NOVEL MONOOXYGENASE AND UTILIZATION THEREOF

Abstract

An enzyme protein that allows production of an optically active -hydroxyamino acid, specifically a monooxygenase having two kinds of hetero (different) subunits. Also, systems and methods using the monooxygenases.

Claims

1. An isolated monooxygenase comprising two different hetero subunits.

2. The monooxygenase according to claim 1, wherein the monooxygenase catalyzes a reaction for converting an -amino acid or ,-disubstituted amino acid into a -hydroxyamino acid.

3. The monooxygenase according to claim 2, wherein the -amino acid or ,-disubstituted amino acid is a compound represented by Formula (1) below: ##STR00007## where R.sup.1 and R.sup.2 are each independently a hydrogen or CH.sub.3, and the -hydroxyamino acid is a compound represented by Formula (2) below: ##STR00008## where R.sup.3 and R.sup.4 are each independently a hydrogen or CH.sub.3.

4. The monooxygenase according to claim 2, wherein the monooxygenase catalyzes at least one of respective reactions represented by Formula (3) to (7) below which reactions are each for converting the -amino acid or ,-disubstituted amino acid into the -hydroxyamino acid, ##STR00009##

5. The monooxygenase according to claim 1, wherein the two hetero subunits are an subunit and a subunit, wherein the subunit comprises a protein selected from the group consisting of (a), (b), (c), and (d) below, and wherein the subunit comprises a protein selected from the group consisting of (e), (f), (g), and (h) below, (a) a protein comprising the amino acid sequence represented by SEQ ID NO:1; (b) a protein comprising the amino acid sequence of SEQ ID NO:1 with substitution, deletion, insertion, and/or addition of one (1) or several amino acid residues, a subunit including the protein (b) having monooxygenase activity in a case where the subunit including the protein (b) has formed a complex together with the subunit; (c) a protein comprising an amino acid sequence having a homology of not less than 80% with respect to the amino acid sequence represented by SEQ ID NO:1, a subunit including the protein (c) having monooxygenase activity in a case where the subunit including the protein (c) has formed a complex together with the subunit; (d) a protein encoded by a gene sequence represented by SEQ ID NO:6; (e) a protein comprising the amino acid sequence represented by SEQ ID NO:2; (f) a protein comprising the amino acid sequence of SEQ ID NO:2 with substitution, deletion, insertion, and/or addition of one (1) or several amino acid residues, a subunit including the protein (f) having monooxygenase activity in a case where the subunit including the protein (f) has formed a complex together with the subunit; (g) a protein comprising an amino acid sequence having a homology of not less than 80% with respect to the amino acid sequence represented by SEQ ID NO:2, a subunit including the protein (g) having monooxygenase activity in a case where the subunit including the protein (g) has formed a complex together with the subunit, and (h) a protein encoded by a gene sequence represented by SEQ ID NO:7.

6. A monooxygenase reaction system for producing a -hydroxyamino acid, the system comprising: a monooxygenase according to claim 1; and an electron transport chain protein.

7. The monooxygenase reaction system according to claim 6, wherein the electron transport chain protein comprises a protein selected from the group consisting of (i), (j), (k), and (l) below and a protein selected from the group consisting of (m), (n), (o), and (p) below, (i) a protein comprising the amino acid sequence represented by SEQ ID NO:3; (j) a protein comprising the amino acid sequence of SEQ ID NO:3 with substitution, deletion, insertion, and/or addition of one (1) or several amino acid residues, the protein (j) having electron transport activity in a case where the protein (j) has been combined with a protein selected from the group consisting of (m), (n), (o), and (p) below; (k) a protein comprising an amino acid sequence having a homology of not less than 80% with respect to the amino acid sequence represented by SEQ ID NO:3, the protein (k) having electron transport activity in a case where the protein (k) has been combined with a protein selected from the group consisting of (m), (n), (o), and (p) below; (l) a protein encoded by a gene sequence represented by SEQ ID NO:8; (m) a protein comprising the amino acid sequence represented by SEQ ID NO:4; (n) a protein comprising the amino acid sequence of SEQ ID NO:4 with substitution, deletion, insertion, and/or addition of one (1) or several amino acid residues, the protein (n) having electron transport activity in a case where the protein (n) has been combined with a protein selected from the group consisting of (i), (j), (k), and (l) above; (o) a protein comprising an amino acid sequence having a homology of not less than 80% with respect to the amino acid sequence represented by SEQ ID NO: 4, the protein (o) having electron transport activity in a case where the protein (o) has been combined with a protein selected from the group consisting of (i)(j), (k), and (l) above; and (p) a protein encoded by a gene sequence represented by SEQ ID NO:9.

8. A monooxygenase gene encoding the monooxygenase of claim 1.

9. A recombinant vector comprising a gene according to claim 8.

10. A transformant comprising a gene according to claim 8.

11. The transformant according to claim 10, further comprising: (1) a gene encoding an electron transport chain protein; and/or (2) a gene encoding a transporter protein.

