Peptide showing melanin generation-promoting activity and use thereof

Abstract

The present invention provides a peptide which shows a melanin generation-promoting activity. The peptide of the present invention increases the activity and expression of tyrosinase and increases the expression of factors related to melanin generation, thereby showing an excellent effect in melanin generation. The peptide of the present invention can be used for preventing, alleviating, and treating hypomelanosis. The above-mentioned superior activity and stability of the peptide of the present invention allows the peptide to be very favorably applied to medicines, quasi drugs, and cosmetics.

Claims

1. A peptide having an activity to stimulate melanogenesis, the peptide consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, optionally wherein (i) the C-terminal end of the peptide is modified by the presence of an amino group or an azide group, or (ii) the N-terminal end of the peptide comprises a protecting group.

2. The peptide of claim 1, wherein the peptide increases the activity of tyrosinase.

3. The peptide of claim 1, wherein the peptide increases the expression of a melanin synthesis-related factor selected from the group consisting of microphthalmia-associated transcription factor (MITF) and tyrosinase-related protein 1 (TRP1).

4. The peptide of claim 1, wherein the peptide increases the expression of tyrosinase.

5. The peptide of claim 1, wherein the peptide increases the phosphorylation of cAMP response element-binding protein (CREB).

6. The peptide of claim 1, wherein the C-terminal end of the peptide is modified by the presence of an amino group or an azide group.

7. The peptide of claim 1, wherein the N-terminal end of the peptide comprises a protecting group.

8. The peptide of claim 7, wherein the protecting group is selected from the group consisting of an acetyl group, a fluorenyl methoxy carbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG).

9. A method for treating hypomelanosis comprising: administering a pharmaceutical composition comprising at least one peptide selected from a peptide consisting of the amino acid of SEQ ID NO: 1 and a peptide consisting of the amino acid of SEQ ID NO: 2, as an active ingredient, optionally wherein (i) the C-terminal end of the at least one peptide is modified by the presence of an amino group or an azide group, or (ii) the N-terminal end of the at least one peptide comprises a protecting group.

10. The method of claim 9, wherein the hypomelanosis is vitiligo, albinism, nevus depigmentosus, pityriasis alba, pityriasis versicolor, post-inflammatory depigmentation, morphea, piebaldism, idiopathic guttate hypomelanosis, or leucoderma punctatum.

11. The method of claim 9, wherein the C-terminal end of the at least one peptide is modified by the presence of an amino group or an azide group.

12. The method of claim 9, wherein the N-terminal end of the at least one peptide comprises a protecting group.

13. The method of claim 12, wherein the protecting group is selected from the group consisting of an acetyl group, a fluorenyl methoxy carbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG).

14. A method for improving hypomelanosis comprising: contacting a subject with a cosmetic composition comprising at least one peptide selected from a peptide consisting of the amino acid of SEQ ID NO: 1 and a peptide consisting of the amino acid of SEQ ID NO: 2, as an active ingredient, optionally wherein (i) the C-terminal end of the at least one peptide is modified by the presence of an amino group or an azide group, or (ii) the N-terminal end of the at least one peptide comprises a protecting group.

15. The method of claim 14, wherein the hypomelanosis is vitiligo, albinism, nevus depigmentosus, pityriasis alba, pityriasis versicolor, post-inflammatory depigmentation, morphea, piebaldism, idiopathic guttate hypomelanosis, or leucoderma punctatum.

16. The method of claim 14, wherein the C-terminal end of the at least one peptide is modified by the presence of an amino group or an azide group.

17. The method of claim 14, wherein the N-terminal end of the at least one peptide comprises a protecting group.

18. The method of claim 17, wherein the protecting group is selected from the group consisting of an acetyl group, a fluorenyl methoxy carbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG).

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1a shows the results of confirming a melanogenesis increasing effect by a peptide composed of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.

(2) FIG. 1b shows the results of confirming a melanogenesis increasing effect by a peptide composed of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.

