UROMODULIN FOR USE IN PREVENTION AND THERAPY OF PATHOLOGICAL CRYSTALLIZATION

Abstract

The invention relates to the use of a uromodulin polypeptide in prevention or therapy of vascular calcification or a disease caused by, or related to, vascular calcification, particularly vascular calcification in chronic kidney disease, in diabetes, in aging and in atherosclerosis.

Claims

1. A uromodulin polypeptide for use in prevention or therapy of vascular calcification or a disease caused by, or related to, vascular calcification, particularly vascular calcification in chronic kidney disease, in diabetes, in aging and in atherosclerosis.

2. The uromodulin polypeptide for use in prevention or therapy of vascular calcification according to claim 1, wherein the uromodulin peptide comprises or essentially consists of the polypeptide sequence of SEQ ID NO 001.

3. The uromodulin polypeptide for use in prevention or therapy of vascular calcification according to claim 1, wherein the uromodulin peptide a. comprises or essentially consists of an amino acid sequence characterized by more than () 85% identity, particularly 90% identity, even more particularly 92%, 94%, 95%, 96, 97%, 98%, or 99% identity to the polypeptide sequence of SEQ ID NO 001, and b. is characterized by at least 85% biological activity of the uromodulin polypeptide of SEQ ID NO 001.

4. The uromodulin polypeptide for use in prevention or therapy of vascular calcification according to any one of claims 1 to 3, wherein the disease is characterized by a peripheral uromodulin level below 125 ng/ml, particularly below 110 ng/ml, even more particularly below 100 ng/ml, 80 ng/ml or 60 ng/ml.

5. A uromodulin polypeptide for use in prevention or therapy of vascular inflammation, particularly wherein the vascular inflammation is associated with vascular calcification.

6. The uromodulin polypeptide for use in prevention or therapy of vascular inflammation according to claim 5, wherein the uromodulin peptide comprises or essentially consists of the polypeptide sequence of SEQ ID NO 001.

7. The uromodulin polypeptide for use in prevention or therapy of vascular inflammation according to claim 5, wherein the uromodulin peptide a. comprises or essentially consists of an amino acid sequence characterized by more than () 85% identity, particularly 90% identity, even more particularly 92%, 94%, 95%, 96, 97%, 98%, or 99% identity to the polypeptide sequence of SEQ ID NO 001, and b. is characterized by at least 85% biological activity of the uromodulin polypeptide of SEQ ID NO 001.

8. The uromodulin polypeptide for use in prevention or therapy of vascular calcification according to any one of claims 5 to 7, wherein the disease is characterized by a peripheral uromodulin level below 125 ng/ml, particularly below 110 ng/ml, even more particularly below 100 ng/ml, 80 ng/ml or 60 ng/ml.

9. The uromodulin polypeptide for use in prevention or therapy of vascular calcification according to any one of the preceding claims, wherein the uromodulin peptide is a recombinant peptide.

10. A method for treatment of vascular calcification or a condition related to, or caused by, vascular calcification or vascular inflammation, in a patient, comprising administering to the patient an effective dose of a uromodulin polypeptide, wherein the uromodulin peptide comprises or essentially consists of the polypeptide sequence of SEQ ID NO 001, or wherein the uromodulin peptide a. comprises or essentially consists of an amino acid sequence characterized by more than () 85% identity, particularly 90% identity, even more particularly 92%, 94%, 95%, 96, 97%, 98%, or 99% identity to the polypeptide sequence of SEQ ID NO 001, and b. is characterized by at least 85% biological activity of the uromodulin polypeptide of SEQ ID NO 001.

11. A pharmaceutical composition comprising a uromodulin polypeptide as specified in any one of claims 1 to 9, for use in prevention or therapy of vascular calcification and/or vascular inflammation.

12. A method for making a pharmaceutical for use in prevention or therapy of vascular calcification and/or vascular inflammation, the method comprising the use of a uromodulin polypeptide as specified in any one of claims 1 to 9.

13. A nucleic acid expression system comprising a nucleic acid sequence, wherein said nucleic acid sequence encodes a polypeptide comprising an amino acid sequence characterized by more than () 85% identity, particularly 90% identity, even more particularly 92%, 94%, 95%, 96, 97%, 98%, or 99% identity to the polypeptide sequence of SEQ ID NO 001, wherein said polypeptide is characterized by at least 85% biological activity of the uromodulin polypeptide of SEQ ID NO 001, for use in prevention or therapy of vascular calcification and/or vascular inflammation.

