AAV-Mediated Direct In vivo CRISPR Screen in Glioblastoma
20200010903 ยท 2020-01-09
Inventors
- Sidi Chen (Milford, CT, US)
- Ryan Chow (San Jose, CA, US)
- Christopher D. Guzman (Sandown, NH, US)
- Randall J. Platt (Basel, CH)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N2320/12
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N2750/14131
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12Q2600/106
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
A01K2267/0393
HUMAN NECESSITIES
A01K2217/072
HUMAN NECESSITIES
International classification
C12N9/22
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
Abstract
The present invention includes novel compositions and methods for identifying driver mutations in glioblastoma. In one aspect, the invention includes an AAV-CRISPR library for identifying driver mutations in, and thus treatments for glioblastoma.
Claims
1. A method of determining treatment for a subject suffering from glioblastoma, the method comprising: contacting a plurality of Adeno-Associated Virus- Clustered Regularly Interspaced Short Palidromic Repeats (AAV-CRISPR) vectors with a sample from the subject, wherein the vectors comprise Cas9 and a plurality of nucleotide sequences homologous to a plurality of tumor suppressor genes (TSGs), thus generating a reaction mixture; sequencing a plurality of nucleic acids isolated from the reaction mixture; and analyzing the data from the sequencing as to identify any mutation in the plurality of nucleic acids, whereby treatment for the subject suffering from glioblastoma is determined based on presence and/or nature of any mutation in the plurality of nucleic acids.
2. A method of determining at least one glioblastoma driver mutation in a sample, the method comprising: contacting a plurality of AAV-CRISPR vectors with the sample, wherein the vectors comprise Cas9 and a plurality of nucleotide sequences homologous to a plurality of tumor suppressor genes (TSGs), thus generating a reaction mixture; sequencing a plurality of nucleic acids isolated from the reaction mixture; and analyzing the sequencing data as to identify any glioblastoma driver mutation therein.
3. The method of claim 1, wherein the plurality of nucleotide sequences homologous to a plurality of TSGs comprises at least one selected from the group consisting of SEQ ID NOs. 1-280.
4. The method of claim 1, wherein the plurality of nucleotide sequences homologous to a plurality of TSGs comprises SEQ ID NOs. 1-280.
5. The method of claim 1, wherein the sequencing comprises targeted capture sequencing.
6. The method of claim 1, wherein the mutation comprises a nucleotide insertion.
7. The method of claim 6, wherein the insertion comprises more than one nucleotide base.
8. The method of claim 1, wherein the mutation comprises a nucleotide deletion.
9. The method of claim 8, wherein the deletion comprises more than one nucleotide base.
10. The method of claim 1, wherein the sample comprises a plurality of glioma cells from the subject.
11. The method of claim 1, wherein the sample comprises a tumor from the subject.
12. The method of claim 1, further comprising monitoring cell proliferation in the reaction mixture.
13. An AAV-CRISPR library comprising a plurality of AAV vectors comprising Cas9 and a plurality of nucleic acids homologous to a plurality of Tumor Suppressor Gene (TSGs).
14. The AAV-CRISPR library of claim 13, wherein the plurality of nucleic acids comprises at least one selected from the group consisting of SEQ ID NOs. 1-280.
15. The AAV-CRISPR library of claim 13, wherein the plurality of nucleic acids comprises SEQ ID NOs. 1-280.
16. A kit for determining at least one driver mutation in a glioblastoma sample comprising: an AAV-CRISPR library comprising a plurality of AAV vectors comprising Cas9 and a plurality of nucleic acids homologous to a plurality of Tumor Suppressor Gene (TSGs), reagents for measuring the at least one driver mutation, and instructional material for use thereof.
17. The kit of claim 16, wherein the plurality of nucleic acids comprises at least one selected from the group consisting of SEQ ID NOs. 1-280.
18. The kit of claim 16, wherein the plurality of nucleic acids comprises SEQ ID NOs. 1-280.
19. A method of determining at least one glioblastoma driver mutation in vivo in a glioblastoma-affected subject, the method comprising: administering into the brain of the subject a plurality of AAV-CRISPR vectors, wherein the AAV-CRISPR vectors comprise Cas9 and a plurality of short guide RNAs (sgRNAs) homologous to a plurality of tumor suppressor genes (TSGs); and sequencing a plurality of nucleic acids isolated from the subject's glioblastoma; whereby analysis of the sequencing data indicates whether any glioblastoma driver mutation is present in the subject's glioblastoma.
20. The method of claim 19, wherein the plurality of sgRNAs comprises at least one selected from the group consisting of SEQ ID NOs. 1-280.
21. The method of claim 19, wherein the plurality of sgRNAs comprises SEQ ID NOs. 1-280.
22. The method of claim 19, wherein the sequencing comprises targeted capture sequencing.
23. The method of claim 19, wherein the mutation comprises a nucleotide insertion.
24. The method of claim 23, wherein the insertion comprises more than one nucleotide base.
25. The method of claim 19, wherein the mutation comprises a nucleotide deletion.
26. The method of claim 25, wherein the deletion comprises more than one nucleotide base.
27. The method of claim 19, wherein the subject is a mammal.
28. The method of claim 27, wherein the mammal is a mouse or a human.
29. A vector comprising an adeno-associated virus (AAV) genome, a U6 promoter gene, an sgRNA sequence, a Glial Fibrillary Acidic Protein (GFAP) promoter gene, and a Cre recombinase gene.
30. The vector of claim 29, wherein the GFAP promoter gene comprises the nucleic acid sequence of SEQ ID NO: 290.
31. A vector comprising the nucleic acid sequence of SEQ ID NO: 289.
32. A kit comprising a vector comprising the nucleic acid sequence of SEQ ID NO: 289, and instructional material for use thereof
33. A kit comprising an adeno-associated virus (AAV) genome, a U6 promoter gene, an sgRNA sequence, a Glial Fibrillary Acidic Protein (GFAP) promoter gene, and a Cre recombinase gene, and instructional material for use thereof.
34. The kit of claim 33, wherein the GFAP promoter gene comprises the nucleic acid sequence of SEQ ID NO: 290.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] The following detailed description of specific embodiments of the invention will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings exemplary embodiments. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0057] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, exemplary materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used.
[0058] It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
[0059] The articles a and an are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, an element means one element or more than one element.
[0060] About as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of 20% or 10%, more preferably 5%, even more preferably 1%, and still more preferably 0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
[0061] As used herein the term amount refers to the abundance or quantity of a constituent in a mixture.
[0062] As used herein, the term bp refers to base pair.
[0063] The term complementary refers to the degree of anti-parallel alignment between two nucleic acid strands. Complete complementarity requires that each nucleotide be across from its opposite. No complementarity requires that each nucleotide is not across from its opposite. The degree of complementarity determines the stability of the sequences to be together or anneal/hybridize. Furthermore various DNA repair functions as well as regulatory functions are based on base pair complementarity.
[0064] The term CRISPR/Cas or clustered regularly interspaced short palindromic repeats or CRISPR refers to DNA loci containing short repetitions of base sequences followed by short segments of spacer DNA from previous exposures to a virus or plasmid. Bacteria and archaea have evolved adaptive immune defenses termed CRISPR/CRISPR-associated (Cas) systems that use short RNA to direct degradation of foreign nucleic acids. In bacteria, the CRISPR system provides acquired immunity against invading foreign DNA via RNA-guided DNA cleavage.
[0065] The CRISPR/Cas9 system or CRISPR/Cas9-mediated gene editing refers to a type II CRISPR/Cas system that has been modified for genome editing/engineering. It is typically comprised of a guide RNA (gRNA) and a non-specific CRISPR-associated endonuclease (Cas9). Guide RNA (gRNA) is used interchangeably herein with short guide RNA (sgRNA) or single guide RNA (sgRNA). The sgRNA is a short synthetic RNA composed of a scaffold sequence necessary for Cas9-binding and a user-defined 20 nucleotide spacer or targeting sequence which defines the genomic target to be modified. The genomic target of Cas9 can be changed by changing the targeting sequence present in the sgRNA.
[0066] Encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
[0067] The term expression as used herein is defined as the transcription and/or translation of a particular nucleotide sequence driven by its promoter.
[0068] Expression vector refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., Sendai viruses, lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
[0069] Homologous as used herein, refers to the subunit sequence identity between two polymeric molecules, e.g., between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous.
[0070] Identity as used herein refers to the subunit sequence identity between two polymeric molecules particularly between two amino acid molecules, such as, between two polypeptide molecules. When two amino acid sequences have the same residues at the same positions; e.g., if a position in each of two polypeptide molecules is occupied by an Arginine, then they are identical at that position. The identity or extent to which two amino acid sequences have the same residues at the same positions in an alignment is often expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching or identical positions; e.g., if half (e.g., five positions in a polymer ten amino acids in length) of the positions in two sequences are identical, the two sequences are 50% identical; if 90% of the positions (e.g., 9 of 10), are matched or identical, the two amino acids sequences are 90% identical.
[0071] As used herein, an instructional material includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the compositions and methods of the invention. The instructional material of the kit of the invention may, for example, be affixed to a container which contains the nucleic acid, peptide, and/or composition of the invention or be shipped together with a container which contains the nucleic acid, peptide, and/or composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.
[0072] A mutation as used herein is a change in a DNA sequence resulting in an alteration from a given reference sequence (which may be, for example, an earlier collected DNA sample from the same subject). The mutation can comprise deletion and/or insertion and/or duplication and/or substitution of at least one deoxyribonucleic acid base such as a purine (adenine and/or thymine) and/or a pyrimidine (guanine and/or cytosine). Mutations may or may not produce discernible changes in the observable characteristics (phenotype) of an organism (subject).
[0073] By nucleic acid is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).
[0074] In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. A refers to adenosine, C refers to cytosine, G refers to guanosine, T refers to thymidine, and U refers to uridine.
[0075] Unless otherwise specified, a nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).
[0076] The term oligonucleotide typically refers to short polynucleotides, generally no greater than about 60 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which U replaces T.
[0077] As used herein, the terms peptide, polypeptide, and protein are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. Polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
[0078] The term polynucleotide includes DNA, cDNA, RNA, DNA/RNA hybrid, anti-sense RNA, siRNA, miRNA, snoRNA, genomic DNA, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified to contain non-natural or derivatized, synthetic, or semisynthetic nucleotide bases. Also, included within the scope of the invention are alterations of a wild type or synthetic gene, including but not limited to deletion, insertion, substitution of one or more nucleotides, or fusion to other polynucleotide sequences.
[0079] Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5-direction.
[0080] The term promoter as used herein is defined as a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence.
