Compositions and methods for identifying drug resistant tuberculosis
10526664 ยท 2020-01-07
Assignee
Inventors
- Hong Wang (Des Plaines, IL, US)
- Gregor W. Leckie (Des Plaines, IL, US)
- Vihanga Pahalawatta (Des Plaines, IL)
- Klara Abravaya (Des Plaines, IL, US)
- Joshua Kostera (Des Plaines, IL, US)
- Ning Tang (Des Plaines, IL)
- Andrea Frank (Des Plaines, IL)
Cpc classification
C12Q2600/106
CHEMISTRY; METALLURGY
International classification
Abstract
Provided herein are compositions and methods for diagnosing and characterizing tuberculosis infection. In particular, provided herein are compositions and methods for identifying drug resistant tuberculosis.
Claims
1. A method of detecting the presence and antibiotic resistance of Mycobacterium complex (MTB) in a subject, comprising: a) contacting a sample from said subject with first reagents for detecting the presence of MTB wherein said first reagents comprise primer SEQ ID NOs: 22-25, probe SEQ ID NOs: 26 and 27, and a first activation reagent comprising MgCl2, Tris, KCl, Proclin 950, sodium azide and ultrapure water; b) performing an MTB detection assay with said first reagents, comprising: i) amplifying said sample from said subject with SEQ ID NO: 22 and SEQ ID NO: 23 to generate an IS6110 amplicon using PCR cycling conditions; ii) detecting said IS6110 amplicon with SEQ ID NO: 26; iii) amplifying said sample from said subject with SEQ ID NO: 24 and 25 to generate a PAB amplicon using PCR cycling conditions; iv) detecting said PAB amplicon with SEQ ID NO: 27; and c) contacting a sample from said subject with second reagents for detecting the presence of MTB rifampicin and isoniazid resistance genes wherein said second reagents comprise primer SEQ ID NOs: 1-6, probe SEQ ID NOs: 7-18, and a second activation reagent comprising MgCl2, Tris, KCl, Proclin 950, sodium azide and ultrapure water; and d) performing a rifampicin and isoniazid resistance assay with said second reagents, comprising: i) amplifying said sample from said subject with SEQ ID NO: 1 and SEQ ID NO: 2 to generate a rpoB RRDR amplicon using PCR cycling conditions: ii) detecting said rpoB RRDR amplicon with SEQ ID NOs: 7-14; iii) amplifying said sample from said subject with SEQ ID NO: 3 and SEQ ID NO: 4 to generate a katG amplicon using PCR cycling conditions; iv) detecting said katG amplicon with SEQ ID NOs: 15 and 16; v) amplifying said sample from said subject with SEQ ID NO: 5 and SEQ ID NO: 6 to generate an inhA upper stream promoter amplicon using PCR cycling conditions; and vi) detecting said inhA upper stream promoter amplicon using SEQ ID NOs: 17 and 18; and wherein said first activation reagent and said second activation reagent are the same activation reagents, and wherein said PCR cycling conditions are the same PCR cycling conditions.
2. The method of claim 1, wherein said amplifying is real time PCR.
3. The method of claim 1, wherein said rifampicin and isoniazid resistance detection assay detects mutations in one or more target regions selected from the group consisting of rpoB RRDR, katG and inhA upper stream promoter.
4. The method of claim 3, wherein said mutations in rpoB are at one or more amino acids selected from the group consisting of D516V, H526Y, H526D, and S531L.
5. The method of claim 3, wherein said katG mutation is amino acid change S315T1 and said inhA upper stream promoter mutation is the nucleic acid mutation C-15T.
6. The method of claim 1, wherein said sample is selected from the group consisting of sputum, BAL, and a NALC sediment of sputum and BAL.
7. The method of claim 1, wherein said MTB is one or more species of Mycobacterium selected from the group consisting of Mycobacterium tuberculosis, Mycobacterium africanum, Mycobacterium bovis, Mycobacterium bovis BCG, Mycobacterium canettii, Mycobacterium microti, Mycobacterium caprae, and Mycobacterium pinnipedii.
8. The method of claim 1, further comprising the step of diagnosing infection by MTB in said subject based on the results of said MTB detection assay.
9. The method of claim 1, further comprising the step of identifying said MTB as resistant to rifampicin and/or isoniazid based on said rifampicin and isoniazid resistance detection assay.
10. A method of detecting the antibiotic resistance of Mycobacterium complex (MTB) in a subject, comprising: a) contacting a sample from said subject with reagents for detecting the presence of MTB rifampicin and isoniazid resistance genes wherein said reagents comprise primer SEQ ID NOs: 1-6, probe SEQ ID NOs: 7-18, and an activation reagent comprising MgCl2, Tris, KCl, Proclin 950, sodium azide and ultrapure water; and b) performing a rifampicin and isoniazid resistance assay with said reagents, comprising: i) amplifying said sample from said subject with SEQ ID NO: 1 and SEQ ID NO: 2 to generate a rpoB RRDR amplicon using PCR cycling conditions: ii) detecting said rpoB RRDR amplicon with SEQ ID NOs: 7-14; iii) amplifying said sample from said subject with SEQ ID NO: 3 and SEQ ID NO: 4 to generate a katG amplicon using PCR cycling conditions; iv) detecting said katG amplicon with SEQ ID NOs: 15 and 16; v) amplifying said sample from said subject with SEQ ID NO: 5 and SEQ ID NO: 6 to generate an inhA upper stream promoter amplicon using PCR cycling conditions; and vi) detecting said inhA upper stream promoter amplicon using SEQ ID NOs: 17 and 18; and wherein said PCR cycling conditions are the same PCR cycling conditions.
Description
DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
DETAILED DESCRIPTION
(5) Provided herein are compositions and methods for diagnosing and characterizing tuberculosis infection. In particular, provided herein are compositions and methods for identifying drug resistant tuberculosis.
Definitions
(6) As used herein, a or an or the can mean one or more than one. For example, a widget can mean one widget or a plurality of widgets.
(7) As used herein, the term nucleic acid molecule refers to any nucleic acid containing molecule, including but not limited to, DNA or RNA. The term encompasses sequences that include any of the known base analogs of DNA and RNA including, but not limited to, 4 acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5 (carboxyhydroxyl-methyl) uracil, 5-fluorouracil, 5 bromouracil, 5-carboxymethylaminomethyl 2 thiouracil, 5 carboxymethyl-aminomethyluracil, dihydrouracil, inosine, N6 isopentenyladenine, 1 methyladenine, 1-methylpseudo-uracil, 1 methylguanine, 1 methylinosine, 2,2-dimethyl-guanine, 2 methyladenine, 2 methylguanine, 3-methyl-cytosine, 5 methylcytosine, N6 methyladenine, 7 methylguanine, 5 methylaminomethyluracil, 5-methoxy-amino-methyl 2 thiouracil, beta D mannosylqueosine, 5 methoxycarbonylmethyluracil, 5 methoxyuracil, 2 methylthio N6 isopentenyladenine, uracil 5 oxyacetic acid methylester, uracil 5 oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2 thiocytosine, 5-methyl-2 thiouracil, 2-thiouracil, 4 thiouracil, 5-methyluracil, N-uracil 5 oxyacetic acid methylester, uracil 5 oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, and 2,6 diaminopurine.
(8) The term gene refers to a nucleic acid (e.g., DNA) sequence that comprises coding sequences necessary for the production of a polypeptide, precursor, or RNA (e.g., rRNA, tRNA). The polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, immunogenicity, etc.) of the full-length or fragment is retained. The term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5 and 3 ends for a distance of about 1 kb or more on either end such that the gene corresponds to the length of the full-length mRNA. Sequences located 5 of the coding region and present on the mRNA are referred to as 5 non-translated sequences. Sequences located 3 or downstream of the coding region and present on the mRNA are referred to as 3 non-translated sequences. The term gene encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed introns or intervening regions or intervening sequences. Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or spliced out from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.
(9) The term primer refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH). The primer is preferably single stranded for maximum efficiency in amplification, but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers will depend on many factors, including temperature, source of primer and the use of the method.
