RAS PROTEIN DEGRADATION INDUCING MOLECULE AND PHARMACEUTICAL COMPOSITION
20200000927 ยท 2020-01-02
Assignee
Inventors
Cpc classification
A61P31/00
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
A61K47/555
HUMAN NECESSITIES
A61P1/16
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
Abstract
A Ras protein degradation inducing molecule that can induce degradation of Ras proteins, and a pharmaceutical composition that contains this Ras protein degradation inducing molecule are provided. The Ras protein degradation inducing molecule is a conjugate of a Ras protein affinity molecule which has affinity to Ras proteins, and a proteolysis-inducing tag which has affinity to protease and does not inhibit proteolysis of proteins by the protease.
Claims
1. A Ras protein-degradation inducing molecule being a conjugate of a Ras protein affinity molecule that has an affinity with a Ras protein, and a protein-degradation inducing tag that has an affinity with a protease and does not inhibit degradation of a protein by the protease; and being capable of inducing degradation of the Ras protein.
2. The Ras protein-degradation inducing molecule according to claim 1, wherein the Ras protein-degradation inducing molecule is capable of inducing degradation of the Ras protein in a ubiquitin-independent manner.
3. The Ras protein-degradation inducing molecule according to claim 1, wherein the protein-degradation inducing tag has a structure where a protease inhibitory activity of a protease inhibitor is inactivated.
4. The Ras protein-degradation inducing molecule according to claim 1, wherein the protease is a proteasome.
5. The Ras protein-degradation inducing molecule according to claim 4, wherein the protein-degradation inducing tag has a structure where a proteasome inhibitory activity of a proteasome inhibitor is inactivated.
6. The Ras protein-degradation inducing molecule according to claim 5, wherein the proteasome inhibitory activity is an inhibitory activity against at least one selected from a caspase-like activity, a trypsin-like activity, and a chymotrypsin-like activity.
7. A pharmaceutical composition comprising the Ras protein-degradation inducing molecule according to claim 1.
8. The pharmaceutical composition according to claim 7, wherein the pharmaceutical composition is used for preventing or treating a Ras protein-mediated disease or condition.
9. The pharmaceutical composition according to claim 8, wherein the Ras protein-mediated disease or condition is a cancer, an immune disease, an infection, a neurological disease, a RAS/MAPK syndrome, cirrhosis, chronic hepatitis, or a memory impairment.
10. The pharmaceutical composition according to claim 9, wherein the Ras protein-mediated disease or condition is a cancer.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
PREFERRED MODE FOR CARRYING OUT THE INVENTION
[0051] Below, the embodiments of the present invention will be described in detail. However, the present invention shall not be limited to the following embodiments.
[0052] A range of numerical values specified using - as used herein refers to a range including values indicated before and after - as the minimum value and the maximum value, respectively. Amino acids as used herein are denoted by the single letter notation (for example, G for glycine) or the three-letter notation (for example, Gly for glycine) as is well known in the art.
<Ras Protein-Degradation Inducing Molecule>
[0053] A Ras protein-degradation inducing molecule of the present disclosure is a conjugate of a Ras protein affinity molecule that has an affinity with a Ras protein and a protein-degradation inducing tag that has an affinity with a protease and does not inhibit degradation of a protein by the protease, and can induce degradation of the Ras protein. The Ras protein-degradation inducing molecule of the present disclosure can lead a Ras protein to degradation (knockdown) by a protease (for example, a proteasome), without ubiquitination of the Ras protein (in other words, in a ubiquitin-independent manner).
[0054] It is noted that a polyubiquitin chain such as a tetraubiquitin chain (Ub.sub.4) or a ubiquitin-like domain (UbL) is likely to function as a protein-degradation inducing tag. However, when a polyubiquitin chain or a ubiquitin-like domain is used as a protein-degradation inducing tag, the Ras protein is indirectly ubiquitinated via the Ras protein affinity molecule. In the present specification, such an indirect ubiquitination of the Ras protein is also included in the ubiquitination of the Ras protein.
(Ras Protein Affinity Molecule)
[0055] The Ras protein affinity molecule constituting the Ras protein-degradation inducing molecule of the present disclosure is a molecule having an affinity with the Ras protein.