14. The nucleic acid expression system according to claim 13, wherein said nucleic acid sequence is under control of a promoter operable in a human cell, for use in prevention or therapy of vascular calcification and/or vascular inflammation.

15. The nucleic acid expression system according to claim 13 or 14, wherein said nucleic acid system is a virus, particularly a virus selected from adenovirus, adeno-associated virus, and herpesvirus, for use in prevention or therapy of vascular calcification and/or vascular inflammation.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0044] FIG. 1 A. Representative original images showing Alizarin red staining in HAoSMCs following treatment for 11 days with control or with calcification medium (Calc., 10 mM -glycerophosphate+1.5 mM CaCl.sub.2) without or with additional treatment with 100 ng/ml native human uromodulin (URO) or 100 ng/ml serum albumin (SA). Images are representative for six independent experiments. The calcified areas are shown as red staining. B. Scatter dot plots and arithmetic meansSEM (n=4, g/mg protein) of calcium content in HAoSMCs following treatment for 11 days with control or with calcification medium (Calc., 10 mM -glycerophosphate+1.5 mM CaCl.sub.2)) without or with additional treatment with 100 ng/ml native human uromodulin (URO) or 100 ng/ml serum albumin (SA). C. Scatter dot plots and arithmetic meansSEM (n=4, U/mg protein) of alkaline phosphatase activity in HAoSMCs following treatment for 7 days with control or with 2 mM -glycerophosphate (Pi) without or with additional treatment with 100 ng/ml native human uromodulin (URO) or 100 ng/ml serum albumin (SA). D,E. Scatter dot plots and arithmetic meansSEM (n=8; arbitrary units, a.u.) of CBFA1 (D) and ALPL (E) relative mRNA expression in HAoSMCs following treatment for 24 hours with control or with 2 mM -glycerophosphate (Pi) without or with additional treatment with indicated concentrations of native human uromodulin (URO, 0-100 ng/ml) or 100 ng/ml serum albumin (SA). *(p<0.05), **(p<0.01), ***(p<0.001) statistically significant vs. control treated HAoSMCs; (p<0.05), (p<0.001) statistically significant vs. HAoSMCs treated with Calc./Pi alone.

[0045] FIG. 2 A,B. Scatter dot plots and arithmetic meansSEM (n=8; arbitrary units, a.u.) of CBFA1 (A) and ALPL (B) relative mRNA expression in HAoSMCs following treatment for 24 hours with control or with 2 mM -glycerophosphate (Pi) without or with additional treatment with 100 ng/ml native human uromodulin (URO) and with mouse monoclonal antibody against human uromodulin (mAb) or negative control mouse IgG (IgG). *(p<0.05), **(p<0.01), ***(p<0.001) statistically significant vs. IgG treated HAoSMCs; (p<0.05), (p<0.001) statistically significant vs. HAoSMCs treated with IgG and Pi; (p<0.01), (p<0.001) statistically significant between HAoSMCs treated with Pi+URO+IgG and Pi+URO+mAb. C,D. Scatter dot plots and arithmetic meansSEM (n=4; a.u.) of CBFA1 (C) and ALPL (D) relative mRNA expression in HAoSMCs following treatment for 24 hours with control or with 2 mM -glycerophosphate (Pi) without or with additional treatment with 100 ng/ml recombinant human uromodulin (rhURO). **(p<0.01), ***(p<0.001) statistically significant vs. control treated HAoSMCs; (p<0.01) statistically significant vs. HAoSMCs treated with Pi alone.

[0046] FIG. 3 A,B. Scatter dot plots and arithmetic meansSEM (n=6; arbitrary units, a.u.) of CBFA1 (A) and ALPL (B) relative mRNA expression in HAoSMCs following treatment for 24 hours with 15% normal serum (NS) or uremic serum (US) without or with additional treatment with 100 ng/ml native human uromodulin (URO). *(p<0.05), ***(p<0.001) statistically significant vs. NS treated HAoSMCs; (p<0.05), (p<0.001) statistically significant vs. respective serum treated HAoSMCs.

