WHOLE CELL VACCINES
20200009241 ยท 2020-01-09
Assignee
Inventors
Cpc classification
A61K39/105
HUMAN NECESSITIES
International classification
Abstract
The disclosure relates to attenuated bacterial cells expressing glycans and glycoconjugate antigens and their use in the manufacture of whole cell vaccines effective at preventing or treating bacterial infections in non-human species.
Claims
1. A pathogenic bacterial cell wherein said cell is transformed with one or more transcription cassettes comprising: a nucleic acid molecule encoding a oligosaccharyltransferase polypeptide, a nucleic acid molecule encoding one or more carrier polypeptides comprising at least one glycosylation site as a substrate for said oligosaccharyltransferase and a nucleic acid molecule encoding a biosynthetic locus comprising one or more polypeptides required for the synthesis of a heterologous glycan antigen not expressed by said transformed pathogenic bacterial cell characterised in that said pathogenic bacterial cell is attenuated and said heterologous glycan antigen is expressed at the bacterial cell surface and wherein said heterologous glycan is also coupled to said carrier polypeptide to provide a glycoconjugate retained within said attenuated pathogenic bacterial cell.
2. The pathogenic bacterial cell according to claim 1 wherein said bacterial cell comprises at least one inactive or mutated gene encoding a membrane polypeptide or membrane associated polypeptide wherein the live pathogenic bacterial cell is attenuated and the attenuation is the result of said gene inactivation or mutation.
3. The pathogenic bacterial cell according to claim 1 wherein said gene is selected from the group consisting of: a gene encoding a sortase and/or a gene encoding a polysaccharide modification enzyme wherein said modification is associated with the inactivation or inhibition of expression of said sortase or polysaccharide modification gene.
4. The pathogenic bacterial cell according to claim 3 wherein the gene encoding said sortase is encoded by a nucleotide sequence selected from the group consisting of: i) a nucleic acid molecule comprising a nucleotide sequence as set forth in SEQ ID NO: 1; ii) a nucleic acid molecule comprising a nucleotide sequence wherein said sequence is degenerate as a result of the genetic code to the nucleotide sequence defined in (i); and iii) a nucleic acid molecule the complementary strand of which hybridizes under stringent hybridization conditions to the nucleotide sequence in i) and ii) above wherein said nucleic acid molecule encodes a sortase.
5. The pathogenic bacterial cell according to claim 3 wherein the gene encoding said sortase is encoded by a nucleotide sequence selected from the group consisting of: i) a nucleic acid molecule comprising a nucleotide sequence as set forth in SEQ ID NO: 2; ii) a nucleic acid molecule comprising a nucleotide sequence wherein said sequence is degenerate as a result of the genetic code to the nucleotide sequence defined in (i); and iii) a nucleic acid molecule the complementary strand of which hybridizes under stringent hybridization conditions to the nucleotide sequence in i) and ii) above wherein said nucleic acid molecule encodes a sortase.
6. The pathogenic bacterial cell according to claim 3 wherein the gene encoding said polysaccharide modification enzyme is encoded by a nucleotide sequence selected from the group consisting of: i) a nucleic acid molecule comprising a nucleotide sequence as set forth in SEQ ID NO: 3; ii) a nucleic acid molecule comprising a nucleotide sequence wherein said sequence is degenerate as a result of the genetic code to the nucleotide sequence defined in (i); and iii) a nucleic acid molecule the complementary strand of which hybridizes under stringent hybridization conditions to the nucleotide sequence in i) and ii) above wherein said nucleic acid molecule encodes a polysaccharide modification enzyme.
7. The pathogenic bacterial cell according to claim 3 wherein said gene encoding the sortase and/or said polysaccharide modification enzyme is modified by deletion of all or part of the nucleotide sequence encoding said sortase and/or polysaccharide modification enzyme, or all or part of a regulatory region controlling expression of said sortase and/or polysaccharide modification enzyme.
8. The pathogenic bacterial cell according to claim 1 wherein said oligosaccharyltransferase is a Campylobacter oligosaccharyltransferase.
9. The pathogenic bacterial cell according to claim 8 wherein said Campylobacter oligosaccharyltransferase is a Campylobacter jejuni oligosaccharyltransferase.
10. The pathogenic bacterial cell according to claim 8 wherein said Campylobacter oligosaccharyltransferase is a Campylobacter sputorum oligosaccharyltransferase.
11. The pathogenic bacterial cell according to claim 9 wherein said oligosaccharyltransferase is encoded by a nucleic acid molecule comprising the nucleotide sequence as set forth in SEQ ID NO:4, or a nucleotide sequence that has at least 90% nucleotide sequence identity over the full-length nucleotide sequence set forth in SEQ ID NO: 4.
12. The pathogenic bacterial cell according to claim 10 wherein said oligosaccharyltransferase is encoded by a nucleic acid molecule comprising the nucleotide sequence as set forth in SEQ ID NO: 5 or 6 or a nucleotide sequence that has at least 90% nucleotide sequence identity over the full length nucleotide sequence set forth in SEQ ID NO: 5 or 6.
13. The pathogenic bacterial cell according to claim 9 wherein said oligosaccharyltransferase is represented by the amino acid sequence set forth in SEQ ID NO: 7, or an amino acid sequence that is at least 90% identical to the full length amino acid sequence set forth in SEQ ID NO: 7.
14. The pathogenic bacterial cell according to claim 10 wherein said oligosaccharyltransferase is represented by the amino acid sequence set forth in SEQ ID NO: 8, or an amino acid sequence that is at least 90% identical to the full length amino acid sequence set forth in SEQ ID NO: 8.