[0056] The Ras protein has isoforms such as a K-Ras protein, an H-Ras protein, and an N-Ras protein, and may be any isoform. Furthermore, the Ras protein may be a wild-type or a mutant. Examples of the mutant K-Ras protein and N-Ras protein include a G12D mutant (a mutant in which glycine (G) that is an amino acid residue at the 12th position from the N-terminal is changed to aspartic acid (D); the same is true hereinafter), a G12V mutant, a G12S mutant, a G12C mutant, a G13D mutant, a G13V mutant, a G13S mutant, a G13C mutant, an A59T mutant, an A59G mutant, a Q61K mutant, a Q61E mutant, a Q61H mutant, a K117N mutant, an A146T mutant, an A146P mutant, an A146V mutant, and the like. Examples of the mutant H-Ras protein include a T35S mutant, and the like.
[0057] The Ras protein regulates cell proliferation and the like by transition between the active form bound to GTP and the inactive form bound to GDP. On the other hand, it is known that in human cancers, the Ras protein is mutated at high frequency, and due to this mutation, the Ras protein is permanently the active form. Thus, the examples of the preferable Ras protein affinity molecule include one having an affinity with a mutant Ras protein that has been mutated to the active form. When the Ras protein affinity molecule has an affinity with the mutant Ras protein that has been mutated to the active form, this mutant Ras protein can be led to degradation (knockdown) by a protease (for example, a proteasome).
[0058] As used herein, the phrase having an affinity with the Ras protein means, for example, the capability of binding to the Ras protein via a covalent bond, a hydrogen bond, a hydrophobic bond, Van der Waals force, and the like. When the interaction between the other molecules that have been known to interact with the Ras protein (proteins, peptides, antibodies, DNA, RNA, metabolites, low molecular weight compounds, and the like) and the Ras protein is influenced by a certain molecule in a concentration dependent manner, it can be determined that the molecule has an affinity with the Ras protein.
[0059] Examples of the Ras protein affinity molecule include low molecular weight compounds, natural products, peptides, antibodies, and the like. It is noted that in the present disclosure, the antibody includes a fragment including a variable site of the antibody, for example, a Fab fragment or a F(ab) fragment of Ig (immunoglobulin), in addition to anIg having two H-chains and two L-chains. Preferably, the Ras protein affinity molecule has a molecular weight within the range of, for example, 50 to 5000 for low molecular weight compounds.
[0060] A structure of the Ras protein affinity molecule is not particularly limited as long as it has an affinity with the Ras protein. As the Ras protein affinity molecule, for example, a Ras inhibitor having an affinity with the Ras protein can be used. Furthermore, the Ras protein affinity molecule can also be obtained by screening from candidate molecules.
[0061] Examples of the Ras protein affinity molecules are shown in the following Tables 1 to 8. However, Ras protein affinity molecules that can be used for the Ras protein-degradation inducing molecule of the present disclosure are not particularly limited thereto. Existing data bases (Binding DB (https://www.bindingdb.org/bind/index.jsp), PCI DB (http://www.tanpaku.org/pci/pci_home.html), ProtChemSI (http://pcidb.russelllab.org/) and the like) can be consulted for information about Ras protein affinity molecules if needed.
TABLE-US-00001 TABLE 1 Molecular No. Name Structural formula weight Target Published paper 1 SCH-53239
TABLE-US-00002 TABLE 2 Molecular No. Name Structural formula weight Target Published paper 7 Compound 2
TABLE-US-00003 TABLE 3 Molecular No. Name Structural formula weight Target Published paper 14 Compound 3
TABLE-US-00004 TABLE 4 Molecular No. Name Structural formula weight Target Published paper 22 Compound 12
TABLE-US-00005 TABLE 5 Molecular No. Name Structural formula weight Target Published paper 29 SJR10
TABLE-US-00006 TABLE 6 Molecular No. Name Structural formula weight Target Published paper 36 AA11
TABLE-US-00007 TABLE 7 Molecular No. Name Structural formula weight Target Data base 45 BDBM 43263
TABLE-US-00008 TABLE 8 Molecular No. Name Structural formula weight Target Data base 51 BDBM 43221
(Protein-Degradation Inducing Tag)
[0062] The protein-degradation inducing tag constituting the Ras protein-degradation inducing molecule according to the present disclosure is a molecule having an affinity with a protease and that does not inhibit degradation of a protein by the protease. Below, the above protein-degradation inducing tag may also be referred to as a CiKD (Chemical interaction and KnockDown) tag or a CANDDY (Chemical AffiNities and Degradation Dynamics) tag.
