (unbranched or one branch point); Group III: lysine, ornithine, arginine and non-naturally occurring amino acids with amine or guanidino substituted C1-C4 aliphatic side chains (unbranched or one branch point); Group IV: glutamine, asparagine and non-naturally occurring amino acids with amide substituted C1-C4 aliphatic side chains (unbranched or one branch point); and Group V: phenylalanine, phenylglycine, tyrosine and tryptophan.

    [0062] As used herein, highly conservative substitution is the replacement of an amino acid with another amino acid that has the same functional group in the side chain and nearly the same size and shape. Amino acids with aliphatic or substituted aliphatic amino acid side chains have nearly the same size when the total number carbon and heteroatoms in their side chains differs by no more than two. They have nearly the same shape when they have the same number of branches in their side chains. Examples of highly conservative substitutions include valine for leucine, threonine for serine, aspartic acid for glutamic acid and phenylglycine for phenylalanine.

    [0063] The term isolated protein or isolated polypeptide as used herein refers to a protein encoded by a nucleic acid including, inter alia, genomic DNA, cDNA, recombinant DNA, recombinant RNA, or nucleic acid of synthetic origin or some combination thereof, which (1) is free of at least some proteins with which it would normally be found, (2) is essentially free of other proteins from the same source, e.g., from the same cell or species, (3) is expressed by a cell from a different species, (4) has been separated from at least about 50 percent of polynucleotides, lipids, carbohydrates, or other materials with which it is naturally found when isolated from the source cell, (5) is not linked (by covalent or noncovalent interaction) to all or a portion of a polypeptide to which the isolated protein is linked in nature, (6) is operatively linked (by covalent or noncovalent interaction) to a polypeptide with which it is not linked in nature, or (7) does not occur in nature. Preferably, the isolated protein is substantially free from other contaminating proteins or polypeptides or other contaminants that are found in its natural environment that would interfere with its therapeutic, diagnostic, prophylactic or research use.

    [0064] As used herein, the terms polynucleotide, nucleotide, oligonucleotide, and nucleic acid may be used interchangeably to refer to nucleic acid comprising DNA, RNA, derivative thereof, or combination thereof.

    [0065] As used herein, the terms polypeptide and protein may be used interchangeably to refer to proteins produced by naturally-occurring and non-recombinant cells, by genetically-engineered or recombinant cells, or by chemical synthesis, and comprise molecules having the amino acid sequence of the native protein, or sequences that have deletions, additions, and/or substitutions of one or more amino acids of the native sequence. In accordance with the instant invention, the disintegrins are polypeptide or protein specifically encompasses modified Rho protein or fragments thereof or variants thereof. In certain particular embodiments, the disintegrins encompasses Rho protein, the fragments or variants thereof that inhibit integrin activity. In certain particular embodiments, the disintegrin targets v-integrin isoform, such as any group selected from the v1, v3, v5, v6 and v8, and integrin 51. In certain other particular embodiments, the integrin is not IIb3.

    [0066] As used herein, a host cell is an individual cell or cell culture which can be or has been a recipient of any recombinant vector(s) or polynucleotide. Host cells include progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or in total DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation and/or change. A host cell includes cells transfected or infected in vitro or in vivo with a recombinant vector or a polynucleotide of the invention. A host cell which comprises a recombinant vector of the invention may be called a recombinant host cell. Suitable host cells include prokaryotic or eukaryotic cells, including, for example, bacterial, yeast, fungal, plant, insect, and mammalian cells.

    [0067] As used herein, the term binding activity refers to the binding of a disintegrin or a disintegrin variant to an integrin that results in one or more of inhibiting, blocking, neutralizing, reducing, abrogating or interfering with the integrin activities. In certain embodiments, the disintegrin or disintegrin variant inhibits integrin activities by binding to integrin and sequestering integrin from binding to other molecules, for example other ECM proteins. In certain other embodiments, the disintegrin or disintegrin variant inhibits integrin activities by binding to integrin and preventing integrin from triggering downstream signaling events in the cells.

    [0068] As used herein, the term inhibition or inhibit in the context of integrin activity as used herein refers to a property of a disintegrin or disintegrin variant that reduces the activity of integrin as analyzed by various functional assays, including without limitation, binding assays, migration assays, apoptosis assays and cell adhesion assays. In certain embodiments of the invention, the integrin is an v-integrin isoform, including v1, v3, v5, v6 and v8. In certain other particular embodiments, the integrin is 51. In certain further embodiments, the disintegrin or disintegrin variant inhibits integrin activity by from about 0% to about 100% as compared to the control in the absence of the disintegrin or disintegrin variant.

    [0069] As used herein, the term selectively bind, selectively inhibit, selective binding, selective inhibition, differentially bind, differentially inhibit, differential binding, or differential inhibition refers to the property of disintegrin or disintegrin variant that shows differential specificity for a particular target integrin molecule over one or more other integrins. For example, a disintegrin variant of the invention selectively binds to one or more of integrins v1, v3, v5, v6, 51, thus has higher affinity to the one or more of integrins v1, v3, v5, v6, 51 than another integrin, such as IIb3 integrin. In certain embodiments, the disintegrin variant comprising a modified Rho fragment selectively inhibits the activity of one or more integrins selected from the group consisting of integrins v1, v3, v5, v6 and integrin 51. In preferred embodiments, the disintegrin variant comprising a modified Rho fragment specifically inhibits both integrin v3 and integrin 51, inhibits both integrin v5 and integrin 51, or both integrin v6 and integrin 51 activities. In certain alternative embodiments, the disintegrin variant comprising a modified Rho fragment specifically inhibits all of integrins v1, v3, v5, v6, and integrin 51 activities.

    [0070] The term homology or homologous as used herein refers to the level of overall sequence similarity and/or identity between corresponding disintegrin fragments, such as a Rho fragment. High sequence homology suggests conservation of protein activity. A number of publicly available algorithms or software programs can be used to determine sequence homology. It is within the ability of one skilled in the art to determine the suitability of additional conservative or non-conservative amino acid substitutions and the level of sequence homology.

    [0071] As used herein, a subject refers to any animal including, but not limited to humans and other primates, rodents (e.g., mice, rats, and guinea pigs), lagamorphs (e.g., rabbits), bovines (e.g., cattle), ovines (e.g., sheep), caprines (e.g., goats), porcines (e.g., swine), equines (e.g., horses), canines (e.g., dogs), felines (e.g., cats), domestic fowl (e.g., chickens, turkeys, ducks, geese, other gallinaceous birds, etc.), as well as feral or wild animals, including, but not limited to, such animals as ungulates (e.g., deer), bear, lagamorphs, rodents, birds, etc. It is not intended that the term be limited to a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are encompassed by the term. Subjects in need of treatment are subjects with diseases and/or conditions that can be treated by inhibiting one or more activities of an integrin to achieve a beneficial therapeutic and/or prophylactic result. A beneficial outcome includes a decrease in the severity of symptoms or delay in the onset of symptoms, increased longevity and/or more rapid or more complete resolution of the disease or condition.

    [0072] A pharmaceutically acceptable carrier refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material, formulation auxiliary, or excipient of any conventional type. A pharmaceutically acceptable carrier is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.

    [0073] As used herein, pharmaceutically acceptable salts refer to derivatives of compounds wherein the parent compound is modified by making acid or base salts thereof.

    [0074] As used herein, a disease related to an integrin refers to any condition, disorder, or syndrome related to the integrin that requires medical intervention or for which medical intervention is desirable. Such medical intervention can include treatment, diagnosis, and/or prevention.

    [0075] As used herein, effective amount or sufficient amount refers to an amount of a disintegrin variant as described herein that can be therapeutically effective to inhibit, prevent, or treat a symptom of a particular disease, disorder, condition, or side effect.

    [0076] The term treat, treatment or treating means reducing the frequency, extent, severity and/or duration with a symptom of a particular disease, disorder, condition, or side effect.

    [0077] The term prevent, prevention or preventing means inhibition or the averting of symptoms of a particular disease, disorder, condition, or side effect.

    Disintegrin Variants

    [0078] It is discovered in the invention that variants of disintegrins from snake venom, such as rhodostomin (Rho) from rhodostoma, exhibit different capabilities to selectively bind to one or more v-integrins, such as one or more of v1, v3, v5, v6 and v8, and other integrins, such as 51, with reduced binding activity to vIIb3. The capability of selectively binding to certain integrin(s) was enabled by mutating amino acid sequences in one or more of the linker region, the RGD loop and the C-terminus of a disintegrin of interest.

    [0079] Accordingly, one general aspect of the invention relates to disintegrin variants. According to one embodiment of the invention, a disintegrin variant has reduced binding activity to IIb3, and binds specifically to at least one of 51, v1, v3, v5, v6 and v8.

    [0080] Preferably, a disintegrin variant has reduced binding activity to IIb3, but increased binding activity to at least one of 51 and v3 as compared to the wild-type disintegrin from which the disintegrin variant derived.

    [0081] For example, it was found that a Rho mutation in the RGD loop can increase specificity for V3 and/or 51 integrin, a mutation in the C-terminal region can cause less binding to IIb3 (thus weaker inhibition on platelet aggregation and less bleeding side effect) and a mutation in the linker region can also reduce binding to IIb3, wherein each of the three regions are identified by the amino acid residue numbers in the wild-type Rho, and the amino acid residues that can be modified, e.g., by an insertion, deletion, or substitution, according to embodiments of the invention are each independently marked as X.

    [0082] According to embodiments of the invention, a disintegrin variant comprises a mutation in the RGD loop, i.e., a mutant RGD loop.

    [0083] In one embodiment, a disintegrin variant comprises a mutant RGD loop having a consensus sequence of .sup.49RXD.sup.51. Examples of such variants include, but are not limited to, those having the amino acid sequences selected from the group consisting of SEQ ID NOs: 7-24.