15. The pathogenic bacterial cell according to claim 1 wherein said carrier polypeptide comprises the amino acid motif: Asn-X-Ser or Asn-X-Thr where X is any amino acid except proline or wherein said acceptor polypeptide includes the amino acid motif: D/E-X-N-X-S/T (SEQ ID NO: 62), wherein X is any amino acid except proline.
16. The pathogenic bacterial cell according to claim 1 wherein said carrier polypeptide is an endogenous carrier polypeptide encoded by the genome of said attenuated pathogenic bacterial cell.
17. The pathogenic bacterial cell according to claim 1 wherein said carrier polypeptide is a heterologous carrier polypeptide encoded by a nucleic acid molecule not naturally expressed by said attenuated pathogenic bacterial cell.
18. The pathogenic bacterial cell according to claim 17 wherein said heterologous carrier polypeptide is encoded by a nucleic acid molecule isolated from a pathogenic bacterial species.
19. The pathogenic bacterial cell according to claim 17 wherein said heterologous carrier polypeptide is encoded by a nucleotide sequence as set forth in SEQ ID NO: 9, 10 or 11.
20. The pathogenic bacterial cell according to claim 1 wherein said nucleic acid molecule encoding a biosynthetic locus comprising one or more polypeptides required for the synthesis of a heterologous glycan antigen encodes a capsular polysaccharide.
21. The pathogenic bacterial cell according to claim 20 wherein said polysaccharide is O-antigen.
22. The pathogenic bacterial cell according to claim 20 wherein said polysaccharide is a heptasaccharide.
23. The pathogenic bacterial cell according to claim 22 wherein said biosynthetic locus comprises a nucleic acid molecule comprising a nucleotide sequence as is set forth in SEQ ID NO:12.
24. The pathogenic bacterial cell according to claim 1 wherein said nucleic acid molecule encoding said oligosaccharyltransferase and/or carrier polypeptide and/or biosynthetic locus is stably integrated into the genome of said attenuated pathogenic bacterial cell.
25.-26. (canceled)
27. The pathogenic bacterial cell according to claim 1 wherein said biosynthetic locus is the PgI locus.
28. The pathogenic bacterial cell according to claim 27 wherein said PgI locus comprises genes encoding said one or more polypeptides selected from the group consisting of: PgIG, PgIF, PgIE, Cj1122c, PgID, PgIC, PgIA, PgIJ, PgII, PgIH, PgIK.
29. The pathogenic bacterial cell according to claim 27 wherein said nucleic acid molecule encoding one or more polypeptides required for the synthesis of a heterogeneous glycan antigen comprises a sequence as set forth in SEQ ID NO 12, wherein said SEQ ID NO: 12 does not include a functional version of PgIB.
30. The pathogenic bacterial cell according to claim 1 wherein said transcription cassette comprises a promoter operably linked to at least the nucleic acid molecule encoding said oligosaccharyltransferase polypeptide.
31. The pathogenic bacterial cell according to claim 30 wherein said promoter is further operably linked to a ribosome binding site wherein there is provided a nucleotide spacer sequence between the 3 prime end of said ribosome binding site and the 5 initiating start codon of the nucleic acid molecule encoding said carrier polypeptide and/or heterologous glycan antigen and/or oligosaccharyltransferase polypeptide wherein translation from the nucleic acid molecule encoding said carrier polypeptide and/or heterologous glycan antigen and/or oligosaccharyltransferase polypeptide is reduced when compared to a control nucleic acid molecule encoding said recombinant polypeptide that does not comprise said nucleotide spacer sequence.
32. The pathogenic bacterial cell according to claim 30 wherein said promoter is regulatable and includes an inducible or repressible nucleotide element conferring regulatable expression.
33. The pathogenic bacterial cell according to claim 1 wherein said attenuated pathogenic bacterial cell is inactivated.
34. A vaccine or immunogenic composition comprising an attenuated or inactivated pathogenic bacterial cell according to claim 1.
35. A method of preventing or treating a bacterial infection in a non-human animal subject, comprising administering the vaccine or immunogenic composition according to claim 34 to the non-human animal subject.
36. The method of claim 35 wherein said vaccine or immunogenic composition prevents or treats two different bacterial infections in said non-human animal subject.
37. The method of claim 35 wherein said vaccine or immunogenic composition prevents or treats three different bacterial infections in said non-human animal subject.
38. The method of claim 35 wherein said bacterial infections are caused by bacterial species selected from the group consisting of: Actinobacillus pleuropneumoniae, Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Campylobacter coli, Haemophilus parasuis, Streptococcus suis, Streptococcus uberis, Salmonella typhimurium, Salmonella enterica, Staphylococcus aureus, Mycobacterium bovis, Francisella tularensis, Shigella flexneri, Yersinia enterocolitica, Bordetella bronhiseptica, Brucella abortus, Listeria monocytogenes, Erysipelotrix rhusiopatie and Leptospira interrogans.
39. The method of claim 35 wherein said bacterial infection is the result of a streptococcal infection.
40. The method of claim 35 wherein said bacterial infection is the result of a Mycoplasma hyopneumoniae infection.
41.-42. (canceled)
43. A live pathogenic bacterial cell comprising at least one inactive or mutated gene encoding a membrane polypeptide or membrane associated polypeptide wherein the live pathogenic bacterial cell is attenuated and the attenuation is the result of said gene inactivation or mutation.