[0047] FIG. 4 A. Representative original Western blots (n=4) of uromodulin, IL-1 and TNF protein expression in total serum (Input) and in uromodulin or negative control IgG immunoprecipitated samples of human serum collected from hemodialysis patients before dialysis (CKD) and from healthy volunteers (CTR). B,C. Scatter dot plots and arithmetic meansSEM (arbitrary units, a.u.) of NF-kB-dependent transcriptional activity measured by luciferase reporter assay in HAoSMCs following transfection for 48 hours with NF-kB-responsive luciferase/Renilla constructs and treatment for 30 min with 10 ng/ml IL-113 (B, n=6) or with 10 ng/ml TNF (C, n=8) and without or with additional treatment with indicated concentrations of native human uromodulin (URO, 0-100 ng/ml) or 100 ng/ml serum albumin (SA). *(p<0.05), **(p<0.01) statistically significant vs. control treated HAoSMCs; (p<0.05) statistically significant vs. HAoSMCs treated with IL-11/TNF alone. D. Scatter dot plots and arithmetic meansSEM (n=4; a.u.) of NF-kB-dependent transcriptional activity measured by luciferase reporter assay in HAoSMCs following transfection for 48 hours with NF-kB-responsive luciferase/Renilla constructs and treatment for 24 hours with control or with 2 mM 3-glycerophosphate (Pi) without or with additional treatment with 100 ng/ml native human uromodulin (URO) or 100 ng/ml serum albumin (SA). **(p<0.01), ***(p<0.001) statistically significant vs. control treated HAoSMCs; (p<0.00) statistically significant vs. HAoSMCs treated with Pi alone. E. Representative confocal microscopy images (n=3) showing NF-kB p65 protein expression and localization in HAoSMCs following treatment for 24 hours with control or with 2 mM -glycerophosphate (Pi) without or with additional treatment with 100 ng/ml native human uromodulin (URO) or 100 ng/ml serum albumin (SA). NF-kB p65 expression: green labeling, nuclei: purple labeling. Scale bar: 25 m.

[0048] FIG. 5 A. Scatter dot plots and arithmetic meansSEM (n=4, U/mg protein) of alkaline phosphatase activity in HAoSMCs following treatment for 7 days with control or with 5 g/ml hydroxyapatite (HAp) without or with additional treatment with 100 ng/ml native human uromodulin (URO) or 100 ng/ml serum albumin (SA). B,C. Scatter dot plots and arithmetic meansSEM (n=6; arbitrary units, a.u.) of CBFA1 (B) and ALPL (C) relative mRNA expression in HAoSMCs following treatment for 24 hours with control or with 5 g/ml hydroxyapatite (HAp) without or with additional treatment with 100 ng/ml native human uromodulin (URO) or 100 ng/ml serum albumin (SA). *(p<0.05), **(p<0.01), ***(p<0.001) statistically significant vs. control treated HAoSMCs; (p<0.05), (p<0.01), (p<0.001) statistically significant vs. HAoSMCs treated with HAp alone. D. Scatter dot plots and arithmetic meansSEM (n=5; mg/dl) of calcium levels in the precipitated pellet following calcium phosphate precipitation in the presence of the indicated concentrations of native human uromodulin (URO, 0-100 ng/ml) or 100 ng/ml serum albumin (SA). E. Scatter dot plots and arithmetic meansSEM (n=5; mg/dl) of calcium levels in the pellet and supernatant, respectively, following hydroxyapatite nanoparticle dissociation in the presence of the indicated concentrations of native human uromodulin (URO, 0-100 ng/ml) or 100 ng/ml serum albumin (SA).

[0049] FIG. 6 A. Scatter dot plots and arithmetic meansSEM (n=5; arbitrary units, a.u.) of Umod relative mRNA expression in MOVAS cells following transfection for 48 hours with empty vector (V) or with a construct encoding mouse uromodulin (Uro). B. Scatter dot plots and arithmetic meansSEM (n=4, g/mg protein) of calcium content in HAoSMCs following transfection for 11 days with empty vector (V) or with a construct encoding mouse uromodulin (Uro) and treatment with control or with calcification medium (Calc., 10 mM -glycerophosphate+1.5 mM CaCl.sub.2)). C. Scatter dot plots and arithmetic meansSEM (n=4, U/mg protein) of alkaline phosphatase activity in HAoSMCs following transfection for 7 days with empty vector (V) or with a construct encoding mouse uromodulin (Uro) and treatment with control or with 2 mM 3-glycerophosphate (Pi). D,E. Scatter dot plots and arithmetic meansSEM (n=5; a.u.) of Cbfa1 (D) and Alpl (E) relative mRNA expression in MOVAS cells following transfection for 48 hours with empty vector (V) or with a construct encoding mouse uromodulin (Uro) and treatment for 24 hours with control or with 2 mM 3-glycerophosphate (Pi). *(p<0.05), **(p<0.01), ***(p<0.001) statistically significant vs. V transfected MOVAS cells; (p<0.05), (p<0.01), (p<0.001) statistically significant vs. V transfected and Calc./Pi treated MOVAS cells.