    [0084] In another embodiment, a disintegrin variant comprises a mutant RGD loop having a consensus sequence of .sup.48XRGD.sup.51 (SEQ ID NO: 341). Examples of such variants include, but are not limited to, those having the amino acid sequences selected from the group consisting of SEQ ID NOs: 25-42.

    [0085] In another embodiment, a disintegrin variant comprises a mutant RGD loop having a consensus sequence of .sup.48XRGDXP.sup.53 (SEQ ID NO: 342). Examples of such variants include, but are not limited to, those having the amino acid sequences selected from the group consisting of SEQ ID NOs: 44-61.

    [0086] In another embodiment, a disintegrin variant comprises a mutant RGD loop having a consensus sequence of .sup.48XRGDMX.sup.53 (SEQ ID NO: 343). Examples of such variants include, but are not limited to, those having the amino acid sequences selected from the group consisting of SEQ ID NOs: 63-78.

    [0087] In another embodiment, a disintegrin variant comprises a mutant RGD loop having a consensus sequence of .sup.46XXPRGD.sup.51 (SEQ ID NO: 344). Examples of such variants include, but are not limited to, those having the amino acid sequences selected from the group consisting of SEQ ID NOs: 79-94.

    [0088] In another embodiment, a disintegrin variant comprises a mutant RGD loop having a consensus sequence of .sup.48XRXDXP.sup.53 (SEQ ID NO: 345). Examples of such variants include, but are not limited to, those having the amino acid sequences selected from the group consisting of SEQ ID NOs: 95-101.

    [0089] According to other embodiments of the invention, a disintegrin variant comprises a mutation in the C-terminal region, i.e., a mutant C-terminus.

    [0090] In one embodiment, a disintegrin variant comprises a mutant C-terminus having a consensus sequence of .sup.65PRXXXXX.sup.71 (SEQ ID NO: 346). Examples of such variants include, but are not limited to, those having the amino acid sequences selected from the group consisting of SEQ ID NOs: 102-107.

    [0091] In another embodiment, a disintegrin variant comprises a mutant C-terminus having a consensus sequence of .sup.65PRXXXXX.sup.71 (SEQ ID NO: 346), and further comprises a mutant RGD loop, such as those described herein. For example, the mutant RGD loop can have a consensus sequence of .sup.48ARGDMP.sup.53 (SEQ ID NO: 335). Examples of such variants include, but are not limited to, those having the amino acid sequences selected from the group consisting of SEQ ID NOs: 115-119.

    [0092] According to yet other embodiments of the invention, a disintegrin variant comprises a mutation in the linker region, i.e., a mutant linker.

    [0093] In one embodiment, a disintegrin variant comprises a mutant linker having a consensus sequence of .sup.39KKKRTIC.sup.47 (SEQ ID NO: 306). Preferably, the disintegrin variant further comprises a mutant RGD loop such as those described herein. For example, the mutant RGD loop can have a consensus sequence of .sup.48XRXDXP.sup.53 (SEQ ID NO: 345). Examples of such variants include, but are not limited to, those having the amino acid sequences selected from the group consisting of SEQ ID NOs: 108-114.

    [0094] According to further embodiments of the invention, a disintegrin variant comprises a mutation in the linker region, a mutation in the RGD loop and a mutation in the C-terminal region. Examples of such variants include, but are not limited to, those having the amino acid sequences selected from the group consisting of SEQ ID NOs:120-179.

    [0095] A disintegrin variant of the invention can be made by any method suitable to the aims of the invention in view of the present disclosure. For example, a disintegrin variant can be constructed by a site-directed mutagenesis method. The disintegrin variant of the invention can be expressed using methods known in the art in view of the present disclosure. Cell-based methods and cell-free methods are suitable for producing peptides of the invention. Cell-based methods generally involve introducing a nucleic acid construct into a host cell in vitro and culturing the host cell under conditions suitable for expression, then harvesting the peptide, either from the culture medium or from the host cell, (for example, by disrupting the host cell), or both. The invention also provides methods of producing a disintegrin variant using cell-free in vitro transcription/translation methods, which are well known in the art.

    [0096] The disintegrin variant can be encoded by a modified disintegrin nucleotide sequence that encodes a modified amino acid sequence resulting in said polypeptide having substantially reduced integrin IIb3 receptor-blocking activity, and/or increased specificity to one or more of v1, v3, v5, v6 and v8, and other integrins, such as 51. The coding sequence for a disintegrin variant can be obtained by modifying a coding sequence for a disintegrin derived from a snake venom. The disintegrin can be chosen from one of rhodostomin, albolabrin, applagin, basilicin, batroxostatin, bitistatin, cereberin, cerastin, crotatroxin, durissin, elegantin, flavoridin, flavostatin, halysin, halystatin, jararacin, jarastatin, kistrin, lachesin, lutosin, molossin, salmosin, saxatilin, tergeminin, trimestatin, trimucrin, trimutase, ussuristatin, and viridin.

    [0097] Thus, another general aspect of the invention relates to a polynucleotide encoding a disintegrin variant of the invention. Yet another general aspect of the invention relates to host cells comprising a polynucleotide encoding a disintegrin variant of the invention.

    [0098] Typically, a heterologous peptide, whether modified or unmodified, may be expressed on its own, as described above, or as a fusion protein, and may include not only secretion signals, but also a secretory leader sequence. A secretory leader sequence of the invention may direct certain proteins to the endoplasmic reticulum (ER) or periplasma. The ER separates the membrane-bound proteins from other proteins. Once localized to the ER, proteins can be further directed to the Golgi apparatus for distribution to vesicles, including secretory vesicles, the plasma membrane, lysosomes, and other organelles. In the case of periplasma, the protein is secreted into the periplasma space of a Gram negative bacterium, such as an Escherichia coli.

    [0099] Additionally, peptide moieties and/or purification tags can be added to the disintegrin variants. Such regions may be removed prior to final preparation of the polypeptide. The addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability, and to facilitate purification, among other reasons, are familiar and routine techniques in the art. Suitable purification tags include, for example, V5, polyhistidines, avidin, and biotin. Conjugation of peptides to compounds such as biotin can be accomplished using techniques well known in the art. (Hermanson ed. (1996) Bioconjugate Techniques; Academic Press). Peptides can also be conjugated with radioisotopes, toxins, enzymes, fluorescent labels, colloidal gold, nucleic acids, vinorelbine, and doxorubicin using techniques known in the art. (Hermanson ed. (1996) Bioconjugate Techniques; Academic Press; Stefano et al. (2006).

    [0100] Fusion partners suitable for use in the invention include, for example, fetuin, human serum albumin, immunoglobulin CH2/CH3 domains (Fc), and/or one or more of their fragments. Conjugated proteins, such as polyethylene glycol conjugates, are also provided.

    [0101] The peptides of the invention can also be chemically synthesized using techniques known in the art (e.g., see Hunkapiller et al., Nature, 310:105 111 (1984); Grant ed. (1992) Synthetic Peptides, A Users Guide, W.H. Freeman and Co.; U.S. Pat. No. 6,974,884)). For example, a polypeptide corresponding to a fragment of a polypeptide can be synthesized by use of a peptide synthesizer or through the use of solid-phase methods known in the art.

    [0102] Furthermore, if desired, nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the polypeptide sequence. Non-classical amino acids include, but are not limited to, to the D-isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, b-alanine, fluoro-amino acids, designer amino acids such as b-methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid analogs in general. Furthermore, the amino acid can be D (dextrorotary) or L (levorotary).

    [0103] The disintegrin variant of the invention can be recovered and purified from chemical synthesis and recombinant cell cultures by standard methods which include, but are not limited to, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. In one embodiment, high performance liquid chromatography (HPLC) is employed for purification. Well known techniques for refolding protein may be employed to regenerate active conformation when the polypeptide is denatured during isolation and/or purification.

    [0104] A disintegrin variant of the invention can be modified with or covalently coupled to one or more of a variety of hydrophilic polymers to increase solubility and circulation half-life of the peptide. Suitable nonproteinaceous hydrophilic polymers for coupling to a peptide include, but are not limited to, polyalkylethers as exemplified by polyethylene glycol and polypropylene glycol, polylactic acid, polyglycolic acid, polyoxyalkenes, polyvinylalcohol, polyvinylpyrrolidone, cellulose and cellulose derivatives, dextran, and dextran derivatives. Generally, such hydrophilic polymers have an average molecular weight ranging from about 500 to about 100,000 daltons, from about 2,000 to about 40,000 daltons, or from about 5,000 to about 20,000 daltons. The peptide can be derivatized with or coupled to such polymers using any of the methods set forth in Zallipsky, S. (1995) Bioconjugate Chem., 6:150-165; Monfardini, C., et al. (1995) Bioconjugate Chem. 6:62-69; U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192; 4,179,337, or WO 95/34326.

    [0105] Pharmaceutical Compositions

    [0106] Another general aspect of the invention relates to a pharmaceutical composition comprising a disintegrin variant of the invention and a pharmaceutically acceptable carrier. Depending on the need, the pharmaceutical compositions can be formulated into preparations in solid, semi-solid, liquid, or gaseous forms, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants and aerosols. The following methods and excipients are merely exemplary and are in no way limiting.

    [0107] In some embodiments, a disintegrin variant of the invention is provided in formulation with pharmaceutically acceptable carriers, excipients, and diluents, of which a wide variety are known in the art. These pharmaceutical carriers, excipients, and diluents include those listed in the USP pharmaceutical excipients listing. USP and NF Excipients, Listed by Categories, p. 2404-2406, USP 24 NF 19, United States Pharmacopeial Convention Inc., Rockville, Md. (ISBN 1-889788-03-1). Pharmaceutically acceptable excipients, such as vehicles, adjuvants, carriers, or diluents, are readily available to the public. Moreover, pharmaceutically acceptable auxiliary substances, such as pH adjusting and buffering agents, tonicity adjusting agents, stabilizers, wetting agents and the like, are readily available to the public.