12. The transformant according to claim 11, wherein the electron transport chain protein comprises a protein selected from the group consisting of (i), (j), (k), and (l) below and a protein selected from the group consisting of (m), (n), (o), and (p) below, (i) a protein comprising the amino acid sequence represented by SEQ ID NO:3; (j) a protein comprising the amino acid sequence of SEQ ID NO:3 with substitution, deletion, insertion, and/or addition of one (1) or several amino acid residues, the protein (j) having electron transport activity in a case where the protein (j) has been combined with a protein selected from the group consisting of (m), (n), (o), and (p) below; (k) a protein comprising an amino acid sequence having a homology of not less than 80% with respect to the amino acid sequence represented by SEQ ID NO:3, the protein (k) having electron transport activity in a case where the protein (k) has been combined with a protein selected from the group consisting of (m), (n), (o), and (p) below; (l) a protein encoded by a gene sequence represented by SEQ ID NO:8; (m) a protein comprising the amino acid sequence represented by SEQ ID NO:4; (n) a protein comprising the amino acid sequence of SEQ ID NO: 4 with substitution, deletion, insertion, and/or addition of one (1) or several amino acid residues, the protein (n) having electron transport activity in a case where the protein (n) has been combined with a protein selected from the group consisting of (i), (j), (k), and (l) above; (o) a protein comprising an amino acid sequence having a homology of not less than 80% with respect to the amino acid sequence represented by SEQ ID NO:4, the protein (o) having electron transport activity in a case where the protein (o) has been combined with a protein selected from the group consisting of (i), (j), (k), and (l) above; and (p) a protein encoded by a gene sequence represented by SEQ ID NO:9.

13. The transformant according to claim 11, wherein the transporter protein is a protein selected from the group consisting of (q), (r), (s), and (t) below, (q) a protein comprising the amino acid sequence represented by SEQ ID NO:5; (r) a protein comprising the amino acid sequence of SEQ ID NO:5 with substitution, deletion, insertion, and/or addition of one (1) or several amino acid residues, the protein (r) having transport activity; (s) a protein comprising an amino acid sequence having a homology of not less than 80% with respect to the amino acid sequence represented by SEQ ID NO:5, the protein (s) having transport activity; and (t) a protein encoded by a gene sequence represented by SEQ ID NO:10.

14. The transformant according to claim 10, wherein the transformant is a Rhodococcus bacterium.

15. A method for producing a -hydroxyamino acid, the method comprising the step of: culturing a transformant according to claim 10 in a medium comprising an -amino acid or an ,-disubstituted amino acid.

16. The method according to claim 15, wherein a gene according to claim 8 is derived from Rhodococcus.

17. A Rhodococcus wratislaviensis C31-06 strain, a representative culture of the strain having been deposited with the National Institute of Technology and Evaluation (NITE) under accession number NITE BP-02370.

18. A transformant comprising a recombinant vector according to claim 9.

19. The transformant according to claim 18, further comprising: (1) a gene encoding an electron transport chain protein; and/or (2) a gene encoding a transporter protein.

20. The transformant according to claim 18, wherein the transformant is a Rhodococcus bacterium.

Description

EXAMPLES

Example 1

Isolation of 2-Aminoisobutyric Acid-Utilizing Microorganism and Evaluation of Hydroxylation Activity

[0190] With use of 2 ml of a liquid medium for accumulation which liquid medium included 0.1% 2-aminoisobutyric acid, 0.1% ammonium chloride, 0.1% potassium dihydrogenphosphate, 0.1% dipotassium hydrogenphosphate, 0.03% magnesium sulfate heptahydrate, and 0.01% Difco Yeast Nitogen Base w/o Amino Acids and Ammoniumu Sulfate, various samples of soil collected from the natural world were shake-cultured at 28 C. for 5 days (the concentration is expressed in (w/v)% [the same applies throughout the Examples]). A culture solution in which a microorganism was starting to grow was inoculated into 2 ml of fresh liquid medium for accumulation. After this operation was carried out several times, a 2-aminoisobutyric acid-utilizing microorganism was isolated from a 1.5% agar plate medium prepared with 1.5% agar plate medium containing the same components as the above liquid medium. Each isolated microorganism was inoculated again in 2 ml of a liquid medium for accumulation, and was shake-cultured at 28 C. for 5 days. Then, a centrifugal operation was carried out at 8000 g for 10 minutes to collect bacteria. The bacteria were washed twice with a 0.85% saline solution. The wet cell was used for a resting microorganism reaction below. The resting microorganism reaction was carried out by shaking the mixture of 10 mM of 2-aminoisobutyric acid, 10 mM of glucose, 1 mM of aminooxyacetic acid, and 5% wet cell in 50 mM of HEPES buffer (pH 7.5) at 300 rpm for 4 hours.

[0191] The results are shown in Table 1. Table 1 indicates production of -methyl-D-serine in three kinds of microorganisms.