[0050] FIG. 7 Scatter dot plots and arithmetic meansSEM (n=6; arbitrary units, a.u.) of Cbfa1 (A) and Alpl (B) relative mRNA expression in MOVAS cells following treatment for 24 hours with control or with 2 mM -glycerophosphate (Pi) without or with additional treatment with 100 ng/ml recombinant mouse uromodulin (rmUro). *(p<0.05), ***(p<0.001) statistically significant vs. control treated MOVAS cells; (p<0.05), (p<0.001) statistically significant vs. MOVAS cells treated with Calc./Pi alone.

[0051] FIG. 8 A. Scatter dot plots and arithmetic meansSEM (n=5; g/mg protein) of calcium content in the aortic arch from mice treated with AAV8-GFP as control (CTR) or with AAV8-mouse uromodulin (Uro) and additional treatment with high-dosed cholecalciferol (vD). B,C. Scatter dot plots and arithmetic meansSEM (n=5, arbitrary units, a.u.) of Cbfa1 (B) and Alpl (C) relative mRNA expression in aortic tissue from mice treated with AAV8-GFP as control (CTR) or with AAV8-mouse uromodulin (Uro) and additional treatment with high-dosed cholecalciferol (vD). *(p<0.05), **(p<0.01) statistically significant vs. CTR+vD treated mice.

[0052] FIG. 9 A Scatter dot plot of correlation between serum uromodulin concentrations (ng/ml) and serum calcification propensity measured as calciprotein particle maturation time (T50, min) in human patients with CKD (n=138). P values are indicated in the figure.

MATERIALS AND METHODS

Cell Culture of Primary Human Aortic Smooth Muscle Cells

[0053] Primary human aortic smooth muscle cells (HAoSMCs) commercially obtained from Thermo Fisher Scientific were cultured in Waymouth's MB 752/1 medium and Ham's F-12 nutrient mixture (1:1 ratio, Thermo Fisher Scientific) supplemented with 10% FBS (Thermo Fisher Scientific), 100 U/ml penicillin and 100 g/ml streptomycin (Thermo Fisher Scientific). The cells were grown to confluence and used in all experiments from passages 4 to 11. At confluence, HAoSMCs were detached using Trypsin/EDTA solution (Thermo Fisher Scientific) and cultured into 6-well plates or 4-well chamber slides (BD Biostatus) for 24 hours prior to treatment. HAoSMCs were treated for the indicated time with 2 mM -glycerophosphate (Sigma Aldrich), 5 g/ml hydroxyapatite nanoparticles (Sigma-Aldrich), 0-100 ng/ml native human uromodulin (BBI solutions), 100 ng/ml recombinant human uromodulin (Origene), 100 ng/ml bovine serum albumin (Sigma Aldrich), 1:5000 dilution of mouse monoclonal antibody anti-human uromodulin (Euroimmun) or mouse IgG as control (Santa Cruz Biotechnology), 10 ng/ml human TNF (stock in PBS, R&D Systems) and 10 ng/ml human IL-1 (stock in PBS/0.1% BSA, R&D Systems). Equal amounts of vehicle were used as control. HAoSMCs were serum starved for 24 hours prior to treatment for 24 hours with 15% uremic serum from hemodialysis patients (uremic serum, US) or control serum from matched healthy individuals (normal serum, NS). Treatment for 11 days with 10 mM -glycerophosphate and 1.5 mM CaCl.sub.2 (Sigma-Aldrich) were used as calcification media for the calcium deposition quantification and for Alizarin Red staining. Fresh media with agents were added every 2-3 days.