(10) As used herein, the term amplicon refers to a nucleic acid generated via amplification reaction. The amplicon is typically double stranded DNA; however, it may be RNA and/or DNA:RNA. The amplicon comprises DNA complementary to a sample nucleic acid. In some embodiments, primer pairs are configured to generate amplicons from a sample nucleic acid. As such, the sequence of any given amplicon may include the primer pair, the complement of the primer pair, and the region of a sample nucleic acid that was amplified to generate the amplicon. One skilled in the art understands that the incorporation of the designed primer pair sequences into an amplicon may replace the native sequences at the primer binding site, and complement thereof. In certain embodiments, after amplification of the target region using the primers the resultant amplicons having the primer sequences are used for subsequent analysis. In some embodiments, the amplicon further comprises a length that is compatible with subsequent analysis.
(11) The term amplifying or amplification in the context of nucleic acids refers to the production of multiple copies of a polynucleotide, or a portion of the polynucleotide, typically starting from a small amount of the polynucleotide (e.g., as few as a single polynucleotide molecule), where the amplification products or amplicons are generally detectable. Amplification of polynucleotides encompasses a variety of chemical and enzymatic processes. The generation of multiple DNA copies from one or a few copies of a target or template DNA molecule during a polymerase chain reaction (PCR) or a ligase chain reaction (LCR) are forms of amplification. Amplification is not limited to the strict duplication of the starting molecule. For example, the generation of multiple cDNA molecules from a limited amount of RNA in a sample using reverse transcription (RT)-PCR is a form of amplification. Furthermore, the generation of multiple RNA molecules from a single DNA molecule during the process of transcription is also a form of amplification.
(12) As used herein, the term solid support refers to a substrate or other solid material that does not dissolve in aqueous solutions utilized in nucleic acid purification or isolation. For example, in some embodiments, solid supports are substrates utilized in nucleic acid purification and isolation. Examples include, but are not limited to, beads, particles, resins, chromatography columns, and the like. In some embodiments, solid supports are coated or functionalized with material that enhances nucleic acid binding.
(13) As used herein, the terms subject and patient refer to any animal, such as a dog, a cat, a bird, livestock, and particularly a mammal, and preferably a human.
(14) As used herein, the term sample is used in its broadest sense. In one sense, it is meant to include a representative portion or culture obtained from any source, including biological and environmental sources. Biological samples may be obtained from animals (including humans) and encompass fluids (e.g., sputum), solids, tissues, and gases. Biological samples include blood products, such as plasma, serum, and the like. In some embodiments, samples comprise cells (e.g., bacterial cells) tissues, or nucleic acids (e.g., DNA or RNA) isolated from such cells or tissues. Environmental samples include environmental material such as surface matter, soil, mud, sludge, biofilms, water, and industrial samples. Such examples are not however to be construed as limiting the sample types applicable to the present disclosure.
Embodiments of the Technology
(15) Although the disclosure herein refers to certain illustrated embodiments, it is to be understood that these embodiments are presented by way of example and not by way of limitation.
(16) I. Detection Assays
(17) Embodiments of the present disclosure provide a multipart assay for detection of the presence of antibiotic resistant MTB and optionally MTB. In some embodiments, the assay first detects the presence or absence of an MTB complex bacterium (e.g., including but not limited to, one or more of M. tuberculosis, M. africanum, M. bovis, M. bovis BCG, M. canettii, M. microti, M. caprae, and M. pinnipedii). The present disclosure is not limited to particular MTB targets. Examples include, but are not limited to, IS6110 or PAB. The Genbank accession number for IS6110 is X17348 and for PAB it is M30046
(18) If a MTB bacterium is detected (or a sample is already known to be MTB positive), an assay to determine the presence or absence of rifampicin and/or isoniazid resistance in the bacterium is performed. In some embodiments, the antibiotic resistance phase of the assay is performed without the MTB detection phase (e.g., when an individual has already been diagnosed with infection by MTB). In some embodiments, the resistance detection phase of the assay is performed after the MTB detection phase without further sample prep.
(19) In some embodiments, rifampicin resistance is determined based on mutations in rpoB (e.g., including, but not limited to, D516V, H526Y, H526D, or S531L).
(20) In some embodiments, resistance to isoniazid is determined based on mutations in katG and the inhA promoter (e.g., including, but not limited to, S315T1 in katG and C-15T in the inhA promoter).
(21) Exemplary primers and probes for identifying the above mutations are shown in SEQ ID NOs: 1-21. The present disclosure is not limited to the primers and probes described in the SEQ ID NOs:1-21. The present disclosure further contemplates sequences comprising, consisting essentially of or consisting of SEQ ID NOs:1-21; variants of SEQ ID NOs:1-21 (e.g., comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotide additions (e.g., to the 3 or 5 end), deletions (e.g., internally or from the 3 or 5 end), or substitutions), polynucleotide sequences that are capable of hybridizing to SEQ ID NOs: 1-21 under conditions of low to high stringency, and the like. In some embodiments, variants comprise non-natural nucleotides. In some embodiments, nucleic acids comprise labels (e.g., those described herein).
(22) In some embodiments, the present disclosure is exemplified with a real time PCR/probe detection assay (RT-PCR) as described in Example 1 below. However, the present disclosure is not limited to RT-PCR. Additional detection methods are described below.
(23) Any suitable sample may be utilized in the compositions and methods disclosed herein. In some embodiments, the sample is sputum, saliva, bronchiolar lavage (BAL), or a N-acetyl-L-cystine (NALC) sediment of any of the aforementioned samples. In some embodiments, samples are processed prior to assaying (e.g., to isolate bacterial DNA, improve purity, remove materials that may impact assay performance, etc.). In some embodiments, samples are used without further processing.
(24) In some embodiments, sample preparation and assay performance is automated (e.g., using automated sample handling, amplification, and analysis systems). In some embodiments, commercially available systems (e.g., available from Abbott, Abbott Park, Ill.; See e.g., U.S. Pat. No. 8,703,445; herein incorporated by reference in its entirety) are utilized.
(25) In some embodiments, the present disclosure provides software and a computer processor and display screen (e.g., computer, laptop, smart phone, tablet, etc.) for analyzing and displaying data.
(26) In some embodiments, assay components are provided in the form of a system or kit. In some embodiments, kits comprise assay reagents (e.g., nucleic acid primers or probes, buffers, controls, dNTPs, etc.), controls, software, instructions, etc. In some embodiments, reagents are provided in one or more separate containers (e.g., vials, wells, tubes, etc.). For example, in some embodiments, sample preparation reagents, MTB detection reagents, and antibiotic resistance detection mutations are each provided in separate containers.
(27) In some embodiments, MTB detection and mutation analysis assays are nucleic acid detection assays (e.g., amplification, sequencing, hybridization, etc.). Illustrative non-limiting examples of nucleic acid amplification techniques include, but are not limited to, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), transcription-mediated amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA), and nucleic acid sequence based amplification (NASBA). Those of ordinary skill in the art will recognize that certain amplification techniques (e.g., PCR) require that RNA be reversed transcribed to DNA prior to amplification (e.g., RT-PCR), whereas other amplification techniques directly amplify RNA (e.g., TMA and NASBA).
(28) In some embodiments, nucleic acid sequencing methods are utilized (e.g., for detection of amplified nucleic acids). In some embodiments, the technology provided herein finds use in a Second Generation (a.k.a. Next Generation or Next-Gen), Third Generation (a.k.a. Next-Next-Gen), or Fourth Generation (a.k.a. N3-Gen) sequencing technology including, but not limited to, pyrosequencing, sequencing-by-ligation, single molecule sequencing, sequence-by-synthesis (SBS), semiconductor sequencing, massive parallel clonal, massive parallel single molecule SBS, massive parallel single molecule real-time, massive parallel single molecule real-time nanopore technology, etc. Morozova and Marra provide a review of some such technologies in Genomics, 92: 255 (2008), herein incorporated by reference in its entirety. Those of ordinary skill in the art will recognize that because RNA is less stable in the cell and more prone to nuclease attack experimentally RNA is usually reverse transcribed to DNA before sequencing.