TABLE-US-00001 TABLE 1 Accession number for Specific Strain international deposit Species activity.sup.1 % e.e..sup.2 C31-06 NITE BP-02370 Rhodococcus 0.14 88.2 wratislaviensis C63-06 Rhodococcus 0.053 85.4 wratislaviensis C86-07 Nocardia 0.24 67.9 globerula .sup.11 nmol of MeSer per min per mg of wet cell .sup.2Enantiomeric excess of -methyl-D-serine

[0192] <Analysis Conditions> [0193] Measurement device: LCMS-2010A (Shimadzu Corporation) [0194] Column: Xbridge C18 column (5 m: 2.1150 mm) (Nihon Waters K.K.) [0195] Column oven temperature: 40 C. [0196] Mobile phase A: 10 mM of ammonium acetate (pH 5.0) [0197] Mobile phase B: methanol [0198] Flow rate: 0.3 ml/min [0199] Gradient setting: 0 to 0.5 min, 0 to 1% mobile phase B; 0.5 to 18 min, 1 to 5% mobile phase B; 18 to 19 min, 5 to 9% mobile phase B; 19 to 29.5 min, 9 to 17% mobile phase B; 29.5 to 40 min, 17 to 60% mobile phase B [0200] MS condition: block temperature: 200 C., Curved desolvation line temperature: 250 C., Detector voltage: 1.5 kV, nebulizing gas flow: 1.51 /min

[0201] An amino acid in an analysis solution was derivatized with use of AccQ-Tag derivation kit (Nihon Waters K.K.), and was then subjected to LCMS analysis.

Example 2

Proteome Analysis of R. wratislaviensis C31-06 Strain

[0202] R. wratislaviensis C31-06 strains were each cultured at 28 C. for 38.5 hours with use of 250 ml of 2-aminoisobutyric acid-induced liquid medium (0.1% 2-aminoisobutyric acid, 0.1% ammonium chloride, 0.1% potassium dihydrogenphosphate, 0.1% dipotassium hydrogenphosphate, 0.03% magnesium sulfate heptahydrate, and 0.01% Difco Yeast Nitogen Base w/o Amino Acids and Ammoniumu Sulfate) or 250 ml of a non-induced medium (which was identical to a 2-aminoisobutyric acid-induced liquid medium except that 0.1% 2-aminoisobutyric acid was replaced with 0.05% glucose) (for each, n=3). Each cultured bacterial cell was collected through centrifugation at 4 C. and 8000 g for 10 minutes, and was suspended in 50 mM of a Tris-HCl (pH8.0) buffer including 7M of urea, 2.0 mM of thiourea, 2% CHAPS, 10 mM of dithiothreitol, and 1 tablet/10 ml of protease inhibitor (Complete Mini, Roche). Then, 0.10-mm beads were added. The bacterial cell was crushed with use of Multi Beads Shocker. Then, the bacterial cell was centrifuged at 4 C. and 20000 g for 15 minutes. The centrifugal supernatant obtained was used as a cell lysate. The precipitate was washed with a minimum amount of 200 mM of TEAB buffer (pH 8.0). The supernatant and the cell lysate together were filtered through a 0.45 m filter. Next, the filtrate was substituted with 200 mM TEAB buffer. Then, 9.5 mM of tris(2-carboxyethyl)phosphine was added to the substituted filtrate for treatment at 55 C. for 60 minutes. After that, iodoacetamide was added in an amount of 17.9 mM for treatment at room temperature for 30 minutes. Finally, cold acetone was added in an amount 2 to 4 times larger for treatment at 20 C. for 3 hours. The resulting product was centrifuged at 4 C. and 13000 g for 10 minutes for collection of protein. The remaining acetone was removed through treatment at 37 C. for 2 minutes.

[0203] Next, tryptic digestion of the protein was carried out. Specifically, the collected protein was suspended in 200 mM of TEAB buffer, and was then digested with use of 47.6 ng/l of trypsin at 37 C. overnight. After that, the resulting digest was labeled in 41 l of acetonitrile with use of tandem mass tag (TMT) 6-plex labeling kit (Thermo Fisher Scientific). The digest reacted at room temperature for 60 minutes. Then, 8 l of 5% hydroxylamine was added, and was mixed for 15 minutes. Next, the liquid was evaporated in a vacuum. Then, the remainder was dissolved in 100 l of 0.1% trifluoroacetic acid.

[0204] The resulting protein having undergone tryptic digestion was subjected to LCMS analysis (Prominence Nano Flow System [Shimadzu Corporation]). The induced protein was identified with use of the mass spectrometry data obtained and Protein Discover Software (Thermo Scientific) including a protein database prepared on the basis of genomic information for the R. wratislaviensis C31-06 strain (obtained from Hokkaido System Science). The results are shown in Table 2.