44.-50. (canceled)
51. A pathogenic bacterial cell wherein said cell is transformed with a transcription cassette comprising a biosynthetic locus comprising one or more polypeptides required for the synthesis of a heterologous glycan antigen not expressed by said transformed pathogenic bacterial cell wherein said heterologous glycan antigen is expressed at the bacterial cell surface.
Description
BRIEF SUMMARY OF THE DRAWINGS
[0165] An embodiment of the invention will now be described by example only and with reference to the following figures:
[0166]
[0167]
[0168]
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
[0175]
[0176]
[0177]
SEQUENCE LISTING
[0178] The Sequence Listing is submitted as an ASCII text file in the form of the file named Sequence.txt (60 kb), which was created on Sep. 2, 2019, and which is incorporated by reference herein.
[0179] Materials and Methods
[0180] Bacterial Strains and Growth Conditions
[0181] Escherichia coli Top10 (Invitrogen) was grown in Luria-Bertani (LB) growth media supplemented with chloramphenicol (12.5 g.Math.ml.sup.1) where appropriate. The S. suis P1/7 strain was cultured at 37 C. in a 5% CO.sub.2 incubator and grown on BHI medium. Where appropriate media was supplemented with chloramphenicol (5 g.Math.ml.sup.1). Plasmids were transferred into S. suis by electroporation.
[0182] General Molecular Biology Techniques
[0183] Plasmids were extracted using a plasmid mini kit (Qiagen) and the genomic DNA with the DNeasy Blood and tissue kit (Qiagen) following treatment with lysozyme (10 mg.Math.ml.sup.1 in phosphate-buffered saline at 37 C. for 30 min), then SDS (10% [wt/vol]) at 65 C. for 30 min) or chelex extraction (cell pellets vortexed in 5% chelex [Sigma] boiled for 10 min, pelleted and the supernatants removed and used). DNA was amplified for cloning using Phusion high fidelity polymerase (NEB), and for screening using Go-taq polymerase (Promega), both in accordance with the manufacturers' instructions. DNA was extracted from PCR reactions and agarose gels using the QIAquick PCR and gel extraction kits (Qiagen) respectively. Plasmids were constructed by restriction/ligation cloning using restriction endonucleases, Antarctic phosphatase and T4 ligase (NEB). Plasmids were confirmed by restriction analysis and Sanger sequencing (SourceBioscience).
[0184] Construction of Allele Exchange Plasmids
[0185] The modular plasmid pMTL82151 was used in this study as the backbone for all allele exchange plasmids. Allele exchange cassettes were assembled by SOE-PCR digested with restriction endonucleases and ligated with pMTL82151, linearized using the same restriction endonucleases. A list of all primers and their corresponding restriction endonucleases can be found in the Table 2. The internal SOE primers were designed to amplify the first three codons and the terminal five codons of the target gene from which regions of approximately 1200 bp were amplified upstream or downstream respectively.
[0186] Mutagenesis
[0187] Allele exchange plasmids were transferred to S. suis by electroporation and transformants were grown on BHI agar supplemented with chloramphenicol (Cm), to select for the plasmid borne catP gene. In the second part of the experiment, chloramphenicol selection was removed to allow growth of double-crossover clones lacking the plasmid marker catP. Single-crossover clones were sub-cultured daily for up to eight consecutive days on non-selective medium. At each sub-culture, several colonies were screened for loss of the plasmid-encoded Cm-resistance by replica-plating. Double-crossover events were detected by replica plating onto non-selective and Cm plates and mutants verified by PCR (see below).
[0188] Confirmation of In-Frame Deletion Mutants
[0189] In-frame deletion mutants were confirmed by PCR also using the chromosomal flanking primers. The sequences of the mutants were confirmed by Sanger sequencing (Sourcebioscience).
[0190] Construction of C. sputorum pgIB2 Expression Plasmid pELLA1
[0191] A codon optimised version of C. sputorum pgIB2 was generated by DNA synthesis in the cloning vector pUC57 km and designed to have EcoRI (GAATTC) restriction enzyme sites at the 5 and 3 end of the construct. The plasmid pEXT21 was grown in E. coli DH5a cells and purified by plasmid extraction (QIAGEN Ltd UK). 1 g of pUC57 Km containing CsPgIB2 and 1 g of pEXT21 were digested with EcoRIHF (New England Biolabs U.K.) cloned into the EcoRI site of the IPTG inducible expression vector pEXT21 to generate the vector pELLA1.
[0192] Construction of pELLA2
[0193] The gene coding for C. sputorum PgIB2 was amplified by PCR with the pTac promoter and Lacl repressor from plasmid pEXT21 as a template using accuprime Taq hifi with (SEQ ID NO: 13, 5-TTTTGCGGCCGCTTCTACGTGTTCCGCTTCC-3) as forward primer and (SEQ ID NO:14, 5-TTTTGCGGCCGCATTGCGTTGCGCTCACTGC-3) reverse primer using the following cycling conditions, 94 C./2 minutes followed by 35 cycles of 94 C. for 30 seconds, 56 C. for 30 seconds and 68 C. for 4 minutes. and ligated into the unique NotI site in pJCUSA1 a Zeocin resistant transposon where the antibiotic marker is flanked by loxP sites allowing for downstream removal of antibiotic marker from the final target strain via the introduction of the CRE enzyme. It has a pMB1 origin of replication and thus can be maintained in any E. coli strain prior to being cut out and transferred along with the Zeocin resistance cassette using SfiI restriction enzyme digestion and transfer into the pUT delivery vector thus generating a functional transposon. The sequence of the transposon is shown below (SEQ ID NO: 15):
TABLE-US-00001 5GGCCGCCTAGGCCGCGGCCGCCTACTTCGTATAGCATACATTATACGA AGTTATGTCTGACGCTCAGTGGAACGACGCGTAACTCACGTTAAGGGATT TTGGTCATGATCAGCACGTTGACAATTAATCATCGGCATAGTATATCGGC ATAGTATAATACGACAAGGTGAGGAACTAAAACATGGCCAAGTTGACCAG TGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCT GGACCGACCGGCTCGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCC GGTGTGGTCCGGGACGACGTGACCCTGTTCATCAGCGCGGTCCAGGACCA GGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACG AGCTGTACGCCGAGTGGTCGGAGGTCGTGTCCACGAACTTCCGGGACGCC TCCGGGCCGGCCATGACCGAGATCGGCGAGCAGCCGTGGGGGCGGGAGTT CGCCCTGCGCGACCCGGCCGGCAACTGCGTGCACTTCGTGGCCGAGGAGC AGGACTGAATAACTTCGTATAGCATACATTATACGAAGTTATGGCCGCCT AGGCC-3.