(29) A number of DNA sequencing techniques are suitable, including fluorescence-based sequencing methodologies (See, e.g., Birren et al., Genome Analysis: Analyzing DNA, 1, Cold Spring Harbor, N.Y.; herein incorporated by reference in its entirety). In some embodiments, the technology finds use in automated sequencing techniques understood in that art. In some embodiments, the present technology finds use in parallel sequencing of partitioned amplicons (PCT Publication No: WO2006084132 to Kevin McKernan et al., herein incorporated by reference in its entirety). In some embodiments, the technology finds use in DNA sequencing by parallel oligonucleotide extension (See, e.g., U.S. Pat. No. 5,750,341 to Macevicz et al., and U.S. Pat. No. 6,306,597 to Macevicz et al., both of which are herein incorporated by reference in their entireties). Additional examples of sequencing techniques in which the technology finds use include the Church polony technology (Mitra et al., 2003, Analytical Biochemistry 320, 55-65; Shendure et al., 2005 Science 309, 1728-1732; U.S. Pat. Nos. 6,432,360, 6,485,944, 6,511,803; herein incorporated by reference in their entireties), the 454 picotiter pyrosequencing technology (Margulies et al., 2005 Nature 437, 376-380; US 20050130173; herein incorporated by reference in their entireties), the Solexa single base addition technology (Bennett et al., 2005, Pharmacogenomics, 6, 373-382; U.S. Pat. Nos. 6,787,308; 6,833,246; herein incorporated by reference in their entireties), the Lynx massively parallel signature sequencing technology (Brenner et al. (2000). Nat. Biotechnol. 18:630-634; U.S. Pat. Nos. 5,695,934; 5,714,330; herein incorporated by reference in their entireties), and the Adessi PCR colony technology (Adessi et al. (2000). Nucleic Acid Res. 28, E87; WO 00018957; herein incorporated by reference in its entirety).
(30) Next-generation sequencing (NGS) methods share the common feature of massively parallel, high-throughput strategies, with the goal of lower costs in comparison to older sequencing methods (see, e.g., Voelkerding et al., Clinical Chem., 55: 641-658, 2009; MacLean et al., Nature Rev. Microbiol., 7: 287-296; each herein incorporated by reference in their entirety). NGS methods can be broadly divided into those that typically use template amplification and those that do not. Amplification-requiring methods include pyrosequencing commercialized by Roche as the 454 technology platforms (e.g., GS 20 and GS FLX), Life Technologies/Ion Torrent, the Solexa platform commercialized by Illumina, GnuBio, and the Supported Oligonucleotide Ligation and Detection (SOLiD) platform commercialized by Applied Biosystems. Non-amplification approaches, also known as single-molecule sequencing, are exemplified by the HeliScope platform commercialized by Helicos BioSciences, and emerging platforms commercialized by VisiGen, Oxford Nanopore Technologies Ltd., and Pacific Biosciences, respectively.
(31) In pyrosequencing (Voelkerding et al., Clinical Chem., 55: 641-658, 2009; MacLean et al., Nature Rev. Microbiol., 7: 287-296; U.S. Pat. Nos. 6,210,891; 6,258,568; each herein incorporated by reference in its entirety), template DNA is fragmented, end-repaired, ligated to adaptors, and clonally amplified in-situ by capturing single template molecules with beads bearing oligonucleotides complementary to the adaptors. Each bead bearing a single template type is compartmentalized into a water-in-oil microvesicle, and the template is clonally amplified using a technique referred to as emulsion PCR. The emulsion is disrupted after amplification and beads are deposited into individual wells of a picotitre plate functioning as a flow cell during the sequencing reactions. Ordered, iterative introduction of each of the four dNTP reagents occurs in the flow cell in the presence of sequencing enzymes and luminescent reporter such as luciferase. In the event that an appropriate dNTP is added to the 3 end of the sequencing primer, the resulting production of ATP causes a burst of luminescence within the well, which is recorded using a CCD camera. It is possible to achieve read lengths greater than or equal to 400 bases, and 10.sup.6 sequence reads can be achieved, resulting in up to 500 million base pairs (Mb) of sequence.
(32) In the Solexa/Illumina platform (Voelkerding et al., Clinical Chem., 55: 641-658, 2009; MacLean et al., Nature Rev. Microbiol., 7: 287-296; U.S. Pat. No. 6,833,246; U.S. Pat. No. 7,115,400; U.S. Pat. No. 6,969,488; each herein incorporated by reference in its entirety), sequencing data are produced in the form of shorter-length reads. In this method, single-stranded fragmented DNA is end-repaired to generate 5-phosphorylated blunt ends, followed by Klenow-mediated addition of a single A base to the 3 end of the fragments. A-addition facilitates addition of T-overhang adaptor oligonucleotides, which are subsequently used to capture the template-adaptor molecules on the surface of a flow cell that is studded with oligonucleotide anchors. The anchor is used as a PCR primer, but because of the length of the template and its proximity to other nearby anchor oligonucleotides, extension by PCR results in the arching over of the molecule to hybridize with an adjacent anchor oligonucleotide to form a bridge structure on the surface of the flow cell. These loops of DNA are denatured and cleaved. Forward strands are then sequenced with reversible dye terminators. The sequence of incorporated nucleotides is determined by detection of post-incorporation fluorescence, with each fluor and block removed prior to the next cycle of dNTP addition. Sequence read length ranges from 36 nucleotides to over 250 nucleotides, with overall output exceeding 1 billion nucleotide pairs per analytical run.
(33) Sequencing nucleic acid molecules using SOLiD technology (Voelkerding et al., Clinical Chem., 55: 641-658, 2009; MacLean et al., Nature Rev. Microbiol., 7: 287-296; U.S. Pat. Nos. 5,912,148; 6,130,073; each herein incorporated by reference in their entirety) also involves fragmentation of the template, ligation to oligonucleotide adaptors, attachment to beads, and clonal amplification by emulsion PCR. Following this, beads bearing template are immobilized on a derivatized surface of a glass flow-cell, and a primer complementary to the adaptor oligonucleotide is annealed. However, rather than utilizing this primer for 3 extension, it is instead used to provide a 5 phosphate group for ligation to interrogation probes containing two probe-specific bases followed by 6 degenerate bases and one of four fluorescent labels. In the SOLiD system, interrogation probes have 16 possible combinations of the two bases at the 3 end of each probe, and one of four fluors at the 5 end. Fluor color, and thus identity of each probe, corresponds to specified color-space coding schemes. Multiple rounds (usually 7) of probe annealing, ligation, and fluor detection are followed by denaturation, and then a second round of sequencing using a primer that is offset by one base relative to the initial primer. In this manner, the template sequence can be computationally re-constructed, and template bases are interrogated twice, resulting in increased accuracy. Sequence read length averages 35 nucleotides, and overall output exceeds 4 billion bases per sequencing run.
(34) In certain embodiments, the technology finds use in nanopore sequencing (see, e.g., Astier et al., J. Am. Chem. Soc. 2006 Feb. 8; 128(5):1705-10, herein incorporated by reference). The theory behind nanopore sequencing has to do with what occurs when a nanopore is immersed in a conducting fluid and a potential (voltage) is applied across it. Under these conditions a slight electric current due to conduction of ions through the nanopore can be observed, and the amount of current is exceedingly sensitive to the size of the nanopore. As each base of a nucleic acid passes through the nanopore, this causes a change in the magnitude of the current through the nanopore that is distinct for each of the four bases, thereby allowing the sequence of the DNA molecule to be determined.
(35) In certain embodiments, the technology finds use in HeliScope by Helicos BioSciences (Voelkerding et al., Clinical Chem., 55: 641-658, 2009; MacLean et al., Nature Rev. Microbiol., 7: 287-296; U.S. Pat. Nos. 7,169,560; 7,282,337; 7,482,120; 7,501,245; 6,818,395; 6,911,345; 7,501,245; each herein incorporated by reference in their entirety). Template DNA is fragmented and polyadenylated at the 3 end, with the final adenosine bearing a fluorescent label. Denatured polyadenylated template fragments are ligated to poly(dT) oligonucleotides on the surface of a flow cell. Initial physical locations of captured template molecules are recorded by a CCD camera, and then label is cleaved and washed away. Sequencing is achieved by addition of polymerase and serial addition of fluorescently-labeled dNTP reagents. Incorporation events result in fluor signal corresponding to the dNTP, and signal is captured by a CCD camera before each round of dNTP addition. Sequence read length ranges from 25-50 nucleotides, with overall output exceeding 1 billion nucleotide pairs per analytical run.