TABLE-US-00002 TABLE 2 Protein ID logFC Annotated function peg.3201 3.88 hypothetical protein peg.812 3.64 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) peg.800 3.2 D-serine/D-alanine/glycine transporter peg.1024 3.05 FIG00821579: hypothetical protein peg.3348 2.99 CAIB/BAIF family protein peg.795 2.98 Alanine racemase (EC 5.1.1.1) peg .2135 2.83 Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis peg.2853 2.8 FIG00995544: hypothetical protein peg.8283 2.65 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) peg.7342 2.63 OsmC family protein peg.5085 2.58 Pyruvate dehydrogenase E1 component beta subunit (EC 1.2.4.1) peg.803 2.57 bll7611; hypothetical protein peg.4183 2.56 Iron utilization protein peg.8589 2.44 Ferric enterobactin-binding periplasmic protein FepB (TC 3.A.1.14.2) peg.807 2.35 hypothetical protein peg.798 2.32 Alanine dehydrogenase (EC 1.4.1.1) peg.806 2.31 Aldehyde dehydrogenase (EC 1.2.1.3) peg.3349 2.28 Aldehyde dehydrogenase (EC 1.2.1.3) peg.804 2.24 bll7611; hypothetical protein peg.799 2.2 Serine hydroxymethyltransferase (EC 2.1.2.1) peg.801 2.18 Flavodoxin reductases (ferredoxin- NADPH reductases) family 1 peg.8070 2.09 18 kDa antigen 2 peg.802 2.09 rieske [2Fe2S] domain protein peg .4813 2.04 peptide monooxygenase logFC was calculated by 10g2(induced area protein amount-non-induced area protein amount)

[0205] <Analysis Conditions> [0206] Measurement device: Prominence Nano Flow System (Shimadzu Corporation) [0207] Column: Monolithic silica capillary column (500 cm long, 0.1 mm ID) (Kyoto Monotech) [0208] Column oven temperature: 40 C. [0209] Mobile phase A: 0.1% aqueous formic acid solution [0210] Mobile phase B: 0.1% formic acid in acetonitrile [0211] Flow rate: 500 ml/min [0212] Gradient setting: 0 to 600 min, 5 to 45% mobile phase B [0213] MS condition: LTQ Velos linear ion trap mass spectrometer (Thermo Scientific), 2.3 kV of ESI voltage, temperature of ion transfer tube on LTQ Velos ion trap: 280 C.

Example 3

Identification of 2-Aminoisobutyric Acid Hydroxylase and Electron Transport Chain Protein

[0214] The proteins obtained in Example 2 and having Protein ID peg.801-804 were each expected to be a complex for catalyzing a 2-aminoisobutyric acid hydroxylation reaction. Thus, a gene encoding the protein was obtained as below.

[0215] Specifically, PCR was carried out under the PCR conditions below to obtain PCR products for peg.801-804.

[0216] <PCR Conditions> [0217] Template: genome of R. wratislaviensis C31-06 strain (100 ng/l, 1 l) [0218] Polymerase: PrimeSTAR Max Premix (2) (Takara Bio Inc.) (25 l)

TABLE-US-00003 Primer(pTipQC1_5 Hyd): (SEQIDNO:11) TGTTTAACTTTAAGAAGGAGATATACCATGGTTGCACCAACCTC GAA(10M,1l) Primer(pTipQC1_3 Hyd): (SEQIDNO:12) TGGTGATGGTGATGCTCGAGAGATCTACTAGAGATCGAGGACG AGCC(10M,1l) [0219] Amplification condition: 30 cycles of 98 C., 10 seconds; 55 C., 5 seconds; and 72 C., 1 minute

[0220] The PCR product was inserted, with use of NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs), into a vector pTipQC1 (Hokkaido System Science) treated with restriction enzymes NcoI and HindIII. Next, E. coli JM109 was transformed with use of the plasmid pQAH1. The transformant was cultured at 28 C. overnight in 2 ml of LB medium (including 50 g/ml of ampicillin). pQAH1 was obtained from the bacterial cell, and then Rhodococcus erythropolis L88 (Hokkaido System Science) was transformed with use of the plasmid. The transformant was cultured at 28 C. overnight in 2 ml of LB medium (including 20 g/ml of chloramphenicol). Part of the culture solution was added to 2 ml of fresh LB medium (including 20 g/ml of chloramphenicol), and was shake-cultured at 28 C. After the turbidity of the culture solution reached 0.8 (absorption wavelength: 600 nm), thiostrepton was added at a concentration of 0.2 g/ml for the purpose of inducing expression of a protein. Next, 2-aminoisobutyric acid was added at a concentration of 10 mM as a reactive substrate. Shaking reaction was then started.

[0221] As a result, after 48 hours of reaction, production of 2.7 mM of -methyl-D-serine was determined.

[0222] The above operation showed that peg.801-804 formed a complex for catalyzing a 2-aminoisobutyric acid hydroxylation reaction.