[0081] A sample or biological sample as used herein means a biological material from a subject, including but is not limited to organ, tissue, exosome, blood, plasma, saliva, urine and other body fluid. A sample can be any source of material obtained from a subject.
[0082] The term subject is intended to include living organisms in which an immune response can be elicited (e.g., mammals). A subject or patient, as used therein, may be a human or non-human mammal. Non-human mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals. Preferably, the subject is human.
[0083] A target site or target sequence refers to a genomic nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule may specifically bind under conditions sufficient for binding to occur.
[0084] The term transfected or transformed or transduced as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A transfected or transformed or transduced cell is one which has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny. In certain embodiments, transfected means an exogenous nucleic acid is transferred transiently into a cell, for example a mammalian cell; while transduced means a exogenous nucleic acid is transferred permanently into a cell, often a mammalian cell, for example by viruses or viral vectors; and transformed means a exogenous nucleic acid is transferred into a cell, often bacterial or yeast cells.
[0085] To treat a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
[0086] A vector is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term vector includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, Sendai viral vectors, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.
[0087] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
Description
[0088] Direct in vivo high-throughput mutational analysis of functional cancer drivers in the mammalian brain has been difficult, due to the nature of biological complexity in vivo. it is challenging to perform high-throughput analysis of mutants in autochthonous models of cancer; that is, models in which the tumors directly evolve from normal cells at the organ site in situ in immunocompetent mice and without cellular transplantation.
[0089] As demonstrated herein, this challenge was overcome by developing a focused AAV-CRISPR library with AAV encoding functional elements and sgRNA pools targeting a top pan-cancer putative TSG set, in combination with the conditional LSL-Cas9 transgenic mice. Thus, a powerful platform was developed to perform high efficiency AAV-CRISPR mediated pooled mutagenesis for direct in vivo analysis of many genes in mice. This platform and approach of AAV-CRISPR mediated pooled mutagenesis in conjunction with targeted capture sequencing provides an efficient platform for massively parallel analysis of GBM drivers directly in vivo.
Methods
[0090] In one aspect, the invention includes a method of determining a treatment for glioblastoma in a subject. The method comprises contacting a plurality of Adeno-Associated Virus-Clustered Regularly Interspaced Short Palidromic Repeats (AAV-CRISPR) vectors with a sample from the subject. The vectors comprise Cas9 and a plurality of nucleotide sequences homologous to a plurality of tumor suppressor genes (TSGs). Nucleic acids are isolated from the sample and sequenced. The sequencing data are analyzed identifying at least one mutation which determines the treatment for glioblastoma in the subject.
[0091] The mutations claimed herein can be any combination of insertions or deletions, including but not limited to a single base insertion, a single base deletion, a frameshift, a rearrangement, and an insertion or deletion of 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, any and all numbers in between, bases. The mutation can occur in a gene or in a non-coding region. The location of the mutation can provide information as to the type of treatment needed. In a non-limiting example, if a mutation occurs in a specific gene rendering that gene non-functional, a drug that acts on that particular gene will not be considered for treatment. In a non-limiting example, if a drug is known to act on a particular gene and that gene is not mutated, that drug will be considered for treatment.
[0092] The invention also includes a method of determining at least one glioblastoma driver mutation in a subject's sample. The method comprises contacting an AAV-CRISPR library with a subject's sample, wherein the vectors comprise Cas9 and a plurality of nucleotide sequences homologous to a plurality of tumor suppressor genes (TSGs). Then nucleic acids are isolated from the sample and sequenced. The sequencing data is analyzed thus determining the at least one glioblastoma driver mutation.
[0093] In certain embodiments of the invention, the plurality of nucleotide sequences homologous to a plurality of TSGs comprises SEQ ID NOs. 1-280.
[0094] Nucleotide sequencing or sequencing, as it is commonly known in the art, can be performed by standard methods commonly known to one of ordinary skill in the art. In certain embodiments of the invention, sequencing is performed by targeted capture sequencing. Targeted captured sequencing can be performed as described herein, or by methods commonly performed by one of ordinary skill in the art. In one non-limiting example, targeted capture sequencing is performed using the target capture probes detailed herein and in
[0095] In certain embodiments of the invention, the sample is a plurality of glioma cells. In other embodiments, the sample is a tumor. In yet other embodiments, the tumor is a glioblastoma. In yet other embodiments, the sample is a non-tumor or non-cancerous cell. For example, the sample can be a non-cancerous cell or cell line that is administered an AAV-CRISPR vector and monitored for excessive proliferation. The cells are subsequently sequenced to determine the driver mutations. The driver mutations can be in TSGs or in other genes.
[0096] In one aspect, the invention includes a method of determining at least one glioblastoma driver mutation in vivo. The method comprises selecting in silico nucleotide sequences from a plurality of tumor suppressor genes (TSGs) and designing in silico a plurality of short guide RNAs (sgRNAs) homologous to the plurality of TSGs. Then a plurality of oligonucleotides are synthesized according to the sgRNAs designed. The oligonucleotides are introduced into a plurality of AAV-CRISPR vectors that contain Cas9. The plurality AAV-CRISPR vectors are administered to the brain of an animal. A tumor is isolated from the animal and nucleic acids are isolated from the tumor and sequenced. The data sequencing are analyzed identifying at least one glioblastoma driver mutation.
[0097] In certain embodiments of the invention, the animal is a mouse. Other animals that can be used include but are not limited to rats, rabbits, dogs, cats, horses, pigs, cows and birds. In certain embodiments, the animal is a human. The AAV-CRISPR vectors can be administered to an animal by any means standard in the art. For example the vectors can be injected into the animal. The injections can be intravenous, subcutaneous, intraperitoneal, or directly into a tissue or organ.
[0098] The AAV-CRISPR vector can include additional components. In one embodiment, the AAV-CRISPR vector is comprised of the components as described herein. The AAV-CRISPR can also include (1) an astrocyte-specific GFAP promoter, for example a polII promoter, (2) a constitutive U6 polIII promoter, (3) sgRNA spacer cloning site with double SapI type II restriction enzyme cutting site; (4) an sgRNA backbone derived from an 89 bp chimeric backbone from Streptococcus pyogenes Cas9 tracrRNA; and (5) a Cre recombinase.
[0099] In one aspect, the invention includes a method for determining the driver mutations responsible for a cancer. The method comprises selecting candidate tumor suppressor genes (TSGs) associated with the cancer and designing short guide RNAs (sgRNAs) against those TSGs, The sgRNAs are synthesized as oligonucleotides and cloned into an AAV-CRISPR vector generating a library packaged in the vectors. The vectors are propagated in cells, isolated (i.e., purified from the cells), and injected into mice. Mice are monitored for tumor formation, survival, histopathology, and pathology. Tumors are isolated from the mice and nucleic acids (and/or proteins) are extracted from the tumors. Targeted sequencing capture probes are designed against the TSGs and used to sequence the nucleic acids from the cancer samples/hybridized to the nucleic acids from the cancer samples and sequenced. The sequencing data are analyzed to determine the mutations (indelsinsertions and deletions) in the TSGs, thus determining the drivers of the cancer.
Compositions
[0100] In one aspect, the invention includes an AAV-CRISPR library. The AAV-CRISPR library comprises a plurality of AAV vectors comprising: Cas9 and a plurality of nucleic acids homologous to a plurality of Tumor Suppressor Gene (TSGs). In certain embodiments, the plurality of nucleic acids comprises SEQ ID NOs 1-280.
[0101] The invention also includes a kit for determining at least one driver mutation in a glioblastoma sample. The kit comprises an AAV-CRISPR library comprising a plurality of AAV vectors comprising Cas9 and a plurality of nucleic acids homologous to a plurality of Tumor Suppressor Gene (TSGs). In one embodiment, the plurality of nucleic acids comprise SEQ ID NOs. 1-280. The kits also include instructional material for use thereof. Instructional material can include directions for using the components of the kit as well as instructions or guidance for interpreting the results. For example the instructional material can include instructions for determining driver mutations in a glioblastoma sample.
[0102] Another aspect of the invention includes an AAV-CRISPR vector containing a cassette that expresses Cre recombinase under the control of a GFAP promoter for conditional induction of Cas9 expression and two sgRNA cassettes: one encoding an sgRNA targeting Trp53, and the other an open sgRNA cassette. In one aspect, the invention includes a vector comprising SEQ ID NO: 289. In another aspect, the invention includes a kit comprising a vector comprising SEQ ID NO: 289 and instructional material for use thereof.
CRISPR/Cas9
[0103] The CRISPR/Cas9 system is a facile and efficient system for inducing targeted genetic alterations. Target recognition by the Cas9 protein requires a seed sequence within the guide RNA (gRNA) and a conserved di-nucleotide containing protospacer adjacent motif (PAM) sequence upstream of the gRNA-binding region. The CRISPR/Cas9 system can thereby be engineered to cleave virtually any DNA sequence by redesigning the gRNA in cell lines (such as 293T cells), primary cells, and CAR T cells. The CRISPR/Cas9 system can simultaneously target multiple genomic loci by co-expressing a single Cas9 protein with two or more gRNAs, making this system uniquely suited for multiple gene editing or synergistic activation of target genes.
[0104] The Cas9 protein and guide RNA form a complex that identifies and cleaves target sequences. Cas9 is comprised of six domains: REC I, REC II, Bridge Helix, PAM interacting, HNH, and RuvC. The Red domain binds the guide RNA, while the Bridge helix binds to target DNA. The HNH and RuvC domains are nuclease domains. Guide RNA is engineered to have a 5 end that is complementary to the target DNA sequence. Upon binding of the guide RNA to the Cas9 protein, a conformational change occurs activating the protein. Once activated, Cas9 searches for target DNA by binding to sequences that match its protospacer adjacent motif (PAM) sequence. A PAM is a two or three nucleotide base sequence within one nucleotide downstream of the region complementary to the guide RNA. In one non-limiting example, the PAM sequence is 5-NGG-3. When the Cas9 protein finds its target sequence with the appropriate PAM, it melts the bases upstream of the PAM and pairs them with the complementary region on the guide RNA. Then the RuvC and HNH nuclease domains cut the target DNA after the third nucleotide base upstream of the PAM.
[0105] One non-limiting example of a CRISPR/Cas system used to inhibit gene expression, CRISPRi, is described in U.S. Patent Appl. Publ. No. US20140068797. CRISPRi induces permanent gene disruption that utilizes the RNA-guided Cas9 endonuclease to introduce DNA double stranded breaks which trigger error-prone repair pathways to result in frame shift mutations. A catalytically dead Cas9 lacks endonuclease activity. When coexpressed with a guide RNA, a DNA recognition complex is generated that specifically interferes with transcriptional elongation, RNA polymerase binding, or transcription factor binding. This CRISPRi system efficiently represses expression of targeted genes.