    [0108] Suitable carriers include, but are not limited to, water, dextrose, trehalose, histidine, glycerol, saline, ethanol, and combinations thereof. The carrier can contain additional agents such as wetting or emulsifying agents, pH buffering agents, or adjuvants which enhance the effectiveness of the formulation. Topical carriers include liquid petroleum, isopropyl palmitate, polyethylene glycol, ethanol (95%), polyoxyethylene monolaurate (5%) in water, or sodium lauryl sulfate (5%) in water. Other materials such as anti-oxidants, humectants, viscosity stabilizers, and similar agents can be added as necessary. Percutaneous penetration enhancers such as Azone can also be included.

    [0109] Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in the art. The composition or formulation to be administered will, in any event, contain a quantity of the agent adequate to achieve the desired state in the subject being treated.

    [0110] In certain embodiments, disintegrin variant of the invention can be formulated into preparations for injection by dissolving, suspending or emulsifying them in an aqueous or nonaqueous solvent, such as vegetable or other similar oils, synthetic aliphatic acid glycerides, esters of higher aliphatic acids or propylene glycol; and if desired, with conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers, and preservatives. Other formulations for oral or parenteral delivery can also be used, as conventional in the art.

    [0111] In pharmaceutical dosage forms, the pharmaceutical compositions of the invention can be administered in the form of their pharmaceutically acceptable salts, or they can also be used alone or in appropriate association, as well as in combination, with other pharmaceutically active compounds. The subject compositions are formulated in accordance to the mode of potential administration. In a preferred embodiment, the pharmaceutical composition is formulated for parental administration, such as in a liquid form for injection.

    [0112] Methods of Treatment

    [0113] The invention also relates to uses of the disintegrin variants in treating and/or preventing a disease associated with one or more integrins selected from the group consisting of 51, v1, v3, v5, v6 and v8 in a subject in need thereof. Such diseases include, but are not limited to, osteoporosis, bone tumor or cancer growth and symptoms related thereto, angiogenesis-related tumor growth and metastasis, tumor metastasis in bone, malignancy-induced hypercalcemia, angiogenesis-related eye diseases, Paget's disease, rheumatic arthritis, and osteoarthritis. The method comprises administering to the subject in need of the treatment a pharmaceutical composition comprising a therapeutically effective amount of a disintegrin variant of the invention and a pharmaceutically acceptable carrier.

    [0114] In one embodiment of the invention, a disintegrin variant of the invention is used for treatment and/or prevention of an angiogenesis-related eye disease, which includes, but is not limited to, age-related macular degeneration, diabetic retinopathy, corneal neovascularizing diseases, ischaemia-induced neovascularizing retinopathy, high myopia, and retinopathy of prematurity.

    [0115] In another embodiment of the invention, a disintegrin variant of the invention is used for treatment and/or prevention of angiogenesis-related disease, including, but not limited to, cancer, eye-related disease, such as macular degeneration, edema.

    [0116] In another embodiment, the invented disintegrin variant binds to v-integrins present in the cornea (v5, v6, and v8), mediates transforming growth factor (TGF) activation, resulting in treatment of related diseases. These diseases include eye disease, arthritis and cancer. In a further aspect, the invented polypeptide is an anti-angiogenic drugs for relieving the arthritic pain and preventing bone joint destruction caused by these pathological and destructive blood vessels. The invented polypeptides can also prove to be useful when combined with conventional chemotherapy or radiation therapy, as part of a multiple warhead approach to attack cancer via different strategies simultaneously.

    [0117] In still another embodiment of the invention, a disintegrin variant of the invention is used for treatment and/or prevention of osteoporosis. The osteoporosis is associated with a pathological condition chosen from post-menopausal estrogen deficiency, secondary osteoporosis, rheumatoid arthritis, ovariectomy, Paget's disease, bone cancer, bone tumor, osteoarthritis, increased osteoclast formation, and increased osteoclast activity. Furthermore, the osteoporosis includes, but is not limited to, an ovariectomy-induced osteoporosis or bone loss and post-menopausal osteoporosis or bone loss.

    [0118] Yet another embodiment of the invention is a method of using the disintegrin variant for treatment and/or prevention of physiological changes in a mammal including a human induced by ovariectomy or post-menopausal osteoporosis. The method includes administering to the mammal in need thereof a therapeutically effective amount of an isolated polypeptide, or a pharmaceutically acceptable salt thereof, which has integrin v1, v3, v5, v6 or 51 receptor-antagonist activity and substantially reduced integrin IIb3 receptor-blocking activity as compared to a wild-type disintegrin, and thereby resulting in treatment and/or prevention of the ovariectomy-induced physiological change in the mammal.

    [0119] In other aspect, the invention provides a method for inhibiting platelet aggregation, comprising administering an effective amount of a disintegrin variant of the invention or a pharmaceutical composition of the invention to a subject in need of such treatment.

    [0120] A disintegrin variant of the invention can be administered to a subject in need of treatment by systemic injection, such as by intravenous injection; or by injection or application to the relevant site, such as by direct injection, or direct application to the site when the site is exposed in surgery; or by topical application, such as if the disorder is on the skin, for example.

    [0121] A disintegrin variant of the invention can be used as monotherapy. Alternatively, the disintegrin variant of the invention can be used in combination with standard regimens to treat integrin associated diseases. For example, the peptides of the invention can be used in a combinational therapy with a therapeutically effective amount of one or more other pharmaceutical agents. Preferably, another pharmaceutical agent is selected from the group consisting of an anti-cancer agent, an anti-inflammatory agent, an immune-modulating agent and an anti-osteoporosis agent. Preferably, an anti-cancer agent is selected from the group consisting of an anti-angiogenic agent, a cytotoxic agent and an anti-neoplastic agent. The other pharmaceutical agent(s) can be administered prior to, together with, or after administration of the peptides of the invention.

    [0122] In some embodiments, a disintegrin variant of the invention is particularly effective against cancers which are associated with a highly expressed osteopontin. In preferred embodiments, the polypeptides of the invention can inhibit osteopontin-induced tumor invasion.

    [0123] Administration of disintegrin variants can be achieved in various ways, including oral, buccal, nasal, rectal, parenteral, intraperitoneal, intradermal, transdermal, subcutaneous, intravenous, intra-arterial, intracardiac, intraventricular, intracranial, intratracheal, and intrathecal administration, etc., or otherwise by implantation or inhalation.

    [0124] The following examples of the invention are to further illustrate the nature of the invention. It should be understood that the following examples do not limit the invention and that the scope of the invention is to be determined by the appended claims.

    EXAMPLES

    Example 1

    Construction of Expression Vectors Expressing Wild-Type Rho and Rho Mutants (Disintegrin Variants)

    [0125] The DNA encoding Rho was composed of codons preferentially used in Pichia pastoris. Rho DNA was amplified by the polymerase chain reaction (PCR) with the sense primer 5-GAATTCGAATTCCATCATCATCATCATCATCATGGTAAGGAATGTGACTGTTCT-3 (SEQ ID NO: 183) that had Eco R1 recognition site and encodes six histidine residues for facilitating purification. The antisense primer has the sequence of 5-CCGCGGCCGCGGTCAGTGGTATCTTGGACAGTCAGC-3 (SEQ ID NO: 180) or 5-CCGCGGCCGCGGTTAGTGGTATCTTGGACAGTCAGC-3 (SEQ ID NO: 184) with Sac II recognition and a TCA (or TTA) stop codon. The PCR product was purified and then ligated into the Eco R1 and Sac II sites of the yeast recombination vector, pPICZ A. The recombinant plasmid was used to transform a DH5 strain, and colonies were selected on agar plates with low salt LB (1% tryptone, 0.5% yeast extract, 0.5% NaCl, 1.5% agar at pH 7.0) and 25 g/ml antibiotic Zeocin.

    [0126] The various DNA constructs encoding the mutants of Rho were synthesized and amplified by the PCR using an overlapping oligonucleotide strategy with primers containing Eco RI and Sac II restriction sites. For illustration purpose, Table 2 lists the consensus sequences of some disintegrin variants, and the primers used to construct these variants according to embodiments of the invention, wherein the primer sequences are presented from the 5 to 3 (left to the right).

    [0127] Expression vectors encoding other variants encompassed by the invention have been or can be constructed in similar manner in view of the present disclosure. Various primers used for synthesizing or confirming disintegrin variants are listed in SEQ ID NOs: 180-305.

    Example 2

    Expression and Purification of Rho Mutants

    [0128] The protein expression of rhodostomin mutants and variants in Pichia pastoris was performed according to the protocols of the Pichia EasyComp Kit with minor modifications. Briefly, a total of 10 g plasmids containing DNA encoding rhodostomin or the variants of disintegrin were purified and digested with Sac I to linearize the plasmids. Pichia strain X33 was transformed with the linearized constructs by a heat shock method, using a Pichia EasyComp kit from Invitrogen. The transformant integrated at the 5AOX1 locus by a single crossover. PCR was used to analyze Pichia integrants to determine if the Rho gene had been integrated into the Pichia genome, and cells were lysed by Lyticase (Sigma). Colonies were selected on agar plates containing YPD (1% yeast extract, 2% peptone, 2% glucose, and 2% agar) and 100 g/ml Zeocin. A number of clones with multiple copies of disintegrin insertions were selected to pick the clone for the highest variants of disintegrin protein expression.