[0223] <Analysis Conditions> [0224] Measurement device: Shimadzu LC-VP (Shimadzu Corporation) [0225] Column: Xbridge C18 column (5 m: 2.1150 mm) (Nihon Waters K.K.) [0226] Column oven temperature: 40 C. [0227] Mobile phase A: Waters AccQ-Tag Eluent A [0228] Mobile phase B: methanol [0229] Flow rate: 0.3 ml/min [0230] Gradient setting: 0 to 0.1 min, 0% mobile phase B; 0.1 to 0.5 min, 0 to 1% mobile phase B; 0.5 to 18 min, 1 to 5% mobile phase B; 18 to 19 min, 5 to 9% mobile phase B; 19 to 29.5 min, 9 to 17% mobile phase B; 29.5 to 40 min, 17 to 60% mobile phase B; 40 to 43 min, 60 to 0% mobile phase B; 43 to 55 min, 0% mobile phase B [0231] Detection: Fluorescence detector (excitation wavelength: 250 nm, emission wavelength: 395 nm)

[0232] An amino acid in an analysis solution was derivatized with use of AccQ-Tag derivation kit (Nihon Waters K.K.), and was then subjected to LC analysis.

Example 4

Function analysis of peg.803, 804

[0233] [4.1]

[0234] A transformed actinomycete that expresses the proteins with Protein ID peg.801, 802, 803 was developed as below.

[0235] Specifically, PCR was carried out under the PCR conditions below to obtain PCR products for peg.801, 802, 803.

[0236] <PCR Conditions> [0237] Template: genome of R. wratislaviensis C31-06 strain (100 ng/l, 1 l) [0238] Polymerase: PrimeSTAR Max Premix (2) (Takara Bio Inc.) (25 l)

TABLE-US-00004 Primer(pTipQC1_5 803): (SEQIDNO:13) TGTTTAACTTTAAGAAGGAGATATACCATGACCATCATCGAACA CGG(10M,1l) Primer(pTipQC1_3 Hyd): (SEQIDNO:12) TGGTGATGGTGATGCTCGAGAGATCTACTAGAGATCGAGGACG AGCC(10M,1l) [0239] Amplification condition: 30 cycles of 98 C., 10 seconds; 55 C., 5 seconds; and 72 C., 1 minute

[0240] The PCR product was inserted, with use of NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs), into a vector pTipQC1 (Qiagen) treated with restriction enzymes NcoI and HindIII. Next, E. coli JM109 was transformed with use of the plasmid pQAH-d804. The transformant was cultured at 28 C. overnight in 2 ml of LB medium (including 50 g/ml of ampicillin). pQAH-d804 was obtained from the bacterial cell, and then Rhodococcus erythropolis L88 (Hokkaido System Science) was transformed with use of the plasmid. The transformant was cultured at 28 C. overnight in 2 ml of LB medium (including 20 g/ml of chloramphenicol). Part of the culture solution was added to 2 ml of fresh LB medium (including 20 g/ml of chloramphenicol), and was shake-cultured at 28 C. After the turbidity of the culture solution reached 0.8 (absorption wavelength: 600 nm), thiostrepton was added at a concentration of 0.2 g/ml for the purpose of inducing expression of a protein. Next, 2-aminoisobutyric acid was added at a concentration of 10 mM as a reactive substrate. Shaking reaction was then started.

[0241] As a result, after 48 hours of reaction, production of -methyl-D-serine was not determined in the culture supernatant.

[0242] The results of Example 3 and the above results show that hydroxylation activity expression requires the peg.804 protein.

[0243] [4.2]

[0244] Subsequently, a transformed actinomycete that expresses the proteins with Protein ID peg.801, 802, 804 was developed as below.

[0245] Specifically, PCR was carried out under the PCR conditions below to obtain PCR products for peg.801, 802, 804.

[0246] <PCR Conditions> [0247] Template: genome of R. wratislaviensis C31-06 strain (100 ng/l, 1 l) [0248] Polymerase: PrimeSTAR Max Premix (2) (Takara Bio Inc.) (25 l)

TABLE-US-00005 Primer(pTipQC1_5 Hyd): (SEQIDNO:11) TGTTTAACTTTAAGAAGGAGATATACCATGGTTGCACCAACCTC GAA(10M,1l) Primer(joint802-4_3): (SEQIDNO:14) CGCTACCGATTACAAACTTGGACATTCTTAACCAACCTTTCCTG GGC(10M,1l) or Primer(joint804-2_5): (SEQIDNO:15) CCCGAGCCCAGGAAAGGTTGGTTAAGAATGTCCAAGTTTGTAAT CGG(10M,1l) Primer(pTipQC1_3 Hyd): (SEQIDNO:12) TGGTGATGGTGATGCTCGAGAGATCTACTAGAGATCGAGGACG AGCC(10M,1l) [0249] Amplification condition: 30 cycles of 98 C., 10 seconds; 55 C., 5 seconds; and 72 C., 1 minute

[0250] Two kinds of PCR products were each inserted, with use of NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs), into a vector pTipQC1 (Qiagen) treated with restriction enzymes NcoI and HindIII. Next, E. coli JM109 was transformed with use of the plasmid pQAH-d803. The transformant was cultured at 28 C. overnight in 2 ml of LB medium (including 50 g/ml of ampicillin). pQAH-d803 was obtained from the bacterial cell, and then Rhodococcus erythropolis L88 (Hokkaido System Science) was transformed with use of the plasmid. The transformant was cultured at 28 C. overnight in 2 ml of LB medium (including 20 g/ml of chloramphenicol). Part of the culture solution was added to 2 ml of fresh LB medium (including 20 g/ml of chloramphenicol), and was shake-cultured at 28 C. After the turbidity of the culture solution reached 0.8 (absorption wavelength: 600 nm), thiostrepton was added at a concentration of 0.2 g/ml for the purpose of inducing expression of a protein. Next, 2-aminoisobutyric acid was added at a concentration of 10 mM as a reactive substrate. Shaking reaction was then started.

