SPECIFIC EXPRESSION PROMOTERS IN RICE AND THE USE THEREOF
20200010846 ยท 2020-01-09
Assignee
Inventors
- Pengcheng Wei (Hefei, CN)
- Juan Li (Hefei, CN)
- Jianbo Yang (Hefei, CN)
- HAO LI (Hefei, CN)
- Ruiying Qin (Hefei, CN)
- Rongfang Xu (Hefei, CN)
Cpc classification
International classification
Abstract
The present invention provides the specific expression promoters in rice and the application. The present invention applies the promoter in the plant genetic engineering. The sequence of the promoter provided in the present invention is composed of the nucleotide sequence shown in SEQ ID No. 11; the nucleotide sequence shown in SEQ ID No. 2; Or the nucleotide sequence shown in SEQ ID No. 3.
Claims
1. Rice specific expression promoter, wherein the rice specific expression promoter consists of one of the following sequences: Nucleotide sequence as shown in SEQ ID No. 1; Nucleotide sequence as shown in SEQ ID No. 2; and Nucleotide sequence as shown in SEQ ID No. 3.
2. The rice specific expression promoter of claim 1, wherein the rice specific expression promoter is extracted from Oryza sativa L cv Nipponbare.
3. The using of the rice specific expression promoter of claim 1, wherein, it comprises: linking the rice specific expression promoter as claimed in claim 1 to the upstream of the genes to be expressed in vector to construct the recombinant expression vector; and transforming the recombinant expression vector to the plant cell, tissue or organ for cultivation.
4. The using as claimed in claim 3, wherein, it used to improve the growth properties of plant, and the plant is monocotyledon, such as rice, wheat, corn, barley, sorghum or oat.
5. A method of increasing the salt-tolerance of plants, characterized in that, the method includes connecting the rice salt-inducible expression promoter POssalt2 to the target gene to construct recombinant vector and importing the recombinant vector into the target plant so that when the salt content in the environment in which the target plant grows increases, the rice salt-inducible expression promoter POssalt2 will induce the expression of the target gene, improving the survivability of the plant in saltine environment.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Hereinafter, the embodiments of the present invention are illustrated by taking in conjunction with the accompanying drawings, wherein:
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0032] The present invention will be apparent from the following detailed description by taking in conjunction with the accompanying drawings and the embodiments, but without limiting the protection scope of the present invention into the scope specified in the embodiments.
[0033] Unless otherwise specified, the experimental methods used in the following embodiments are normal methods. The following involved experimental materials are available in the market.
Embodiment 1
Obtaining of Root-Specific Expression Promoter and Construction of Expression Vector (1) Clone of Promoter POsRo5
[0034] According to the whole genome sequence of Oryza sativa L cv Nipponbare provided by NCBI, the amplification primer is designed by using the primer design software primer5 based on the sequence specified in SEQ ID No. 1, and the restriction site for the primer is designed according to the characteristics of the selected vector and target gene, and the primer sequence is as follows:
TABLE-US-00001 FP: (SEQIDNO:4) GGATCCACCCCCTTAATCAAAAACAACA RP: (SEQIDNO:5) GTCGACTTGATGCAAAGGAGCAACGAGC
[0035] Wherein, GGATCC base is the recognition site and protective base of the restriction enzyme BamHI, and GTCGAC base is the recognition site and protective base of the restriction enzyme SalI.
[0036] Taking the rice genome DNA as a template, use the KOD pfu ultra for PCR amplification. The reaction system (50 L) is as follows. Perform 1% agarose gel electrophoresis for amplification products.
[0037] KOD reaction system (total volume 50 L) PCR amplification protocol of KOD reaction system
TABLE-US-00002 10 KOD buffer 5 L 95 C. 3 min MgSO4 4 L 95 C. 30 s dNTPs 5 L 58 C. 30 s {close oversize brace} 35 cycles Primer (Pf + Pr) 4 L 68 C. 2 min KOD enzyme 1 L 68 C. 10 min ddH.sub.2O 29 L 4 C. hold Template 2 L
(2) Adding Ploy A and Linking to T Vector
[0038] Recycle the PCR products, and add poly A tail and link to T vector in order to obtain cloning vector.
[0039] Add system A: place 3.175 L recycled product and 1.825 L A-added mixture (5 Taq buffer 2 L, 25 mM MgCl2 0.5 L, 100 mM dATP 0.5 L, Taq polymerase 0.25 L) at 72 C. for reaction for 30 min.
[0040] Link to T vector: take 4 L A-added product and 1 L vector T and place them at 25 C. for reaction for 30 min to obtain the target product, and transfer the product into the E. coli competence.