    [0129] Recombinant Rho mutants were produced as follows: selected colonies were grown in the YPD medium (1% yeast extract, 2% peptone, and 2% dextrose) containing 100 g/ml Zeocin at 30 C. After 48 hours, cells were collected by centrifugation and grown in 1 liter of minimal methanol medium (containing 1.34% yeast nitrogen base with ammonium sulfate without amino acids and 410.sup.5% biotin). A total of 1% methanol was added once every 24 hours to induce Rho or variant expression for 2 days. The supernatant was collected by centrifugation and dialyzed twice against 5 liter buffer A (5 mM EDTA, 8M urea and 10 mM Na-phosphate buffer, pH 7.7). The final solution was loaded into a nickel-chelating column and eluted with a gradient of 200 mM imidazole. The recombinant rhodostomin and the variants of disintegrin were further purified by HPLC (reverse phase C18 HPLC). The purified recombinant variants of the disintegrin had a purity of greater than 95% as judged by tricine-SDS-PAGE.

    TABLE-US-00002 TABLE2 IllustrationofPrimersUsedtoConstructRhoandRhoVariants Rho/Variant PrimerSequence SEQIDNO RGDM Sense AGAGGTGACATG (SEQIDNO.181) GRGDM Annse CATGTCACCTCTACCGATTCTAC (SEQIDNO.182) Rho-1 Sense GAATTCGAATTCCATCATCATCATCA (SEQIDNO.183) TCATGGTAAGGAATGTGACTGTTCT Rho-2 Antisense CCGCGGCCGCGGTTAGTGGTATCTTG (SEQIDNO.184) GACAGTCAGC LRGDM Antisense CATGTCACCTCTCAAGATTCTAC (SEQIDNO.185) RRGDM Antisense CATGTCACCTCTTCTGATTCTAC (SEQIDNO.186) VRGDM Antisense CATGTCACCTCTAACGATTCTAC (SEQIDNO.187) HRGDM Antisense CATGTCACCTCTATGGATTCTAC (SEQIDNO.188) WRGDM Antisense CATGTCACCTCTCCAGATTCTAC (SEQIDNO.189) FRGDM Antisense CATGTCACCTCTAAAGATTCTAC (SEQIDNO.190) P48A-1 Sense TGTAGAATCGCTAGAGGTGACATG (SEQIDNO.191) P48A-2 Antisense CATGTCACCTCTAGCGATTCTACA (SEQIDNO.192) SRGDM Antisense CATGTCACCTCTAGAGATTCTAC (SEQIDNO.193) MRGDM Antisense CATGTCACCTCTCATGATTCTAC (SEQIDNO.194) TRGDM Antisense CATGTCACCTCTAGTGATTCTAC (SEQIDNO.195) NRGDM Antisense CATGTCACCTCTGTTGATTCTAC (SEQIDNO.196) QRGDM Antisense CATGTCACCTCTTTGGATTCTAC (SEQIDNO.197) YRGDM Antisense CATGTCACCTCTGTAGATTCTAC (SEQIDNO.198) IRGDM Antisense CATGTCACCTCTAATGATTCTAC (SEQIDNO.199) KRGDM Antisense CATGTCACCTCTCTTGATTCTAC (SEQIDNO.200) ERGDM Antisense CATGTCACCTCTTTCGATTCTAC (SEQIDNO.201) DRGDM Antisense CATGTCACCTCTATCGATTCTAC (SEQIDNO.202) RAD Sense GTAGAATCCCAAGAGCTGACATGCC (SEQIDNO.203) RRD Sense GTAGAATCCCAAGAAGAGACATGCC (SEQIDNO.204) RND Sense GTAGAATCCCAAGAAACGACATGCC (SEQIDNO.205) RDD Sense GTAGAATCCCAAGAGATGACATGCC (SEQIDNO.206) RED Sense GTAGAATCCCAAGAGAAGACATGCC (SEQIDNO.207) RQD Sense GTAGAATCCCAAGACAAGACATGCC (SEQIDNO.208) RKD Sense GTAGAATCCCAAGAAAGGACATGCC (SEQIDNO.2(9) RMD Sense GTAGAATCCCAAGAATGGACATGCC (SEQIDNO.210) RFD Sense GTAGAATCCCAAGATTTGACATGCC (SEQIDNO.211)

    Example 3

    Rho Mutants Selectively Inhibited Cell Attachment Mediated by Different v Integrins and 51 Integrin

    [0130] The inhibitory activities of Rho mutants and variants were evaluated by cell adhesion inhibition assays as described previously (Zhang, et al., 1998 J Biol Chem 73:7345-7350). The adhesions of CHO-IIb3 cells to fibrinogen, CHO-v3 cells to fibrinogen, K562 cells to fibronectin, HT-29 cells to vitronectin, and HT-29 cells to fibronectin were used determine the inhibitory activities of tested protein to integrins IIb3, v3, 51, v5, and v6. Briefly, 96-well Immulon-2 microtiter plates (Costar, Corning, N.Y.) were coated with 100 l of phosphate-buffered saline (PBS: 10 mM phosphate buffer, 0.15M NaCl, pH 7.4) containing substrates at a concentration of 50-500 nM, and incubated overnight at 4 C. The substrates and their coating concentrations were fibrinogen (Fg) 200 g/ml, vitronectin (Vn) 50 g/ml, and fibronectin (Fn) 25 g/ml. Non-specific protein binding sites were blocked by incubating each well with 200 L of heat-denatured 1% bovine serum albumin (BSA) (Calbiochem) at room temperature for 1.5 h. The heat-denatured BSA was discarded and each well was washed twice with 200 L of PBS.

    [0131] CHO cells that expressed the integrins v3 (CHO-v3) and IIb3 (CHO-IIb3) were kindly provided by Dr. Y. Takada (Scripps Research Institute) and maintained in DMEM. Human erythroleukemia K562 and colorectal adenocarcinoma HT-29 cells were purchased from ATCC and cultured in Roswell Park Memorial Institute (RPMI)-1640 medium containing 5% FCS. Harvested K562 and HT-29 cells were washed in PBS buffer containing 1 mM EDTA and resuspended in Tyrode's buffer (150 mM NaCl, 5 mM KCl, and 10 mM Hepes) [pH 7.35] containing 1 mM MgSO.sub.4, 2 mM CaCl.sub.2, and 500 M MnCl.sub.2. Cells (CHO, K562, and HT-29) were diluted to 310.sup.5 cells/mL, and 100 L of the cells were used for the assay. Rho and its mutants were added to the cultured cells and incubated at 37 C., 5% CO.sub.2 for 15 minutes. Rho and its variants were used as inhibitors at the concentrations of 0.001-500 M. The treated cells were then added into the coated plate and reacted at 37 C., 5% CO.sub.2 for 1 hour. The incubation solution was then discarded and non-adhered cells were removed by washing twice with 200 L PBS.

    [0132] Bound cells were quantified by crystal violet staining. Briefly, the well was fixed with 100 L of 10% formalin for 10 minutes and dried. Fifty microliters of 0.05% crystal violet were then added into the well at room temperature for 20 minutes. Each well was washed with 200 L of distilled water four times and dried. Colorization was carried out by adding 150 L of colorizing solution (50% alcohol and 0.1% acetic acid). The resulting absorbance was read at 600 nm and the readings were correlated with the number of adhering cells. Inhibition was defined as % inhibition=100[OD.sub.600 (Rho wild type or disintegrin-treated sample)/OD.sub.600 (untreated sample)]100.

    [0133] IC.sub.50 was defined as the concentration (nM) of a disintegrin variant required for 50% inhibition of the cell adhesion mediated by a particular integrin. Therefore, lower IC.sub.50 indicates greater specificity or potency of the disintegrin variant in inhibiting the cell adhesion activity of the respective integrin, thus higher binding activity (or selectivity) of the disintegrin variant to the respective integrin. The IC.sub.50 results are summarized in Tables 3 to 14 below.

    [0134] A series of Rho mutants involved in the RGD loop region (R.sup.50XD, .sup.48XRGD (SEQ ID NO: 341), XRGD.sup.52XP (SEQ ID NO: 342), XRGDMX.sup.53 (SEQ ID NO: 343), .sup.46X.sup.47XPRGD (SEQ ID NO: 344), and ARGD.sup.51X.sup.52X (SEQ ID NO: 340)), the linker region, and C-terminal region were recombinantly expressed and purified to homogeneity. The cell adhesion and platelet aggregation assays were used to determine their integrin-binding affinity. It was found that variants of rhodostomin or disintegrins with one or more modifications in these regions have different selective binding affinity to V3, V5, V6, 51 and IIb3 (Tables 3-14).

    [0135] For example, it was found that Rho variants with certain mutations in the RXD motif, in which the Gly50 (G) residue was replaced by Leu (L), Val (V), Ile (I), Glu (E), Asp (D), Gln (Q), Phe (F), Trp (W), His (H), Lys (K), or Arg (R), had their highest effects on integrins in the following order: IIb3 (1686-fold)>51 (586-fold)>v5 (348-fold)>v6 (179-fold)>v3 (26-fold), showing their binding selectivity to V3 (Table 3). Rho variants with the mutation in the XRGD (SEQ ID NO: 341) motif, in which the P.sup.48 residue was replaced by other amino acids, had their highest effects on integrins in the following order: 51 (71-fold)>IIb3 (41-fold)>v3 (5-fold) (Table 4). Rho variants with the mutation in the XRGDXP (SEQ ID NO: 342) motif, in which the M52 residue was replaced by other amino acids, had their highest effects on integrins in the following order: IIb3 (209-fold)>51 (122-fold)>V3 (14-fold) (Table 5). Rho variants with the mutation in the XRGDMX (SEQ ID NO: 343) motif, in which the P.sup.53 residue was replaced by other amino acids, had their highest effects on integrins in the following order: IIb3 (258-fold)>51 (45-fold)>V3 (40-fold) (Table 6). Rho variants with the mutation in the XXPRGD (SEQ ID NO: 344) motif, in which the R46 and I47 residues were replaced by other amino acids, had their highest effects on integrins in the following order: IIb3 (73-fold)>51 (19-fold)>V3 (10-fold) (Table 7). These results showed that the mutations in the RGD loop exhibited significant effect on the inhibitory activity in integrins IIb3 and 51, but not V3 integrin.