[0251] As a result, after 48 hours of reaction, production of -methyl-D-serine was not determined in the culture supernatant.

[0252] The results of Example 3 and the above results show that hydroxylation activity expression requires the peg.803 protein.

Comparative Example 1

Evaluation of Reactivity of Transformed E. coli

[0253] A transformed E. coli that expresses the proteins with Protein ID peg.801-804 was developed as below.

[0254] Specifically, PCR was carried out under the PCR conditions below to obtain PCR products for peg.803, 804.

[0255] <PCR Conditions> [0256] Template: genome of R. wratislaviensis C31-06 strain (100 ng/l, 1 l) [0257] Polymerase: Tsk Gflex DNA Polymerase (Takara Bio Inc.) (1.25 units/l, 1 l)

TABLE-US-00006 Primer(pQE60_5 Hyd): (SEQIDNO:16) GAATTCATTAAAGAGGAGAAATTAACCATGGTTGCACCAACCTC GAA(10M,1l) Primer(pQE60_3 Hyd): (SEQIDNO:17) CAACAGGAGTCCAAGCTCAGCTAATTACTAGAGATCGAGGACG AGCC(10M,1l) [0258] Amplification condition: 30 cycles of 98 C., 10 seconds; 58 C., 15 seconds; and 68 C., 1 minute

[0259] The PCR product was inserted, with use of NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs), into a vector pQE60 (Qiagen) treated with restriction enzymes NcoI and HindIII. Next, E. coli JM109 was transformed with use of the plasmid pQEHyd. The transformant was cultured at 28 C. overnight in 2 ml of LB medium (including 50 g/ml of ampicillin). Next, part of the culture solution was added to 250 ml of TB medium (including 50 g/ml of ampicillin), and was shake-cultured at 28 C. After the turbidity of the culture solution reached 0.6 (absorption wavelength: 600 nm), IPTG was added at a concentration of 1 mM for the purpose of inducing expression of a protein. After 16 hours of culture, 2-aminoisobutyric acid was added at a concentration of 10 mM as a reactive substrate. Shaking reaction was then started.

[0260] As a result, after 48 hours of reaction, production of 0.2 mM of -methyl-D-serine was determined. This amount of production of -methyl-D-serine was smaller than in Example 3.

[0261] This indicates that as a host for this reaction system, Rhodococcus bacteria allow higher reactivity than E. coli.

Example 5

Evaluation of Reactivity Resulting from Introduction of peg.800

[0262] The protein obtained in Example 2 and having Protein ID peg.800 was expected, on the basis of the result of homology search, to be a transporter of 2-aminoisobutyric acid. Thus, a gene encoding the protein with Protein ID peg.800 was obtained as below.

[0263] Specifically, PCR was carried out under the PCR conditions below to obtain a PCR product for peg.800.

[0264] <PCR Conditions> [0265] Template: genome of R. wratislaviensis C31-06 strain (100 ng/l, 1 l) [0266] Polymerase: PrimeSTAR Max Premix (2) (Takara Bio Inc.) (25 l)

TABLE-US-00007 Primer(pTipRT2_NdeI_5 800): (SEQIDNO:18) GTTTAACTTTAAGAAGGAGATATACATATGACAGTGAATCATTCC CA(10M,1l) Primer(pTipRT2_HindIII_3 800): (SEQIDNO:19) TGGTGATGGTGATGCTCGAGAGATCTATCAGATTCTGGGCTGC AGAA(10M,1l) [0267] Amplification condition: 30 cycles of 98 C., 10 seconds; 55 C., 5 seconds; and 72 C., 1 minute

[0268] The PCR product was inserted, with use of NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs), into a vector pTipRT2 (Hokkaido System Science) treated with restriction enzymes NdeI and HindIII. Next, E. coli JM109 was transformed with use of the plasmid pRAT1. The transformant was cultured at 28 C. overnight in 2 ml of LB medium (including 50 g/ml of ampicillin). pRAT1 was obtained from the bacterial cell, and then pQAH1 Rhodococcus erythropolis L88 produced in Example 3 was transformed with use of the plasmid. The transformant (pQAH1/pRAT1 Rhodococcus erythropolis L88) was cultured at 28 C. overnight in 2 ml of LB medium (including 5 g/ml of tetracycline, 20 g/ml of chloramphenicol). Part of the culture solution was added to 2 ml of fresh LB medium (including 5 g/ml of tetracycline, 20 g/ml of chloramphenicol), and was shake-cultured at 28 C. After the turbidity of the culture solution reached 0.8 (absorption wavelength: 600 nm), thiostrepton was added at a concentration of 0.2 g/ml for the purpose of inducing expression of a protein. Next, 2-aminoisobutyric acid was added at a concentration of 10 mM as a reactive substrate. Shaking reaction was then started.