(3) Transform the Escherichia coli Competent Cells
{circle around (1)} Transfer the solution of the A-added linking T vector into 1.5 mL Eppendorf tube containing 100 L competent cells, and keep it on the ice for 30 min;
{circle around (2)} After heat shock at 42 C. for 90 s, immediately put it in ice bath for 2 min;
{circle around (3)} Add 500 L LB liquid medium and place it in 37 C. shake incubator for cultivation for 1 h (120 r/min) to make the bacteria recover to the normal growth situation
{circle around (4)} Take 100 L of the bacteria solution and smear it onto the ampicillin-contained LB screen plate. After the bacteria solution is fully absorbed by the culture medium, place the culture dish upside down for cultivation at 37 C. for 1624 h. {circle around (5)} Select the clones which are enzyme digestion verified and send to BGI-Beijing for sequencing analysis to obtain the promoters of the candidate genes.
(4) Construction of Promoter Expression Vector
[0041] After digestions with corresponding double enzymes, recycle the promoter fragment and the linear processed plasmid pCAMBIA1381. Link the recycled target fragment and linearized vector with T4 ligase (1 L 10T4 ligase buffer, 1 L T4 ligase, 2 L linearized vector, 6 L target fragment), PCR and double enzyme digested colony to obtain the expression vectors of the corresponding promoters.
(5). Transform Agrobacterium tumefaciens EHA105 with Expression Vector
{circle around (1)} Take 10 L expression vector plasmid DNA and add into the agrobacterium competent cells which are taken out of the ultra-low temperature freezer, and mix them and put them into ice bath for 30 min;
{circle around (2)} Quickly freeze for 1 min with liquid nitrogen;
{circle around (3)} Add into 1 mL LB culture medium and culture at 28 C. and at speed 120 r/min for 4 h;
{circle around (4)} Centrifuge at speed 4000 r/min for 1 min, and discard the supernatant. Add into 150 L culture medium for resuspending, and smear the bacteria solution onto the LB solid plate containing 50 g/mL Kan and 10 g/mL Rif;
{circle around (5)} Culture at 28 C. for 23 days until the growth of individual colony, and identify the colony PCR.
{circle around (6)} Select the positive clones and store them with 50% glycerin (1:1).
Agrobacterium-Mediated Rice Genetic Transformation
(1) Callus Induction
[0042] Soak the sterilized seeds with 30 C. sterile water in dark for a night, remove the embryos with scalpel, and place them onto the induction medium. Put 12 embryos in each dish (10025 mm disposable plastic culture dish, containing 50 ml induction medium), and keep the inducing callus at 30 C. in dark for 23 weeks until they grow light yellow granular calluses.
(2) Pre-Culture
[0043] Select granular calluses without scab from the culture medium and place them onto the new induction medium for culturing at 30 C. in dark for 35 d.
(3) Dip Dyeing and Co-Culture
[0044] Transfer the pre-cultured calluses into 50 ml sterile tube, add expression vector agrobacterium solution and soak for 20 min, pour out the bacteria solution, and sip up the residual bacteria solution with sterile filter paper. Then spread the calluses onto the co-culture medium evenly, and keep them at 23 C. in dark for 23 days.
(4) Recovery
[0045] Transfer the co-cultured calluses onto the recovery medium (avoid callus overlapping). Culture at 23 C. in dark for 35 days.
(5) Screen
[0046] Select the brightly colored granular resistant/embryonic calluses in light yellow without bacterial plague from the screening medium, and transplant them in screening medium, 30 pieces in each dish, and culture at 30 C. in dark for 23 weeks until they grow new resistant granular calluses.
(6) Differentiation
[0047] For each transformation (all calluses reproduced by one callus during screening), select and transfer 3 individual embryonic calluses into a region of the differentiation medium, and culture them in 30 C. lighting incubator (16 h lighting/8 h dark) for 34 weeks until they send forth seedlings.
(7) Rooting
[0048] Select two strong seedlings from each region and transfer them into the rooting medium, culture them in 30 C. lighting incubator (16 h lighting/8 h dark) for about 3 weeks, and perform the identification and transplant into the field.
Identification of Promoter Expression Characteristics in Transgenic Rice Seedlings
[0049] GUS can react with the chromogenic substrate X-gluc and appears blue, so the GUS expression level and expression pattern can be researched qualitatively by histochemical staining.
[0050] For the reagent for GUS staining and the procedures, refer to the method proposed by Jefferson (Jefferson R A et al. GUS fusion: -Glucuronidase as a sensitive and versatile gene fusion marker in higher plant[J]. EMBO J., 1987, 6:3901-3907), as follows:
[0051] {circle around (1)} Staining: Soak the samples to be tested into GUS dye liquor, and place in 37 C. incubator for 24 h-36 h.