    [0136] Mutants of rhodostomin or disintegrins with one or more modifications in addition to the RGD motif, e.g., in the linker region or the C-terminus, exhibited the capability to selectively binding to V3, V5, V6, 51 or IIb3 (Table 8-14). For example, Rho variants with the mutation in the linker region, in which the SRAGKIC (SEQ ID NO: 332) was replaced by KKKRTIC (SEQ ID NO: 306), KKARTIC (SEQ ID NO: 313), MKKGTIC (SEQ ID NO: 307), IEEGTIC (SEQ ID NO: 308), LKEGTIC (SEQ ID NO: 310), AKKRTIC (SEQ ID NO: 311), KAKRTIC (SEQ ID NO: 312), KGAGKIC (SEQ ID NO: 309), KKKATIC (SEQ ID NO: 314), KKKRAIC (SEQ ID NO: 315), KAKRAIC (SEQ ID NO: 316), and SKAGTIC (SEQ ID NO: 317) amino acids, had their highest effects on integrins in the following order: IIb3 (2-fold)>51 (5-fold)>V3 (14-fold) (Table 8). These results showed that the mutations in the linker region of Rho exhibited significant effect on the inhibitory activity in integrin V3.

    [0137] Rho variants with the mutation in the C-terminal region, in which the PRYH (SEQ ID NO: 334) was replaced by PGLYG (SEQ ID NO: 324), PRNRFH (SEQ ID NO: 321), PRNRFHA (SEQ ID NO: 322), PRWNDL (SEQ ID NO: 319), PRNGLYG (SEQ ID NO: 323), and PRNPWNG (SEQ ID NO: 320) amino acids, had their highest effects on integrins in the following order: IIb3 (13-fold)>V5 (8-fold)=V6 (8-fold)>V3 (4-fold)>51 (2-fold) (Table 9). These results showed that the mutations on the C-terminal region of Rho exhibited significant effect on the inhibitory activity in integrins IIb3, V5, and V6.

    [0138] Rho variants with the mutation in the C-terminal region, in which PRYH (SEQ ID NO: 334) was replaced by PGLYG (SEQ ID NO: 324), PPLYG (SEQ ID NO: 327), PRLYG (SEQ ID NO: 328), PGLY (SEQ ID NO: 325), PYLYG (SEQ ID NO: 352) and PELYG (SEQ ID NO: 337) amino acids, had their highest effects on integrins in the following order: IIb3 (6493-fold)>51 (40-fold)>v5 (8-fold)>v6 (6-fold)>v3 (1-fold), showing its significant effect on integrins IIb3 and 51 (Table 10).

    [0139] Disintegrin (Rho) variants specific to integrins v3 and 51 were successfully obtained by modifying the RGD loop region, the linker region, and C-terminal region of Rho. For example, the mutant .sup.39KKART-.sup.46ARGRGDNP-.sup.66DLYG (SEQ ID NO: 147) exhibited an excellent inhibitory activity to integrins v3 and 51 but not to IIb3, v5, and v6 (Table 11). The mutations in the RGD loop and linker region increased its activity in inhibiting integrins v3 and 51 and significantly decreased its activity in inhibiting integrin IIb3. The mutations in the C-terminal region decreased its activity in inhibiting integrins v5, and v6.

    [0140] Disintegrin (Rho) variants specific to integrins v3, v5, and 51 were successfully obtained by modifying the RGD loop region, the linker region, and C-terminal region of Rho. For example, the mutant .sup.39KKART-.sup.46ARGRGDDL-.sup.66GLYG (SEQ ID NO: 339) exhibited an excellent inhibitory activity to v3, v5, and 51 but not to IIb3 and v6 (Table 12). The mutations of SRAGKIC (SEQ ID NO: 332) into KKARTIC (SEQ ID NO: 313) in the linker region increased its activity in inhibiting RGD-binding integrins. The mutations of R46A, I47R, P48A, M52D, and P53L in the RGD loop decreased its activity in inhibiting integrins IIb3 and V6. The mutations of PRYH (SEQ ID NO: 334) into PGLYG (SEQ ID NO: 324) in the C-terminal region decreased its activity in inhibiting integrin IIb3.

    [0141] Disintegrin (Rho) variants specific to integrins vx and 51 were successfully obtained by modifying the RGD loop region, the linker region, and C-terminal region of Rho. For example, the mutant .sup.39KKART-.sup.46ARGRGDNP-.sup.66RYH (SEQ ID NO: 123) exhibit an excellent inhibitory to integrins v3 and 51 but not to IIb3, v5, and v6 (Table 13). The mutations in the RGD loop and linker region increased its activity in inhibiting integrins V3 and 51 and significantly decreased its activity in inhibiting integrin IIb3. The mutations on the C-terminal region decreased its activity in inhibiting integrins v5, and v6.

    Example 4

    Inhibition of Platelet Aggregation by Rho Mutants

    [0142] Disintegrin (Rho) variants were also tested for their ability to inhibit platelet aggregation that is mediated by IIb3. Venous blood (9 parts) samples from healthy donors who had not received any medication for at least two weeks were collected in 3.8% sodium citrate (1 part). Blood samples were centrifuged at 150g for 10 min to obtain platelet-rich plasma (PRP) and allowed to stand for 5 min, and PRP was collected. The platelet-poor plasma (PPP) was prepared from the remaining blood by centrifuging at 2000g for 25 min. The PPP platelet count was measured on a hematology analyzer and diluted to 250,000 platelets/l. A solution of 190 l of PRP and 10 l of either Rho or PBS buffer were incubated for 5 min in a Hema Tracer 601 aggregometer at 37 C. Ten microliters of 200 M adenosine diphosphate (ADP) were further added to monitor the response of platelet aggregation by light transmission. The results on inhibition of platelet aggregation are also summarized in Tables 3 to 14 below.

    TABLE-US-00003 TABLE3 IntegrinSelectivityandInhibitionofPlateletAggregationbythe RXDDisintegrinVariants IC.sub.50(nM) Platelet [Interactiontowardstargets] Aggregation ConsensusSequence 51 V3 IIb3 (nM) [00001]embedded image 216.0 11.4 17.8 77.5 1. [00002]embedded image 14425.3 74.6 299.1 176.5 2. [00003]embedded image 104452.5 2275.0 6122.3 1236.0 3. [00004]embedded image 3296.0 63.9 2554.3 523.8 4. [00005]embedded image 3043.3 32.4 1998.8 480.3 5. [00006]embedded image 2604.3 119.9 4895.0 669.6 6. [00007]embedded image 4915.6 188.7 185.4 414.4 7. [00008]embedded image 3325.3 274.6 5486.6 652.6 8. [00009]embedded image 1231.7 247.5 2001.6 508.3 9. [00010]embedded image 1104.8 291.0 2425.8 476.5 10. [00011]embedded image 6254.5 78.1 142.2 189.9 11. [00012]embedded image 5420.6 54.1 1154.3 281.7 12. [00013]embedded image 43192.0 88.0 647.1 186.7 13. [00014]embedded image 77335.0 132.3 2920.6 539.4 14. [00015]embedded image 131702.0 123.5 10688.3 1216.5 15. [00016]embedded image 86954.5 89.9 35411.3 2162.3 16. [00017]embedded image 6489.0 131.6 2109.0 465.7 17. [00018]embedded image 150186.5 387.8 33915.7 1527.3 18. [00019]embedded image 111949.0 404.2 4372.3 401.7

    TABLE-US-00004 TABLE4 IntegrinSelectivityandInhibitionofPlateletAggregationbytheXRGD DisintegrinVariants IC.sub.50(nM) Platelet [Interactiontowardstargets] Aggregation ConsensusSequence v3 51 IIb3 (nM) [00020]embedded image 13.0 256.8 21.0 83.2 1. [00021]embedded image 15.3 4188.3 860.2 631.3 2. [00022]embedded image 12.9 522.2 677.2 528.1 3. [00023]embedded image 19.6 92.2 68.4 370.2 4. [00024]embedded image 15.8 59.0 31.6 110.3 5. [00025]embedded image 20.4 139.4 38.6 214.6 6. [00026]embedded image 12.9 251.3 28.5 115.1 7. [00027]embedded image 11.4 310.6 20.4 68.9 8. [00028]embedded image 41.0 248.2 39.8 142.0 9. [00029]embedded image 14.9 282.1 36.1 124.0 10. [00030]embedded image 11.3 283.4 22.1 168.0 11. [00031]embedded image 17.6 281.7 47.9 183.9 12. [00032]embedded image 19.5 194.7 47.6 136.9 13. [00033]embedded image 11.3 222.7 26.4 137.4 14. [00034]embedded image 8.8 190.9 60.9 128.9 15. [00035]embedded image 8.0 264.6 28.5 274.4 16. [00036]embedded image 24.1 246.6 22.3 157.0 17. [00037]embedded image 15.5 214.4 30.0 179.4 18. [00038]embedded image 11.6 194.8 24.4 115.2