[0194] The insertion of CspgIB2 into this transposon and transfer into the pUT delivery vector resulted in plasmid pELLA2 and maintained in Transformax E. coli strain EC100D pir+ (Cambio U.K.).
[0195] Bacterial Conjugation
[0196] To enable transfer of the CspgIB2 transposon cargo into the chromosome of a recipient E. coli strain or any other bacterium the plasmids pELLA2 was transferred into E. coli MFD a diaminopimelic acid (DAP) auxotroph. Growth medium was supplemented with Zeocin 100 g/ml and ampicillin 100 g/ml. Both donor and recipient bacteria were growth until late exponential phase. Bacterial cells were pelleted by centrifugation, washed 3 times with PBS and mixed together in a ratio of 1:3 recipient to donor and spotted on a dry LB agar plate with no antibiotics for 4-8 hrs. The cells were scraped and suspended in PBS and dilutions plated on LB agar with appropriate selection antibiotics to select for transconjugants. Individual colonies were picked up and screened for loss of the pUT backbone and for the presence of the transposon.
[0197] Generation of Unmarked pgIB Insertion
[0198] The transposon carrying CspgIB2 and loxP recombination sites around a Zeocin resistance cassette was introduced into PouIVAc E. coli. Following selection for Zeocin resistant colonies, the antibiotic selection marker was removed by introduction via electroporation, the temperature sensitive vector pCRE5 (Reference: Appl Environ Microbiol. 2008 February; 74(4): 1064-1075. Genetic Tools for Select-Agent-Compliant Manipulation of Burkholderia pseudomallei. Kyoung-Hee Choi, Takehiko Mima, Yveth Casart, Drew Rholl, Ayush Kumar, Ifor R. Beacham and Herbert P. Schweizer).
[0199] PoulVAc E. coli was cultured at 28 C. in the presence of kanamycin 50 g/ml, rhamnose was added to induce expression at 0.2% final concentration and the organism subcultured several times to select for colonies that had lost resistance to Zeocin but maintained resistance to kanmaycin indicating that the bleomycin resistance gene had been flipped out of the chromosome.
[0200] This E. coli mutant was then sub-cultured at 42 C. to cure out the pCRE5 plasmid. Screening for colonies that had once again become sensitive to kanamycin confirmed loss of pCRE5 and completed generation of an unmarked inducible copy of pgIB on the chromosome of E. coli.
[0201] Construction of pELLA3
[0202] The pgIB gene from C. sputorum was amplified using the primers CsPgIB1fwd: TTTT GAATTCGATTATCGCCATGGCGTCAAATTTTAATTTCGCTAAA (SEQ ID NO 16) and the reverse primer CsPgIB1 rev: TTTT GAATTC TTATTTTTTGAGTTTATAAATTTTAGTTGAT (SEQ ID NO 17) using Accuprime Taq Hifi and the following cycling conditions 94 C./30 s, followed by 24 cycles of the following conditions 94 C./30 s, 53 C./30 s, 68 C./2 min. The PCR product was cut with the restriction enzyme EcoRI HF for 16 hr at 37 C. The plasmid pEXT21 was also cut with the restriction enzyme EcoRI HF for 16 hr at 37 C. Both plasmid and PCR product were purified with a PCR purification kit (QIAGEN UK) and the plasmid pEXT21 was dephosphorylated by treating with Antarctic phosphatase (NEB UK Ltd) at 37 C. for 1 hr. The enzyme was heat inactivated by heating at 80 C. for 2 min before the plasmid and the insert were ligated together using T4 DNA ligase (Promega UK) and the reaction was incubated overnight at 4 C. The ligation reaction was transformed into E. coli Dh10 cells (NEB UK Ltd) and recovered on LB Spectinomycin plates (80 g/ml). Constructs were then sequenced to confirm that the cloned C. sputorum PgIB had not gained any mutations during the cloning process. This new construct was named pELLA3.
[0203] In another version of this glycoengineering tool a mariner Himar1 element was modified to carry a unique NotI site between the IR1 and IR2 ends of the transposon. This NotI site was used to enable the integration of the hyaluronan synthase gene and UDP-Glc dehydrogenase encoding genes from Streptococcus pneumoniae serotype 3 under control of the erm cassette contained within the Himar1 transposon. The vector used to make the Himar1 based insertions was a derivative of vector pCAM45 (May et al. FEMS Microbiology Letters 2004) with the modification that the R6k origin of replication was removed. This new transposon carrying vector was named pELLA4.