Cell Culture of MOVAS Cells

[0054] MOVAS cells, a mouse aortic smooth muscle cell line, commercially obtained from ATCC were cultured in DMEM high glucose medium (Thermo Fisher Scientific) supplemented with 10% FBS (Thermo Fisher Scientific) and 0.2 mg/ml G-418 (Thermo Fisher Scientific). At confluence, MOVAS cells were detached using Trypsin/EDTA solution (Thermo Fisher Scientific) and cultured into 6-well plates for 24 hours prior to treatment. MOVAS cells were transfected with 2 g DNA encoding mouse uromodulin in pCMV6Kan/Neo vector (Origene) or empty vector as control (Origene) using X-tremeGENE HP DNA transfection reagent (Roche Applied Science) according to the manufacturer's protocol. Transfection efficiency was determined by quantitative RT-PCR. MOVAS cells were treated for the indicated time with 2 mM -glycerophosphate (Sigma Aldrich), 100 ng/ml recombinant mouse uromodulin (Creative BioMart) or 100 ng/ml bovine serum albumin (Sigma Aldrich). Treatment for 11 days with 10 mM -glycerophosphate and 1.5 mM CaCl.sub.2 (Sigma-Aldrich) were used as calcification media for the calcium deposition quantification. Fresh media with agents were added every 2-3 days.

Animal Experiments

[0055] All animal experiments were conducted according to the recommendations of the Guide for Care and Use of Laboratory Animals of the National Institutes of Health as well as the German law for the welfare of animals and were approved by local authorities. Generation of AAV8 pseudotyped vectors containing mouse uromodulin or a GFP control was performed using standard procedures. AAVs (10.sup.12 vg/mouse) were injected intravenously into C57BL/6 mice. The mice were subsequently injected with vehicle or 400000 IU/kg BW of cholecalciferol (Sigma-Aldrich) subcutaneously for three days. After six days, blood was collected by retroorbital puncture. Mice were sacrificed by cervical dislocation under inhalative isoflurane anaesthesia and aortic tissues were rapidly collected and snap-frozen. Plasma concentrations of phosphate and calcium were measured by QuantiChrom Phosphate assay kit and QuantiChrom Calcium assay kit, respectively (BioAssay Systems).

Calcification Analysis

[0056] The quantification of aortic arch calcification was performed by incubation of the tissues overnight at 37 C. in 0.6 M HCl. Cells were decalcified for 24 hours at 4 C. in 0.6 M HCl. Calcium content was determined by using QuantiChrom Calcium assay kit (BioAssay Systems) according to the manufacturer's protocol. Tissues or cells were lysed with 0.1 M NaOH/0.1% SDS and total protein concentration was measured by the Bradford assay (Bio-Rad Laboratories). The calcium content was normalized to total protein concentration. To visualize calcium deposition, HAoSMCs were fixed with 4% paraformaldehyde and stained with 2% Alizarin Red (pH 4.5). The calcified areas are shown as red staining.

Alkaline Phosphatase (ALPL) Activity Assay

[0057] ALPL activity in the whole cell extract was determined using the ALPL colorimetric assay kit (Abcam) according to the manufacturer's protocol. ALPL activity was normalized to total protein concentration as measured by the Bradford assay (Bio-Rad Laboratories).

Luciferase Assay

[0058] HAoSMCs were transfected for 48 hours with 1 g DNA mixture of NF-kB-responsive luciferase construct and a constitutively expressing Renilla construct (40:1 ratio, Qiagen) as control for transfection efficiency using X-tremeGENE HP DNA transfection reagent (Roche Applied Science) according to the manufacturer's protocol. After the incubation period, HAoSMCs were lysed with Passive Lysis Buffer (Promega) and assayed for transcriptional activity using Dual-Luciferase Reporter Assay (Promega) and a luminometer (Victor 2 plate reader, Perkin Elmer) according to the manufacturer's protocol. Results are expressed as the ratio of NF-kB Firefly-Luciferase to Renilla-Luciferase (relative light units) normalized to control treated HAoSMCs.

Quantitative RT-PCR

[0059] Total RNA was isolated from murine aortic tissues, HAoSMCs or MOVAS cells by using Trifast Reagent (Peqlab) according to the manufacturer's instructions. Reverse transcription of 2 g RNA was performed using oligo(dT).sub.12-18 primers (Thermo Fisher Scientific) and SuperScript III Reverse Transcriptase (Thermo Fisher Scientific). Quantitative RT-PCR was performed with the iCycler iQ Real-Time PCR Detection System (Bio-Rad Laboratories) and iQ Sybr Green Supermix (Bio-Rad Laboratories) according to the manufacturer's instructions. The following human primers were used (Thermo Fisher Scientific, 5-3 orientation):

TABLE-US-00002 (SEQIDNO002) ALPLfw: GGGACTGGTACTCAGACAACG; (SEQIDNO003) ALPLrev: GTAGGCGATGTCCTTACAGCC; (SEQIDNO004) CBFA1fw: GCCTTCCACTCTCAGTAAGAAGA; (SEQIDNO005) CBFA1rev: GCCTGGGGTCTGAAAAAGGG; (SEQIDNO006) GAPDHfw: GAGTCAACGGATTTGGTCGT; (SEQIDNO007) GAPDHrev: GACAAGCTTCCCGTTCTCAG.