    TABLE-US-00005 TABLE5 IntegrinSelectivityandInhibitionofPlateletAggregationbythe ARGDXPDisintegrinVariants IC.sub.50(nM) Platelet [Interactiontowardstargets] Aggregation ConsensusSequence v3 51 IIb3 (nM) 1. [00039]embedded image 13.0 256.8 21.0 83.2 2. [00040]embedded image 15.8 59.0 31.6 110.3 3. [00041]embedded image 45.3 5044.5 850.9 752.7 4. [00042]embedded image 156.3 2436.0 1063.0 518.8 5. [00043]embedded image 19.6 517.4 72.5 100.5 6. [00044]embedded image 21.5 368.2 36.2 145.7 7. [00045]embedded image 34.5 139.7 112.5 200.0 8. [00046]embedded image 18.8 199.7 70.5 106.9 9. [00047]embedded image 11.1 199.1 247.4 149.4 10. [00048]embedded image 36.9 138.8 71.6 146.2 11. [00049]embedded image 26.9 178.7 51.4 167.7 12. [00050]embedded image 18.3 44.1 262.7 213.6 13. [00051]embedded image 18.5 88.1 68.1 171.9 14. [00052]embedded image 29.6 52.0 12.4 129.8 15. [00053]embedded image 38.5 45.2 44.7 76.2 16. [00054]embedded image 17.5 51.1 16.6 99.4 17. [00055]embedded image 55.0 91.9 39.1 97.8 18. [00056]embedded image 3.0 49.1 51.2 77.1 19. [00057]embedded image 224.7 840.5 2643.3 359.6 20. [00058]embedded image 40940.0 62460.0 64665.0 49410.0

    TABLE-US-00006 TABLE6 IntegrinSelectivityandInhibitionofPlateletAggregationbythe ARGDMXDisintegrinVariants IC.sub.50(nM) Platelet [Interactiontowardstargets] Aggregation ConsensusSequence v3 51 IIb3 (nM) [00059]embedded image 13.0 256.8 21.0 83.2 1. [00060]embedded image 15.8 59.0 135.2 110.3 2. [00061]embedded image 97.2 4496.6 557.6 240.4 3. [00062]embedded image 93.0 6212.3 2317.3 171.5 4. [00063]embedded image 144.6 11416.3 1198.3 196.1 5. [00064]embedded image 196.0 5619.7 2792.0 200.8 6. [00065]embedded image 118.7 3329.3 3297.8 216.7 7. [00066]embedded image 213.8 9787.8 1142.4 86.5 8. [00067]embedded image 398.9 16794.7 1909.7 84.1 9. [00068]embedded image 83.5 4607.8 7057.7 224.5 10. [00069]embedded image 57.4 785.6 1328.3 165.5 11. [00070]embedded image 18.6 1386.7 1002.0 130.2 12. [00071]embedded image 16.8 755.8 1280.0 187.5 13. [00072]embedded image 10.7 505.7 2212.7 160.1 14. [00073]embedded image 20.9 687.0 340.7 103.1 15. [00074]embedded image 11.3 1090.7 1237.3 138.6 16. [00075]embedded image 10.0 673.2 688.6 129.5 17. [00076]embedded image 12.9 139.1 181.6 139.3 18. [00077]embedded image 16.1 218.4 562.7 115.8

    TABLE-US-00007 TABLE7 IntegrinSelectivityandInhibitionofPlateletAggregationbythe XXPRGDDisintegrinVariants IC.sub.50(nM) Platelet [Interactiontowardstargets] Aggregation ConsensusSequence v3 51 IIb3 (nM) [00078]embedded image 13.0 256.8 21.7 83.2 1. [00079]embedded image 3.5 69.5 22.0 122.3 2. [00080]embedded image 8.3 393.3 31.5 198.4 3. [00081]embedded image 11.9 256.8 36.9 180.6 4. [00082]embedded image 15.5 383.0 94.1 178.4 5. [00083]embedded image 15.9 768.1 63.6 200.3 6. [00084]embedded image 13.6 1292.3 51.1 189.7 7. [00085]embedded image 4.9 351.5 17.0 159.4 8. [00086]embedded image 18.8 460.7 89.3 397.7 9. [00087]embedded image 5.1 38.1 14.3 170.0 10. [00088]embedded image 14.2 76.6 36.7 235.5 11. [00089]embedded image 9.1 481.1 34.8 205.8 12. [00090]embedded image 12.1 449.8 70.3 152.7 13. 14. [00091]embedded image 6.3 458.6 35.5 239.3 15. [00092]embedded image 7.3 823.8 51.2 467.0 16. [00093]embedded image 62.1 1293.3 188.7 587.2 17. [00094]embedded image 18.7 913.4 477.1 1468.0

    TABLE-US-00008 TABLE8 IntegrinSelectivityandInhibitionofPlateletAggregationbythe DisintegrinVariantswithMutantRGDLoop,MutantLinkerand/orMutantC- Terminus IC.sub.50(nM) [Interactiontowardstargets] Platelet ConsensusSequence Aggregation IIb3 V3 51 [00095]embedded image 64.2 33.8 18.8 223.4 1. [00096]embedded image RIPRGDMP YH 104.5 25.6 1.3 76.1 (SEQIDNO:127) 2. SRAGK [00097]embedded image YH 125.4 256.0 22.6 40.0 (SEQIDNO:128) 3. [00098]embedded image [00099]embedded image YH 88.2 133.4 5.9 10.0 (SEQIDNO:129) 4. SRAGK [00100]embedded image [00101]embedded image 195.0 146.1 23.0 53.0 (SEQIDNO:347) 5. [00102]embedded image [00103]embedded image [00104]embedded image 160.2 31.7 3.7 11.5 (SEQIDNO:131) 6. SRAGK [00105]embedded image [00106]embedded image 233.7 98.7 2.5 2.2 (SEQIDNO:130) 7 [00107]embedded image [00108]embedded image [00109]embedded image 153.5 44.3 3.2 1.6 (SEQIDNO:132) 8. [00110]embedded image [00111]embedded image [00112]embedded image 132.2 27.6 6.9 64.0 (SEQIDNO:138) 9. [00113]embedded image [00114]embedded image [00115]embedded image 190.2 65.5 16.0 47.6 (SEQIDNO:139) 10. [00116]embedded image [00117]embedded image [00118]embedded image 157.5 34.2 3.5 15.5 (SEQIDNO:140) 11. [00119]embedded image [00120]embedded image [00121]embedded image 140.9 26.7 6.9 21.0 (SEQIDNO:141) 12. [00122]embedded image [00123]embedded image [00124]embedded image 192.2 78.4 19.2 58.2 (SEQIDNO:142) 13. [00125]embedded image [00126]embedded image [00127]embedded image 156.6 25.0 1.9 68.4 (SEQIDNO:143) 14. [00128]embedded image [00129]embedded image [00130]embedded image 174.6 124.4 23.7 71.3 (SEQIDNO:144) 15. [00131]embedded image [00132]embedded image [00133]embedded image 206.1 401.0 15.7 50.6 (SEQIDNO:135) 16. [00134]embedded image [00135]embedded image [00136]embedded image 176.0 43.8 9.8 116.1 (SEQIDNO:136) 17. [00137]embedded image [00138]embedded image [00139]embedded image 187.9 80.6 8.2 118.2 (SEQIDNO:137) 18. [00140]embedded image [00141]embedded image [00142]embedded image 178.5 151.8 4.0 113.4 (SEQIDNO:134) 19. SRAGK [00143]embedded image [00144]embedded image 199.8 85.0 9.6 10.9 (SEQIDNO:130) 20. [00145]embedded image [00146]embedded image [00147]embedded image 147.6 31.4 3.6 2.7 (SEQIDNO:132) 21. [00148]embedded image [00149]embedded image [00150]embedded image 160.2 31.7 3.7 11.5 (SEQIDNO:131)

    TABLE-US-00009 TABLE9 IntegrinSelectivityandInhibitionofPlateletAggregationbythe DisintegrinVariantswithMutantC-Terminus IC.sub.50(nM) [Interactiontowardstargets] Platelet ConsensusSequence v3 v5 v6 51 IIb3 Aggregation [00151]embedded image 13.0 94.4 176.2 256.8 52.2 83.2 1. [00152]embedded image 9.8 88.5 133.7 365.9 53.7 100.9 2. [00153]embedded image 15.0 162.9 140.8 590.8 81.8 107.9 3. [00154]embedded image 26.6 712.3 192.7 309.7 290.9 154.7 4. [00155]embedded image 40.7 681.1 160.2 260.0 235.2 121.9 5. [00156]embedded image 26.7 258.3 282.5 238.1 186.0 96.6 6. [00157]embedded image 30.1 274.8 1062.6 157.0 710.6 204.7

    TABLE-US-00010 TABLE10 IntegrinSelectivityandInhibitionofPlateletAggregationbythe DisintegrinVariants IC.sub.50(nM) [Interactiontowardstargets] Platelet ConsensusSequence v3 v5 v6 51 IIb3 Aggregation [00158]embedded image 13.0 94.4 176.2 256.8 52.2 83.2 1. [00159]embedded image 12.0 445.3 1081.8 27.8 133335.0 35253.2 2. [00160]embedded image 7.1 410.2 245.6 35.8 >95011.0 23790.5 3. [00161]embedded image 6.8 363.5 417.0 6.5 43085.5 5208.5 4. [00162]embedded image 9.5 413.8 989.9 21.6 >136245.0 30285.5 5. [00163]embedded image 13.6 720.2 986.8 15.3 >338956.0 46147.5