(3) FIG. 2a shows the results of confirming a tyrosinase activity increasing effect by a peptide composed of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.

(4) FIG. 2b shows the results of confirming a tyrosinase activity increasing effect by a peptide composed of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.

(5) FIG. 3a shows the results of confirming mRNA expression increases of MITF, tyrosinase, and TRP1 by a peptide composed of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.

(6) FIG. 3b shows the results of confirming mRNA expression increases of MITF, tyrosinase, and TRP1 by a peptide composed of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.

(7) FIG. 4a shows the results of confirming protein expression increases of MITF and tyrosinase by a peptide composed of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.

(8) FIG. 4b shows the results of confirming a protein expression increase of tyrosinase by a peptide composed of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.

(9) FIG. 5 shows the results of confirming a phosphorylation increase of CREB by a peptide composed of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.

BEST MODE FOR CARRYING OUT THE INVENTION

(10) Provided is a peptide having an activity to stimulate melanogenesis, the peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2.

MODE FOR CARRYING OUT THE INVENTION

(11) Hereinafter, the present invention will be described in detail with reference to examples. These examples are only for illustrating the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

EXAMPLES

Synthetic Example 1: Peptide Synthesis

(12) 700 mg of chlorotrityl chloride resin (CTL resin, Nova Biochem Cat No. 01-64-0021) was added into a reaction container, and 10 ml of methylene chloride (MC) was added, followed by stirring for 3 minutes. After the solution was removed, 10 ml of dimethyl form amide (DMF) was added, followed by stirring for 3 minutes, and then the solvent was again removed.

(13) 10 ml of a dichloromethane solution was added to a reactor, and 200 mmole Fmoc-Asp(OtBu)-OH (Bachem, Swiss) and 400 mmole diisopropyl ethylamine (DIEA) were added. Thereafter, the mixture was well dissolved with stirring, and then the reaction was conducted with stirring for 1 hour.

(14) After the reaction, washing was conducted, and then methanol and DIEA (2:1) were dissolved in dichloromethane (DCM), followed by reaction for 10 minutes, and then the resulting material was washed with excess DCM/DMF (1:1). After the solution was removed, 10 ml of dimethyl form amide (DMF) was added, followed by stirring for 3 minutes, and then the solvent was again removed.

(15) 10 ml of a deprotection solution (20% piperidine/DMF) was added to a reaction container, followed by stirring at room temperature for 10 minutes, and then the solution was removed. An equal amount of a deprotection solution was added, and then the reaction was again maintained for 10 minutes, and thereafter, the solution was removed, followed by washing twice with DMF, once with MC, and once with DMF, for 3 minutes each, thereby preparing Ser (tBu)-CTL resin.

(16) 10 ml of a DMF solution was added to a new reactor, and 200 mmol Fmoc-Thr(tBu)-OH (Bachem, Swiss), 200 mmol HoBt, and 200 mmole Bop were added, and the mixture was well dissolved with stirring. 400 mmole DIEA was added to a reactor in two divided portions, and then stirring was conducted for at least 5 minutes until all solids were dissolved.

(17) The dissolved amino acid mixed solution was added to the reaction container containing the deprotected resin, and the reaction was conducted with stirring at room temperature for 1 hour. After the reaction solution was removed, the stirring was conducted using a DMF solution three times for 5 minutes each, followed by removal.

(18) A small amount of the reaction resin was taken to check the extent of reaction using the Kaiser test (Ninhydrin test). The deprotection reaction was twice conducted using a deprotection solution in the same manner as described above, thereby preparing Glu(OtBu)-Asp(OtBu)-CTL resin.

(19) After sufficient washing with DMF and MC, the Kaiser test was again conducted, and then the following amino acid attachment test was conducted in the same manner as described above.