[0269] As a result, after 48 hours of reaction, production of 8.5 mM of -methyl-D-serine was determined in the culture supernatant.

[0270] This Example resulted in determination of a larger amount of product than in Example 3. This indicates that the peg.800 protein improves the reactivity.

[0271] The -methyl-D-serine produced had an optical purity of 93.5% e.e.

[0272] <Analysis Conditions> [0273] Measurement device: LCMS-2010A (Shimadzu Corporation) [0274] Column: Xbridge C18 column (5 m: 2.1150 mm) (Nihon Waters K.K.) [0275] Column oven temperature: 40 C. [0276] Mobile phase A: 5% acetic acid [0277] Mobile phase B: acetonitrile/methanol=90/10 [0278] Flow rate: 0.25 ml/min [0279] Gradient setting: 0 to 0.1 min, 5% mobile phase B; 0.1 to 30 min, 5 to 35% mobile phase B; 30 to 40 min, 90% mobile phase B; 40 to 50 min, 5% mobile phase B [0280] MS condition: block temperature: 200 C., Curved desolvation line temperature: 250 C., Detector voltage: 1.5 kV, nebulizing gas flow: 1.51/min

[0281] The optical purity was analyzed with use of the product of mixing 25 l of reaction solution with 25 l of 0.8% triethylamine in acetonitrile solution and derivatizing the mixture with 50 l of 2,3,4,6,-tetra-O-acetyl--D-glucopyranosyl isocyanate.

Example 6

Evaluation of Substrate Specificity

[0282] pQAH1/pRAT1 Rhodococcus erythropolis L88 was cultured in an LB medium by a method similar to that for Example 5. Expression of a protein was induced with 0.2 g/ml of thiostrepton, and then 10 mM of each of L-isovaline, D-isovaline, L-aminobutyrate, and D-aminobutyrate was added together with 5% glucose. After 26 hours of reaction, the reaction supernatant was analyzed by the LCMS analysis method used for Example 1.

[0283] As a result, a product was determined of which the molecular weight was increased by 16 for each substrate. This indicates that a hydroxylation reaction was proceeding. The results of NMR and optical rotation analyses showed production of (2S,3S)-2-methyl threonine for a case where L-isovaline was a substrate, (2R,3R)-2-methyl threonine for a case where D-isovaline was a substrate, L-allo-threonine for a case where L-aminobutyrate was a substrate, and D-allo-threonine in a case where D-aminobutyrate was a substrate.

[0284] The results of NMR for (2S,3S)-2-methyl threonine and (2R,3R)-2-methyl threonine are as below (Table 3).

TABLE-US-00008 TABLE 3 Product Results of NMR (2S,3S)- [].sub.D.sup.20 = +8.8 (c 0.80, H2O); 1H NMR (D2O): 1.17 2-methyl (d, 3H, J = 6.6 Hz, CHOCH3), 1.46 [s, 3H, C(CH3) threonine N], 4.02 (q, 1H, J = 6.6 Hz, CHOCH3); 13 C NMR (D2O): 16.8, 20.0 [CHOCH3, C(CH3)N], 65.2 [C(C H3)N], 69.3 (CHOCH3), 175.1 (CO). (2R,3R)- 1H NMR (D2O): 1.18 (d, 3H, J = 6.6 Hz, CHOC 2-methyl H3), 1.47 [s, 3H, C (CH3)N], 4.03 (q, 1H, J = 6.6 threonine Hz, CHOCH3); 13C NMR (D2O): 16.8, 20.0 [CH OCH3, C (CH3)N], 65.2 [C (CH3)N], 69.3 (CHOCH3), 175.1 (CO).

Example 7

Analysis of Structure of Peg.803, 804

[0285] A transformed E. coli that expresses the proteins with Protein ID peg.803, 804 was developed as below.

[0286] Specifically, PCR was carried out under the PCR conditions below to obtain PCR products for peg.803, 804.

[0287] <PCR Conditions> [0288] Template: genome of R. wratislaviensis C31-06 strain (100 ng/l, 1 l) [0289] Polymerase: PrimeSTAR Max Premix (2) (Takara Bio Inc.) (25 l)

TABLE-US-00009 Primer(pQE_804_5): (SEQIDNO:20) TCGCATCACCATCACCATCACGGATCCATGGTTGCACCAACCTC GAA(10M,1l) Primer(pQE803_3): (SEQIDNO:21) CAACAGGAGTCCAAGCTCAGCTAATTATTAGTCCGCCTGATTCG TAA(10M,1l) [0290] Amplification condition: 30 cycles of 98 C., 10 seconds; 55 C., 5 seconds; and 72 C., 1 minute