    TABLE-US-00011 TABLE11 DisintegrinVariantsSpecifictoIntegrinsv3and51 IC.sub.50(nM) [Interactiontowardstargets] Platelet ConsensusSequence v3 v5 v6 51 IIb3 Aggregation .sup.39SRAGK-.sup.46RIPRGDMP- 13.0 94.4 176.2 256.8 52.2 83.2 .sup.66RYH(Rhowild-type) (SEQIDNO:1) 1. .sup.39KKART-.sup.46ARGRGDNP- 12.0 445.3 1081.8 27.8 133335.0 35253.2 .sup.66GLYG (SEQIDNO:124) 2. .sup.39KKART-.sup.46ARGRGDNP- 11.0 413.8 1072.7 7.5 136245.0 30285.5 .sup.66YLYG (SEQIDNO:120) 3. .sup.39KKART-.sup.46ARGRGDNP- 13.6 720.2 979.4 16.9 643101.0 46147.5 .sup.66ELYG (SEQIDNO:121) 4. .sup.39KKART-.sup.46ARGRGDNP- 6.6 833.7 1996.2 15.4 450958.0 84719.0 .sup.66DLYG (SEQIDNO:147)

    TABLE-US-00012 TABLE12 DisintegrinVariantsSpecifictoIntegrinsv3,v5,and51 IC.sub.50(nM) [Interactiontowardstargets] Platelet ConsensusSequence v3 v5 v6 51 IIb3 Aggregation .sup.39SRAGK-.sup.46RIPRGDMP- 13.0 94.4 176.2 256.8 52.2 83.2 .sup.66RYH(Rhowild-type) (SEQIDNO:1) 1. .sup.39SRAGK-.sup.46RIARGDMP- 15.8 70.6 217.4 59.0 126.2 110.3 .sup.66RYH (SEQIDNO:43) 2. .sup.39SRAGK-.sup.46RIARGDDP- 45.3 6886.0 14980.5 5044.5 5117.2 752.7 .sup.66RYH (SEQIDNO:44) 3. .sup.39SRAGK-.sup.46RIARGDDL- 41.3 226.6 15734.5 526.7 1518.1 454.6 .sup.66RYH (SEQIDNO:338) 4. .sup.39KKART-.sup.46ARGRGDDL- 42.5 242.5 17323.3 562.3 44232.2 47329.0 .sup.66GLYG (SEQIDNO:339)

    TABLE-US-00013 TABLE13 DisintegrinVariantsSpecifictoIntegrinsvxand51 IC.sub.50(nM) [Interactiontowardstargets] Platelet ConsensusSequence v3 v5 v6 51 IIb3 Aggregation .sup.39SRAGK-.sup.46RIPRGDMP- 13.0 94.4 176.2 256.8 52.2 83.2 .sup.66RYH(Rhowild-type) (SEQIDNO:1) 1. .sup.39SRAGK-.sup.46RIARLDDL- 42.0 941.4 20683.3 14539.0 23171.0 10380.0 .sup.66RYH (SEQIDNO:125) 2. .sup.39SRAGK-.sup.46DDPRGDMP- 25.1 500.0 1251.5 8653.0 >44540.0 18922.3 .sup.66RYH (SEQIDNO:126) 3. .sup.39KKART-.sup.46ARGRGDNP- 5.0 445.7 317.0 28.8 37925.0 4478.3 .sup.66RYH(KG,AR-NP) (SEQIDNO:123) 4. .sup.39KKART-.sup.46ARGRGDNP- 12.0 445.3 1081.8 27.8 133335.0 35253.2 .sup.66GLYG(KG-P) (SEQIDNO:124) 5. .sup.39KKART-.sup.46ARGRGDNP- .sup.66RWNDL(KG-WN) 1.8 43.7 108 25.6 27985 4533 (SEQIDNO:171)

    TABLE-US-00014 TABLE14 IntegrinSelectivityandInhibitionofPlateletAggregationbyVaryingOneorMoreoftheLinker, RGDLoopandtheC-Terminus IC.sub.50(nM) [Interactiontowardstargets] ConsensusSequenceofDisintegrin Platelet Variant 51 V3 IIb3 Aggregation 1. -----.sup.48ARGD.sup.65PR(SEQIDNO:115) 3636.5 479.6 1588.3 107.1 2. -----.sup.48ARGD.sup.65PRNGL(SEQIDNO:348) 5161.0 146.0 1086.3 69.9 3. -----.sup.48ARGD.sup.65PRNGLYG(SEQIDNO:119) 9529.3 1191.8 245.2 83.4 4. -----.sup.48ARGD.sup.65PRNPWNG(SEQIDNO:118) 2679.0 1259.0 184.7 132.7 5. 39KKKRT-.sup.48ARGDN.sup.53P-.sup.67NGLY.sup.71G 11.5 1.3 3.7 0.9 31.7 4.7 160.2 16.9 (SEQIDNO:131) 6. 39MKKGT-.sup.48ARGDN.sup.53P-.sup.67NGLY.sup.71G 113.4 2.3 4.0 0.8 151.8 23.7 178.5 10.3 (SEQIDNO:349) 7. 39IEEGT-.sup.48ARGDN.sup.53P-.sup.67NGLY.sup.71G 50.6 5.0 15.7 2.2 401.0 77.9 206.1 17.9 (SEQIDNO:135) 8. 39SRAGK-.sup.48ARGDN.sup.53P-.sup.67NGLY.sup.71G 53.0 7.8 23.0 7.1 146.1 30.9 195.0 45.7 (SEQIDNO:347) 9. 39KGAGK-.sup.48ARGDN.sup.53P-.sup.67NGLY.sup.71G 116.1 19.9 9.8 1.8 43.8 3.5 176.0 35.9 (SEQIDNO:136) 10. 39LKEGT-.sup.48ARGDN.sup.53P-.sup.67NGLY.sup.71G 118.2 6.2 8.2 0.5 80.6 2.5 187.9 25.7 (SEQIDNO:137) 11. .sup.39AKKR.sup.34T-.sup.48ARGDN.sup.53P-.sup.67NGLY.sup.71G 64.0 3.9 6.9 1.0 27.6 6.5 132.2 27.1 (SEQIDNO:138) 12. K.sup.40AKR.sup.43T-.sup.48ARGDN.sup.53P-.sup.67NGLY.sup.71G 47.6 9.5 16.0 2.4 65.5 3.5 190.2 16.5 (SEQIDNO:139) 13. KK.sup.41AR.sup.43T-.sup.48ARGDN.sup.53P-.sup.67NGLY.sup.71G 15.5 3.2 3.5 0.4 34.2 5.3 157.5 10. (SEQIDNO:140) 14. KKK.sup.42A.sup.43T-.sup.48ARGDN.sup.53P-.sup.67NGLY.sup.71G 21.0 2.2 6.9 1.3 26.7 4.7 140.9 10.6 (SEQIDNO:141) 15. KKKR.sup.43A-.sup.48ARGDN.sup.53P-.sup.67NGLY.sup.71G 58.2 6.7 19.2 1.2 78.4 11.5 192.2 6.9 (SEQIDNO:142) 16. .sup.39KAKRA.sup.43-.sup.48ARGDN.sup.53P-.sup.67NGLY.sup.71G 68.4 1.9 25.0 4.4 156.6 28.2 (SEQIDNO:143) 17. .sup.39SKAGT.sup.43-.sup.48ARGDN.sup.53P-.sup.67NGLY.sup.71G 71.3 23.7 124.4 0.9 174.6 23.7 (SEQIDNO:144) 18. .sup.39SRAGKICR-.sup.47RARGDN.sup.53P-.sup.67NGLY.sup.71G 2.2 2.5 98.7 9.1 233.7 22.3 (SEQIDNO:130) 19. .sup.39KKKRTICR-.sup.47RARGDN.sup.53P-.sup.67NGLY.sup.71G 1.6 3.2 44.3 10.1 153.5 5.4 (SEQIDNO:132) 20. .sup.9KKKRT-.sup.46ARARGDN.sup.53P-.sup.67NGLY.sup.71G 2.7 3.6 31.4 147.6 (SEQIDNO:169) 21. .sup.39KKKR.sup.43T-.sup.48PRGDM.sup.53P-.sup.67Y.sup.68H 76.1 22.3 1.3 0.2 25.6 7.0 104.5 23.0 (SEQIDNO:127) (3) (2) (3) 22. .sup.39SRAG.sup.43K-.sup.48ARGDN.sup.53P-.sup.67Y.sup.68H 40.0 5.8 22.6 3.7 256.0 8.5 125.4 25.4 (SEQIDNO:128) (2) (2) (2) 23. .sup.39KKKR.sup.43T-.sup.48ARGDN.sup.53P-.sup.67Y.sup.68H 10.0 2.4 5.9 1.0 133.4 15.1 88.2 17.2 (SEQIDNO:166) (3) (3) (3)

    Example 5

    Inhibition of Cell Migration by Disintegrin Variant and Wild Type of Rhodostomin

    [0143] Transwell filters were equilibrated in serum containing DMEM for 2 h before use. DMEM containing 10% FBS was added to the lower compartments of the migration filters. In a volume of 100 ml serum-free DMEM, 210.sup.4 A375 human melanoma cells were plated per transwell filter. Cells were allowed to migrate for 6 h at 37 C. in 5% CO.sub.2, and were subsequently fixed by immersion of the filters in methanol for 15 min at room temperature. Rhodostomin, AR-NP (see Table 13 for consensus sequence), or PBS buffer were added into upper chamber. Filters were washed once with water, and were stained in 0.2% crystal violet in a 20% methanol/water solution for 10 min. Cells were removed from the upper surface of the membrane with a cotton swab. Cells that had migrated to the underside of the membrane were counted at 200 magnification from five random fields per membrane.

    [0144] The inhibitory activity of Rho, AR-NP, or PBS buffer in this study as shown in FIGS. 2A, 2B, and 2C. Briefly, AR-NP markedly inhibited the migration of A375 human melanoma cells.