(20) A chain reaction was conducted in the order of Fmoc-Ile-OH, Fmoc-Lys(Boc)-OH, Fmoc-Arg(Pbf)-OH, Fmoc-Arg(Pbf)-OH, Fmoc-Trp-OH, and Fmoc-Arg(Pbf)-OH on the basis of the selected amino acid sequence. The Fmoc-protecting group was removed by reaction twice with the deprotection solution for 10 minutes for each and then favorable washing.

(21) Acetic anhydride, DIEA, and HoBt were added to conduct acetylation for 1 hour, and then the prepared peptidyl resin was washed with DMF, MC, and methanol three times for each, dried under the flow of nitrogen gas, and completely dried by decompression under vacuum in P.sub.2O.sub.5.

(22) Thereafter, 30 ml of a leaving solution [95% trifluoroacetic acid (TFA), 5% distilled water 2, and 5% thioanisole 2] was added, and the reaction was maintained for 2 hours while the mixture was intermittently stirred at room temperature.

(23) The resin was obtained through filtration, washed with a small amount of a TFA solution, and then mixed with the stock solution. The distillation was conducted under reduced pressure to reduce the total volume by half, and then 50 ml of cold ether was added to induce precipitation.

(24) Thereafter, the precipitates were collected by centrifugation, followed by washing twice with cold ether. The stock solution was removed, followed by sufficient drying under nitrogen atmosphere, thereby synthesizing 0.65 g of unpurified peptide 1, Arg-Trp-Arg-Arg-Lys-Ile-Glu-Asn (yield: 92.0%).

(25) The molecular weight was determined as 1157.3 (theoretical value: 1157.33) by using a molecular weight analysis system. In addition, the peptide composed of the amino acid sequence of SEQ ID NO: 2 was synthesized by the method as described above.

(26) TABLE-US-00001 TABLE1 Analysisvalue SEQ (Massspectrometer) ID Analytical Theoretical NO Sequence(5->3) value value 1 Arg-Trp-Arg-Arg-Lys- 1157.3 1157.33 Ile-Glu-Asn 2 Phe-Cys-Leu-Gly-Pro- 1398.7 1398.7 Cys-Pro-Tyr-Ile-Trp- Ser-Leu

Example 1: Melanogenesis Assay

(27) After melanocytes (B16F10 cell line) in 6-well plates were cultured in an incubator at 37 C. for 24 hours, the medium of each plate was removed and exchanged with fresh medium, followed by treatment with the present peptide at different concentrations. After the incubation for 72 hours, the culture medium was removed, and the cells were taken off and then transferred into 5-ml tubes, followed by centrifugation at 13,000 rpm for 3 minutes. The supernatant was removed, and cell pellets were collected to observe melanin. Then, 150 l of 2 M NaOH was added to the cell pellets to lyse intracellular melanin at 60 C. for 30 minutes. Then, 100 l of the supernatant obtained from the lysis was added into each well of 96-well plates, and the absorbance was measured at 490 nm. The results are shown in FIGS. 1a and 1b.

(28) As can be confirmed in FIGS. 1a and 1b, melanogenesis was increased when the mouse melanin cell line B16F10 was treated with the peptide composed of the amino acid sequence of SEQ ID NO: 1 or 2.

Example 2: Tyrosinase Activity Assay

(29) Melanoma cell line (B16F10) cells were cultured in 6-well culture plates for 24 hours, and treated with the peptide with difference concentrations, followed by culture for 72 hours. The 6-well culture plates were loaded on ice and washed with cool PBS, and then 300 l of 0.1 M sodium phosphate buffer (pH 6 lysis buffer) containing 1% Triton X-100 was added. The cells were collected in 1.5-mL tubes, and then cell membranes were disrupted by repeating five times rapid-freezing at 270 C. and thawing. After centrifugation at 13,000 rpm for 20 minutes, the supernatant was collected in other 1.5-mL tubes, and the protein of the samples was quantified. The samples were diluted to have the same protein concentration and then dispensed in every three wells in 96-well culture plates, and then 20 l of 10 mM L-dopa was added, followed by incubation at 37 C. for 1 hour. The absorbance was measured at 475 nm.