[0291] The PCR product was inserted, with use of NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs), into a vector pQE80 (Qiagen) treated with restriction enzymes BamHI and HindIII. Next, E. coli Rosetta 2 (DE3) was transformed with use of the plasmid pQE804-803. The transformant was cultured at 28 C. overnight in 2 ml of LB medium (including 50 g/ml of ampicillin, 25 g/ml of chloramphenicol). Part of the culture solution was added to 200 ml of TB medium (including 50 g/ml of ampicillin, 25 g/ml of chloramphenicol), and was shake-cultured at 20 C. After the turbidity of the culture solution reached 0.6 (absorption wavelength: 600 nm), IPTG was added at a concentration of 0.5 mM for the purpose of inducing expression of a protein. After 16 hours of culture, the bacterial cell was recovered through centrifugation, and was washed twice with 0.85% NaCl. The bacterial cell was suspended in 0.5 M of NaCl, 30 mM of imidazole, and 20 mM of HEPES (pH 8.0), and was homogenized ultrasonically. The supernatant of the homogenate as centrifuged was introduced into HisTALON Superflow (1.62.5 cm) (Takara Bio Inc.), and was eluted with use of 0.5 M of NaCl, 30 mM of imidazole, and 150 mM of HEPES (pH 8.0) for recovery of an enzyme fraction including peg.803, 804. The enzyme fraction was concentrated through ultrafiltration, and was then introduced into a Superdex 200 Increase 10/300 GL column (1.030 cm) (GE Healthcare). Then, the respective molecular weights of the proteins with peg.803, 804 were measured at approximately 180,000 with use of 10 mM of HEPES (pH 8.0) and 0.14M of NaCl. The respective assumed molecular weights of the proteins with peg.803, 804 are 42,000 and 43,000, respectively. This result and the results of the SDS-PAGE analysis indicate that the proteins with peg.803, 804 are associated with each other in an equimolar manner.

[0292] This suggests that the monooxygenase includes the proteins with peg.803 and peg.804 and has a heterotetramer structure as a whole.

Example 8

Identification of Coenzyme of peg.801

[0293] A transformed E. coli that expresses the protein with Protein ID peg.801 was developed as below.

[0294] Specifically, PCR was carried out under the PCR conditions below to obtain a PCR product for peg.801.

[0295] <PCR Conditions> [0296] Template: genome of R. wratislaviensis C31-06 strain (100 ng/l, 1 l) [0297] Polymerase: PrimeSTAR Max Premix (2) (Takara Bio Inc.) (25 l )

TABLE-US-00010 Primer(pQE_801_5): (SEQIDNO:22) TCGCATCACCATCACCATCACGGATCCATGACCAATTCAGATAG TTC(10M,1l) Primer(pQE_801_3): (SEQIDNO:23) CAACAGGAGTCCAAGCTCAGCTAATTACTAGAGATCGAGGACG AGCC(10M,1l) [0298] Amplification condition: 30 cycles of 98 C., 10 seconds; 55 C., 5 seconds; and 72 C., 1 minute

[0299] The PCR product was inserted, with use of NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs), into a vector pQE80 (Qiagcn) treated with restriction enzymes BamHI and HindIII. Next, E. coli Rosetta 2 (DE3) was transformed with use of the plasmid pQE-801. The transformant was cultured at 28 C. overnight in 2 ml of LB medium (including 50 g/ml of ampicillin, 25 g/ml of chloramphenicol). Part of the culture solution was added to 200 ml of TB medium (including 50 g/ml of ampicillin, 25 g/ml of chloramphenicol), and was shake-cultured at 20 C. After the turbidity of the culture solution reached 0.6 (absorption wavelength: 600 nm), IPTG was added at a concentration of 0.5 mM for the purpose of inducing expression of a protein. After 16 hours of culture, the bacterial cell was recovered through centrifugation, and was washed twice with 0.85% NaCl. The bacterial cell was suspended in 0.5 M of NaCl, 30 mM of imidazole, and 20 mM of HEPES (pH 8.0), and was crushed ultrasonically. The supernatant of the crushed liquid as centrifuged was introduced into HisTALON Superflow (1.62.5 cm) (Takara Bio Inc.), and was eluted with use of 0.5 M of NaCl, 30 mM of imidazole, and 150 mM of HEPES (pH 8.0) for recovery of an enzyme fraction including peg.801. The enzyme fraction was concentrated through ultrafiltration, was then introduced into a MonoQ 10/100 GL column (1.010 cm) (GE healthcare), and was eluted with use of 1M of NaCl and 20 mM of Tris-HCl buffer (pH 7.4). This produced a purified enzyme of peg.801. Then, 0.77 g/ml of the purified enzyme of peg.801 was added to a reaction solution including 10-150 M of NADH or NADPH, 20-100 M of dichloroindophenol, and 100 mM of a potassium phosphate buffer (pH 7.5) for measurement of the enzyme activity of the purified enzyme of peg.801.

[0300] The Km value for this reaction was measured at 8.2 M for NADH and 6.2 mM for NADPH. This shows that peg.801 requires NADH as a coenzyme.

INDUSTRIAL APPLICABILITY

[0301] The present invention is applicable to fields that require stable protein supplies, for example, the field of peptide medicine production.

[0302] [Accession Number]

[0303] NITE BP-02370

[0304] [Sequence Listing]