(36) The Ion Torrent technology is a method of DNA sequencing based on the detection of hydrogen ions that are released during the polymerization of DNA (see, e.g., Science 327(5970): 1190 (2010); U.S. Pat. Appl. Pub. Nos. 20090026082, 20090127589, 20100301398, 20100197507, 20100188073, and 20100137143, incorporated by reference in their entireties for all purposes). A microwell contains a template DNA strand to be sequenced. Beneath the layer of microwells is a hypersensitive ISFET ion sensor. All layers are contained within a CMOS semiconductor chip, similar to that used in the electronics industry. When a dNTP is incorporated into the growing complementary strand a hydrogen ion is released, which triggers a hypersensitive ion sensor. If homopolymer repeats are present in the template sequence, multiple dNTP molecules will be incorporated in a single cycle. This leads to a corresponding number of released hydrogens and a proportionally higher electronic signal. This technology differs from other sequencing technologies in that no modified nucleotides or optics are used. The per-base accuracy of the Ion Torrent sequencer is 99.6% for 50 base reads, with 100 Mb to 100 Gb generated per run. The read-length is 100-300 base pairs. The accuracy for homopolymer repeats of 5 repeats in length is 98%. The benefits of ion semiconductor sequencing are rapid sequencing speed and low upfront and operating costs.
(37) The technology finds use in another nucleic acid sequencing approach developed by Stratos Genomics, Inc. and involves the use of Xpandomers. This sequencing process typically includes providing a daughter strand produced by a template-directed synthesis. The daughter strand generally includes a plurality of subunits coupled in a sequence corresponding to a contiguous nucleotide sequence of all or a portion of a target nucleic acid in which the individual subunits comprise a tether, at least one probe or nucleobase residue, and at least one selectively cleavable bond. The selectively cleavable bond(s) is/are cleaved to yield an Xpandomer of a length longer than the plurality of the subunits of the daughter strand. The Xpandomer typically includes the tethers and reporter elements for parsing genetic information in a sequence corresponding to the contiguous nucleotide sequence of all or a portion of the target nucleic acid. Reporter elements of the Xpandomer are then detected. Additional details relating to Xpandomer-based approaches are described in, for example, U.S. Pat. Pub No. 20090035777, entitled High Throughput Nucleic Acid Sequencing by Expansion, filed Jun. 19, 2008, which is incorporated herein in its entirety.
(38) Other emerging single molecule sequencing methods include real-time sequencing by synthesis using a VisiGen platform (Voelkerding et al., Clinical Chem., 55: 641-58, 2009; U.S. Pat. No. 7,329,492; U.S. patent application Ser. No. 11/671,956; U.S. patent application Ser. No. 11/781,166; each herein incorporated by reference in their entirety) in which immobilized, primed DNA template is subjected to strand extension using a fluorescently-modified polymerase and florescent acceptor molecules, resulting in detectible fluorescence resonance energy transfer (FRET) upon nucleotide addition.
(39) In some embodiments, detection methods utilize hybridization assays. Illustrative non-limiting examples of nucleic acid hybridization techniques include, but are not limited to, microarrays including, but not limited to: DNA microarrays (e.g., cDNA microarrays and oligonucleotide microarrays). A DNA microarray, commonly known as gene chip, DNA chip, or biochip, is a collection of microscopic DNA spots attached to a solid surface (e.g., glass, plastic or silicon chip) forming an array for the purpose of expression profiling or monitoring expression levels for thousands of genes simultaneously. The affixed DNA segments are known as probes, thousands of which can be used in a single DNA microarray. Microarrays can be used to identify disease genes or transcripts by comparing gene expression in disease and normal cells. Microarrays can be fabricated using a variety of technologies, including but not limiting: printing with fine-pointed pins onto glass slides; photolithography using pre-made masks; photolithography using dynamic micromirror devices; ink-jet printing; or, electrochemistry on microelectrode arrays.
(40) Southern and Northern blotting is used to detect specific DNA or RNA sequences, respectively. DNA or RNA extracted from a sample is fragmented, electrophoretically separated on a matrix gel, and transferred to a membrane filter. The filter bound DNA or RNA is subject to hybridization with a labeled probe complementary to the sequence of interest. Hybridized probe bound to the filter is detected. A variant of the procedure is the reverse Northern blot, in which the substrate nucleic acid that is affixed to the membrane is a collection of isolated DNA fragments and the probe is RNA extracted from a tissue and labeled.
(41) One illustrative detection method, the Hybridization Protection Assay (HPA) involves hybridizing a chemiluminescent oligonucleotide probe (e.g., an acridinium ester-labeled (AE) probe) to the target sequence, selectively hydrolyzing the chemiluminescent label present on unhybridized probe, and measuring the chemiluminescence produced from the remaining probe in a luminometer. See, e.g., U.S. Pat. No. 5,283,174 and Norman C. Nelson et al., Nonisotopic Probing, Blotting, and Sequencing, ch. 17 (Larry J. Kricka ed., 2d ed. 1995, each of which is herein incorporated by reference in its entirety).
(42) Attachment of fluorophores to nucleic acid probes is well known in the art and may be accomplished by any available means. Fluorophores can be covalently attached to a particular nucleotide, for example, and the labeled nucleotide incorporated into the probe using standard techniques such as nick translation, random priming, PCR labeling, and the like. Alternatively, the fluorophore can be covalently attached via a linker to the deoxycytidine nucleotides of the probe that have been transaminated. Methods for labeling probes are described in U.S. Pat. No. 5,491,224 and Molecular Cytogenetics: Protocols and Applications (2002), Y.-S. Fan, Ed., Chapter 2, Labeling Fluorescence In Situ Hybridization Probes for Genomic Targets, L. Morrison et al., p. 21-40, Humana Press, both of which are herein incorporated by reference for their descriptions of labeling probes.
(43) Exemplary fluorophores that can be used for labeling probes include TEXAS RED (Molecular Probes, Inc., Eugene, Oreg.), CASCADE blue aectylazide (Molecular Probes, Inc., Eugene, Oreg.), SPECTRUMORANGE (Abbott Molecular, Des Plaines, Ill.) and SPECTRUMGOLD (Abbott Molecular).
(44) Examples of fluorophores that can be used in the methods described herein are: 7-amino-4-methylcoumarin-3-acetic acid (AMCA); 5-(and -6)-carboxy-X-rhodamine, lissamine rhodamine B, 5-(and -6)-carboxyfluorescein; fluorescein-5-isothiocyanate (FITC); 7-diethylaminocoumarin-3-carboxylic acid, tetramethyl-rhodamine-5-(and -6)-isothiocyanate; 5-(and -6)-carboxytetramethylrhodamine; 7-hydroxy-coumarin-3-carboxylic acid; 6-[fluorescein 5-(and -6)-carboxamido]hexanoic acid; N-(4,4-difluoro-5,7-dimethyl-4-bora-3a, 4a diaza-3-indacenepropionic acid; eosin-5-isothiocyanate; erythrosine-5-isothiocyanate; 5-(and -6)-carboxyrhodamine 6G; and Cascades blue aectylazide (Molecular Probes, Inc., Eugene, Oreg.).
(45) Probes can be viewed with a fluorescence microscope and an appropriate filter for each fluorophore, or by using dual or triple band-pass filter sets to observe multiple fluorophores. See, e.g., U.S. Pat. No. 5,776,688 to Bittner, et al., which is incorporated herein by reference. Any suitable microscopic imaging method can be used to visualize the hybridized probes, including automated digital imaging systems, such as those available from MetaSystems or Applied Imaging. Alternatively, techniques such as flow cytometry can be used to examine the hybridization pattern of the chromosomal probes.
(46) Probes can also be labeled indirectly, e.g., with biotin or digoxygenin by means well known in the art. However, secondary detection molecules or further processing are then used to visualize the labeled probes. For example, a probe labeled with biotin can be detected by avidin conjugated to a detectable marker, e.g., a fluorophore. Additionally, avidin can be conjugated to an enzymatic marker such as alkaline phosphatase or horseradish peroxidase. Such enzymatic markers can be detected in standard colorimetric reactions using a substrate for the enzyme. Substrates for alkaline phosphatase include 5-bromo-4-chloro-3-indolylphosphate and nitro blue tetrazolium. Diaminobenzoate can be used as a substrate for horseradish peroxidase. Fluorescence detection of a hybridized biotin or other indirect labeled probe can be achieved by use of the commercially available tyramide amplification system.
(47) Other agents or dyes can be used in lieu of fluorophores as label-containing moieties. Suitable labels that can be attached to probes include, but are not limited to, radioisotopes, fluorophores, chromophores, mass labels, electron dense particles, magnetic particles, spin labels, molecules that emit luminescence, electrochemically active molecules, enzymes, cofactors, and enzyme substrates. Luminescent agents include, for example, radioluminescent, chemiluminescent, bioluminescent, and phosphorescent label containing moieties. Alternatively, detection moieties that are visualized by indirect means can be used. For example, probes can be labeled with biotin or digoxygenin using routine methods known in the art, and then further processed for detection. Visualization of a biotin-containing probe can be achieved via subsequent binding of avidin conjugated to a detectable marker. The detectable marker may be a fluorophore, in which case visualization and discrimination of probes may be achieved as described above for ISH.
(48) In some embodiments, probes are designed to have labels placed at a common interval throughout the nucleic acid (e.g., one label group every 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12).
(49) In some embodiments, a probe library comprises probes with different detectable labels (e.g., different colors of fluorescent signal).
(50) Probes hybridized to target regions may alternatively be visualized by enzymatic reactions of label moieties with suitable substrates for the production of insoluble color products. A biotin-containing probe within a set may be detected via subsequent incubation with avidin conjugated to alkaline phosphatase (AP) or horseradish peroxidase (HRP) and a suitable substrate. 5-bromo-4-chloro-3-indolylphosphate and nitro blue tetrazolium (NBT) serve as substrates for alkaline phosphatase, while diaminobenzidine serves as a substrate for HRP.
(51) In embodiments where fluorophore-labeled probes or probe compositions are used, the detection method can involve fluorescence microscopy, flow cytometry, or other means for determining probe hybridization. Any suitable microscopic imaging method may be used in conjunction with the methods of the present disclosure for observing multiple fluorophores. In the case where fluorescence microscopy is employed, hybridized samples may be viewed under light suitable for excitation of each fluorophore and with the use of an appropriate filter or filters. Automated digital imaging systems such as the MetaSystems, BioView or Applied Imaging systems may alternatively be used.
(52) Diagnosis, Treatment and Monitoring
(53) Embodiments of the present disclosure provide compositions and methods for diagnosing MTB, determining antibiotic resistance status of MTB infection, and determining and administering a treatment course of action (e.g., for treatment of tuberculosis or other MT infections).
(54) In some embodiments, individuals identified using the methods described herein as antibiotic sensitive are administered standard treatment for tuberculosis (e.g., rifampicin, isoniazid, pyrazinamide, and ethambutol for the first two months, and only rifampicin and isoniazid) for the last four months.
(55) If resistance to one or more antibiotics is identified, alternative treatments are utilized. In some embodiments, individuals identified as having multi-drug resistant MTB using the methods described herein are administered bedaquiline.
(56) In some embodiments, assays for antibiotic resistant MTB described herein are repeated multiple times (e.g., once a month, once every 6 months, once every year, or after several years) to determine if a MTB infection has become resistant during treatment. In some embodiments, assays are repeated after a recurrence of infection by MTB.
(57) The present disclosure contemplates any method capable of receiving, processing, and transmitting the information to and from laboratories conducting the assays, information providers, medical personal, and subjects. For example, in some embodiments of the present disclosure, a sample (e.g., a sputum or BAL sample) is obtained from a subject and submitted to a profiling service (e.g., clinical lab at a medical facility, genomic profiling business, etc.), located in any part of the world (e.g., in a country different than the country where the subject resides or where the information is ultimately used) to generate raw data. Where the sample comprises a tissue or other biological sample, the subject may visit a medical center to have the sample obtained and sent to the profiling center, or subjects may collect the sample themselves (e.g., a sputum sample) and directly send it to a profiling center. Once received by the profiling service, the sample is processed and a profile is produced (e.g., MTB antibiotic resistance profile), specific for the diagnostic or prognostic information desired for the subject.
(58) The profile data is then prepared in a format suitable for interpretation by a treating clinician. For example, rather than providing raw data, the prepared format may represent a diagnosis or risk assessment (e.g., presence of drug resistant MTB) for the subject, along with recommendations for particular treatment options. The data may be displayed to the clinician by any suitable method. For example, in some embodiments, the profiling service generates a report that can be printed for the clinician (e.g., at the point of care) or displayed to the clinician on a computer monitor.
(59) In some embodiments, the information is first analyzed at the point of care or at a regional facility. The raw data is then sent to a central processing facility for further analysis and/or to convert the raw data to information useful for a clinician or patient. The central processing facility provides the advantage of privacy (all data is stored in a central facility with uniform security protocols), speed, and uniformity of data analysis. The central processing facility can then control the fate of the data following treatment of the subject. For example, using an electronic communication system, the central facility can provide data to the clinician, the subject, or researchers.
(60) In some embodiments, the subject is able to directly access the data using the electronic communication system. The subject may chose further intervention or counselling based on the results. In some embodiments, the data is used for research use. For example, the data may be used to further optimize the inclusion or elimination of markers as useful indicators of a particular condition or stage of disease.
EXPERIMENTAL
Example 1
(61) This example describes MTB Detection assays.
(62) The MTB Assay is a qualitative in vitro polymerase chain reaction (PCR) assay for the direct, qualitative detection of the MTB complex. The MTB complex includes eight Mycobacterium species: M. tuberculosis, M. africanum, M. bovis, M. bovis BCG, M. canettii, M. microti, M. caprae, M. pinnipedii.
(63) Specimens for the MTB assay, including assay controls, are loaded on an automated instrument. The DNA is extracted using DNA GPR sample preparation reagents from the Abbott M Sample Preparation System.sub.DNA. The mplification/detection reagents are combined into a mastermix and transferred into a 96-well PCR tray by the m2000sp. Sample eluent is added to the 96-well PCR tray by the m2000sp for the subsequent amplification/detection reaction. Likewise, sample preparation and PCR plate preparation can also be performed manually. The plate is manually sealed and transferred to the m2000rt for the amplification and real-time fluorescence detection reaction. A negative control and a positive control are used with each run. Patient results are automatically reported on the m2000rt workstation. A signal with a valid cycle number less than or equal to a predetermined value is considered positive. A signal with no amplification or with a valid cycle number greater than the predetermined value is considered negative. The negative signal is invalidated when the IC is invalid.
(64) The Abbott RealTime MTB Oligonucleotide Reagent (Code 08N15L or 8N15L0099) includes PCR oligo buffer, ultrapure water, dNTPs, one forward primer, one reverse primer and one probe for TB IS6110, one forward primer, one reverse primer, one probe for TB PAB, one forward primer, one reverse primer, and one IC probe for the IC, and ROX Passive Reference Standard. The Oligonucleotide Reagent is filled and assembled into the Abbott RealTime MTB Amplification Reagent Kit.
(65) The Activation Reagent (Code 51-503200) contains MgCl.sub.2, a co-factor of the TaqGold enzyme. The Activation Reagent is prepared by mixing Magnesium Chloride, Tris, KCl, Proclin 950, Sodium Azide, and ultrapure water. After filtration, the Activation Reagent is filled (Code 51-503200FL) and assembled into Abbott RealTime MTB Amplification Reagent Kit.
(66) The Enzyme Reagent is prepared by filling AmpliTaq Gold DNA Polymerase (Code 33794) into vials (Code 3379400FL). After filling, it is assembled into the Abbott RealTime MTB Amplification Reagent Kit.
(67) The Abbott RealTime MTB controls are used to evaluate run validity. The control kit consists of positive controls and negative controls. The positive control consists of a dual target PAB/IS6110 plasmid DNA, Proclin 950, Sodium Azide and poly dA:dT in TE buffer. The negative control consists of TE buffer, Proclin 950, Sodium Azide. The Negative Control (Code 8N15Z0001) and Positive Control (Code 8N15W0001) are filled, labeled and packaged into the Abbott RealTime MTB Control Kit.
(68) Sample Preparation Kit
(69) The Abbott Sample Preparation System (List 6K12-24) is comprised of General Purpose Reagents for the isolation of DNA using a non-specific capture chemistry. These reagents are manufactured by Promega Corporation for Abbott Laboratories and are distributed by Abbott Laboratories.
(70) Real-Time MTB Amplification Reagent Kit Formulation
(71) TABLE-US-00001 Final Reaction Reagent Component Concentration Oligonucleotide MTB IS6110 (121) Forward Primer 0.504 uM MTB IS6110 (121) Reverse Primer 0.504 uM MTB PAB abt2 Forward Primer b 0.504 uM MTB PAB abt2 Reverse Primer x 0.504 uM MTB IS6110 probe 6 0.252 uM MTB PAB probe 1 0.202 uM Internal Control Forward Primer 196 0.605 uM Internal Control Reverse Primer 310 0.605 uM Internal Control probe 0.504 uM *Kras 5x PCR Oligo Buffer 0.504X ROX Reference 0.066 uM dNTPs 0.706 mM **Activation Reagent MgCl.sub.2 7.086 mM Enzyme AmpliTaq Gold Polymerase 14.283 units/reaction ***IC reagent IC plasmid Approximately 225 copies/ Negative diluent (TE with poly dA:dT) reaction MTB IC 8N15Y0001 *The KRAS 5X PCR Oligo Buffer contains Tris, EDTA, EGTA, KCl, Sodium Azide and Proclin 950. **The Activation Reagent is in buffer containing Tris, KCl, Sodium Azide and Proclin 950.
(72) Control Kit Formulation
(73) TABLE-US-00002 Control Component Target Level Negative Control* TE buffer NA Positive Control* TB Plasmid DNA Target to CN of 30 in FAM Channel TE buffer NA poly dA:dT NA *The Control Reagents contain Sodium Azide and Proclin 950.
(74) Cycling Conditions
(75) TABLE-US-00003 Step Number Number of Cycles Temperature Time 1 1 50 degrees C. 10 minutes 2 1 94 degrees C. 10 minutes 3 50 94 degrees C. 35 seconds 64 degrees C. 15 seconds 65 degrees C. 40 seconds
(76) TABLE-US-00004 Material Description SEQIDNO. IS6110 5 CCTGCGAGCGTA 22 (121)FP GGCGTCGGTGA3 IS6110 5 CGTCCAGCGCCG 23 (121)RP CTTCGGACCA3 PABabt2 5 GCACCTCAAGCT 24 FPb GAACGGAAAAGT CCT3 PABabt2 5 CCGGGGTTGAGC 25 RPx GCAGCGATCT3 IS6110 5 6-Fam-pdU#AG 26 probe6 GpdUGAGGpdUpdC*pdU GpdCpdUApdCpdC pdC-BHQ1dT3 PAB 5 6-Fam-pdUApdC 27 probe1 pdCAGGGpdCApdCpdC ApdUpdCAAA-BHQ1dT3 ICFP196 5 CTACAGCAGAGT 28 TGGCAGCTTCAC TTTC3 ICRP310 5 GTCTGGCCTTTC 20 AGCAAGTTTC3 Internal 5 Quasar-GApdCGAG 21 Control pdUpdUpdCApdUGAGG Probe: GpdCA-BHQ2dT3 Thermostable RefertoMS-33794 AmpliTaq fordetails GoldDNA Polymerase #pdU = 5PROPYNYL dU *pdC = 5PROPYNYL dC
Example 2
(77) This example describes an experimental protocol for performing MTB RIF/INH resistance assays.
(78) A. Reagents
(79) Amplification Reagent Kit
(80) The RealTime MTB RIF/INH Resistance Amplification Reagent Kit includes 3 reagent packs and 2 Internal Control bottles (sequences for the described nucleic acids are given below):
(81) (1) Reagent Pack A
(82) 1 bottle MTB RIF-1 Resistance Oligonucleotide Reagent A: PCR oligo buffer, ultrapure water, ProClin 950, Sodium Azide, dNTPs, IC reverse primer, IC forward primer, IC Probe, rpoB forward primer, rpoB reverse primer, rpoB rPb1 probe, rpoB rPb2 probe, rpoB rPb3, and rpoB Pb4 probe. 1 bottle AmpliTaq Gold DNA Polymerase Enzyme. 1 bottle Activation Reagent.
(2) Reagent Pack B 1 bottle MTB RIF-2 Resistance Oligonucleotide Reagent B: PCR oligo buffer, ProClin 950, Sodium Azide, ultrapure water, dNTPs, IC reverse primer, IC forward primer, IC Probe, rpoB forward primer, rpoB Reverse Primer, rpoB Pb5, rpoB Pb6, rpoB rPb7, and rpoB Pb8 probe. 1 bottle AmpliTaq Gold DNA Polymerase Enzyme. 1 bottle Activation Reagent.
(3) Reagent Pack C 1 bottle MTB INH Resistance Oligonucleotide Reagent C: PCR oligo buffer, ProClin 950, Sodium Azide, ultrapure water, dNTPs, IC reverse primer, IC forward primer, IC Probe, katG forward primer, katG reverse primer, inhA forward primer, inhA reverse primer, katGrPbwtS315-13b probe, katGrPbm315T1-13b probe, inhA rPbwt-16 probe, and inhA rPbm15T-14 probe. 1 bottle AmpliTaq Gold DNA Polymerase Enzyme. 1 bottle Activation Reagent.
(4) Internal Control 2 bottles MTB Internal Control.
(83) The Oligonucleotide Reagents are filled and assembled into the Abbott RealTime MTB RIF/INH Resistance Amplification Reagent Kit.
(84) The Activation Reagent contains MgCl.sub.2, a co-factor of the TaqGold enzyme.
(85) The Activation Reagent is prepared by mixing Magnesium Chloride, Tris, KCl, Proclin 950, Sodium Azide, and ultrapure water. After filtration, the Activation Reagent is filled and assembled into Abbott RealTime MTB RIF/INH Resistance Amplification Reagent Kit.
(86) The Enzyme Reagent is prepared by filling AmpliTaq Gold DNA Polymerase into vials. After filling, it is assembled into the Abbott RealTime MTB RIF/INH Resistance Amplification Reagent Kit.
(87) Control Kit
(88) The Abbott RealTime MTB RIF/INH Resistance controls are used to evaluate run validity. The control kit comprises positive controls and negative controls. The positive control consists of plasmid DNA containing five DNA sequences of three target regions (rpoB RIF Resistance-Determining Region (RRDR) wildtype, katG wildtype, inhA Upper Stream Promoter (USP) wildtype, katG mutation, inhA Upper Stream Promoter (USP) mutation), Proclin 950, Sodium Azide and poly dA:dT in TE buffer. The negative control consists of TE buffer, Proclin 950, Sodium Azide. The Negative Control and Positive Control are filled, labeled and packaged into the Abbott RealTime MTB RIF/INH Resistance Control Kit.
(89) Sample Preparation Kit
(90) The Abbott Sample Preparation System (List 6K12-24) is comprised of General Purpose Reagents for the isolation of DNA using a non-specific capture chemistry. These reagents are manufactured by Promega Corporation for Abbott Laboratories and are distributed by Abbott Laboratories.
(91) Real-Time MTB Amplification Reagent Kit Formulation
(92) TABLE-US-00005 Final Reaction Final Oligomix Reagent Component Concentration Concentration Oligonucleotide RIF-1 MTB R rpoB Forward Primer .800 M 3.789 M (Reagent A) and RIF-2 (Reagent B) RIF-1 (Reagent A) and RIF- MTB R rpoB Reverse Primer .800 M 3.789 M 2 (Reagent B) INH (Reagent C) MTB R katG (Forward Primer .800 M 3.313 M INH MTB R katG Reverse Primer .800 M 3.313 M INH MTB R inhA Forward Primer .800 M 3.313 M INH MTB R inhA Reverse Primer .800 M 3.313 M RIF-1 MTB R rpoB Probe 1 .115 M 0.545 M RIF-1 MTB R rpoB Probe 2 .225 M 1.066 M RIF-1 MTB R rpoB Probe 3 .090 M 0.426 M RIF-1 MTB R rpoB Probe 4 .160 M 0.758 M RIF-2 MTB R rpoB Probe 5 .225 M 1.066 M RIF-2 MTB R rpoB Probe 6 .225 M 1.066 M RIF-2 MTB R rpoB Probe 7 .200 M 0.947 M RIF-2 MTB R rpoB Probe 8 .090 M 0.426 M INH MTB R katG Probe 1 .225 M 0.932 M INH MTB R katG Probe 2 .115 M 0.476 M INH MTB R inhA Probe 1 .225 M 0.932 M INH MTB R inhA Probe 2 .135 M 0.559 M RIF-1, RIF-2 Internal Control Forward Primer 196 .500 M 2.368 M INH Internal Control Forward Primer 196 .500 M 2.071 M RIF-1, RIF-2 Internal Control Reverse Primer 310 .550 M 2.605 M (RIF-1 & RIF-2) INH Internal Control Reverse Primer 310 .600 M 2.485 M (INH) RIF-1, RIF-2 Internal Control Probe (RIF-1 & .450 M 2.131 M RIF-2) INH Internal Control Probe (INH) .500 M 2.071 M RIF-1, RIF-2, 10X Buffer 1.10X 5.209X INH 10X Buffer 1.10X 4.555X RIF-1, and RIF-2 dNTPs (RIF-1 & RIF-2) .900 mM 4.262 mM INH dNTPs (INH) .800 mM 3.313 mM **Activation Reagent (RIF-1 MgCl2 (RIF-1 & RIF-2) 9.000 mM N/A & RIF-2 INH MgCl2 (INH) 8.000 mM N/A Enzyme (RIF-1 and RIF-2) AmpliTaq Gold Polymerase (RIF-1 & 13.000 units/ N/A RIF-2) reaction INH AmpliTaq Gold Polymerase (INH) 12.000 N/A units/reaction ***IC reagent IC plasmid Approximately N/A Negative diluent (TE with poly 225 copies/ dA:dT) reaction MTB IC 8N15Y0001 *The Oliogomixs (RIF-1(Reagent A), RIF-2 (Reagent B), and INH (Reagent C)) are in PCR Oligo Buffer containing Tris, EDTA, EGTA, KCl, primers, probes, and approximately 0.085% Sodium Azide, and 0.15% Proclin 950. **The Activation Reagent is in buffer containing Tris, KCl, 0.084% Sodium Azide, and 0.15% Proclin 950.
Control Kit Formulation
(93) TABLE-US-00006 Control Component Target Level Negative Control* TE Buffer N/A Positive Control** MTB Resistance wt-15T-315T1 4E5 copies/mL Plasmid DNA TE Buffer N/A Poly dA:dT** N/A *The Negative Control Reagent is in buffer containing Tris, EDTA, 0.085% Sodium Azide, and 0.15% Proclin 950. **The Positive Control (PC) Reagent is in buffer containing Tris, EDTA, 1.5 UG/ML final concentration of Poly dA:dT, PC plasmid, approximately 0.085% Sodium Azide, and 0.15% Proclin 950.
Nucleic Acid Primers and Probes
(94) TABLE-US-00007 rpoBFP (SEQIDNO:1) 5-GAGGCGATCACACCGCAGACGTT-3 rpoBRP (SEQIDNO:2) 5-TCCAGCCCGGCACGCTCACGT-3 katGFP (SEQIDNO:3) 5-TCCGCTGGAGCAGATGGGCTTG-3 katGRP (SEQIDNO:4) 5-CGAGGAAACTGTTGTCCCATTTCG-3 inhAFP (SEQIDNO:5) 5-ACGTTACGCTCGTGGACATACCGA-3 inhARP (SEQIDNO:6) 5-ACTGAACGGGATACGAATGGG-3 rpoBrPb1 (SEQIDNO:7) 5-CFR610-GCTGGCTGGTGCC-MGB-DQ-3 rpoBrPb2 (SEQIDNO:8) 5-NED-TCTGGTCCATGAATT-MGB-3 rpoBrPb3 (SEQIDNO:9) 5-VIC-CAACCCCGACAGC-MGB-3 rpoBPb4 (SEQIDNO:10) 5-6FAM-CTGTCGGCGCTGG-MGB-3 rpoBPb5 (SEQIDNO:11) 5-CFR610-CAGCTGAGCCAATT-MGB-3 rpoBPb6 (SEQIDNO:12) 5-NED-AGAACAACCCGCTG-MGB-3 rpoBrPb7 (SEQIDNO:13) 5-VIC-CTTGTGGGTCAACC-MGB-3 rpoBPb8 (SEQIDNO:14) 5-6FAM-AGCGCCGACTGTCG-MGB-3 katGrPbwtS315-13b (SEQIDNO:15) 5-NED-ATGCCGCTGGTGA-MGB-3 katGrPbm315T1-13b (SEQIDNO:16) 5-6FAM-ATGCCGGTGGTGA-MGB-3 inhArPbwt-16 (SEQIDNO:17) 5-CFR610-ACAACCTATCGTCTCG-MGB-3 inhArPbm15T-14 (SEQIDNO:18) 5-VIC-CAACCTATCATCTC-MGB-3 ICFP196 (SEQIDNO:19) 5 CTACAGCAGAGTTGGCAGCTTCACTTTC3 ICRP310 (SEQIDNO:20) 5 GTCTGGCCTTTCAGCAAGTTTC3 InternalControlProbe: (SEQIDNO:21) 5 Quasar-GApdCGAGpdUpdUpdCApdUG AGGGpdCA-BHQ2dT3 ThermostableAmpliTaqGoldDNAPolymerase #pdU = 5PROPYNYL dU *pdC = 5PROPYNYL dC. MGB-DQ = EDQ, CFR610 = Cal Fluor Red 610.
(95) The Table below describes rpoB primers, katG primers, inhA primers, Internal control primers and Internal control probe:
(96) TABLE-US-00008 Mutation Typeof SEQ Material Description Detected Detection IDNO. rpoB 5-GAGGCGATCACA Primer N/A 1 F1210-23 CCGCAGACGTT-3 rpoB 5-TCCAGCCCGGCA Primer N/A 2 R1394-21 CGCTCACGT-3 katG 5-TCCGCTGGAGCA Primer N/A 3 F873-22 GATGGGCTTG-3 katG 5-CGAGGAAACTGT Primer N/A 4 R1000-24 TGTCCCATTTCG-3 inhA 5-ACGTTACGCTCG Primer N/A 5 F1673379-24 TGGACATACCGA-3 inhA 5-ACTGAACGGGAT Primer N/A 6 R1673492-21 ACGAATGGG-3 ICFP196 5 CTACAGCAGAGT Primer N/A 28 TGGCAGCTTCAC TTTC3 ICRP310 5 GTCTGGCCTTTC Primer N/A 20 AGCAAGTTTC3 Internal 5 Quasar-GApdCGAG Internal Positive 21 Control pdUpdUpdCApdUG Control Probe: AGGGpdCA-BHQ2dT3
(97) The Table below describes mutation coverage by each probe.
(98) TABLE-US-00009 Mutation Typeof SEQ Material Description Coverage Detection IDNO. rpoBrPb1 5-CFR610-GCT Aminoacids Negative 7 (1288-13) GGCTGGTGCC- 507-511 MGB-DQ-3 e.g.,Q510E rpoBrPb2 5-NED-TCTGGT Aminoacids Negative 8 (1309-15) CCATGAATT- 513-518 MGB-DQ-3 e.g,D516V, D516Y rpoBrPb3 5-VIC-CAACCC Aminoacids Negative 9 (1329-13) CGACAGC- 520-524 MGB-DQ-3 e.g.,L521M rpoBPb4 5-6FAM-CTG Aminoacids Negative 10 (1345-13) TCGGCGCTGG- 530-533 MGB-DQ-3 e.g.,S531L, S531W rpoBPb5 5-CFR610-CAG Aminoacids Negative 11 (1285-14) CTGAGCCAA 510-514 TT-MGB-DQ-3 e.g.,L511P rpoBPb6 5-NED-AGAACA Aminoacids Negative 12 (1307-14) ACCCGCTG- 517-521 MGB-DQ-3 e.g.,N518I rpoBrPb7 5-VIC-CTTGTG Aminoacids Negative 13 (1338-14) GGTCAACC- 523-527 MGB-DQ-3 e.g.,H526Y, H526D rpoBPb8 5-6FAM-AGC Aminoacids Negative 14 (1337-14) GCCGACTGT 527-531 CG-MGB-DQ-3 e.g.,L530M katGrPbwtS315- 5-NED-ATG 315T1,other Negative 15 13b CCGCTGGTGA- mutations MGB-DQ-3 (e.g.,315T2, 315T3,315N, 315I,315R1, 315R2,315R3, 315G,315L) katGrPbm315T1- 5-6FAM-ATG 315T1 Positive 16 13b CCGGTGGTG A-MGB-DQ-3 inhArPbwt-16 5-CFR610-ACA C-15T,other Negative 17 ACCTATCGT mutations CTCG-MGB- (e.g.,G17T, DQ-3 A16G,T8C, T8A,T8G) inhA 5-VIC-CAA C-15T Positive 18 rPbm15T-14 CCTATCATC TC-MGB-DQ-3
(99) Below are the genBank accession numbers or TB Drug Resistance Mutation Database References for primers and probes/mutations of rpoB, katG and inhA upper stream promoter.
(100) TABLE-US-00010 rpoBF1210-23: SEQIDNO.1 5-GAGGCGATCACACCGCAGACGTT-3 (gb/AL123456)RIF-1VialandRIF-2Vial rpoBR1394-21: SEQIDNO.2 5-TCCAGCCCGGCACGCTCACGT-3 (gb/AL123456)RIF-1VialandRIF-2Vial katGF873-22: SEQIDNO.3 5-TCCGCTGGAGCAGATGGGCTTG-3 (gb/AL123456)INHVial katGR1000-24: SEQIDNO.4 5-CGAGGAAACTGTTGTCCCATTTCG-3 (gb/AL123456)INHVial inhAF1673379-24: SEQIDNO.5 5-ACGTTACGCTCGTGGACATACCGA-3 (gb/AL123456)INHVial inhAR1673492-21: SEQIDNO.6 5-ACTGAACGGGATACGAATGGG-3 (gb/AL123456)INHVial rpoBrPb1(rPb1288-13(1h)): SEQIDNO.7 5-CalFluoRed610-GCTGGCTGGTGCC-MGB-3 (gb/AL123456,Rv0667)RIF-1Vial rpoBrPb2(rPb1309-15(2c)): SEQIDNO.8 5-NED-TCTGGTCCATGAATT-MGB-3 (gb/AL123456,Rv0667)RIF-1Vial rpoBrPb3(rPb1329-13(3S)): SEQIDNO.9 5-VIC-CAACCCCGACAGC-MGB-3 (gb/AL123456,Rv0667)RIF-1Vial rpoBPb4(Pb1345-13(4k)): SEQIDNO.10 5-6FAM-CTGTCGGCGCTGG-MGB-3 (gb/AL123456,Rv0667)RIF-1Vial rpoBPb5(Pb1285-14(5a)): SEQIDNO.11 5-CalFluoRed610-CAGCTGAGCCAATT-MGB-3 (gb/AL123456,Rv0667)RIF-2Vial rpoBPb6(Pb1307-14(6d)): SEQIDNO.12 5-NED-AGAACAACCCGCTG-MGB-3 (gb/AL123456,Rv0667)RIF-2Vial rpoBrPb7(rPb1338-14(7h): SEQIDNO.13 5-VIC-CTTGTGGGTCAACC-MGB-3 (gb/AL123456,Rv0667)RIF-2Vial rpoBPb8(Pb1337-14(8J)): SEQIDNO.14 5-6FAM-AGCGCCGACTGTCG-MGB-3 (gb/AL123456,Rv0667)RIF-2Vial
(101) Representative mutations covered by rpoB probes:
(102) TABLE-US-00011 rpoBrPb1(rPb1288-13(1h)): SEQIDNO.7 5-CalFluoRed610-GCTGGCTGGTGCC-MGB-3 (Aminoacids507-511;e.g.,Q510E,gb/EF628328) rpoBrPb2(rPb1309-15(2c)): SEQIDNO.8 5-NED-TCTGGTCCATGAATT-MGB-3 (Aminoacids513-518;e.g,D516V,gb/JF269609; D516Y,gb/HQ286625) rpoBrPb3(rPb1329-13(3S)): SEQIDNO.9 5-VIC-CAACCCCGACAGC-MGB-3 (Aminoacids520-524;e.g.,L521M,gb/AB711174) rpoBPb4(Pb1345-13(4k)): SEQIDNO.10 5-6FAM-CTGTCGGCGCTGG-MGB-3 (Aminoacids530-533;e.g.,S531L,gb/HM179030, S531W,gb/GU904014) rpoBPb5(Pb1285-14(5a)): SEQIDNO.11 5-CalFluoRed610-CAGCTGAGCCAATT-MGB-3 (Aminoacids510-514;e.g.,L511P,gb/JQ414016) rpoBPb6(Pb1307-14(6d)): SEQIDNO.12 5-NED-AGAACAACCCGCTG-MGB-3 (Aminoacids517-521;e.g.,N518I,gb/AB711171) rpoBrPb7(rPb1338-14(7h): SEQIDNO.13 5-VIC-CTTGTGGGTCAACC-MGB-3 (Aminoacids523-527;e.g.,H526Y,gb/AY271365; H526D,gb/HQ844251) rpoBPb8(Pb1337-14(8J)): SEQIDNO.14 5-6FAM-AGCGCCGACTGTCG-MGB-3 (Aminoacids527-531;e.g.,L530M,gb/DQ205438)
(103) Representative mutations covered by katG probes:
(104) TABLE-US-00012 INHVial NED TCACCAGCGGCAT:katGrPb950 wtS315-13b (gb/AL123456,Rv1908c)SEQIDNO.29 INHVial FAM TCACCACCGGCAT:katGrPb950 mt315T1-13b (gb/DQ056354)SEQIDNO.30 ACA mt315T2 (gb/U41309) ACG mt315T3 (TBDReaMDB:GagneuxSPLOSPath2006) AAC mt315N (gb/DQ056356) ATC mt315I (gb/AF314112) AGA mt315R1 (TBDReaMDB:LipinMYCMI2007) CGC mt315R2 (TBDReaMDB:HaasWAAAC1997) AGG mt315R3 (gb/EU884628) GGC mt315G (gb/EU884620) CTA mt315L (TBDReaMDB:MarttilaHJAAC1996)
(105) Representative mutations covered by inhA Upper Stream Promoter (USP) probes:
(106) TABLE-US-00013 INHVialCalFluoRed 610 CGAGACGATAGGTTGT inhArPbwt-16 (gb/AL123456)SEQIDNO.31 INHVial VIC GAGATGATAGGTTG inhArPbm15T- SEQIDNO.32 14(gb/FM173198) T rPbm17T (gb/AY192027) G rPbm16G (RamaswamySMusserJMTuberclelingDis1998) C rPbm8C (TBDReaMDB:BakerLVAAC2005) A rPbm8A (gb/CP001658) G rPbm8G (gb/FM173199)
B. Assay Protocol
(107) Specimens for the Abbott RealTime MTB RIF/INH Resistance assay, including assay controls, are loaded on the m2000sp instrument. The DNA is extracted using DNA sample preparation reagents from the Abbott mTM Sample Preparation SystemDNA. The amplification/detection reagents are combined into a mastermix and transferred into a 96-well PCR tray by the m2000sp. Sample eluent is added to the 96-well PCR tray by the m2000sp for the subsequent amplification/detection reaction. Likewise, sample preparation and PCR plate preparation can also be performed manually. The plate is manually sealed and transferred to the m2000rt for the amplification and real-time fluorescence detection reaction. A negative control and a positive control are required with each run. Patient results are automatically reported on the m2000rt workstation.
(108) Cycling Conditions:
(109) TABLE-US-00014 Step Number Number of Cycles Temperature Time 1 1 50 degrees C. 10 minutes 2 1 94 degrees C. 10 minutes 3 50 94 degrees C. 35 seconds 64 degrees C. 15 seconds 65 degrees C. 40 seconds
C. Results
(110)
(111) In addition, 70 purified clinical MTB genomic DNA samples from Dr. Kreiswirth (an expert in TB drug resistance) were tested. All 70 genomic DNA samples had DST results and sequencing results. The following mutations were detected in the clinical samples: rpoB: L533P, 5531L, S531W, S531F, H526Y, H526D, H526R, H526N, D516V, D516Y, D516G, D516A, H512R, L511P, and insertion 514-515. katG: S315T1, S315N, and S315I. inhA upper steam promoter: C15T and T8A.
(112) Results are shown below:
(113) TABLE-US-00015 RIF RIF Sensitivity Specificity INH INH Assay (%) (%) Sensitivity (%) Specificity (%) AM MTB 84.4 (38/45) 96.0 (24/25) 91.5 (43/47) 95.7 (22/23) RIF/INH
290 MTB cultured clinical isolates obtained from Bangladesh were also assayed. Results are shown below.
(114) TABLE-US-00016 RIF RIF Sensitivity Specificity INH INH Assay (%) (%) Sensitivity (%) Specificity (%) AM MTB 86.2 100.0 86.1-91.7 100.0 (253/253) RIF/INH (25/29) (260/260) (31/36-33*/36)
(115) All 290 cultured clinical isolates had DST results. These cultured clinical isolates (heat-inactivated) were treated with AM Inactivation Reagent (IR) then processed through m2000sp sample preparation
(116) All patents, patent application publications, journal articles, textbooks, and other publications mentioned in the specification are indicative of the level of skill of those in the art to which the disclosure pertains. All such publications are incorporated herein by reference to the same extent as if each individual publication were specifically and individually indicated to be incorporated by reference.