[0204] Carrier Polypeptide
[0205] Attenuated bacterial strains are transformed with the plasmid pGVXN150:GT-ExoA encoding a modified carrier polypeptide [GT-ExoA]. The GT-ExoA construct was engineered to express a modified version of P. aeruginosa Exotoxin A in the vector pGH and closed into a vector derived from pEC415 using the restriction enzymes NheI and EcoRI (NEB). The synthesized protein contains two internal modifications that allow glycosylation of the protein by PgI, as well as containing four N-glycosylation sequons at the N terminal and an additional 4 at the C terminals glycotags. In addition, a hexa-histidine tag was added to the C-terminus of the protein to facilitate putification and and an E. coli DsbA signal peptide was added to the N-terminal sequences enabling Sec-dependent secretion to the periplasm. pGVXN150: GT-ExoA is ampicillin resistant and L-(+)-Arabinose inducible. The construct sequence was then confirmed using Sanger sequences with the primers GTExoA NF (SEQ ID NO 18; GCGCTGGCTGGTTTAGTTT), GTExoA NR (SEQ ID NO 19; CGCATTCGTTCCAGAGGT), GTExoA CF (SEQ ID NO 20; GACAAGGAACAGGCGATCAG) and GTExoA CR (SEQ ID NO 21; TGGTGATGATGGTGATGGTC).
[0206] Reducing the Toxicity of PgIB
[0207] Protein glycan coupling technology requires the use of Campylobacter jejuni PgIB. This enzyme has 13 transmembrane domain and is toxic when overexpressed in E. coli. The pgIB gene was originally amplified by PCR with oligonucleotides PgIBEcoRI (EcoRI in bold) using the primers (SEQ ID NO 22: AAGAATTCATGTTGAAAAAAGAGTATTTAAAAAACCC) and PgIBNcoI-HA (SEQ ID NO 23: AACCATGGTTAAGCGTAATCTGGAACATCGTATGGGTAAATTTTAAGTTTAAAAACCTTA GC), using Pfu polymerase with pACYC(pgI) as template. Oligonucleotide PgIBNcoI-HA encodes an HA-tag to follow PgIB expression by Western blot. The PCR product was digested with EcoRI and NcoI and cloned in the same sites of vector pMLBAD. The plasmid obtained was named pMAF10. Arabinose-dependent expression of PgIB was confirmed by Western blot (Feldman et al. 2005). This construct has been subcloned into the EcoRI site of the vector pEXT21 allowing for IPTG dependant inducible expression of CjpgIB. This plasmid and ORF combination has been used for several years in order to produce several glycoconjugate vaccines. In a recent modification using PgIB from Campylobacter sputorum we have carried out tests and found that the ribosome binding site is encoded within the pEXT21 vector itself. This means that translational efficiency is partly controlled by the distance between the RBS and the ATG start codon of pgIB. We noticed that inserting the PgIB coding gene into the vector pEXT21 with an extended 10 base pairs of DNA sequence resulted in reduced toxicity of the enzyme and subsequently increased growth in the carrier E. coli strain as measured by optical density. Therefore it may be possible to reduce the toxicity of C. jejuni PgIB by the simple modification of insertion of additional nucleotides before the ATG start codon or alternatively clone the gene further away from the RBS carried within the expression plasmid.
[0208] In Vitro Mutagenesis of the C. jejuni 81116 PgI Locus Cloned in pACYC184
[0209] Mutagenesis of 11 genes in the C. jejuni 81116 glycosylation locus cloned in pACYC184 (pACYCpgI) was performed in vitro using a customised EZ::TNtransposon system (Epicentre, Madison, Wis., USA). Briefly, a kanamycin resistance cassette (Trieu-Cuot et al., 1985) lacking a transcriptional terminator and therefore unable to exert downstream polar effects was amplified by PCR and cloned into the multiple cloning site of the vector pMOD<MCS> (Epicentre). This construct was linearized by ScaI digestion and the kanamycin resistance cassette along with flanking mosaic ends was amplified by PCR using primers FP-1 and RP-1 (Epicentre). The PCR product was combined with plasmid pACYCpgI (Wacker et al., 2002) in an in vitro transposition reaction performed according to manufacturer's instructions (Epicentre). The resultant pool of mutated pACYCpgI plasmids was electroporated into E. coli XL1-Blue MRF (Stratagene) and putative mutants were screened by PCR to identify the location and orientation of the kanamycin cassette. We only used those mutants having the kanamycin resistance cassette inserted with the same transcriptional orientation as the genes of the glycosylation locus, which were also confirmed by sequence analysis.
[0210] Pathogenesis of Streptococcus suis Mutants and Wild Type P1/7 Strain in Pigs
TABLE-US-00002 TABLE 1 Experimental Groups GROUP CHALLENGE NO PIG# 4E RM Group 1 cps2E 5 1-5 7 Group 2 srtB 5 6-10 9 Group 3 srtF 5 11-15 11 Group 4 1476 5 16-20 13 Group 5 WT SS P1/7 (shared w/ 8 990-997 8-14 SRD121) (2 pigs/room)
[0211] Nasal swaps and blood samples were taken from the pigs prior to intranasal challenge with Streptococcus suis mutant and wild type strains (day 0). The pigs were challenged with 2 ml (1 ml per nostril) of approx. 10.sup.9 CFU/ml in PBS of S. suis mutant and wild type strains (Table 3).