[0052] {circle around (2)} Destaining: Add 100% ethyl alcohol and soak until they are destained completely. They can be stored with solution containing 30% glycerin and 70% ethyl alcohol.
[0053] {circle around (3)} Take photos and record under the microscope.
[0054] The results of the GUS staining by the above method are as shown in
Embodiment 2
[0055] This embodiment provides a promoter that is significant to the growth of the rice root and is responsive to the external water environment expression.
[0056] Step 1. Cloning of Promoter Psubs3 and Construction of Vector pCAMBIA1381-Psubs3
[0057] According to the whole genome sequence of Oryza sativa L cv Nipponbare provided by NCBI, design the amplification primer based on the sequence specified in SEQ ID No. 2, and design the restriction enzyme cutting site of the primer according to the characteristics of the selected vector and target gene. The primer for amplification includes:
TABLE-US-00003 ForwardPrimer:EcoRI (SEQIDNO:6) GAATTCTTTACTCACCGTGTCCTCTGTT ForwardPrimer:HindIII (SEQIDNO:7) AAGCTTTGTATCTCTCTCTGGTAGTTAG
[0058] Taking the rice variety Oryza sativa L cv Nipponbare as the template, by utilizing the forward primer and the reverse primer to amplify the promoter Psubs3, and by the conventional PCR system, uses the following amplification protocol:
[0059] Pre-denaturation at 95 C. for 5 min; Denturation at 95 C. for 30 s; Annealing at 58 C. for 30 s; Elongation at 72 C. for 2 min and 30 s; executing 35 cycles from pre-denaturation at 95 C. to elongation at 72 C.; At last elongation at 72 C. for 10 min.
[0060] Recycle the PCR amplified target fragment, and the target fragment is 1939 bp. Link it to PGEM-T-Easy vector (purchased from Promega, blend in the proportion as specified in the vector manual), and send it to Invitrogen (a company which can do the sequencing) for sequencing, wherein the nucleotide sequence is as shown in SEQ ID No: 2.
[0061] Perform double enzyme digestion for the PGEM-T-Easy vector which is linked with Psubs3 by using HindIII and EcoRI, recycle the promoter Psubs3 fragment. Simultaneously, perform linear processing to pCAMBIA1381 by using HindIII and EcoRI, link the Psubs3 fragment topCAMBIA1381 vector to obtain the plant expression vector pCAMBIA1381-Psubs3 gintegratin Psubs3 and GUS gene, as shown in
[0062] Step 2: Agrobacterium-Mediated Rice Genetic Transformation
[0063] Remove the glumes of the mature seeds, and soak them with 70% ethyl alcohol for 1 min, and discard the ethyl alcohol. Soak the seeds in 50% sodium hypochlorite (the concentration of available chlorine in the original solution is bigger than 4%) solution containing 1 drop of Tween 20 for 40 min (at 150 r/min). Discard the sodium hypochlorite and wash the seeds with sterile water for 5 times until the solution is clean and free of flavor of sodium hypochlorite. Soak the seeds in sterile water for a night. Remove the embryo along with the seed's aleurone layer with scalpel, and transplant the embryo onto the callus induction medium. After dark culture at 30 C. for 11 days, separate the callus from the endosperm and germ, pre-culture the degerminated primary calluses in good condition and with strong division for 35 days before using for agrobacterium transformation.
[0064] Perform agrobacterium-mediated genetic transformation for the Agrobacterium tumefaciens in which the pCAMBIA1381-Psubs3 recombinant expression vector is transferred, and for the genetic transformation, transformant selection and transgenic plants regeneration, refer to the method proposed by Yongbo Duan (Yongbo Duan, Chenguang Zhai, et al. An efficient and high-throughput protocol for Agrobacterium mediated transformation based on phosphomannose isomerase positive selection in Japonica rice (Oryza sativa L.)[J]. Plant Cell Report, 2012.DOI 10.1007/s00299-012-1275-3).
[0065] Total 32 plants are obtained. Extract the DNAs from the plants, and after PCR identification, 28 positive pCAMBIA1381-Psubs3 plants are obtained.
[0066] Step 3. Psubs3 Promoter Activity Identification
[0067] Referring to the method proposed by Jefferson (Jefferson R A et al. GUS fusion: -Glucuronidase as a sensitive and versatile gene fusion marker in higher plant[J]. EMBO J., 1987, 6:3901-3907), evacuate the tissue to be dyed, and soak it into the dyeing liquor and dye it at 37 C. for 24 h. When destaining, process it with 95% ethyl alcohol at 37 C. until the negative control material turns white.