[0060] The following mouse primers were used (Thermo Fisher Scientific, 5-3 orientation):

TABLE-US-00003 (SEQIDNO008) AlpIfw: TTGTGCCAGAGAAAGAGAGAGA; (SEQIDNO009) AlpIrev: GTTTCAGGGCATTTTTCAAGGT; (SEQIDNO010) Cbfa1fw: AGAGTCAGATTACAGATCCCAGG; (SEQIDNO011) Cbfa1rev: AGGAGGGGTAAGACTGGTCATA; (SEQIDNO012) Gapdhfw: AGGTCGGTGTGAACGGATTTG; (SEQIDNO013) Gapdhrev: TGTAGACCATGTAGTTGAGGTCA; (SEQIDNO014) Umodfw: GGCACCCATGTGGCTCAAT; (SEQIDNO015) Umodrev: GGGCGCTGTCAAGTTGTAAAT.

[0061] The specificity of the PCR products was confirmed by analysis of the melting curves. All PCRs were performed in duplicate and relative mRNA fold changes were calculated by the 2.sup.ct method using GAPDH as internal reference. For animal experiments, relative mRNA fold changes were calculated to a control mouse receiving vehicle only.

Immunostaining and Confocal Microscopy

[0062] HAoSMCs cultured onto four-well chamber slides (BD Biostatus) were fixed with ice-cold 100% methanol for 10 min at room temperature. To reduce non-specific background staining, slides were incubated with 5% normal goat serum in PBS/0.1% Triton-X100 for 1 hour at room temperature. Cells were incubated overnight at 4 C. with primary rabbit polyclonal anti-NF-kB p65 antibody (diluted 1:50, Santa Cruz Biotechnology) and then with goat anti-rabbit Alexa488-conjugated antibody (diluted 1:1000, Thermo Fisher Scientific) for 1 hour at room temperature. Nuclei were stained using DRAQ5 dye (diluted 1:1000, Biostatus) for 10 min at room temperature. The slides were mounted with Prolong Gold antifade reagent (Thermo Fisher Scientific). Images were collected with a confocal imaging system (A1Rsi+, Nikon Instruments) using a 60 (Oil), 1.4NA objective. Confocal images are representative for three independent experiments. Negative controls were carried out simultaneously with all experiments by omitting incubation with primary antibody.

Immunoprecipitation and Western Blot Analysis

[0063] Immunoprecipitation of uromodulin from human serum was performed by using Pierce Direct IP kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Coupling of 6 l mouse monoclonal anti-human uromodulin antibody (Euroimmun) or mouse IgG as control (Santa Cruz Biotechnology) to the AminoLink Plus coupling resin (Thermo Fisher Scientific) was performed for 2 hours at RT. Human serum (2 mg proteins) from hemodialysis patients before dialysis (CKD) and from healthy volunteers (CTR) was incubated with the immobilized antibody/control to form the immune complex overnight at 4 C. on a rotator. Then, immune complexes were washed to remove non-bound proteins and low pH elution buffer was used to dissociate the bound antigen from the antibody. The eluted proteins or equal amounts of total proteins from human serum were boiled in Roti-Load1 Buffer (Carl Roth GmbH) by heating for 5 minutes at 100 C. Proteins were separated on SDS-polyacrylamide gels and transferred to PVDF membranes. The membranes were incubated overnight at 4 C. with primary antibodies: mouse anti-human uromodulin antibody (diluted 1:1000, Euroimmun), mouse anti-IL-1 antibody (diluted 1:1000, Cell Signaling) or rabbit anti-TNF antibody (diluted 1:1000, Cell Signaling) and then with secondary anti-mouse HRP-conjugated antibody (diluted 1:2000, Santa Cruz Biotechnology) or anti-rabbit HRP-conjugated antibody (diluted 1:1000, Cell Signaling) for 1 hour at room temperature. The membranes were stripped in stripping buffer (Thermo Fisher Scientific) at room temperature for 10 min. Antibody binding was detected with ECL detection reagent (Thermo Fisher Scientific).