TABLE-US-00003 TABLE 3 Titers of inocula: cps2E (5) tntc (6) 250, 176 (7) 15, 9 2.13 10.sup.9 CFU/ml srtB (5) tntc (6) 122, 102 (7) 16, 15 1.12 10.sup.9 CFU/ml srtF (5) tntc (6) 146, 170 (7) 16, 18 1.58 10.sup.9 CFU/ml 1476 (5) tntc (6) 190, 189 (7) 23, 20 1.90 10.sup.9 CFU/ml P1/7 (5) tntc (6) 63, 66 (7) 6, 4 6.45 10.sup.8 CFU/ml
[0212] On day 2, 5 and 7 either nasal or nasal and tonsil swabs were taken and immediately plated for bacterial count.
[0213] Pigs were observed for clinical signs of severe disease, including lameness, lethargy, neurological symptoms. Samples at necropsy such as SST for blood, nasal swab, tonsil swab, swab of serosa (pericardium, thoracic cavity, abdominal cavity), joint tap or swab (affected joint or hock), CSF tap. Lung lavage was taken and either immediately cultured or frozen, gross lesions were recorded. Samples were collected in 2 ml PBS except lung lavage where 50 ml of PBS were instilled into the lung and collected with a pipette. 100ul of the samples were plated on TSA blood agar plates.
[0214] If presentation was severe enough (dyspneic, paddling and/or does not rise upon human entry into the pen), the pig was euthanized. Otherwise if no clinical signs show pigs were euthanize pigs at day 15 after infection. Serum antibody titre was measured after 15 days of exposure in pigs (
EXAMPLE 1
[0215] The construct pELLA1 was transformed into E. coli CLM24 cells alongside a pEC415 vector coding for Pseudomonas aeruginosa exotoxin A with a single internal glycosylation site and the plasmid pACYCpgIB::km coding for the entire C. jejuni heptasaccharide with a disruption in the pgIB gene by insertion of a miniTn5km2 element. As a comparison the exotoxin A and C. jejuni heptasaccharide coding constructs were transformed into an E. coli CLM24 cell carrying pEXT21pgIB from C. jejuni. 500 ml LB containing 30 g/ml.sup.1 cm, 100 g/ml.sup.1 amp, 80 g/ml.sup.1 spectinomycin were inoculated with 10 ml of an O/N culture of either CLM24 construct combination and incubated with shaking at 37 C. Optical density 600 nm reading were taken at hourly intervals and protein expression induced at an OD.sub.600 nm of 0.4 by the addition of IPTG 1 mM and L-arabinose 0.2% final concentration. 5 hr post initial induction, 0.2% L-arabinose was added and OD.sub.600 nm continued to be measured (
[0216] The growth of E. coli CLM24 cells without any induction of protein expression was also measured. This was carried out in the same way as described above for the E. coli CLM24 cells carrying pELLA1 except that no IPTG or L-arabinose was added (
EXAMPLE 2
[0217] E. coli CLM24 cultures carrying plasmids coding for singly glycosylatable exotoxinA, C. sputorum PgIB2 or C. jejuni PgIB were used to inoculate 500 ml of LB broth. Protein expression was induced as described in example 1 with the modification that the cultures were incubated for a further 16 hr after the second 0.2% L-arabinose addition. At this point cells were pelleted by centrifugation at 4000g for 30 min and lysed using a high pressure cell homogeniser (Stansted Fluid power) HIS tagged exotoxinA was purified from CLM24 cells using NiNTA binding. Protein was separated on a 12% Bis-tris gel (Invitrogen) before transferring onto a nitrocellulose membrane. This was probed with primary rabbit hr6 anti-campy glycan antibody and mouse anti-HIS. Goat anti-rabbit and anti-mouse infrared dye labelled secondary antibodies were used to enable visualisation of glycoprotein using an Odyssey LI-COR scanner (LI-COR Biosciences UK Ltd) (
EXAMPLE 3
[0218] pACYCpgI was introduced into PouIVAC E. coli by electroporation alongside the plasmid pUA31 coding for a c-Myc tagged tetraglycosylatable L-arabinose inducible CjaA. After 2 inductions with 0.2% L-arabinose and a total of 24 hr incubation at 37 C. with shaking. 1 ml of culture was obtained and centrifuged at 10,000g for 10 min. The supernatant was discarded and the pellet resuspended in 100 l of 2SDS PAGE loading dye. This was boiled for 10 min before 20 l was loaded into a 12% Bis-Tris gel and transferring onto a nitrocellulose membrane. Samples were probed with mouse anti c-Myc antibody and rabbit hr6 antibody. Goat anti-rabbit and anti-mouse infrared dye labelled secondary antibodies were used to enable visualisation of glycoprotein using an Odyssey LI-COR scanner (LI-COR Biosciences UK Ltd) (
EXAMPLE 4
[0219] Salmonella Typhimurium strain SL3749 was transformed with pUA31 (coding for the acceptor protein CjaA), pACYCpgI(pgIB::km) (coding for C. jejuni heptasaccharide coding locus but with pgIB knocked out) and pMAF10 (coding for arabinose inducible C. jejuni PgIB). A 10 ml O/N 37 C. shaking culture was prepared and used to inoculate 200 ml of LB broth. This continue to be shaken 37 C. until an OD600 nm of 0.4 was reached. At this point 0.2% L-arabinose was added to induce CjaA and PgIB expression. After 4 hr of incubation L-arabinose was added again to 0.2% final concentration and culture incubated for a further 16 hr at 37 C. with shaking. Bacterial cultures were pelleted by centrifugation at 6000g for 30 min and resuspended in 30 ml 25 mM Tris, 0.15 M NaCl pH 7.5 (TBS). Cells were lysed using a high pressure cell homogeniser. 2% SDS and 1% Triton X-100 were added and the lysed material incubated for 3 hr at 4 C. with mixing. The material was then centrifuged at 4000g for 20 min. Pellet was discarded before 300 l of c-Myc sepharose (Thermo Scientific USA) was added. This was allowed to incubate O/N at 4 C. with mixing. The material was then centrifuged at 4000g for 10 min and the supernatant removed. 1 ml TBS was added with 0.05% Tween. This was washed 5 times by pulsing at 10,000g. Protein elution was achieved by the addition of 300 l 2SDS loading buffer containing 3 l DTT and boiled for 10 minutes. Western blot was carried out as described in example 3 (
EXAMPLE 5
[0220] We have used the transposon pELLA2 carrying an IPTG inducible copy of CspgIB to integrate this gene into the chromosomes of glycoengineering E. coli strains W3110, CLM24, CLM37, 5e874, SCM7, SCM6, SCM3 as well as PouIVAc E. coli and S. typhimurium.