[0068] Dye the positive Transgenic plant tissue 21 days after the seed germination. For the rice plants growing under normal conditions, after 24 h dyeing, the root (A), the stem (B), and the leaf (C) are free of GUS activity, but for the ones submerged in water for 1 hour and being dyed for 24 h, there are strong GUS expression (scale=5 mm) in the root (A), the stem (B), and the leaf (C). For the results, see
[0069] Extract the RNAs of the 14-day seedlings before and after being submerged in water, and obtain cDNAs by inverse transcription. Detect the GUS gene expression level by real-time fluorogenic quantitative PCR, and simultaneously, compare with the rice house-keeping gene ACTIN as control. The changes in the GUS gene expression reflect the water-induced activity of Psubs3 promoter.
[0070] The RT-qPCR is SuperReal fluorogenic quantitative PreMix Plus (TIANGEN, SYBR Green, FP205) from TIANGEN (Beijing). Taking the rice ACTINgene as the reference gene to quantitate the applied RNA templates. Process the obtained signals and data by using 2-.sup.CT (CT=CT target geneCT reference gene; CT=CT pose-processingCT control). Repeat three times for each gene. The quantitative primer used in this experiment is: Actin-FP 5-CCTGACGGAGCGTGGTTAC-3 (SEQ ID NO: 8); and
[0071] Actin-RP, 5-CCAGGGCGATGTAGGAAAGC-3 (SEQ ID NO: 9) for ACTIN amplification; Gus-FP, 5-TACGGCAAAGTGTGGGTCAATAATCA-3 (SEQ ID NO: 10)
[0072] And Gus-RP, 5-CAGGTGTTCGGCGTGGTGTAGAG-3 (SEQ ID NO: 11) for GUS amplification. The results as shown in
Embodiment 3
1. Obtaining of POssalt2 Promoter Containing Restriction Enzyme Cutting Site
(1) Primer Design
[0073] It is in accordance with the whole genome sequence of Oryza sativa L cv Nipponbare provided by NCBI. Design the amplification primer based on the sequence specified in SEQ ID No. 3, and design the restriction enzyme cutting site according to the characteristics of the selected vector and target gene
[0074] In this embodiment, taking the rice binary expression vector (
TABLE-US-00004 Forwardprimer: (SEQIDNO:12) AATCTCTACTACTTAAATTCCAEcoRI Reverseprimer: (SEQIDNO:13)
CCAAATCAGCTAACCCGCGCCTBamHI
(2) Cloning of Promoter and Construction of Expression Vector
[0075] Taking the rice genome DNA as the template, use the KOD pfu ultra for PCR amplification. Perform 1% agarose gel electrophoresis for amplification products. Recycle the PCR products, and add polyA tail and link to T vector in order to obtain cloning vector. Send the cloning vector to BGI-Beijing for sequencing analysis to obtain the promoter POssalt2 in length of 2072 bp.
[0076] Respectively digest the promoter POssalt2 with corresponding enzyme and linearly process the pCAMBIA1381 plasmid. Perform the linking with T4 ligase to obtain the corresponding pCAMBIA1381-POssalt2 expression vector.
(3). Transform Agrobacterium Tumefaciens EHA105 with Expression Vector
{circle around (1)} Take and add 10 L expression vector plasmid DNA into the agrobacterium competent cells taken out from the ultra-low temperature freezer, and mix them and put them into ice bath for 30 min;
{circle around (2)} Quickly freeze for 1 min with liquid nitrogen;
{circle around (3)} Add into 1 mL LB culture medium and culture at 28 C. and at speed 120 r/min for 4 h;
{circle around (4)} Centrifuge at speed 4000 r/min for 1 min, and discard the supernatant. Add into 150 L culture medium for resuspending, and smear the bacteria solution onto the LB solid plate containing 50 g/mL Kan and 10 g/mL Rif;
{circle around (5)} Culture at 28 C. for 23 days until the growth of individual colony, and identify the colony PCR.
{circle around (6)} Select the positive clones and store them with 50% glycerin (1:1).
2. Obtaining Transgenic Plants
(1) Rice Genetic Transformation
{circle around (1)} Callus Induction
[0077] Soak the sterilized rice seeds with 30 C. sterile water in dark for a night, remove the embryos with scalpel, and place them onto the induction medium. Put 12 embryos in each dish (10025 mm disposable plastic culture dish, containing 50 ml induction medium), and keep the inducing callus at 30 C. in dark for 23 weeks until they grow light yellow granular calluses.