Calcium Phosphate Precipitation Assay

[0064] Calcium phosphate mineral phase formation assay was performed using a homogeneous system containing 10 mM CaCl.sub.2 (Sigma-Aldrich) and 10 mM sodium phosphate buffer (pH7.4, Sigma Aldrich) in 500 mM HEPES buffer (pH7.4, Sigma Aldrich) in the presence of the indicated concentrations of native human uromodulin. After incubation for 10 minutes at room temperature, the samples were centrifuged at 1890 g for 30 seconds and the obtained pellet was dissolved in 150 mM HCl. Calcium levels were determined colorimetric by using QuantiChrom Calcium assay kit (BioAssay Systems) according to the manufacturer's protocol.

Hydroxyapatite Dissociation Assay

[0065] Hydroxyapatite dissociation assay was performed using a homogeneous system containing 2 mM hydroxyapatite nanoparticles (<200 nm particle size, Sigma Aldrich) in 500 mM HEPES buffer (pH7.4, Sigma Aldrich) in the presence of the indicated concentrations native human uromodulin. After overnight incubation at 37 C. on a shaker (100 rpm), the samples were centrifuged at 1890 g for 30 seconds and the obtained pellet was dissolved in 150 mM HCl. The calcium levels in the supernatant and the pellet, respectively, were determined colorimetric by using QuantiChrom Calcium assay kit (BioAssay Systems) according to the manufacturer's protocol.

Human Samples

[0066] All patients and volunteers gave informed consent. Blood was collected from patients of various stages of CKD to obtain serum. Healthy volunteers served as controls. Uromodulin levels were measured by ELISA (Euroimmun). Serum calcification propensity was analysed by determining the one-half maximal transition time (T.sub.50) of in-vitro transformation from primary to secondary calciprotein particles by using a Nephelostar Plus nephelometer (BMG Labtech, Ortenberg, Germany). Where indicated, uromodulin was added to the serum samples.

Statistics

[0067] Data are shown as scatter dot plots and arithmetic meanSEM. Normality was tested with Shapiro-Wilk test. Non-normal datasets were transformed (log, reciprocal or sqrt) prior to statistical testing to provide normality according to Shapiro-Wilk test. Statistical testing was performed by one-way Anova followed by Tukey-test for homoscedastic data or Games-Howell test for heteroscedastic data. Non-normal data were tested by the Steel-Dwass method. The Steel test and Dunett test, according to normality distribution, were used for the experiments of TNF and IL-1 treatment. Two groups were compared by unpaired two-tailed t-test. For correlation analysis, Spearman correlation test was performed. P<0.05 was considered statistically significant.

EXAMPLES

Example 1: Uromodulin Supplementation is Able to Abolish Vascular Calcification

[0068] Uromodulin supplementation is able to prevent the osteoinductive properties of phosphate. Treatment even with low concentrations of uromodulin is able to inhibit osteogenic transformation of primary human aortic smooth muscle cells in-vitro (FIG. 1; FIG. 2). The osteoblastic transformation is evaluated as the relative increase of core-binding factor alpha 1 (CBFA1) and tissue non-specific alkaline phosphatase (ALPL) expression as well as of ALPL activity. This powerful effect cannot be replicated by treatment with serum albumin as control (FIG. 1). Moreover, this effect can be suppressed by an anti-uromodulin blocking antibody (FIG. 2). Therefore, uromodulin exerts powerful effects to prevent osteoinductive transformation of vascular smooth muscle cells.

[0069] Most importantly, uromodulin is able to prevent vascular calcification. Treatment with uromodulin completely prevents the calcification of the primary human aortic smooth muscle cells induced by calcification medium (FIG. 1). These experiments reflect the calcification processes in vascular tissue. Therefore, uromodulin treatment is a potent antagonist of vascular calcification.

[0070] Uromodulin treatment is also able to inhibit primary human aortic smooth muscle cells osteogenic transformation induced during uremic conditions (FIG. 3). Thus, uromodulin may reduce the progression of vascular calcification triggered by complex conditions such as chronic kidney disease.

[0071] Uromodulin treatment is also able to inhibit primary human aortic smooth muscle cells osteogenic transformation induced by pre-formed hydroxyapatite crystals (FIG. 5). Therefore, uromodulin inhibits vascular calcification not by simple inhibition of calcium and phosphate precipitation, but by an active effect on vascular smooth muscle cells.