[0063] There is no particular limitation for the protease, and any molecule having a protease activity can be used. For example, it may be a protease complex such as a proteasome, or may be a protease other than the proteasome. Alternatively, it may be a portion of a proteasome as long as the portion has a protease activity.
[0064] Examples of the proteasome include 26S proteasome, an immunoproteasome, and a thymus proteasome.
[0065] 26S proteasome is composed of 20S proteasome and two units of 19S proteasome, the two units of 19S proteasome being attached to the 20S proteasome. 20S proteasome has a cylindrical structure in which an -ring consisting of 7 subunits of 1 to 7 and a -ring consisting of 7 subunits of 1 to 7 are stacked in order of , and 1, 2, and 5 show catalytic activities of a caspase-like activity, a trypsin-like activity, and a chymotrypsin-like activity, respectively.
[0066] In the immunoproteasome, the catalytic subunits 1, 2, and 5 are replaced with 1i, 2i, and 5i, respectively (Science, 1994, 265, 1234-1237).
[0067] In the thymus proteasome, 5t which is expressed specifically in cortical thymic epithelial cells (cTEC) is incorporated along with 1i and 2i (Science, 2007, 316, 1349-1353).
[0068] Examples of a protease other than the proteasome include -secretase, -secretase, aminopeptidase, angiotensin-converting enzyme, bromelain, calpine I, calpine II, carboxypeptidase A, carboxypeptidase B, carboxypeptidase P, carboxypeptidase Y, caspase 1, caspase 2, caspase 3, caspase 5, caspase 6, caspase 7, caspase 8, caspase 9, caspase 13, cathepsin B, cathepsin C, cathepsin D, cathepsin G, cathepsin L, chymotrypsin, clostripain, collagenase, complement C1r, complement C1s, complement factor B, complement factor D, dipeptidyl peptidase I, dipeptidyl peptidase II, dipeptidyl peptidase IV, dispase, elastase, endoproteinase Arg-C, endoproteinase Glu-C, endoproteinase Lys-C, ficin, granzyme B, kallikrein, leucine aminopeptidase, matrix metalloprotease, metalloprotease, papain, pepsin, plasmin, procaspase 3, pronase E, proteinase K, renin, thermolysin, thrombin, trypsin, cytosol alanyl aminopeptidase, enkephalinase, neprilysin, and the like.
[0069] As used herein, the phrase having an affinity with a protease means the capability of binding to a protease, for example, via a covalent bond, a hydrogen bond, a hydrophobic bond, Van der Waals force, and the like. When the thermal stability of a protease changes in the presence of a certain molecule, the molecule can be determined as having an affinity with that protease.
[0070] As used herein, the phrase without inhibiting degradation of a protein by a protease means that, for example, the protein-degradation inducing tag does not bind to the degradation active site of the protease via a covalent bonding. When a protein is degraded by a protease in the presence of a certain molecule, and the degradation of the protein is inhibited in the presence of a protease inhibitor, the molecule can be considered not to inhibit the degradation of the protein by the protease.
[0071] Examples of the protein-degradation inducing tag include low molecular weight compounds, natural products, peptides, antibodies, and the like. The protein-degradation inducing tag preferably has a molecular weight within the range of, for example, 50 to 200000. When the protein-degradation inducing tag is a low molecular weight compound, the molecular weight of the protein-degradation inducing tag is preferably within the range of, for example, 50 to 5000.
[0072] There is no particular limitation for the structure of the protein-degradation inducing tag as long as the protein-degradation inducing tag has an affinity with a protease without inhibiting degradation of a protein by the protease. The protein-degradation inducing tag can be obtained by, for example, screening from the candidate molecules. Furthermore, the protein-degradation inducing tag can be produced by inactivating the protease inhibitory activity (for example, proteasome inhibitoryactivity) of a protease inhibitor (for example, a proteasome inhibitor).