EXAMPLE 6
[0221] The E. coli strain CLM24 carrying a plasmid coding for the Campylobacter jejuni heptasaccharide pACYCpgI (without a knock out in pgIB) and an acceptor protein as well as the construct pELLA1 were grown in 50 ml of LB broth containing Cm 30 g/ml, Sp 80 g/ml, Amp 100 g/ml with shaking at 37 C. Optical density readings were taken at 600 nm at hourly intervals. The growth was compared to that observed when pEXT21 carried C. jejuni pgIB. At an optical density of OD600 .sub.nm of 0.4 IPTG was added at a final concentration of 1 mM and L-arabinose was added at 0.2% final concentration. Results are shown in
EXAMPLE 7
[0222] The E. coli strain CLM24 carrying a plasmid coding for the Campylobacter jejuni heptasaccharide pACYCpgI (without a knock out in pgIB) and an acceptor protein as well as the construct pELLA3 were grown in 50 ml of LB broth containing Cm 30 g/ml, Sp 80 g/ml, Amp 100 g/ml with shaking at 37 C. Optical density readings were taken at 600 nm at hourly intervals. The growth was compared to that observed when pEXT21 carried C. jejuni pgIB. At an optical density of OD600 .sub.nm of 0.4 IPTG was added at a final concentration of 1 mM and L-arabinose was added at 0.2% final concentration. Results are shown in
EXAMPLE 8
[0223] Mutagenesis of the Swine and Human Pathogen Streptococcus suis Serotype 2 (Ss2) in the Absence of a Counter-Selection Marker
[0224] S. suis serotype 2, is a major pathogen of swine that has recently been reported to have crossed the species barrier, causing infections in humans. The presence of the polysaccharide capsule is considered the major virulence determinant and the gene cps2E is thought to be essential for capsule formation. Other genes of interest to us were the S. suis sortases of which there are 6 putative sortases, SrtA-F.
[0225] First we identified a plasmid pMTL82151 which is non-replicative in S. suis and therefore suitable as a suicide plasmid in this organism. S. suis P1/7 competent cells transformed with pMTL82151 could not form colonies on selective plates, while cells transformed with the replicative plasmid pSET1 formed colonies as expected. Allele exchange cassettes for the deletion of the genes csp2E, srtB and srtFwere then constructed, with approximately 1.2 kbp regions of homology (with the exception of srtF homology region 2 which contained a 700 bp region of homology to avoid cloning any whole genes which appeared to be toxic to E. coli). S. suis was transformed with the allele exchange plasmids and chloramphenicol (Cm) resistant single-crossover clones obtained. Single-crossover integrants were passaged without selection and each day colonies were patch plated to determine whether double recombination had occurred. This frequency was high enough that mutants could be easily isolated by the fifth and sixth passage without selection. Cm-sensitive clones were screened by PCR to determine whether they contained mutant or alleles revertant to wild type, mutants of cps2E, srtB and srtFwere isolated and confirmed by Sanger sequencing.
TABLE-US-00004 TABLE2 Primername Sequence(5-3) Function(restrictionsite) cps2ER1 TTACTTACTTCCCTCTCTCAAT AmplifyP1/7cps2EHA1 ATTTCAATATTCATAGCTCCT (SEQIDNO24) cps2EF2 AGGAGCTATGAATATTGAAATA AmplifyP1/7cps2EHA2 TTGAGAGAGGGAAGTAAGTAA (SEQIDNO25) cps2EF1 TATATTGAATTCAATTACAAAG AmplifyP1/7cps2EHA1-1200 ATTACAGGTTTG(SEQIDNO bp(EcoRI) 26) cps2ER2 AGTTCAGGATCCTCCTTTAAAC AmplifyP1/7cps2EHA1+1200 AACTTCTCATAC(SEQIDNO bp(BamHI) 27) cps2Escreen CTGCGGCTAGTCTCGCTATT PCRscreenP1/7cps2E F (SEQIDNO28) cps2Escreen CATGCGCTTCAAATTCATTC PCRscreenP1/7cps2E R (SEQIDNO28) srtBF1 AGTTCACATATGCGGGTGGTA AmplifyP1/7srtBHA1Forward TCGGTACACTT(SEQIDNO30) srtBR1 CCTTTTTGTTAATAAGAAAATC AmplifyP1/7srtBHA1Reverse AGTTTCTGTATCATAATCCGAA CTTC(SEQIDNO31) srtBF2 GAAGTTCGGATTATGATACAGA AmplifyP1/7srtBHA2Forward AACTGATTTTCTTATTAACAAAA AGG(SEQIDNO32) srtBR2 