[0106] CRISPR/Cas gene disruption occurs when a guide nucleic acid sequence specific for a target gene and a Cas endonuclease are introduced into a cell and form a complex that enables the Cas endonuclease to introduce a double strand break at the target gene. In certain embodiments, the CRISPR/Cas system comprises an expression vector, such as, but not limited to, an pAd5F35-CRISPR vector. In other embodiments, the Cas expression vector induces expression of Cas9 endonuclease. Other endonucleases may also be used, including but not limited to, T7, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, other nucleases known in the art, and any combinations thereof.
[0107] In certain embodiments, inducing the Cas expression vector comprises exposing the cell to an agent that activates an inducible promoter in the Cas expression vector. In such embodiments, the Cas expression vector includes an inducible promoter, such as one that is inducible by exposure to an antibiotic (e.g., by tetracycline or a derivative of tetracycline, for example doxycycline). However, it should be appreciated that other inducible promoters can be used. The inducing agent can be a selective condition (e.g., exposure to an agent, for example an antibiotic) that results in induction of the inducible promoter. This results in expression of the Cas expression vector.
[0108] In certain embodiments, guide RNA(s) and Cas9 can be delivered to a cell as a ribonucleoprotein (RNP) complex. RNPs are comprised of purified Cas9 protein complexed with gRNA and are well known in the art to be efficiently delivered to multiple types of cells, including but not limited to stem cells and immune cells (Addgene, Cambridge, Mass., Mirus Bio LLC, Madison, Wis.).
[0109] The guide RNA is specific for a genomic region of interest and targets that region for Cas endonuclease-induced double strand breaks. The target sequence of the guide RNA sequence may be within a loci of a gene or within a non-coding region of the genome. In certain embodiments, the guide nucleic acid sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more nucleotides in length.
[0110] Guide RNA (gRNA), also referred to as short guide RNA or sgRNA, provides both targeting specificity and scaffolding/binding ability for the Cas9 nuclease. The gRNA can be a synthetic RNA composed of a targeting sequence and scaffold sequence derived from endogenous bacterial crRNA and tracrRNA. gRNA is used to target Cas9 to a specific genomic locus in genome engineering experiments. Guide RNAs can be designed using standard tools well known in the art.
[0111] In the context of formation of a CRISPR complex, target sequence refers to a sequence to which a guide sequence is designed to have some complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In certain embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. In other embodiments, the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or nucleus. Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g., within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs) the target sequence. As with the target sequence, it is believed that complete complementarity is not needed, provided this is sufficient to be functional.
[0112] In certain embodiments, one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a host cell, such that expression of the elements of the CRISPR system direct formation of a CRISPR complex at one or more target sites. For example, a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements may be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector. CRISPR system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5 with respect to (upstream of) or 3 with respect to (downstream of) a second element. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction. In certain embodiments, a single promoter drives expression of a transcript encoding a CRISPR enzyme and one or more of the guide sequence, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g., each in a different intron, two or more in at least one intron, or all in a single intron).
[0113] In certain embodiments, the CRISPR enzyme is part of a fusion protein comprising one or more heterologous protein domains (e.g. about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more domains in addition to the CRISPR enzyme). A CRISPR enzyme fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains. Examples of protein domains that may be fused to a CRISPR enzyme include, without limitation, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity. Additional domains that may form part of a fusion protein comprising a CRISPR enzyme are described in U.S. Patent Appl. Publ. No. US20110059502, incorporated herein by reference. In certain embodiments, a tagged CRISPR enzyme is used to identify the location of a target sequence.
[0114] Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian and non-mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of a CRISPR system to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell (Anderson, 1992, Science 256:808-813; and Yu, et al., 1994, Gene Therapy 1:13-26).
[0115] In certain embodiments, the CRISPR/Cas is derived from a type II CRISPR/Cas system. In other embodiments, the CRISPR/Cas system is derived from a Cas9 protein. The Cas9 protein can be from Streptococcus pyogenes, Streptococcus thermophilus, or other species.
[0116] In general, Cas proteins comprise at least one RNA recognition and/or RNA binding domain. RNA recognition and/or RNA binding domains interact with the guiding RNA. Cas proteins can also comprise nuclease domains (i.e., DNase or RNase domains), DNA binding domains, helicase domains, RNAse domains, protein-protein interaction domains, dimerization domains, as well as other domains. The Cas proteins can be modified to increase nucleic acid binding affinity and/or specificity, alter an enzymatic activity, and/or change another property of the protein. In certain embodiments, the Cas-like protein of the fusion protein can be derived from a wild type Cas9 protein or fragment thereof. In other embodiments, the Cas can be derived from modified Cas9 protein. For example, the amino acid sequence of the Cas9 protein can be modified to alter one or more properties (e.g., nuclease activity, affinity, stability, and so forth) of the protein. Alternatively, domains of the Cas9 protein not involved in RNA-guided cleavage can be eliminated from the protein such that the modified Cas9 protein is smaller than the wild type Cas9 protein. In general, a Cas9 protein comprises at least two nuclease (i.e., DNase) domains. For example, a Cas9 protein can comprise a RuvC-like nuclease domain and a HNH-like nuclease domain. The RuvC and HNH domains work together to cut single strands to make a double-stranded break in DNA. (Jinek, et al., 2012, Science, 337:816-821). In certain embodiments, the Cas9-derived protein can be modified to contain only one functional nuclease domain (either a RuvC-like or a HNH-like nuclease domain). For example, the Cas9-derived protein can be modified such that one of the nuclease domains is deleted or mutated such that it is no longer functional (i.e., the nuclease activity is absent). In some embodiments in which one of the nuclease domains is inactive, the Cas9-derived protein is able to introduce a nick into a double-stranded nucleic acid (such protein is termed a nickase), but not cleave the double-stranded DNA. In any of the above-described embodiments, any or all of the nuclease domains can be inactivated by one or more deletion mutations, insertion mutations, and/or substitution mutations using well-known methods, such as site-directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis, as well as other methods known in the art.
[0117] In one non-limiting embodiment, a vector drives the expression of the CRISPR system. The art is replete with suitable vectors that are useful in the present invention. The vectors to be used are suitable for replication and, optionally, integration in eukaryotic cells. Typical vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the desired nucleic acid sequence. The vectors of the present invention may also be used for nucleic acid standard gene delivery protocols. Methods for gene delivery are known in the art (U.S. Pat. Nos. 5,399,346, 5,580,859 & 5,589,466, incorporated by reference herein in their entireties).
[0118] Further, the vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (4.sup.th Edition, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 2012), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, Sindbis virus, gammaretrovirus and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193).
Introduction of Nucleic Acids
[0119] Methods of introducing nucleic acids into a cell include physical, biological and chemical methods. Physical methods for introducing a polynucleotide, such as DNA or RNA, into a cell include transfection, transformation, transduction, calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. RNA and DNA can be introduced into cells using commercially available methods which include electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Mass.) or the Gene Pulser II (BioRad, Denver, Colo.), Multiporator (Eppendort, Hamburg Germany). RNA and DNA can also be introduced into cells using cationic liposome mediated transfection using lipofection, using polymer encapsulation, using peptide mediated transfection, or using biolistic particle delivery systems such as gene guns (see, for example, Nishikawa, et al. Hum Gene Ther., 12(8):861-70 (2001).
[0120] Biological methods for introducing a polynucleotide of interest into a cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362. Non-viral vector such as plasmids can also be used to introduce nucleic acids or polynucleotides into a cell. In certain embodiments plasmids containing guide RNAs are transfected into a cell.
[0121] Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
[0122] Regardless of the method used to introduce exogenous nucleic acids into a host cell, in order to confirm the presence of the nucleic acids in the host cell, a variety of assays may be performed. Such assays include, for example, molecular biological assays well known to those of skill in the art, such as gel electrophoresis, Southern and Northern blotting, RT-PCR and PCR; biochemical assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
[0123] It should be understood that the method and compositions that would be useful in the present invention are not limited to the particular formulations set forth in the examples. The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description, and are not intended to limit the scope of what the inventors regard as their invention.
[0124] The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, Molecular Cloning: A Laboratory Manual, fourth edition (Sambrook et al. (2012) Molecular Cloning, Cold Spring Harbor Laboratory); Oligonucleotide Synthesis (Gait, M. J. (1984). Oligonucleotide synthesis. IRL press); Culture of Animal Cells (Freshney, R. (2010). Culture of animal cells. Cell Proliferation, 15(2.3), 1); Methods in Enzymology Weir's Handbook of Experimental Immunology (Wiley-Blackwell; 5 edition (Jan. 15, 1996); Gene Transfer Vectors for Mammalian Cells (Miller and Carlos, (1987) Cold Spring Harbor Laboratory, New York); Short Protocols in Molecular Biology (Ausubel et al., Current Protocols; 5 edition (Nov. 5, 2002)); Polymerase Chain Reaction: Principles, Applications and Troubleshooting, (Babar, M., VDM Verlag Dr. Mler (Aug. 17, 2011)); Current Protocols in Immunology (Coligan, John Wiley & Sons, Inc. Nov. 1, 2002).
[0125] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures, embodiments, claims, and examples described herein. Such equivalents were considered to be within the scope of this invention and covered by the claims appended hereto. For example, it should be understood, that modifications in reaction conditions, including but not limited to reaction times, reaction size/volume, and experimental reagents, such as solvents, catalysts, pressures, atmospheric conditions, e.g., nitrogen atmosphere, and reducing/oxidizing agents, with art-recognized alternatives and using no more than routine experimentation, are within the scope of the present application.
[0126] It is to be understood that wherever values and ranges are provided herein, all values and ranges encompassed by these values and ranges, are meant to be encompassed within the scope of the present invention. Moreover, all values that fall within these ranges, as well as the upper or lower limits of a range of values, are also contemplated by the present application.
[0127] The following examples further illustrate aspects of the present invention. However, they are in no way a limitation of the teachings or disclosure of the present invention as set forth herein.
EXPERIMENTAL EXAMPLES
[0128] The invention is now described with reference to the following Examples. These Examples are provided for the purpose of illustration only, and the invention is not limited to these Examples, but rather encompasses all variations that are evident as a result of the teachings provided herein.
[0129] The materials and methods employed in these experiments are now described.