{circle around (2)} (2) Pre-Culture
[0078] Select granular calluses from the culture medium and place them onto the new induction medium for culturing at 30 C. in dark for 35 days.
{circle around (3)} Dip Dyeing and Co-Culture
[0079] Transfer the pre-cultured calluses into 50 ml sterile tube, add agrobacterium solution (OD600=0.2) and soak for 20 min, pour out the bacteria solution, and sip up the residual bacteria solution with sterile filter paper. Then spread the calluses onto the co-culture medium evenly, and keep them at 23 C. in dark for 23 days.
{circle around (4)} Recovery:
[0080] Transfer the co-cultured calluses onto the recovery medium for culturing at 30 C. in dark for 35 d.
{circle around (5)} Screen:
[0081] Select the brightly colored granular embryonic calluses in light yellow without bacterial plague from the screening medium, and transplant them in screening medium, 30 pieces in each dish, and culture at 30 C. in dark for 23 weeks until they grow new resistant granular calluses.
{circle around (6)} Differentiation:
[0082] For each transformation, select and transfer 3 individual embryonic calluses into a region of the differentiation medium, and culture them in 30 C. lighting incubator (16 h lighting/8 h dark) for 34 weeks until they send forth seedlings.
{circle around (7)} Rooting:
[0083] Select two strong seedlings from each region and transfer them into the rooting medium, culture them in 30 C. lighting incubator (16 h lighting/8 h dark) for about 3 weeks, and perform the identification and transplant into the field.
(2) Identification of Transgenic Plants
[0084] Totally, 33 pCAMBIA1381-POssalt2 plants (POssalt2: GUS Transgenic rice plants) are obtained. Extract the DNAs of the Transgenic plants by conventional method, and test the transformed plants by amplifying the hygromycin gene with PCR, and 30 positive plants are obtained.
3. Promoter Activity Identification
(1) GUS Tissue Histochemical Staining
[0085] Referring to the method proposed by Jefferson et al, perform GUS staining analysis for the plants which are tested positive before and after being processed with 200M NaCl solution. Soak the samples to be tested into the GUS dyeing solution, and keep it in 37 C. incubator for 24 h. Then immerse the samples in 100% ethyl alcohol until they are destained completely, and take photos.
[0086] The staining results are as shown in
(2) Quantitative PCR Analyzing the Promoter Activity
[0087] The GUS staining results qualitatively suggests that, POssalt2 is a salt-inducible expression promoter. To validate the activity of salt-inducing strength POssalt2, we extracted the RNAs of the Transgenic seedlings 10 days before and after being induced by 200 mM NaCl solution, and inversely transcribed them to cDNAs, and tested the changes in expression of GUS genes driven by POssalt2 before and after being induced by 200 mM NaCl solution by using fluorogenic quantitative PCR (RT-qPCR) method.
[0088] Apply RNAprep pure Kit (for plant) (TIANGEN, Spin Column, DP432) from Tiangen Biotech (Beijing) Company. Perform inverse transcription for the obtained RNA by the following procedures: Add 5 L RNase-Free ddH.sub.2O, 2 L 5gDNA buffer, 3 L RNA into the RNase-free centrifuge tube, and place at 42 C. to incubate for 3 min, and place the tube on ice; Successively add 5 L RNase-Free ddH.sub.2O, 2 L FQ-RT Primer Mix, 2 LL 10 Fast RT Buffer, and 1 L RT Enzyme Mix into the above reaction liquid and mix them thoroughly, then place the mixture at 42 C. to incubate for 3 min and place on ice, and cDNA is obtained.
[0089] The RT-qPCR is SuperReal fluorogenic quantitative PreMix Plus (TIANGEN, SYBR Green, FP205) from TIANGEN (Beijing). Taking the rice ACTIN gene as the reference gene to quantitate the applied RNA templates. Process the obtained signals and data by using 2-.sup.CT (CT=CT target geneCT reference gene; CT=CT pose-processingCT control). Repeat three times for each gene. The quantitative primer used in this experiment is: Actin-FP 5-CCTGACGGAGCGTGGTTAC-3 (SEQ ID NO: 8); and Actin-RP, 5-CCAGGGCGATGTAGGAAAGC-3 (SEQ ID NO: 9) for ACTIN amplification; Gus-FP, 5-TACGGCAAAGTGTGGGTCAATAATCA-3 (SEQ ID NO: 10) And Gus-RP, 5-CAGGTGTTCGGCGTGGTGTAGAG-3 (SEQ ID NO: 11) for GUS amplification.
[0090] The quantitative PCR results are as shown in