TTCGTATGGATCCAACTACGGT AmplifyP1/7srtBHA1Reverse GACCGGCAAT(SEQIDNO33) srtBscreenF GAGAATTGAAGGAAGTGATA PCRscreenP1/7srtB (SEQIDNO34) srtBscreenR ATATAAGGAGTACAGGTTAG PCRscreenP1/7srtB (SEQIDNO35) srtFF1 AGTTCAGCTAGCGGGCAAAGA AmplifyP1/7srtFHA1Forward ATTTCGGTACA(SEQIDNO36) srtFR1 CTTTCTGAGGTTCCATGGTAAG AmplifyP1/7srtFHA1Reverse GAGCCATTTGATCATGAAAT (SEQIDNO37) srtFF2 ATTTCATGATCAAATGGCTCCT AmplifyP1/7srtFHA2Forward TACCATGGAACCTCAGAAAG (SEQIDNO38) srtFR2 TTCGTATGGATCCGTAGTCCAA AmplifyP1/7srtFHA1Reverse ATGAGCTACTTAC(SEQIDNO 39) srtFscreenF GACAAGCCAACTGAAACAAC PCRscreenP1/7srtF (SEQIDNO40) srtFscreenR AGATTCCCCTGATTTAGCTA PCRscreenP1/7srtF (SEQIDNO41) M13F ACTGGCCGTCGTTTTACA PCRscreen (SEQIDNO42) M13R CAGGAAACAGCTATGACC PCRscreen (SEQIDNO43) HA = homology arm; bp = base pairs; F = Forward; R = Reverse. Underlined sequences correspond to recognition sequences for restriction endonuclease
EXAMPLE 9
[0226] The pigs were challenged with the wild type strain of S. suis (P1/7), the cps2E mutant which was used as a non-disease-causing control, the srtB and srtF mutants and a mutation in ssu1476 which is a putative sorted protein. Challenge was intranasal, the natural route of infection in pigs.
[0227] Onset of clinical signs/necropsy in groups 4-5 was between 3-8 days, whereas groups 1-3 showed no clinical symptoms 15 days after challenge.
TABLE-US-00005 TABLE 4 Results - Strep culture at necropsy Onset of clinical signs/necropsy Nasal Tonsil Serosal Joint Pig day wash swab BALF swab fluid CSF Serum 1 NCS/15 ? ? 2 NCS/15 ? ? 3 NCS/15 ? ? 4 NCS/15 ? ? 5 NCS/15 ? ? 6 NCS/15 ? ? 7 NCS/15 ? ? 8 NCS/15 ? ? 9 NCS/15 ? ? 10 NCS/15 ? ? 11 NCS/15 ? ? 12 NCS/15 ? ? 13 NCS/15 ? ? 14 NCS/15 ? ? 15 NCS/15 ? ? 16 6/6 + ? 27 tntc tntc 17 NCS/15 ? ? 18 3/3 ? ? 300 Tntc 1 19 6/6 tntc ? 2 tntc tntc 20 6/6 100 ? tntc 990 5/6 100 ? 1 tntc Tntc tntc 148 991 4/4 ? ? Tntc tntc 992 8/8 ? ? 2 Tntc tntc 17 993 3/3 ? ? 10 tntc 95 994 NCS/15 ? ? 995 8/8 ? ? 10 Tntc tntc tntc 996 5/5 ? ? Tntc 20 997 6/6 ? ? tntc 72 CS = no clinical signs ? = too many contaminating bacteria to see whether or not Strep colonies were present, plan to do PCR. + = Strep present but difficult to estimate numbers with other bacteria present.
REFERENCES
[0228] Development of an in vivo Himar1 transposon mutagenesis system for use in Streptococcus equi subsp. equi. May J P, Walker C A, Maskell D J, Slater J D. FEMS Microbiol Lett. 2004 Sep. 15; 238(2):401-9. [0229] Mutagenesis of Streptococcus equi and Streptococcus suis by transposon Tn917. Slater J D, Allen A G, May J P, Bolitho S, Lindsay H, Maskell D J. Vet Microbiol. 2003 May 29; 93(3):197-206. [0230] Genetic analysis of the capsular biosynthetic locus from all 90 pneumococcal serotypes. Bentley S D.sup.1, Aanensen D M, Mavroidi A, Saunders D, Rabbinowitsch E, Collins M, Donohoe K, Harris D, Murphy L, Quail M A, Samuel G, Skovsted I C, Kaltoft M S, Barrell B, Reeves P R, Parkhill J, Spratt B G. PLoS Genet. 2006 March; 2(3):e31. [0231] Gene content and diversity of the loci encoding biosynthesis of capsular polysaccharides of the 15 serovar reference strains of Haemophilus parasuis. Howell K J, Weinert L A, Luan S L, Peters S E, Chaudhuri R R, Harris D, Angen O, Aragon V, Parkhill J, Langford P R, Rycroft A N, Wren B W, Tucker A W, Maskell D J; BRaDP1T Consortium. J Bacteriol. 2013 September; 195(18):4264-73. doi: 10.1128/JB.00471-13. Epub 2013 Jul. 19. [0232] Exploitation of bacterial N-linked glycosylation to develop a novel recombinant glycoconjugate vaccine against Francisella tularensis. Cuccui J, Thomas R M, Moule M G, D'Elia R V, Laws T R, Mills D C, Williamson D, Atkins T P, Prior J L, Wren B W. Open Biol. 2013 May 22; 3(5):130002 [0233] Characterization of the structurally diverse N-linked glycans of Campylobacter species. Jervis A J, Butler J A, Lawson A J, Langdon R, Wren B W, Linton D. J Bacteriol. 2012 May; 194(9):2355-62