(30) As can be confirmed from FIGS. 2a and 2b, tyrosinase activity was increased when mouse melanin cell line B16F10 was treated with the peptide composed of the amino acid sequence of SEQ ID NO: 1 or 2

Example 3: RT-PCR of Melanogenesis-Related Genes

(31) Melanocytes (B16F10 cell line) were incubated on 6-well culture plates in an incubator for 24 hours, and were treated with the peptides of the present invention with different concentrations. After RNA was extracted from the cells incubated for 72 hours, cDNA was prepared. PCR was performed by using respective primers specific to MITF and tyrosinase, which are the factors involved in melanogenesis, and the expression changes of the respective genes were observed. The results are shown in FIGS. 3a and 3b.

(32) TABLE-US-00002 TABLE2 SEQ ID Primer NO name Sequence(5-3) 3 MITF_F CCAGCCTGGCGATCATGTCAT 4 MITF_R GGTCTGGACAGGAGTTGCTG 5 tyrosinase_F GGCCAGCTTTCAGGCAGAGG 6 tyrosinase_R TGGTGCTTCATGGGCAAAAT 7 TRP1_F TCTGTGAAGGTGTGCAGGAG 8 TRP1_R CCGAAACAGAGTGGAAGGTT

(33) As can be confirmed in FIGS. 3a and 3b, the mRNA expression of MITF, tyrosinase, and TRP1, which are transcriptional factors involved in melanogenesis, were increased when the mouse melanin cell line B16F10 was treated with the peptide composed of the amino acid sequences of SEQ ID NO: 1 or SEQ ID NO: 2.

Example 4: Western Blotting of Melanogenesis-Related Proteins

(34) Melanocytes (B16F10 cell line) were incubated on 6-well culture plates in an incubator for 24 hours, and were treated with the peptides of the present invention with different concentrations. After 72-hour incubation, the cells were lysed, and the cells were subjected to western blotting using specific antibodies (two types, both by Santa Cruz Biotechnology, USA) to investigate the expression of MITF and tyrosinase, which are the factors involved in melanogenesis. The results are shown in FIGS. 4a and 4b.

(35) As can be confirmed from FIG. 4a, the protein expression of the MITF transcriptional factor and tyrosinase enzyme, which are involved in melanogenesis, was increased when the mouse melanin cell line B16F10 was treated with the peptide composed of the amino acid sequences of SEQ ID NO: 1.

(36) As can also be confirmed from FIG. 4b, the protein expression of tyrosinase, which is involved in melanogenesis, was increased when the mouse melanin cell line B16F10 was treated with the peptide composed of the amino acid sequences of SEQ ID NO: 2.

Example 5: Melanogenesis-Related Protein Activity Assay

(37) Melanocytes (B16F10 cell line) were incubated on 6-well culture plates in an incubator for 24 hours, and were treated with the peptide of the present invention with different concentrations. After 72-hour incubation, the cells were lysed, and the cells were subjected to western blotting using specific antibodies (Cell Signaling Technology, USA) to investigate the phosphorylation level of CREB, which is a signaling substance involved in melanogenesis. The results are shown in FIG. 5.

(38) As can be confirmed from FIG. 5, the phosphorylation level of CREB, which is a factor involved in melanogenesis, was increased when the mouse melanin cell line B16F10 was treated with the peptide composed of the amino acid sequences of SEQ ID NO: 1.

INDUSTRIAL APPLICABILITY

(39) The present invention relates to a peptide showing melanogenesis stimulatory activity, a pharmaceutical composition containing the peptide as an active ingredient for preventing and/or treating hypomelanosis, a cosmetic composition containing the peptide as an active ingredient for preventing and/or alleviating hypomelanosis, and a use of the peptide for preventing, alleviating and/or treating hypomelanosis.