[0130] Design, synthesis and cloning of the mTSG library: Due to cellular complexity in the organs in vivo, a small focused library was designed for viral transduction. Briefly, pan-cancer mutation data from 15 cancer types were retrieved from The Cancer Genome Atlas (TCGA portal) via cBioPortal (Gao et al., 2013, Sci Signal 6) and Synapse (www dot synapse dot org). Significantly mutated genes were calculated similar to previously described methods (Davoli et al., 2013, Cell 155, 948-962; Kandoth et al., 2013, Nature 502, 333-339; Lawrence et al., 2014, Nature 505, 495-501; Lawrence et al., 2013, Nature 499, 214-218). Known oncogenes were excluded and only known or predicted tumor suppressor genes (TSGs) were included. The top 50 TSGs were chosen, and their mouse homologs (mTSG) were retrieved from mouse genome informatics (MGI) (www dot informatics dot jax dot org). A total of 49 mTSGs were found. A total of 7 known housekeeping genes were chosen as internal controls. SgRNAs were designed against these 56 genes (Shalem et al., 2014, Science 343, 84-87; Wang et al., 2014, Science 343, 80-84) with custom scripts. Five sgRNAs were chosen for each gene, plus 8 non-targeting controls (NTCs), making a total 288 sgRNAs in the mTSG library. There were two sets of duplicate sgRNAs, Cdkn2a-sg2/Cdkn2a-sg5, and Rp122-sg4/Rp122-sg5, leaving a total of 286 unique sgRNAs.
[0131] Design, cloning of an AAV-CRISPR GBM vector and mTSG sgRNA library cloning: An AAV-CRISPR vector was designed for astrocyte-specific genome editing. This vector contained a cassette that specifically expresses Cre recombinase under the control of a GFAP promoter for conditional induction of Cas9 expression in astrocytes in the brain when delivered to LSL-Cas9 mice (Platt et al., 2014, Cell 159, 440-455). Two sgRNA cassettes were built in this vector, one encoding an sgRNA targeting Trp53, the guardian of the genome and most frequently mutated gene in cancer (Davoli et al., 2013, Cell 155, 948-962; Kandoth et al., 2013, Nature 502, 333-339; Lawrence et al., 2014, Nature 505, 495-501), with the other being an open sgRNA cassette (double SapI sites for sgRNA cloning) enabling flexible targeting of genes of interest in either individual or pooled manner. The vector was generated by gBlock gene fragment synthesis (IDT) followed by Gibson assembly (NEB). The mTSG library was generated by oligo synthesis, pooled, and cloned into the double SapI sites of the AAV-CRISPR GBM vector. The library cloning was done at over 100 coverage to ensure proper representation. Plasmid library representation was readout by barcoded Illumina sequencing (Chen et al., 2015, Cell 160, 1246-1260) with primers customized to this vector.
TABLE-US-00001 VectorpAAV-sgRNA-GFAP-Cre: (SEQIDNO:289) 1 cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtc 61 gggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggcca 121 actccatcactaggggttcctgcggccgcacgcgtgagggcctatttcccatgattcctt 181 catatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaa 241 acacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttg 301 cagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatt 361 tcgatttcttggctttatatatcttGTGGAAAGGACGAAACACCGTGTAATAGCTCCTGC 421 ATGGgttttagagctaGAAAtagcaagttaaaataaggctagtccgttatcaacttgaaa 481 aagtggcaccgagtcggtgcTTTTTTtctagaagagggcctatttcccatgattccttca 541 tatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaac 601 acaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgca 661 gttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttc 721 gatttcttggctttatatatcttGTGGAAAGGACGAAACACCggaagagcgagctcttct 781 gttttagagctaGAAAtagcaagttaaaataaggctagtccgttatcaacttgaaaaagt 841 ggcaccgagtcggtgcTTTTTTggtaccaggatcccacctccctctctgtgctgggactc 901 acagagggagacctcaggaggcagtctgtccatcacatgtccaaatgcagagcataccct 961 gggctgggcgcagtggcgcacaactgtaattccagcactttgggaggctgatgtggaagg 1021 atcacttgagcccagaagttctagaccagcctgggcaacatggcaagaccctatctctac 1081 aaaaaaagttaaaaaatcagccacgtgtggtgacacacacctgtagtcccagctattcag 1141 gaggctgaggtgaggggatcacttaaggctgggaggttgaggctgcagtgagtcgtggtt 1201 gcgccactgcactccagcctgggcaacagtgagaccctgtctcaaaagacaaaaaaaaaa 1261 aaaaaaaaaaaaagaacatatcctggtgtggagtaggggacgctgctctgacagaggctc 1321 gggggcctgagctggctctgtgagctggggaggaggcagacagccaggccttgtctgcaa 1381 gcagacctggcagcattgggctggccgccccccagggcctcctcttcatgcccagtgaat 1441 gactcaccttggcacagacacaatgttcggggtgggcacagtgcctgcttcccgccgcac 1501 cccagcccccctcaaatgccttccgagaagcccattgagcagggggcttgcattgcaccc 1561 cagcctgacagcctggcatcttgggataaaagcagcacagccccctaggggctgcccttg 1621 ctgtgtggcgccaccggcggtggagaacaaggctctattcagcctgtgcccaggaaaggg 1681 gatcaggggatgcccaggcatggacagtgggtggcagggggggagaggagggctgtctgc 1741 ttcccagaagtccaaggacacaaatgggtgaggggactgggcagggttctgaccctgtgg 1801 gaccagagtggagggcgtagatggacctgaagtctccagggacaacagggcccaggtctc 1861 aggctcctagttgggcccagtggctccagcgtttccaaacccatccatccccagaggttc 1921 ttcccatctctccaggctgatgtgtgggaactcgaggaaataaatctccagtgggagacg 1981 gaggggtggccagggaaacggggcgctgcaggaataaagacgagccagcacagccagctc 2041 atgtgtaacggctttgtggagctgtcaaggcctggtctctgggagagaggcacagggagg 2101 ccagacaaggaaggggtgacctggagggacagatccaggggctaaagtcctgataaggca 2161 agagagtgccggccccctcttgccctatcaggacctccactgccacatagaggccatgat 2221 tgacccttagacaaagggctggtgtccaatcccagcccccagccccagaactccagggaa 2281 tgaatgggcagagagcaggaatgtgggacatctgtgttcaagggaaggactccaggagtc 2341 tgctgggaatgaggcctagtaggaaatgaggtggcccttgagggtacagaacaggttcat 2401 tcttcgccaaattcccagcaccttgcaggcacttacagctgagtgagataatgcctgggt 2461 tatgaaatcaaaaagttggaaagcaggtcagaggtcatctggtacagcccttccttccct 2521 ttttttttttttttttttgtgagacaaggtctctctctgttgcccaggctggagtggcgc 2581 aaacacagctcactgcagcctcaacctactgggctcaagcaatcctccagcctcagcctc 2641 ccaaagtgctgggattacaagcatgagccaccccactcagccctttccttcctttttaat 2701 tgatgcataataattgtaagtattcatcatggtccaaccaaccctttcttgacccacctt 2761 cctagagagagggtcctcttgcttcagcggtcagggccccagacccatggtctggctcca 2821 ggtaccacctgcctcatgcaggagttggcgtgcccaggaagctctgcctctgggcacagt 2881 gacctcagtggggtgaggggagctctccccatagctgggctgcggcccaaccccaccccc 2941 tcaggctatgccagggggtgttgccaggggcacccgggcatcgccagtctagcccactcc 3001 ttcataaagccctcgcatcccaggagcgagcagagccagagcaggatggagaggagacgc 3061 atcacctccgctgctcgccgggcgtacggccaccatgcccaagaagaagaggaaggtgtc 3121 caatctcctgactgttcaccagaacctccctgcgctgccagtagatgccactagcgatga 3181 ggtcaggaaaaatctcatggatatgtttagggatagacaggcgttttctgaacacacctg 3241 gaaaatgctgcttagcgtgtgccgatcctgggcagcctggtgtaagctgaacaatcgcaa 3301 atggttccccgccgagccggaggacgtgcgcgattacctgctgtatctccaggcaagagg 3361 gctggctgtcaagactatccagcagcacttgggccaactgaatatgctgcatcgacgcag 3421 cgggctcccccggcctagcgattcaaacgcagtctcccttgttatgaggagaattagaaa 3481 ggaaaacgtagatgcgggtgagagggctaagcaggctctcgcttttgagcggactgattt 3541 cgaccaggtcagatccctgatggagaacagcgatcggtgccaggacatcaggaacctcgc 3601 atttctgggaattgcatataacacacttctgcgcatagctgagatcgcccggatcagagt 3661 gaaagacatcagtcgaacggacggcggccggatgcttattcatattggacgcacaaagac 3721 attggtcagcaccgctggcgttgaaaaggccttgtccctgggcgtaacgaagctggtgga 3781 aagatggatctcagtgtccggcgtggctgacgaccctaataattacttgttctgtcgagt 3841 gagaaaaaacggagtcgccgcgccctctgccaccagccaattgagtacacgggcccttga 3901 agggatctttgaggcaacccaccgactcatatacggagccaaggatgacagtggccagag 3961 gtatctcgcctggtcaggtcattctgctagggtgggggccgcacgagacatggcgcgggc 4021 aggagtctccataccagagattatgcaagctggaggttggacaaatgtgaacatcgttat 4081 gaactatatccgcaatcttgactctgaaaccggggccatggtgagactgctcgaagatgg 4141 tgactacccatacgatgttccagattacgctTAAGAATTCgatatcaagcttAATAAAAG 4201 ATCTTTATTTTCATTAGATCTGTGTGTTGGTTTTTTGTGTggtaaccacgtgcggaccga 4261 gcggccgcaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgct 4321 cactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagt 4381 gagcgagcgagcgcgcagctgcctgcaggggcgcctgatgcggtattttctccttacgca 4441 tctgtgcggtatttcacaccgcatacgtcaaagcaaccatagtacgcgccctgtagcggc 4501 gcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgcc 4561 ctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccc 4621 cgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctc 4681 gaccccaaaaaacttgatttgggtgatggttcacgtagtgggccatcgccctgatagacg 4741 gtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaact 4801 ggaacaacactcaaccctatctcgggctattcttttgatttataagggattttgccgatt 4861 tcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaa 4921 atattaacgtttacaattttatggtgcactctcagtacaatctgctctgatgccgcatag 4981 ttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctc 5041 ccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttt 5101 tcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttatag 5161 gttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtg 5221 cgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgaga 5281 caataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacat 5341 ttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcaccca 5401 gaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatc 5461 gaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttcca 5521 atgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccggg 5581 caagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcacca 5641 gtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccata 5701 accatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggag 5761 ctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccg 5821 gagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggca 5881 acaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaatta 5941 atagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggct 6001 ggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgca 6061 gcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcag 6121 gcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcat 6181 tggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttt 6241 taatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaa 6301 cgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttga 6361 gatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcg 6421 gtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagc 6481 agagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaag 6541 aactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgcc 6601 agtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcg 6661 cagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctac 6721 accgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggaga 6781 aaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagctt 6841 ccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgag 6901 cgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcg 6961 gcctttttacggttcctggccttttgctggccttttgctcacatgt GFAP:(GenbankM67446.1Humanglialfibrillaryacidicprotein(GFAP),exon1) (SEQIDNO:290) cccacctccctctctgtgctgggactcacagagggagacctcaggaggcagtctgtccatcacatgtccaaatgcaga gcataccctgggctgggcgcagtggcgcacaactgtaattccagcactttgggaggctgatgtggaaggatcacttga gcccagaagttctagaccagcctgggcaacatggcaagaccctatctctacaaaaaaagttaaaaaatcagccacgtg tggtgacacacacctgtagtcccagctattcaggaggctgaggtgaggggatcacttaaggctgggaggttgaggctg cagtgagtcgtggttgcgccactgcactccagcctgggcaacagtgagaccctgtctcaaaagacaaaaaaaaaaaaa aaaaaaaaaagaacatatcctggtgtggagtaggggacgctgctctgacagaggctcgggggcctgagctggctctgt gagctggggaggaggcagacagccaggccttgtctgcaagcagacctggcagcattgggctggccgccccccagggcc tcctcttcatgcccagtgaatgactcaccttggcacagacacaatgttcggggtgggcacagtgcctgcttcccgccg caccccagcccccctcaaatgccttccgagaagcccattgagcagggggcttgcattgcaccccagcctgacagcctg gcatcttgggataaaagcagcacagccccctaggggctgcccttgctgtgtggcgccaccggcggtggagaacaaggc tctattcagcctgtgcccaggaaaggggatcaggggatgcccaggcatggacagtgggtggcagggggggagaggagg gctgtctgcttcccagaagtccaaggacacaaatgggtgaggggactgggcagggttctgaccctgtgggaccagagt ggagggcgtagatggacctgaagtctccagggacaacagggcccaggtctcaggctcctagttgggcccagtggctcc agcgtttccaaacccatccatccccagaggttcttcccatctctccaggctgatgtgtgggaactcgaggaaataaat ctccagtgggagacggaggggtggccagggaaacggggcgctgcaggaataaagacgagccagcacagccagctcatg tgtaacggctttgtggagctgtcaaggcctggtctctgggagagaggcacagggaggccagacaaggaaggggtgacc tggagggacagatccaggggctaaagtcctgataaggcaagagagtgccggccccctcttgccctatcaggacctcca ctgccacatagaggccatgattgacccttagacaaagggctggtgtccaatcccagcccccagccccagaactccagg gaatgaatgggcagagagcaggaatgtgggacatctgtgttcaagggaaggactccaggagtctgctgggaatgaggc ctagtaggaaatgaggtggcccttgagggtacagaacaggttcattcttcgccaaattcccagcaccttgcaggcact tacagctgagtgagataatgcctgggttatgaaatcaaaaagttggaaagcaggtcagaggtcatctggtacagccct tccttccctttttttttttttttttttgtgagacaaggtctctctctgttgcccaggctggagtggcgcaaacacagc tcactgcagcctcaacctactgggctcaagcaatcctccagcctcagcctcccaaagtgctgggattacaagcatgag ccaccccactcagccctttccttcctttttaattgatgcataataattgtaagtattcatcatggtccaaccaaccct ttcttgacccaccttcctagagagagggtcctcttgcttcagcggtcagggccccagacccatggtctggctccaggt accacctgcctcatgcaggagttggcgtgcccaggaagctctgcctctgggcacagtgacctcagtggggtgagggga gctctccccatagctgggctgcggcccaaccccaccccctcaggctatgccagggggtgttgccaggggcacccgggc atcgccagtctagcccactccttcataaagccctcgcatcccaggagcgagcagagccagagcaggatggagaggaga cgcatcacctccgctgctcgccggg
[0132] AAV-mTSG viral library production: The AAV-CRISPR GBM plasmid vector (AAV-vector) and library (AAV-mTSG) were subjected to AAV9 production and chemical purification. Briefly, HEK 293FT cells (ThermoFisher) were transiently transfected with transfer (AAV-vector or AAV-mTSG) serotype (AAV9) and packaging (pDF6) plasmids using polyethyleneimine (PEI). Each replicate consisted of five 15-cm tissue culture dishes or T-175 flasks (Corning) of 80% confluent HEK 293FT cells. Multiple replicates were pooled to enhance production yield. Approximately 72 hours post transfection, cells were dislodged and transferred to a conical tube in sterile PBS. 1/10 volume of pure chloroform was added and the mixture was incubated at 37 C. and vigorously shaken for 1 hour. NaCl was added to a final concentration of 1 M and the mixture was shaken until dissolved and then pelleted at 20 k g at 4 C. for 15 minutes. The aqueous layer was discarded while the chloroform layer was transferred to another tube. PEG8000 was added to 10% (w/v) and shaken until dissolved. The mixture was incubated at 4 C. for 1 hour and then spun at 20 k g at 4 C. for 15 minutes. The supernatant was discarded, and the pellet was resuspended in DPBS plus MgCl.sub.2, treated with Benzonase (Sigma), and incubated at 37 C. for 30 minutes. Chloroform (1:1 volume) was then added, shaken, and spun down at 12 k g at 4 C for 15 min. The aqueous layer was isolated and passed through a 100 kDa MWCO (Millipore). The concentrated solution was washed with PBS and the filtration process was repeated. Virus was titered by qPCR using custom Taqman assays (ThermoFisher) targeted to Cre.
[0133] Design, cloning of lentiCRISPR GBM vectors and mTSG sgRNA library, and lentivirus production: Two lentiCRISPR vectors were designed, one for constitutive, and the other for astrocyte-specific genome editing. These vectors contain a cassette that specifically expresses Cre recombinase under the control of an EFS promoter or a GFAP promoter for conditional induction of Cas9 expression in the brain when delivered to LSL-Cas9 mice. Two sgRNA cassettes were built in this vector, one encoding an sgRNA targeting Trp53, with the other being an empty sgRNA cassette (double BsmbI sites for sgRNA cloning) enabling flexible targeting of genes of interest in either individual or pooled manner. These vectors were generated by gBlock gene fragment synthesis (IDT) followed by Gibson assembly (NEB). The mTSG libraries were generated by oligo synthesis, pooled, and cloned into the double BsmbI sites of the lentiCRISPR GBM vectors. The library cloning was done at over 100 coverage to ensure proper representation. Plasmid library representation was readout by barcoded Illumina sequencing as described above, with primers customized to the vectors. The LentiCRISPR GBM plasmid vector (Lenti-vector) and library (Lenti-mTSG) were subjected to high-titre lentivirus production and purification. Briefly, HEK 293FT cells (ThermoFisher) were transiently transfected with transfer (Lenti-vector or Lenti-mTSG), and packaging (psPAX and pMD2.G) plasmids using PEI or Lipofectamine. Each replicate consist of five of 80% confluent HEK 293FT cells in 15-cm tissue culture dishes or T-175 flasks (Corning). Multiple replicates were pooled to enhance production yield. Approximately 48 hours post transfection, virus-containing media was collected, and purified via sucrose gradient ultracentrifugation at >=30,000 rpm for 2-3 h. The supernatant was discarded and the pellet was dried and resuspended with 100 l sterile PBS at 4 C. overnight. Virus was titered by viral protein p24 ELISA (RnD).
[0134] Stereotaxic surgery and virus transduction in the brain: Conditional LSL-Cas9 knock-in mice were bred in a mixed 129/C57BL/6 background. Mixed gender (randomized males and females) 6-14 week old mice were used in the experiment. Animals were maintained and breed in standard individualized cages with maximum of 5 mice per cage, with regular room temperature (65-75 F., or 18-23 C.), 40-60% humidity, and a 12 h:12 h light cycle. Mice were anesthetized by intraperitoneally injection of ketamine (100 mg/kg) and xylazine (10 mg/kg), or by inhalation of isoflurane at approximately 2% for 20-30 minutes. Buprenorphine HCl (0.1 mg/kg), or carprofen (5.0 mg/kg) was administered intraperitoneally as a pre-emptive analgesic. Reflexes were tested before surgical procedures. Once subject mice were in deep anesthesia, they were immobilized in a stereotaxic apparatus (Kopf, or Stoelting) using intra-aural positioning studs and a tooth bar to immobilize the skull. Heat was provided for warmth by a standard heating pad, or a heatlamp. According to the mouse brain stereotaxic coordinates, 1-2 mm holes were drilled on the surface of the skull, and a 33 G Nanofil syringe needle (World Precision Instrument) was used to inject into the ventricle at 0.6-1.0 mm caudal/posterior to Bregma, 0.8-1.5 mm right-side lateral to Bregma, and 2.0-3.0 mm deep from the pial surface for injection (coordinates: A/P 0.6 to 1.0, M/L 0.8 to 1.5, D/V 2.0 to 3.0). For a small fraction of animals, injections were made into the hippocampus (HPF) at the following coordinates (A/P 1.3, M/L 0.6, D/V 1.7). PBS, or 8 uL AAV (between 110.sup.10-110.sup.11 viral genome copies, or Cre copy number equivalent), or 8 uL lentivirus (Between 810.sup.9-810.sup.10 viral particles, or p24 equivalent) was injected into the right hemisphere of the brain for each mouse. Injection rates were monitored by an UltraMicroPump3 (World Precision Instruments). After injection, the incision site was closed with 6-0 Ethilon sutures (Ethicon by Johnson & Johnson), or a VetBond tissue glue (3M). Animal were postoperatively hydrated with 1 mL lactated Ringer's solution (subcutaneous) and housed on warmed cages or in a temperature controlled (37 C.) environment until achieving ambulatory recovery. Meloxicam (1-2 mg/kg) was also administered subcutaneously directly after surgery.
[0135] MRI: MRI imaging was performed using standard imaging protocols with MRI machines (Varian 7T/310/ASR-whole mouse MRI system, or Bruker 9.4T horizontal small animal systems). Briefly, animals were anesthetized using isoflurane, and setup in the imaging bed with a nosecone providing constant isoflurane. A total of 20-30 views were acquired for each mouse brain using a custom setting: echo time (TE)=20, repetition time (TR)=2000, slicing=0.5 mm. Raw image stacks were processed using Osirix or Slicer tools. Rendering and quantification were performed using Slicer (slicer dot org). For all mice with brain tumors, only 1 tumor was observed per mouse. Tumors were approximate as spheres and their sizes were calculated with the following formula:
Volume(mm.sup.3)=0.5*length(mm)*height(mm)*depth(mm)
[0136] Survival analysis: Mice that developed brain tumors rapidly deteriorated in their body condition scores. Mice with observed macrocephaly and body condition score <=1 were euthanized and the euthanasia date was recorded as the last survival date. Occasionally mice bearing brain tumors died unexpectedly early, and the date of death was recorded as the last survival date. Cohorts of mice stereotaxically injected with PBS, AAV-vector or AAV-mTSG virus were monitored for their survival. Survival analysis was analyzed using the standard Kaplan-Meier method. Of note, several AAV-vector or PBS injected mice were sacrificed at time points earlier than 299 days (at times when a certain AAV-mTSG mice were found dead or euthanized due to poor body conditions) to provide time-matched histology, but those mice were healthy without brain tumor or other detectable symptoms. Mice euthanized early in healthy states were excluded from calculation of survival percentage.