Example 2: Uromodulin Supplementation is Able to Inhibit Vascular Inflammation

[0072] Uromodulin acts on vascular smooth muscle cells to inhibit vascular inflammation. Treatment with uromodulin inhibits activation of the nuclear factor kappa-light-chain-enhancer of activated B cells induced by pro-calcific environment (FIG. 4). This effect is specific to uromodulin and cannot be replicated by serum albumin as control. Therefore, uromodulin may be used to prevent vascular inflammation.

[0073] Uromodulin is able to counter the effects of inflammatory cytokines. Uromodulin presumably inactivates the effects of the pro-inflammatory cytokines tumor necrosis factor alpha (TNF) and Interleukin 1 beta (IL-1) (FIG. 4). Therefore, uromodulin can be used as an inhibitor of inflammation.

[0074] Serum uromodulin is able to interact with endogenous inflammatory cytokines TNF and IL-1 in the serum from human patients, as shown by detection of these cytokines in uromodulin immunoprecipitated serum samples (FIG. 4).

[0075] One particular use where the treatment according to the invention is of benefit is the amelioration of inflammatory processes triggered by or associated with TNF or IL-1.

Example 3: Uromodulin Overexpression is Able to Reduce Vascular Calcification In-Vivo

[0076] Uromodulin overexpression is able to reduce aortic calcification and aortic osteogenic markers expression following high-dosed cholecalciferol treatment in mice (FIG. 8). Uromodulin overexpression shows anti-calcific effects in the vascular tissues without significantly affecting plasma calcium or phosphorus concentrations in the cholecalciferol treated mice (Table 1).

TABLE-US-00004 TABLE 1 Arithmetic means SEM of plasma calcium and phosphate in mice treated with AAV8-GFP as control (CTR) or with AAV8- mouse uromodulin (Uro) and additional treatment with high-dosed cholecalciferol (vD). CTR vD Uro vD Calcium [mg/dl] 18.51 0.19 18.08 0.54 n = 5 Phosphate [mg/dl] 5.92 0.11 5.89 0.16 n = 5

[0077] These results were also confirmed in mouse smooth muscle cells in vitro. Uromodulin overexpression is able to prevent phosphate-induced calcification and osteoinductive signaling in MOVAS mouse aortic smooth muscle cells (FIG. 6). Similarly, uromodulin supplementation is able to prevent the osteoinductive properties of phosphate in MOVAS cells (FIG. 7).

Example 4: Serum Uromodulin Levels are Inversely Correlated with Serum Calcification Propensity in Chronic Kidney Disease Patients

[0078] Serum uromodulin levels are inversely correlated with serum calcification propensity, a marker for increased risk for vascular calcification, in a chronic kidney disease patient cohort with various stages of renal disease (FIG. 9). Addition of exogenous uromodulin is not able to significantly modify the serum calcification propensity in controls or dialysis patients (Table 2), suggesting that uromodulin has no ex-vivo effects on overall propensity for calcification in serum but acts indirectly via other mechanisms.

TABLE-US-00005 TABLE 2 Arithmetic means SEM of serum calcification propensity measured as calciprotein particle maturation time (T.sub.50) in the absence or presence of 100 ng/ml native human uromodulin (URO) in human hemodialysis patients before dialysis and in healthy volunteers. T.sub.50 [min] T.sub.50 [min] (URO) CTR 191.50 9.74 212.62 22.08 n = 13 CKD 105.76 16.32** 122.46 17.59* n = 13 *(p < 0.05), **(p < 0.01) statistically significant vs. control patients.

[0079] The inventors, thus, have substantiated the utility of uromodulin supplementation for the treatment and prevention of vascular calcification and its sequelae.

[0080] Similarly, the data presented herein substantiate the utility of uromodulin supplementation by any route to prevent inflammation, vascular calcification and its sequelae, cardiac dysfunction and hypertrophy, renal inflammation and decline of renal function as well as treatment of general inflammation.

[0081] The treatment with uromodulin is ideal for the use in human patients. Uromodulin is an endogenous protein produced in the human body. Under diseased state, especially chronic kidney disease, the body does not produce enough uromodulin. Therefore, uromodulin deficiency seems to be a cause for the progression of vascular calcification. Supplementation with uromodulin reduces vascular calcification. As it is an endogenous protein, supplementation should not be associated with any adverse effects.