    Example 6

    Inhibition of Angiogenesis by Disintegrin Variants in Matrigel Angiogenesis Assay

    [0145] The matrigel containing VEGF (100 ng/ml) and heparin (24-26 U/ml) is subcutaneously injected into B6 mice. After 5 days the gels are recovered, weighed and processed for hemoglobin quantification or histology as previously described. Hemoglobin content is measured with a Drabkin reagent kit 525 (Sigma). For histological analyses, the matrigel pellets are fixed in 4% paraformaldehyde and embedded in paraffin; four micron sections are stained with hematoxylin-eosin by standard procedures.

    [0146] An aliquot (300 L) of MATRIGEL (Becton Dickinson Lab.) containing VEGF (150 ng) and heparin (30 IU) was injected subcutaneously into the dorsal region of 6-8 week-old C57BL/6 mice. The MATRIGEL formed a plug rapidly. AR-NP (1 mg/kg) or ARLDDL (SEQ ID NO: 351) (1 mg/kg) (see Table 13 for consensus sequence) was administered once intravenously 24 hr later. After 5 days, plugs were taken and photographed (upper panel). Neovessels were quantified by measuring the hemoglobin of the plugs as an indication of blood vessel formation with the Drabkin method and Drabkin reagent kit 525 (Sigma) (B&C). The analysis showed that AR-NP was more effective than ARLDDL (SEQ ID NO: 351) when the drug was injected only once during 5 days angiogenesis period. See FIGS. 3A, 3B, and 3C.

    Example 7

    Inhibition of Angiogenesis by Hyperoxia/Normoxia-Driven Model of Retinopathy of Prematurity (ROP)

    [0147] One-week-old C57BL/6j mice or ICR mice and their mothers are exposed to 75%2% oxygen for 5 days (hyperoxia) and then returned to normoxic conditions for another 5 day (hyperoxic period, P7 to P12) for inducing relative hypoxic conditions, and were then housed in room air for a further 7 days (hypoxic-induced angiogenic period, P12 to P19). AR-NP (1 pg) was administered via intravitreous route on Day 12 and the mice were sacrificed on Day-19. Unexposed control animals are kept in room air. The animals are maintained at a constant temperature of 211 C. and on a 12-hour light-dark cycle. Oxygen concentration is measured with an oximeter. At the end of the oxygen exposure (day 12) and 5 days after return to normoxic conditions (day 17), the pups are killed, and retinal angiogenesis is evaluated by neovessels and endothelial cells.

    [0148] The results of this study were shown in FIGS. 4A, 4B, and 4C. The analysis showed that AR-NP significantly reduced angiogenesis in a mouse model of retinopathy.

    Example 8

    Inhibition of Angiogenesis by Disintegrin Variants in Mice Aortic Ring Assays

    [0149] The thoracic aortas of mice 8-12 weeks of age are dissected out and cut into rings approximately 0.5 mm in width. The aortic rings are mounted in 200 ml matrigel covered with DMEM supplemented with 2.5% FCS and 30 ng/ml VEGF with or without the appropriate inhibitors or control agents. The experiment was conducted in CO.sub.2 incubator at 37 C. After 7 d in culture, the aortic rings are fixed with 4% formaldehyde and stained them with crystal violet. The number of sprouts grown from each ring by using inverted microscope was counted.

    [0150] Mouse aortic rings were incubated with VEGF and 0.1 M AR-NP in matrigel containing 100 mg/ml of fibronectin. The culture medium was changed every 3 days. Graphs showed the microvessel sprouting after 7 days culture. Note that AR-NP significantly reduced the vessel sprouting (see FIG. 5).

    Example 9

    Inhibition of Colony Formation by Disintegrin Variants on Breast Cancer Cells

    [0151] The representative images in FIG. 6 showed the results of colony formation assay. 4-T1 breast cancer cells were plated in 6-well dishes with a top layer of 0.35% agar and a bottom layer of 0.7% agar in medium. 0.3 mL of medium is supplemented every 3 days. After 18 days, the number of cell clusters per dish is identified by crystal violet staining and counted. The analysis showed that both ARLDDL (SEQ ID NO: 351) (0.1 M & 1 M) and AR-NP (0.1 M & 1 M) inhibited colony formation of 4-T1 breast cancer cells.

    Example 10

    Inhibition of Osteoclastogenesis by Disintegrin Variants

    [0152] Six- to eight-week-old SD rats are obtained from the Animal Center of National Laboratory and are kept under controlled conditions including a 221 C. room temperature and a 12-h light-dark cycle. Animals are fed with Purina Laboratory Rodent Diet and distilled water ad libitum. Bone marrow cells are prepared by removing from femurs and tibiae and flushing the bone marrow cavity with DMEM (Invitrogen, Carlsbad, Calif.) which is supplemented with 20 mM HEPES and 10% heat-inactivated FBS, 2 mM glutamine, penicillin (100 U/ml) and streptomycin (100 g/ml). The non-adherent cells (hematopoietic cells) are collected after 24 hr and used as osteoclast precursors. Cells are seeded at 110.sup.6 cells/well in 24-well plates in the presence of human recombinant soluble RANKL (50 ng/ml) and M-CSF (20 ng/ml). The culture medium is replaced every 3 days. Osteoclast formation is measured on Day-8 by TRAP staining. In brief, adherent cells are fixed with 10% formaldehyde in PBS for 3 min and then stained with Naphthol AS-MX phosphate and tartrate solution for 1 hr at 37 C. Osteoclast-like cells in each well are scored by counting the number of TRAP-positive and multinucleated cells containing more than three nuclei.

    [0153] The protein drugs were added on D1D7. IC50 of osteoclastogenesis for 51 and v3 dual integrin AR-NP is 3.61 nM. As shown in FIGS. 7A-7D, AR-NP protein or ARLDDL protein (SEQ ID NO: 351) inhibited RANKL-induced osteoclastogenesis in comparison with untreated control.

    Example 11

    Inhibition of Glioma Invasion by Disintegrin

    [0154] Human glioma cells (U251) were cultured in upper chamber with matrigel containing 100 g/ml hyaluronan. Disintegrin variant was added in both upper and lower chambers. 24 hours later, the cells in the lower chamber were stained using crestal violet and counted. As shown in FIG. 8, both ARLDDL (SEQ ID NO: 351) (0.1 M) and AR-NP (0.1 M) markedly inhibited glioma invasion.

    Example 12

    Effect of AR-NP on Blood Pressure and Heart Rate

    [0155] Blood pressure and heart rate were recorded from tail using non-invasive method under isoflurane anesthesia in Wistar rat. AR-NP was administered from tail vein after getting a stable measurement. Note that AR-NP at 5 mg/kg did not significantly affect blood pressure and heart rate (FIGS. 9A and 9B). The usual dose of AR-NP for pharmacological effect is 1 mg/kg.

    Example 13

    Inhibition of A375 Melanoma Growth by AR-NP

    [0156] A375 tumor cells (at 510.sup.6) were injected subcutaneously in the flank of 4-5 week-old male SCID mice. One week after cell implantation, mice were injected with AR-NP (KKART-ARGRGDNP; SEQ ID NO: 350) (2 mg/kg, 5 days/week, i.p.). Tumor volume was measured every two days. Tumors were excised and weighed after 18 days of drug treatment. Scale bar: 1 cm. Note that AR-NP treatment markedly inhibited tumor growth (see FIG. 10).

    Example 14

    Inhibition of Tumor Growth by KG (AR-NP) in K-rasG12D Transgenic Mice

    [0157] K-Ras.sup.G12D transgenic mice was fed with 400 mg/L doxycycline to induce lung cancer. After 3.5 months, TG mice were intraperitoneally (IP) injected with 2 mg/kg of AR-NP at two days interval for one month. Two weeks after fifteenth treatment, mice were sacrificed. Lungs were injected with India ink and fixated in Fekete's solution. The number of tumor nodules on lung were counted. **, P value<0.001. As shown in FIG. 11, the disintegrin variant (AR-NP) inhibited tumor growth in K-rasG12D transgenic mice.

    Example 15

    Inhibition of Brain Tumor Growth in U87-Bearing Mice by KG

    [0158] NOD-SCID mice were originally purchased and bred/maintained in a specific-pathogen-free vivarium with a well-controlled environment with a 12-h/12-h light/dark cycle and controlled humidity and temperature. 8-10 week-old mice weighing approximately 22-25 g were used. The mice were intraperitoneally anesthetized with a mixture of Dexdomitor/Zoletil (20 m/kg/2 mg/kg), then placed in a stereotactic frame, and the skull was exposed by incision. U87-MG cells were harvested and adjusted to a density of 2.510.sup.5 cells/L in phosphate buffered saline (PBS) before intracranial injection. 2 L of U87-MG cells were injected into the striatum at the designated coordinates from the Bregma using a micro-infusion pump and 10-ml Hamilton syringe with a 30 S-gage needle. The skull was then cleaned, the hole was sealed with bone wax, and the incision was sutured.

    [0159] MRI was performed in a horizontal 7.0-T spectrometer with an active shielding gradient of 300 mT/m in 80 s. The outlines of the tumors were delineated based on the contrast provided by the T2WIs between the tumor and the brain tissues. The total tumor volume (mm.sup.3) was calculated by summing the tumor area across the slices covered by tumor using MR Vision software. Growth curves were plotted as the change in tumor volume at each time point. Starting from day 23 after tumor implantation, the mice were treated intravenously via tail vein with the disintegrin variant (AR-NP) only or a mixture at 5 mg/kg once a day, five days a week. As shown by the results in FIG. 12, the disintegrin variant (AR-NP) also inhibited tumor growth in U87-bearing mice.

    [0160] While the invention has been described in detail, and with reference to specific embodiments thereof, it will be apparent to one of ordinary skill in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof.