Pharmaceutical composition for preventing or treating breast cancer including crystalline polymorph of tetraarsenic hexoxide, and method for producing same
10525079 ยท 2020-01-07
Assignee
Inventors
Cpc classification
C01P2002/72
CHEMISTRY; METALLURGY
C01P2002/88
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a pharmaceutical composition for preventing or treating breast cancer which includes tetraarsenic hexoxide in which a crystalline polymorph a(As.sub.4O.sub.6-a), of tetraarsenic hexoxide is 99% or higher, and to a method for producing the same. The composition of the present invention exhibits excellent effects of inhibiting the proliferation and metastasis of cancer cells, and thus can be usefully used as an anticancer agent.
Claims
1. A pharmaceutical composition containing tetraarsenic hexoxide (As.sub.4O.sub.6) as an active ingredient for treatment of breast cancer, wherein the tetraarsenic hexoxide includes 99 wt % or more of tetraarsenic hexoxide crystalline polymorph a having features (i) to (iii) below: (i) Cell parameters: a=b=c=11.0734 ===90 V=1357.82 .sup.3 (ii) AsO bond length: 1.786 (iii) OAsO bond angle: 98.36.
2. The pharmaceutical composition of claim 1, wherein the tetraarsenic hexoxide is prepared by: a first step of heating sodium chloride at 100800 C., followed by cooling; a second step of placing arsenic trioxide (As.sub.2O.sub.3) on the sodium chloride, followed by heating from 100 C. to 1000 C. in an airtight state and then cooling; a third step of separating crystals crystallized in a filter bed collecting sublimated arsenic; and a fourth step of repeating the second and third steps four to ten times using the crystals obtained in the third step instead of the arsenic trioxide in the second step, thereby obtaining tetraarsenic hexoxide crystals.
3. The pharmaceutical composition of claim 1, wherein the tetraarsenic hexoxide has a purity of 99.9% or higher.
4. The pharmaceutical composition of claim 1, wherein in the X-ray powder diffraction spectrum of the crystalline polymorph a, obtained by using a light source wavelength of 1.5406 within a diffraction angle (2) of 10 to 50 at a rate of 1/min (scan step of 0.02), peaks are shown at 20 values of 13.84, 27.88, 32.32, 35.3, 39.84, 42.38, 46.34, 48.6, and 49.34.
5. A pharmaceutical composition containing tetraarsenic hexoxide (As.sub.4O.sub.6) as an active ingredient for inhibition of breast cancer metastasis, wherein the tetraarsenic hexoxide includes 99 wt %/o or more of tetraarsenic hexoxide crystalline polymorph a having features (i) to (iii) below: (i) Cell parameters: a=b=c=11.0734 ===90 V=1357.82 .sup.3 (ii) AsO bond length: 1.786 (iii) OAsO bond angle: 98.36.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
MODE FOR CARRYING OUT THE INVENTION
(7) Hereinafter, preferable examples of the present invention will be described in detail. However, the present invention is not limited to the examples described herein, and thus may be embodied into different forms. Rather, these examples are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.
Example 1: Preparation of Present Tetraarsenic Hexoxide
(8) A synthesis reactor (100 mm in height and 190 mm in diameter) specially manufactured using kaolin and three to six clamps capable of mounting filters thereon were prepared. A first clamp was installed at a distance of 50 mm from the synthesis reactor, and second to sixth clamps were installed above the first clamp at intervals of 2-6 mm from the first stamp, and the dimension of each clamp was 210 mm in diameter and 10 mm in thickness.
(9) Coarse salt weighing 400-600 g (a moisture content of 10% or less) was introduced into the synthesis reactor, and then evenly spread out and packed to a thickness of about 20 mm. The synthesis reactor was slowly heated at 100-800 C. for 3 hours, and continuously heated such that the surface temperature of the salt was 29030 C. inside the reactor, thereby removing moisture and impurities. Then, cooling was carried out at room temperature for 5 hours.
(10) Then, 100 g of a raw material, As.sub.2O.sub.3 (a purity of 98% or higher, prepared by YUNNAN WENSHAN JINCHI ARSENIC CO., LTD.) was placed on the coarse salt inside the synthesis reactor, and filters (filter beds) capable of collecting sublimated arsenic were mounted on the three to six clamps installed above the synthesis reactor such that the intervals between the filters were 2-6 mm. The filters used herein preferably had a basic weight of 70-100 g/m.sup.2, a thickness of 0.17-0.25 mm, a filtration speed of 22-30 s/100 ml, and a retention rate of 5-10 m.
(11) The filters were fixed using the clamps, and then heat was applied to the bottom portion of the synthesis reactor to gradationally raise the temperature from 100 C. to 1,000 C. First, the bottom portion of the synthesis reactor was heated for 1 hour such that the temperature outside the bottom portion of the synthesis reactor was about 3501000 C., and thereafter, heating was carried out such that the temperature outside the bottom portion of the synthesis reactor was about 600-650 C. and about 700-1,000 C., so the temperature of the center portion of the highest filter bed was maintained at 150100 C. through heating for a total of 5-10 hours. Then, cooling was carried out at room temperature for 5-7 hours. In this procedure, the As.sub.2O.sub.3 powder placed on the salt inside the synthesis reactor transformed into a gas inside the synthesis reactor, and the gas moved up, and then transformed into a liquid since the upper temperature outside the synthesis reactor was relatively low, and thereafter, the liquid was crystallized as a solid, and thus white crystals were generated on the filters.
(12) The collected white crystals were placed on the coarse salt inside the synthesis reactor, and the heating, cooling, and crystal collecting processes were again repeated four times, thereby finally obtaining 12.0 g of the crystals. As a result of checking the structure of the obtained arsenic compound crystals, it was confirmed that most of the crystals were As.sub.4O.sub.6-a while 99 wt % or more of As.sub.4O.sub.6-a and less than 1 wt % of As.sub.4O.sub.6-b were obtained.
(13) It was confirmed that as for the differential scanning calorimetry (DSC) value at a temperature rise rate of 10 V/min, As.sub.4O.sub.6-a showed an endothermic peak (melting point) at 282.67 and As.sub.4O.sub.6-b showed an endothermic peak (melting point) at 286.77 C.
(14) X-ray powder diffraction spectra of As.sub.4O.sub.6-a and As.sub.4O.sub.6-b are shown in
(15) TABLE-US-00002 TABLE 2 As.sub.4O.sub.6-a As.sub.4O.sub.6-b Diffraction Diffraction 2 () intensity 2 () intensity 13.84 7631.01 13.86 4012.09 27.88 10000 27.92 10000 32.32 2801.74 32.36 2130.23 35.3 3369.82 35.34 2511 39.84 623.242 39.9 447.422 42.38 1551.5 42.44 1431.86 46.34 2345.2 46.4 4159.8 48.6 447.69 48.66 564.995 49.34 502.761 49.4 375.571
(16) As confirmed in
(17) (1) DSC Analysis
(18) Using a DSC system (SDT Q600 V20.9 Build 20), 20.0 mg of a sample was analyzed while the temperature was raised to 310 C. at a temperature rise rate of 10/min with N.sub.2 flowing out at 100 mL/min.
(19) (2) X-Ray Crystallography
(20) Single crystals of tetraarsenic hexoxide (As.sub.4O.sub.6, MW=395.6) were placed on a glass fiber and then an X-ray beam was applied thereto, to observe diffraction patterns on photographic films and the presence or absence of the organization of diffraction data, thereby determining space groups and cell parameters. Diffraction intensities were collected in the range of 10<2<50. The crystal structure of As.sub.4O.sub.6 was determined from the data by the Patterson method by using a structure determination program (SHELXTL program).
(21) (3) X-Ray Diffractometry
(22) A sample was prepared by pulverizing the obtained crystals into particles having a size of 10-30 m (325 mesh), filling a glass holder for X-ray diffraction analysis (20 mm16 mm1 mm) with the particles, compressing the particles by a glass slide or the like, and flattening the particles to allow a sample surface to be parallel with a holder surface. The X-ray diffraction spectrum of the crystals was drawn using Cu Kai (1.54060 ) of XRD within a diffraction angle (2) of 10 to 50 at a rate of 1/min (scan step of 0.02).
Comparative Example 1: Preparation of Tetraarsenic Hexoxide
(23) A synthesis reactor (100 mm in height and 190 mm in diameter) specially manufactured using kaolin and three to six clamps capable of mounting filters thereon were prepared. A first clamp was installed at a distance of 50 mm from the synthesis reactor, and second to sixth clamps were installed above the first clamp at intervals of 2-6 mm from the first stamp, and the dimension of each clamp was 210 mm in diameter and 10 mm in thickness.
(24) Coarse salt weighing 400-600 g (a moisture content of 10- or less) was introduced into the synthesis reactor, and then evenly spread out and packed to a thickness of about 20 mm. The synthesis reactor was slowly heated at 100-800 C. for 3 hours, and continuously heated such that the surface temperature of the salt was 29030 inside the reactor, thereby removing moisture and impurities. Then, cooling was carried out at room temperature for 5 hours.
(25) Then, 100 g of a raw material, As.sub.2O.sub.3 (a purity of 98% or higher, prepared by YUNNAN WENSHAN JINCHI ARSENIC CO., LTD.) was placed on the coarse salt inside the synthesis reactor, and filters (filter beds) capable of collecting sublimated arsenic were mounted on the three to six clamps installed above the synthesis reactor such that the intervals between the filters were 2-6 mm. The filters used herein preferably had a basic weight of 70-100 g/m.sup.2, a thickness of 0.17-0.25 mm, a filtration speed of 22-30 s/100 ml, and a retention rate of 5-10 m.
(26) The filters were fixed using the clamps, and then heat was applied to the bottom portion of the synthesis reactor to gradationally raise the temperature from 100 C. to 1,000 C. First, the bottom portion of the synthesis reactor was heated for 1 hour such that the temperature outside the bottom portion of the synthesis reactor was about 350100 C., and thereafter, heating was carried out such that the temperature outside the bottom portion of the synthesis reactor was about 600-650 C. and about 700-1,000 C., so the temperature of the center portion of the highest filter bed was maintained at 150100 C. through heating for a total of 5-10 hours. Then, cooling was carried out at room temperature for 5-7 hours. In this procedure, the As.sub.2O.sub.3 powder placed on the salt inside the synthesis reactor transformed into a gas inside the synthesis reactor, and the gas moved up, and then transformed into a liquid since the upper temperature outside the synthesis reactor was relatively low, and thereafter, the liquid was crystallized as a solid, and thus white crystals were generated on the filters. 48.5 g of crystals were collected from the filters. As a result of checking the crystal structure of the collected arsenic compounds, it was confirmed that As.sub.4O.sub.6-b accounted for 99% or more.
Comparative Examples 2 to 4: Preparation of Tetraarsenic Hexoxide
(27) Comparative Examples 2 and 3 were prepared by mixing Example 1 (composition having 99% or more of crystalline polymorph As.sub.4O.sub.6-a) and Comparative Example 1 (composition having 99% or more of crystalline polymorph As.sub.4O.sub.6-b) at 4:1 and 1:1, respectively.
Test Example 1: Test of Human Breast Cancer Cell Proliferation Inhibitory Effects
(28) (1) Materials and Cell Culture
(29) Fetal bovine serum (FBS) and cell culture medium were prepared (Hyclone), and dimethyl sulfoxide (DMSO) and 3-(4,5-dimetyl-thiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT, Amresco LLC, USC) were prepared.
(30) As human cancer cell lines, human breast cancer cells MCF-7 and SK-BR-3 were obtained from the Shanghai Cell Bank of Chinese Academy of Sciences. The MCF-7 cells were incubated in Minimum Essential Media (MEM) supplemented with 10% FBS, 100 U/ml penicillin, and 100 g/ml streptomycin and the SK-BR-3 cells were incubated in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS, 100 U/ml penicillin, and 100 g/ml streptomycin in a humidified incubator with 5% CO.sub.2 and 95% air. The media were exchanged every three days.
(31) (2) Cell Proliferation Assay (MTT Assay)
(32) The effects of Example 1 and Comparative Examples 1 to 3 on cell proliferation were assessed using MTT assay. MTT assay is based on the ability of viable cells against MTT to produce insoluble dark blue formazan products. After the cells were suspended in the medium by trypsin treatment and collected, the cells were dispensed at a density of 410.sup.3 cells/well in a 96-well culture dish (Costar, Cambridge, Mass., USA). After 24 hours, the cells in the media containing 10% FBS were treated with Example 1 and Comparative Examples 1 to 3, at 0, 0.625, 1.25, 2.5, 5, 10, 20, 40, or 80 M, and then incubated. Here, stock solutions obtained by dissolving Example 1 and Comparative Examples 1 to 3 at 510.sup.2 M in 1 M sodium hydroxide was used. For MTT assay for cell proliferation, supernatants were removed from the cells incubated for 48 hours, and 72 hours after the sample treatment, and 20 l of 5 mg/me MTT solution was added per well, and the cells were incubated at 37 C. for 4 hours to form formazan crystals. After the incubation, supernatants were again removed, followed by addition of 100 l of DMSO to every well, and then mixing was carried out to completely dissolve dark blue crystals. All the crystals were completely dissolved by standing at room temperature for 15 minutes, and the absorbance was measured using a micro-plate reader at a wavelength of 570 nm (A.sub.570 nm).
(33) (3) Statistical Analysis
(34) The absorbance value of the control group treated without the sample was calculated as 100, and the absorbance value of the treatment group treated with the sample, compared with that of the control group, was calibrated, and the percentage of inhibition of cell proliferation was calculated according to the following equation.
Percentage (%) of inhibition of cell proliferation=((mean absorbance of control group cellsmean absorbance of treatment group cells)/mean absorbance of control group cells)100
(35) All data were expressed as meanstandard error of the mean (meanSEM). One-way analysis of variance (ANOVA) followed by Dunnett's post-test was used to perform multiple comparison. Statistical significance was defined as p<0.05, and each test was repeated three times.
(36) (4) Results of Test Using MCF-7 Cells
(37) The human breast cancer cell line MCF-7 cells were treated with Example 1 and Comparative Examples 1 to 3, and incubated for 48 and 72 hours, followed by MTT assay. The results are shown in
(38) (5) Results of Test Using SK-BR-3 Cells
(39) The human breast cancer cell line SK-BR-3 cells were treated with Example 1 and Comparative Examples 1 to 3, and incubated for 48 and 72 hours, followed by MTT assay. The results are shown in
Test Example 2: Test on Effect of Inducing Human Breast Cancer Cell Apoptosis
(40) (1) Materials and Cell Culture
(41) Fetal bovine serum (FBS) and cell culture medium were prepared (Hyclone). RT-PCR Kit and Trizol were obtained from Takara Biotechnology CO., LTD., and Annexin V-FITC was obtained from Shanghai Biyuntian Biological Technology Co., LTD. Primers were designed and synthesized by Beijing Aodingkangsheng Biological Technology Co., LTD.
(42) Human breast cancer cells MCF-7, as a human cancer cell line, were obtained from the Shanghai Cell Bank of Chinese Academy of Sciences. MCF-7 cells were incubated in Minimum Essential media (MEM) supplemented with 10% FBS, 100 U/ml penicillin, and 100 g/m streptomycin in a humidified incubator with 5% CO.sub.2 and 95% air. The media were exchanged every three days.
(43) (2) Flow Cytometry
(44) The effect of Example 1 on the induction of cell apoptosis was assessed by flow cytometry. The cells were dispensed at 110.sup.5 cells/well in a 6-well culture dish, and incubated for 24 hours. After 24 hours, the cells contained in the MEM containing 10% FBS were treated with Example 1 at 0, 1, 3, 6, 9, 12 or 15 M, and incubated for 24 hours. After 24 hours, the cells were treated using Annexin V-FITC kit to check cell apoptosis, and also treated with propidium iodide (PI) for distinguishment from natural cell death. Here, experiments were conducted according to the use methods of PI and Annexin V-FITC kit. The cells treated with the Annexin V-FITC kit were analyzed for the degree of cell apoptosis by using the BD FACS calibur flow cytometry system. The results are shown in
(45) (3) Reverse Transcription Polymerase Reaction (RT-PCR)
(46) In order to investigate the effect of Example 1 on the induction of cell apoptosis, mRNA expression levels of caspase-3, p21, cyclin E1, and cyclin A2, which are genes involved in cell cycle and apoptosis, were examined by RT-PCR. The cells were dispensed at 110.sup.5 cells/well in a 6-well culture dish, and incubated for 24 hours. After 24 hours, the cells contained in the MEM containing 10% FBS were treated with Example 1 at 0, 1, 3, 6, 9, 12 or 15 M, and incubated for 24 hours. After 24 hours, the cells were collected, and then RNA was extracted using Trizol reagent. The gene amplification was carried out using the primers on Table 3 below and the RT-PCR kit while the extracted RNA was used as a template, and then the changes in mRNA expression levels of caspase 3, p21, cyclin E1, and cyclin A2 were examined by electrophoresis on agarose gel. The results are shown in
(47) Therefore, it can be seen that the tetraarsenic hexoxide of Example 1 can treat breast cancer by inducing apoptosis of breast cancer cells.
(48) TABLE-US-00003 TABLE3 Amplification Gene Primersequences(5 .fwdarw. 3) length(bp) -actin Upstream:TGACGTGGACATCCGaAAAG 206 Downstream:CTGGAAGGTGGACAGCGAGG p21 Upstream:ACATCTTCTGCCTTAGTCTCA 426 Downstream:GCCCCTTCAAAGTGCCATC Caspase-3 Upstream:TGGCAACAGAATTTGAGTCCT 596 Downstream:GCAGTTAAGTCATCCGTGTAT CyclinE1 Upstream:GCCTTGTATCATTTCTCGTCAT 305 Downstream:CTCTGCTTCTTACCGCTCT CyclinA2 Upstream:GTAAACAGCCTGCGTTCACC 382 Downstream:ACTTGAACTAACCAGTCCACGAG
Test Example 3: Test to Investigate Breast Cancer Metastasis Inhibitory Effect
(49) 5-Week-old babl/c-nu male nude mice, which were safe from specific pathogens and respiratory diseases and had a body weight of 18-20 g, were used as experimental animals. The nude mice were allowed free access to food and water, and were bred in a 12-hr light/12-hr dark cycle for 7 days.
(50) The mice were transplanted with human breast cancer cells, MDA-MB-231, through subcutaneous injection, and bred for 7 days. After 7 days, the mice were randomly divided, and then respective mice were orally administered with the compositions of Example 1 and Comparative Example 1 at 4.5 mg/kg for 7 days. Here, the mice treated with nothing after the transplantation of breast cancer cells were used as a control group. After 7 days of administration of the compositions, lung tissues were taken from the mice, and then cancer cells spread to the lungs were counted to compare the degree of inhibition of breast cancer metastasis.
(51) As a result, it was confirmed that most of the transplanted breast cancer cells spread to the lungs in the control group treated with nothing after the transplantation of breast cancer cells, whereas the spreading of the breast cancer cells to the lungs was inhibited in the groups treated with Comparative Example 1 and Example 1. It was especially confirmed that Example 1 showed a percentage of inhibition of cancer cell metastasis of 90% or more, indicating a significantly excellent cancer metastasis inhibitory effect compared with Comparative Example 1 showing a percentage of inhibition of cancer cell metastasis of 50%.
Test Example 4: Clinical Test
(52) The following clinical test was conducted using the composition of Example 1.
(53) The patient received hospital treatments and folk remedies since breast cancer was found in 2006, but the breast cancer was metastasized to the lungs, pleura, bones, and liver. In May 2014, pleural effusion and peritoneal fluid collection were found, and thus the pleural effusion was extracted several times. However, due to a severe difficulty in breathing caused by malignant pleural effusion, the patient breathed through an oxygen respiratory system in an emergency room and hospice medical ward. However, the patient began to develop pallor due to a lack of oxygen, and the patient, having about one week left to live, was orally administered with 5 mg of Example 1 three times a day (15 mg/day).
(54) CT images of the patient before the administration of Example 1 and after 8, 13, 17 and 22 months of administration of Example 1 are shown in
(55) It was confirmed through the clinical test results that the composition of the present invention had a metastatic breast cancer treatment effect.