[0137] Mouse brain dissection, fluorescent imaging, and histology: Mice were sacrificed by carbon dioxide asphyxiation or deep anesthesia with isoflurane followed by cervical dislocation. Mouse brains were manually dissected under a fluorescent stereoscope (Zeiss, Olympus or Leica). Brightfield and/or GFP fluorescent images were taken for the dissected brain, and overlaid using ImageJ. Brains were then fixed in 4% formaldehyde or 10% formalin for 48 to 96 hours, embedded in paraffin, sectioned at 6 m and stained with hematoxylin and eosin (H&E) for pathology. For tumor size quantification, H&E slides were scanned using an Aperio digital slidescanner (Leica). Tumors were manually outlined as region-of-interest (ROI), and subsequently quantified using ImageScope (Leica). Sections were de-waxed, rehydrated and stained using standard immunohistochemistry (IHC) protocols as previously described (Chen et al., 2015, Cell 160, 1246-1260). The following antibodies were used for IHC: rabbit anti-Ki67 (abcam ab16667, 1:500), rabbit anti-GFP (ThermoFisher Scientific A11122, 1:300), rabbit anti-GFAP (Dako, 1:500), and mouse anti-Cas9 (Diagenode, 1:300).
[0138] Mouse tissue collection for molecular biology: Mouse brain (targeting organ) and liver (non-targeting organ) were dissected and collected manually. For molecular biology, tissues were flash frozen with liquid nitrogen, ground in 24 Well Polyethylene Vials with metal beads in a GenoGrinder machine (OPS diagnostics). Homogenized tissues were used for DNA/RNA/protein extractions using standard molecular biology protocols.
[0139] Genomic DNA extraction from cells and mouse tissues: For genomic DNA (gDNA) extraction, 50-200 mg of frozen ground tissue were resuspended in 6 ml of Lysis Buffer (50 mM Tris, 50 mM EDTA, 1% SDS, pH 8) in a 15 ml conical tube, and 30 l of 20 mg/ml Proteinase K (Qiagen) was added to the tissue/cell sample and incubated at 55 C. overnight. The next day, 30 l of 10 mg/ml RNAse A (Qiagen) was added to the lysed sample, which was then inverted 25 times and incubated at 37 C. for 30 minutes. Samples were cooled on ice before addition of 2 ml of pre-chilled 7.5M ammonium acetate (Sigma) to precipitate proteins. The samples were vortexed at high speed for 20 seconds and then centrifuged at 4,000g for 10 minutes. Then, a tight pellet was visible in each tube and the supernatant was carefully decanted into a new 15 ml conical tube. Then 6 ml 100% isopropanol was added to the tube, inverted 50 times and centrifuged at >4,000g for 10 minutes. Genomic DNA was visible as a small white pellet in each tube. The supernatant was discarded, 6 ml of freshly prepared 70% ethanol was added, the tube was inverted 10 times, and then centrifuged at >4,000g for 1 minute. The supernatant was discarded by pouring; the tube was briefly spun, and remaining ethanol was removed using a P200 pipette. After air-drying for 10-30 minutes, the DNA changed appearance from a milky white pellet to slightly translucent. Then, 500 l of ddH.sub.2O was added and the tube was incubated at 65 C. for 1 hour and at room temperature overnight to fully resuspend the DNA. The next day, the gDNA samples were vortexed briefly. The gDNA concentration was measured using a Nanodrop (Thermo Scientific).
[0140] Targeted capture sequencing probe design: Targeted capture sequencing probes were designed as follows: the predicted cutting sites (3 bp 5 of PAM) of the 280 gene-targeting sgRNAs in the mTSG library plus the Trp53-targeting sgRNA in the vector were retrieved from mouse genome (mm10). The 140 bp sequences of the flanking regions of the cutting sites (5-70 bp and 3-70 bp) were retrieved using Bedtools (Quinlan & Hall, 2010, Bioinformatics 26, 841-842). The regions were consolidated using NimbleDesign (Roche/NimbleGen), and probe matches were set with the following parameters: Preferred Close Matches=3, where initial selection of probes for a given region only included probes with 3 close matches or less; and Maximum Close Matches=20, if there were insufficient probes available for a given region at the Preferred Close Match number, the threshold was incrementally increased to 20 until adequate coverage was achieved. After consolidation, a number of 178 regions covering 280 sgRNAs, with a total of 33638 bp were covered in the probeset, with Target Bases Covered=32239 (95.8%) and one target sgRNA without coverage due to a lack of qualified candidate probes in the region.
[0141] Targeted capture sequencing: The mTSG-Amplicon targeted capture sequencing probes were synthesized using the SeqCap EZ Probe Pool synthesis procedure (Roche). The capture sequencing was performed following standard Illumina-Roche protocols. Genomic DNA samples from mouse organs were subjected to fragmentation, followed by a library preparation step using KAPA Library Preparation Kit (Illumina). The libraries were then amplified using LM-PCR, hybridized to the mTSG-Amplicon probe pool, washed and recovered, and amplified with multiplexing barcodes using LM-PCR. The multiplexed library was then QC'ed using qPCR, and subjected to high-throughput sequencing using the Hiseq-2500 or Hiseq-4000 platforms (Illumina) at Yale Center for Genome Analysis. 277/278 (99.6%) of unique targeted sgRNAs were captured for all samples from this experiment, with the missing one being Arid1a-sg5.
[0142] mTSG sgRNA cutting efficiency measurement: The mouse mTSG sgRNA cutting efficiency measurement was performed similar to the screen with the exception of early sampling. Briefly, AAV-mTSG library virus was injected in to LV of LSL-Cas9 mice, but instead of end-point tumor, mice were sacrificed at early time point (3.5 weeks post injection) and examined under fluorescent stereoscope, and GFP+regions from the brain were dissected. Genomic DNA was extracted, and subjected to capture sequencing.
[0143] Mouse whole-exome capture sequencing: The mouse whole-exome capture was performed using SeqCap EZ exome kit (Roche). Briefly, capture sequencing was done following standard Illumina-Roche-Illumina protocols. Genomic DNA samples from mouse organs were subjected to fragmentation, followed by a library preparation step using KAPA Library Preparation Kit (Illumina). The libraries were then amplified using LM-PCR, hybridized to the exome probe pool, washed and recovered, and amplified with multiplexing barcodes using LM-PCR. The multiplexed library was then QC'ed using qPCR, and subjected to high-throughput sequencing using the Hiseq-2500 or Hiseq-4000 platforms (Illumina) at Yale Center for Genome Analysis.
[0144] Illumina sequencing data processing and variant calling: FASTQ reads were mapped to the mm10 genome using the bwa mem function in BWA v0.7.13 (Li and Durbin, 2009, Bioinformatics 25, 1754-1760). Bam files were merged, sorted, and indexed using bamtools v2.4.0 (Barnett et al., 2011, Bioinformatics 27, 1691-1692) and samtools v1.3 (Li et al., 2009, Bioinformatics 25, 2078-2079). For each sample, indel variants were called using samtools and VarScan v2.3.9 (Koboldt et al., 2012, Genome Res 22, 568-576). Specifically, samtools mpileup (-d 1000000000 -B -q 10) was used and the output was piped to VarScan pileup2indel (--min-coverage 1 --min-reads2 1 --min-var-freq 0.001 --p-value 0.05). To link each indel to the sgRNA that most likely caused the mutation, the center position of each indel was mapped to the closest sgRNA cut site.
[0145] Calling significantly mutated sgRNAs and significantly mutated genes: All detected indels were further filtered by requiring that each indel overlap with the 3 basepairs flanking the closest sgRNA cut site, as Cas9-induced double-strand breaks are expected to occur within a narrow window of the predicted cut site. A series of criteria to identify high-confidence mutations were utilized: 1) As an initial pass to exclude possible germline mutations, any sgRNAs with indels present in more than half of the control samples with greater than 5% variant frequency were removed. This filter specifically removed Rps19_sg5 from further consideration. 2) To determine the significantly cutting sgRNAs in each sample, a false-discovery approach was used based on the PBS and vector control samples. For each sgRNA, the highest % variant read frequency across all control samples was taken; in order for a mutation to be called in an mTSG sample, the % variant read frequency had to exceed the control sample cutoff. However, since the base vector contained a Trp53 sgRNA (Trp53 sg8) whose cut site was only 1 bp away from the target site of Trp53 sg4 (from mTSG library), only PBS samples were considered when calculating the false-discovery cutoff for Trp53 sg4. Nevertheless, in the current study this exception was unnecessary because of the third filter: 3) To identify the dominant clones in each sample, a 5% variant frequency cutoff was further set on top of the false-discovery cutoff. These criteria gave a binary table (i.e. not significantly mutated vs. significantly mutated detailing each sgRNA and whether its target site was significantly mutated in each sample. None of the AAV-vector samples passed the 5% cutoff at the p53 sg 4/8 target site, which is consistent with our observation that no tumors were found in vector-treated animals. To convert significantly cutting sgRNAs into significantly mutated genes, the binary sgRNA scores were collapsed by gene, such that if any of the 5 sgRNAs for a gene were found to be significantly cutting, the entire gene would be called as significantly mutated.
[0146] Exome sequencing data analysis: For exome sequencing analysis, a modified set of criteria were imposed on each detected variant: 1) 10 supporting reads for the reference allele; 2) 10 supporting reads for the variant allele; 3) the variant is within 6 bp of a Cas9 PAM, NGG (or CCN on the reverse strand); 4) a variant allele frequency <75%, as this was the maximum detected variant frequency out of the mTSG brain samples; 5) the variant was not detected in any sequenced control samples, which were considered as germline variants.
[0147] Clustering of variant frequencies to infer clonality of tumors: For each mTSG brain sample, the individual variants that comprised the SMS calls in that sample were extracted, with a cutoff of 5% variant frequency to eliminate low-abundance variants. Because of these cutoffs, 3 sequenced mTSG brain samples were not eligible for variant frequency clustering analysis. To identify clusters of variant frequencies in an unbiased manner, the variant frequency distribution was modeled with a Gaussian kernel density estimate, using the Sheather-Jones method to select the smoothing bandwidth. From the kernel density estimate, the number of local maxima (i.e. peaks) within the density function were identified. The number of peaks thus represents the number of variant frequency clusters for an individual sample, which is an approximation for the clonality of the tumors.
[0148] Coding frame analysis: For coding frame and exonic/intronic analysis, only indels that were associated with a sgRNA which had been considered significantly mutated in that particular sample were considered. This final set of significant indels was converted to .avinput format and subsequently annotated using ANNOVAR v. 2016 Feb. 1, using default settings (Wang et al., 2010, Nucleic Acids Res 38).
[0149] Co-occurrence and correlation analysis: Co-occurrence analysis was performed by first generating a double-mutant count table for each pairwise combination of genes in the mTSG library. Statistical significance of the co-occurrence was assessed by hypergeometric test. For correlation analysis, the % variant frequency tables was collapsed on the gene level (in other words, summing the % variant frequencies for all 5 of the targeting sgRNAs for each gene). Using these summed % variant frequency values, the Pearson correlation was calculated between all gene pairs, across each mTSG sample. Statistical significance of the correlation was determined by converting the correlation coefficient to a t-statistic, and then using the t-distribution to find the associated probability. A similar approach was used to analyze co-occurring mutations in human TCGA GBM data.
[0150] Testing driver combinations with sgRNA minipool: Mixtures of five sgRNAs targeting each gene were cloned as sgRNA minipool into the same astrocyte-specific AAV-CRISPR vector. For gene pair targeting, the five-sgRNA single gene minipools from both genes were mixed 1:1. Plasmid mixes were then packaged into AAV. Briefly, HEK293FT cells were transfected with the minipools plasmids, pAAV1 plasmid, pAAV2 plasmid, helper plasmid pDF6, and PEI Max (Polysciences, Inc. 24765-2) in DMEM (ThermoFisher, 10569-010). 72 hours post transfection, cell culture media was discarded and cells were rinsed and pelleted via low speed centrifugation. Cells were then lysed and the supernatant containing viruses was applied to HiTrap heparin columns (GE Biosciences 17-0406-01) and washed with a series of salt solutions with increasing molarities. During the final stages, the eluates from the heparin columns were concentrated using Amicon ultra-15 centrifugal filter units (Millipore UFC910024). Titering of viral particles was executed by quantitative PCR using custom Cre-targeted Taqman probes (ThermoFisher). After packaging, AAV minipools were stereotaxically injected into the ventricle of LSL-Cas9 mice. Survival and histology analysis followed injection as described above. Several control (uninjected, EYFP and vector) mice were sacrifice as surrogate histology although they were in good body condition and were subsequently found devoid of tumor.
[0151] Generation of Nf1 and Rb1 mutant cell lines from primary GBMs induced by AAV-CRISPR minipools: Autochthonous mouse GBMs were induced by stereotaxic injection with the Nf1 or Rb1 AAV minipool (in the AAV9-sgTrp53-sgX-GFAP-Cre vector described above). Tumor-containing brains were visually inspected under a fluorescent dissecting scope, made into single-cell suspension through physical dissociation plus Collagenase/DNase digestion, and cultured in DMEM supplemented with 10% FBS and Pen/Strep. Growing clones were further established as autochthonous mouse GBM cell lines.
[0152] Single sgRNA knockout lentiviral production: Lenti-pHKO-U6-sgBsmBI-EF1 a-Puro-P2A-FLuc was generated by subcloning P2A-Fluc expression cassette into a lentiviral CRISPR knockout vector by Gibson assembly. For the cloning of sgRNA targeting individual genes such as Pten, Arid1b, Mll3 (Kmt2c), B2m, and Zc3h13, the corresponding oligos were synthesized, annealed and cloned into BsmBI linearized lentiviral knockout vector. Lentiviruses were produced by transfecting lentiviral knockout plasmids, together with pMD2.G and psPAX2 into 80-90% confluent HEK293FT cells, with viral supernatants collected 48 and 72 h post-transfection, aliquoted and stored in 80 C.
[0153] Generation of NF1+geneX and RB1+geneX knockout cell line: The Nf1 and Rb1 knockout tumor cells were infected by single sgRNA knockout lentiviruses at M.O.I<=0.3 to further knockout desired geneX. 24 h post-infection, lentiviral transduced cells were selected by the addition of 4-8 g/ml puromycin and were split 2-3 days.
[0154] Temozolomide (TMZ) treatment, Cell viability assay, and RNAseq: After 7-9 days' culture under puromycin selection, lentiviruses-infected Nf1 and Rb1 knockout tumor cells were plated in triplicates into 96-well plate at a density of 2.510.sup.3 cells per well, and 510.sup.6 cells were collected at the same time and used for cutting efficiency analysis. One day after plating, either TMZ or DMSO was added at a concentration of 10 M, 100 M, 500 M, 1 mM, and 2 mM. After 3 days of drug/vehicle treatment, cell viability was measured using CellTiter Glo (Promega) according to the manufactures' protocol. Briefly, the CellTiter Glo was equilibrated at room temperature for 1 h before use. The media of 96-well plates was aspirated, and then 50 L fresh DMEM+10% FBS and 50 L CellTiter Glo was added. The luminescent signals were readout using EnVision plate reader (PerkinElmer). For RNAseq samples preparation, cell lines harboring specific gene knockouts were cultured for 7-9 days under the selection pressure of puromycin, and then plated into 6-well plates at a density of 210.sup.5 cells per well in triplicates. 24 h after plating, 1 mM TMZ or DMSO in fresh DEME+10% FBS was added and cultured for another 48 h. Then, cellular RNA of control or treated cells were extracted by adding 350 L TRIzol Reagent (Invitrogen) directly into 6-well plates to lyse the cells, followed by gently shaking the plates and incubation for 5-10 min to complete and lysis and homogenization. Then, 70 L chloroform was added, vigorously mixed, and centrifuged at 16,000 g for 15 min. Transfer the RNA containing aqueous phase to a new tube and further purified using RNeasy mini kit (Qiagen). After eluting RNA from column using Nuclease free water, the concentrations of sample RNA were normalized into 150-300 ng/uL for RNAseq.
[0155] T7 Endonuclease I (T7E1) Assays: The genomic DNA of these cells that were collected after 9 days of puromycin selection was extracted by using QuickExtract DNA Extraction Solution (Epicentre), mixed well and incubated at 65 C. for 30-60 min. Then, 1-2 L of genomic DNA from parental or Lenti-sgRNA transduced cells was used as the template to amplify gene of interest using surveyor primers with thermocycling conditions as 98 C. for 1 min, 35 cycles of (98 C. for 1 s, 60 C. for 5 s, 72 C. for 10 s), and 72 C. for 1 min. The PCR products were gel-purified using QIAquick Gel Extraction Kit from 2% E-gel EX and quantified, followed by PCR products denaturing at 95 C. for 5 min, and annealing by using following conditions: ramp from 95 to 85 C. at a rate of 2 C. per seconds; from 85 C. to 25 C. at a rate of 0.1 C. per second, and 4 C. hold. 1 L of T7 endonuclease I was added into annealed oligo, and incubated at 37 C. for 60 min to digest the mismatched sites. The digested PCR products were loaded into 2% E-gel EX, and the amount of DNA fragments were quantified. The cutting efficiency was calculated to estimate gene editing using the following formula: Indels (%)=100 (1(1-fraction cleaved)).
[0156] Transcriptome profiling of different driver combinations in the presence and absence of chemotherapy: Mixtures of five sgRNAs targeting each gene were cloned as sgRNA minipool into the same astrocyte-specific AAV-CRISPR vector. After packaging, AAV minipools were stereotaxically injected into the lateral ventricle of LSL-Cas9 mice. Cell lines were derived from mouse GBMs by single-cell isolation, plating and culture in DMEM media. Additional driver mutations were introduced by lentiCRISPR where applicable. GBM cells with different drivers were treated with DMSO or TMZ for 48 h, and harvested for mRNA-seq for transcriptome profiling. Briefly, total RNA was extracted from cancer cells derived from AAV-CRISPR minipools induced GBM treated with DMSO or TMZ, using commercially available kits (Qiagen/Thermofisher). PolyA-mRNA library was constructed using Illumina TruSeq mRNA library prep kit, and sequenced on Illumina Hiseq 2500 and/or Hiseq 4000 platform.
[0157] RNA-seq differential expression analysis: Strand-specific single-end RNA-seq read files were analyzed to obtain transcript level counts using Kallisto, with the settings --rf-stranded -b 100. The counts were subsequently passed to the tximport R package to collapse to gene level counts. Pairwise differential expression analysis between groups was then performed using edgeR with default settings.
[0158] Pathway enrichment analysis of differentially expressed transcripts: Using an adjusted p-value cutoff of 0.05, and a log fold change threshold of 1, we determined the set of genes that were significantly upregulated or downregulated. We then used the resultant gene sets for DAVID functional annotation analysis. We considered a GO category as statistically significant if the Benjamini-Hochberg adjusted p-value was less than 0.05.
[0159] GBM comparative cancer genomics analysis using TCGA datasets: Somatic mutation calls, copy number variation calls, RNA-seq expression z-scores, and clinical data containing patient survival information were obtained through cBioPortal for GBM on Nov. 15, 2016. Pearson correlation coefficients were calculated comparing mouse and human mutation frequencies; statistical significance was calculated by converting the correlation coefficient to a t-statistic, and then using the t-distribution to calculate significance.
[0160] GBM comparative cancer genomics analysis using Yale Glioma datasets: Somatic mutation calls and copy number variation calls and partial clinical data containing diagnostic information were obtained from Yale Glioma tissue bank and data bank. All patient samples were de-identified. Total event for each patient was calculated as the sum of mutation events and copy number variant events. Pearson correlation coefficients were calculated comparing mouse and human mutation frequencies; statistical significance was calculated by converting the correlation coefficient to a t-statistic, and then using the t-distribution to calculate significance.
[0161] Histology analysis of clinical GBM samples from Yale Glioma tissue bank: Histology sections were obtained from the Yale Glioma tissue bank. All patient samples were de-identified. The mutations associated with specific samples were obtained from the Yale Glioma data bank. Slides stained with H&E or anti-GFAP were subsequently scanned using a slidescanner (Leica) and subjected to pathological analysis.
[0162] Statistical tests: In addition to the statistical tests detailed above, a two-tailed Welch's t-test was used for comparisons in which group variances were unequal. If the variances were found to be sufficiently equal and the data was normally distributed, a standard two-tailed t-test was used. For evaluating differences in the incidence of tumors in different groups, Fischer's exact test was used.
[0163] Data accession: Genomic sequencing (targeted capture, exome) and RNA-seq data have all been deposited in NCBI SRA (project PRJNA393202): targeted capture sequencing (SUB2842710), RNA-seq (SUB2843781), and exome sequencing (SUB2843864). CRISPR reagents (AAV-CRISPR and lentiCRISPR backbone plasmids and mTSG libraries) are available to the academic community and have been submitted through Addgene.
[0164] The results of the experiments are now described.
Example 1: Sterotaxic Injection of an AAV-CRISPR Library Drives Robust Gliomagenesis
[0165] To directly test the function of putative SMGs in the mouse brain, a direct in vivo autochthonous screening strategy was developed, which necessitates pooled mutagenesis of normal cells directly in the native organ and subsequent deconvolution of mutant phenotypes. Based on pan-cancer analysis of mutations in The Cancer Genome Atlas (TCGA) (Davoli et al., 2013, Cell 155, 948-962; Kandoth et al., 2013, Nature 502, 333-339; Lawrence et al., 2014, Nature 505, 495-501; Lawrence et al., 2013, Nature 499, 214-218), a set of the 50 most significantly mutated tumor suppressor genes (TSG) across all cancer types was chosen, and their mouse homologs retrieved (49 genes, one without homolog) (mTSG). An sgRNA library (mTSG library) was designed against these 49 genes together with 7 genes with essential molecular functions as internal controls, with 5 sgRNAs per gene, plus 8 non-targeting controls (NTCs), totaling 288 sgRNAs (
[0166] Because GBM is a disease originating from astrocytes, an AAV-CRISPR vector encoding a Glial fibrillary acidic protein (GFAP) promoter driving Cre recombinase for conditional expression of Cas9-GFP in astrocytes was generated. Conditional expression of Cas9 and GFP in astrocytes is achieved when injected into a conditional Rosa26-LSL-Cas9-GFP mouse (LSL-Cas9 mouse) (
[0167] The overall survival of a cohort of LSL-Cas9 mice injected with AAV-mTSG, AAV-vector or PBS was analyzed (
[0168] For several AAV-mTSG mice at the time of euthanasia, together with time-matched cohorts of AAV-vector or PBS injected, or uninjected mice, the brains of these mice were dissected and examined under a fluorescent stereoscope. In accordance with the prior MRI analysis, AAV-mTSG mice had massive GFP-positive tumors that deformed the brains (100% or 6/6) (
[0169] Endpoint histopathology showed that the vast majority of AAV-mTSG mice developed brain tumors ( 10/11=91%), whereas none of AAV-vector ( 0/7=0%) or PBS ( 0/3=0%) mice had detectable tumors, as shown by endpoint histopathology analysis (two-tailed Fischer's exact test: p=0.0003, mTSG vs. vector; p=0.011, mTSG vs. PBS (
Example 2: Targeted Capture Sequencing Reveals Diverse Mutational Profiles Across Tumors
[0170] Because AAVs usually do not integrate into the genome, direct sequencing of the targeted regions was needed to determine which mutations were in each tumor. To globally map the molecular landscape of these brain tumors, a customized probe set was designed (mTSG-Amplicon probes) covering the targeted regions of all library sgRNAs (
[0171] The mutant variants were analyzed at the predicted cutting sites of the 277 successfully captured sgRNAs across all samples. At the single sgRNA level, for example, at the predicted cutting site of sgRNA-4 in the Mixed-linkage leukemia protein 2 (Mll2) locus (also called histone-lysine N-methytransferase 2D, Kmt2d), various insertions and deletions (indels) were detected in AAV-mTSG but not AAV-vector or PBS mice (
[0172] By applying a statistical analysis of mutational significance compared to samples from PBS and AAV-vector injected mice (false discovery rate (FDR)<= 1/12, or 8%), significantly mutated sgRNA sites (SMSs) were identified across all AAV-mTSG and AAV-vector samples (Table 4). Different mice showed radically different mutational landscapes (
[0173] As gliomagenesis takes multiple months in mice (
[0174] The mutational data from the SMS level to the mSMG level was summarized, and co-mutation analysis of this functional map of tumor suppressors was performed in mouse GBM. The number of SMSs ranged from 3 to 46, with mSMGs ranging from 3 to 33 (excluding the two samples with zero SMSs). A pairwise map of co-occurrence of mSMGs was generated, and the number of double-mutant samples in each pair of genes calculated, as well as the statistical significance of their co-occurrence compared to random chance (
[0175] In addition, correlation analysis of mutant frequencies of each pairs of tumor suppressors across all individual mice was performed (
[0176] The mutational data was summarized from the SMS level to the mSMG level and an oncomap of all mTSG brain samples was created (
[0177] Six mSMGs were mutated in more than half of the mice, including Pten, Nf1, Pik3r1, Cdkn1b, B2m, and Trp53 (
[0178] Mutational frequencies in mice were compared to the variant frequencies of their homologous genes in human GBM with their frequencies of non-silent mutation and deletion. For these 56 genes, the mutation frequencies in mouse GBMs (an end-product of pooled mutagenesis and in vivo gliomagenesis) significantly correlated with the mutation frequencies in TCGA GBM patients (Pearson correlation R=0.402, p=2.1*10.sup.3) (
Example 3: Co-Mutation Analysis Identifies Frequently Co-Occurring Driver Combinations
[0179] To generate an unbiased map of co-drivers, the co-occurrence rate of double-mutations for each gene pair we calculated (
Example 4: Minipool Validation of Individual Drivers and Combinations
[0180] Several of the highly represented individual drivers or combinations were tested using an sgRNA minipool validation approach (
[0181] Interestingly, brain tumors with Nf1 mutations displayed highly polymorphic pathological features, with diverse fibroblastic cell morphologies, regions of necrosis and large hemorrhages (
Example 5: Transcriptomic Characterization of Tumors with Differing Mutational Backgrounds
[0182] The molecular underpinnings of gliomagenesis driven by different combinations of drivers was investigated (
[0183] To understand the direct effect of additional mutations on the transcriptome of these cells, Nf1; ; Mll3 were compared to Nf1 cells, and Rb1; Zc3h13 were compared to Rb1 cells. 522 genes were upregulated in Nf1; Mll3 compared to Nf1 cells, while 175 were downregulated (
Example 6: Secondary Mutations Influence the Transcriptome and Engender Chemotherapeutic Resistance
[0184] As GBM remains a challenging cancer type to treat, understanding the molecular changes underlying drug response is of profound importance. Thus, drug-treatment-RNA-seq experiments were performed to investigate the transcriptome responses of AAV-CRISPR-induced GBM cells (Rb1, Rb1; Pten and Rb1; Zc3h13) to TMZ, a chemotherapeutic with significant albeit small survival benefit for GBM patients, among the only 4 currently approved drugs for this disease (
[0185] Of the genes that were significantly reduced upon TMZ treatment in each group, a total of 69 genes were shared among all three genotypes (
Example 7: Discussion
[0186] GBM is one of the most lethal cancer types, and is the major malignancy in the human brain. Currently, identifying mutations that are cancer drivers in patients is not straightforward or necessarily accurate, as they are often inferred from mutation type or frequency. Determining whether these alterations are bona fide driver mutations requires direct functional testing, but such testing is generally performed one gene at a time in cell lines or mouse models. Animal models of cancer in the past several decades have significantly advanced our understanding of the roles of oncogenes, tumor suppressor genes and other modulating factors in cancer progression and therapeutic responses. Development and applications of mouse models of GBM have led to profound progress in our understanding of tumor initiation, stem cell populations, progression and therapeutic responses of GBM. However, animal studies to date are limited to small numbers of genes. Direct in vivo high-throughput mutational analysis of functional cancer drivers in the mouse brain has been difficult, due to the nature of biological complexity in vivo. It is challenging to perform high-throughput analysis of mutants in autochthonous models of cancer; that is, models in which the tumors directly evolve from normal cells at the organ site in situ in immunocompetent mice and without cellular transplantation.
[0187] This challenge has been overcome herein by developing a focused AAV-CRISPR library with AAV encoding functional elements and sgRNA pools targeting a top pan-cancer putative TSG set, in combination with the conditional LSL-Cas9 transgenic mice. Herein, a powerful platform was developed to perform high efficiency AAV-CRISPR mediated pooled mutagenesis for direct in vivo analysis of many genes in mice. AAV usually does not integrate into the genome, except under certain circumstances (low rate of integration at AAVS1 locus). Thus, AAV-encoded transgenes such as exogenously supplied sgRNAs do not replicate as cells divide during tumor progression, limiting the direct readout of mTSG library by PCR amplification of the sgRNA cassette itself. Successful readout of driver mutations in the targeted genes was achieved by directly sequencing the predicted sgRNA cutting sites for indels using targeted captured sequencing at high coverage. The approach of AAV-CRISPR mediated pooled mutagenesis in conjunction with targeted capture sequencing provides an efficient platform for massively parallel analysis of GBM drivers directly in vivo. The AAV-CRISPR genetically engineered mouse tumor models described herein were developed in fully immunocompetent mice, preserve the native tumor microenvironment, and therefore can be used in high-throughput screening of immunotherapy responses in vivo.
[0188] With this platform, high-throughput gene editing was demonstrated in multiplexed autochthonous GBM models in fully immunocompetent mice. This study provides a dynamic picture of tumor suppressors in vivo, revealing the relative selective strength of mutations in these genes when competing together in the astrocytes in the brain, as well as the oncotypic variations between individuals. Moreover, co-occurrence analysis revealed strongly enriched combinations of mSMGs that far exceeded what would be expected by chance. These include well-documented combinations (e.g. Nf1-Pten), indicating technological robustness and disease relevance, as well as previously unexpected functional combinations (e.g. Gata3-Kdm5c, B2m-Pik3r1) with unknown molecular mechanisms for the selection forces that evidently favor them.
[0189] Across all genes tested, the mutation frequencies in this highly complex mouse model of GBM significantly correlate with the mutation frequencies in human patients from two large independent cohorts (TCGA and Yale Glioma bank), suggesting the clinical relevance of the findings. Several of the novel SMGs highly enriched in this mouse study have also been associated with GBM in the clinical setting, such as B2M, CIC, MLL2, MLL3, SETD2, ZC3H13 and ARID1B. Because differences in driver mutations can dramatically affect treatment efficacies in pre-clinical animal models and in patients, a functional understanding of cancer drivers is therefore essential for precision medicine.
[0190] A lentiCRISPR direct in vivo screen was also performed in GBM, using the same mTSG library (
[0191] Taken altogether, this study provides a systematic and unbiased molecular landscape of functional tumor suppressors in an autochthonous mouse model of GBM, opening the path for high-throughput analysis of cancer gene phenotypes directly in vivo.
Other Embodiments
[0192] The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
[0193] The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.