[0073] In a certain embodiment, for example, the protein-degradation inducing tag may have a structure represented by the following formula (I). It is demonstrated that the compound represented by the following formula (I) has an affinity with a protease, and does not inhibit the degradation of protein by the protease (see, for example, the below-mentioned Reference Examples 1 to 4).
##STR00056##
[0074] In the formula (I), R.sup.1 and R.sup.2 each independently represent a hydrocarbon group having 1 to 20 carbon atoms, an alkoxy group having 1 to 20 carbon atoms, an aryloxy group having 6 to 20 carbon atoms, a hydroxy group, a carboxy group, an amino group, or a halogeno group.
[0075] Examples of the hydrocarbon group include an alkyl group, an alkenyl group, an aryl group, combinations thereof, and the like. Specific examples include an alkyl group having 1 to 20 carbon atoms such as a methyl group and an ethyl group; an alkenyl group having 2 to 20 carbon atoms such as a vinyl group and an allyl group; an aryl group having 6 to 20 carbon atoms such as a phenyl group and a naphthyl group; an arylalkyl group having 7 to 20 carbon atoms such as a benzyl group and a phenethyl group; an alkylaryl group having 7 to 20 carbon atoms such as a tolyl group and a xylyl group; and the like. Examples of the halogeno group include a fluoro group, a chloro group, a bromo group, and the like.
[0076] In another embodiment, the protein-degradation inducing tag may have a structure in which the proteasome inhibitory activity of a proteasome inhibitor is inactivated. More specifically, at least one inhibitory activity selected from a caspase-like activity, a trypsin-like activity, and a chymotrypsin-like activity can be mentioned as the proteasome inhibitory activity.
[0077] The term structure in which a proteasome inhibitory activity is inactivated as used herein encompasses a structure in which a proteasome inhibitory activity is attenuated in addition to a structure in which a proteasome inhibitory activity is completely eliminated. In a certain embodiment, the protein-degradation inducing tag has a 50% inhibition concentration (IC.sub.50) against at least one selected from a caspase-like activity, a trypsin-like activity, and a chymotrypsin-like activity which is 2 times or more of the 50% inhibition concentration (IC.sub.50) of the original proteasome inhibitor.
[0078] As the proteasome inhibitor, any compound having a proteasome inhibitory activity can be used. A proteasome inhibitor is a compound which has an affinity with a proteasome (a protease complex), and inhibits degradation of a protein by a proteasome. Therefore, a protein-degradation inducing tag may be obtained by replacing the active site of a proteasome inhibitor with another structural moiety to inactivate the proteasome inhibitory activity. Proteasome inhibitors are being studied as anticancer agents, and there are many compounds that have been approved as pharmaceutical products, or are under clinical trials. Moreover, many of proteasome inhibitors have relatively small molecular weights and low hydrophobicity, and are less problematic in terms of cell membrane permeability, cytotoxicity, and the like. For these reasons, synthesizing a protein-degradation inducing tag based on a proteasome inhibitor is quite reasonable and efficient.
[0079] Examples of the proteasome inhibitor are shown in the following Tables 9 and 10. The proteasome inhibitors shown in Tables 9 and 10 are each a 20S proteasome inhibitor having an affinity with the active center part of 20S proteasome. Furthermore, the proteasome inhibitors shown in Tables 9 and 10 naturally have affinity with 26S proteasome. However, a proteasome inhibitor which can be used for producing a protein-degradation inducing tag shall not be limited to these examples.
TABLE-US-00009 TABLE 9 Generic name/ Structural formula Molecular No. Product name (Circles indicate active sites) weight 1 Bortezomib
TABLE-US-00010 TABLE 10 Generic name/ Structural formula Molecular No. Product name (Circles indicate active sites) weight 8 Carfilzomib
[0080] For example, bortezomib as a boronic acid-based proteasome inhibitor is known to inhibit a proteasome activity when the boronyl group as an active site covalently binds to the degradation active site of 20S proteasome as shown in the following scheme (Kisselev, A. F. et al., Chemistry & Biology, 2012, 19, 99-115).
##STR00071##
[0081] Further, MLN9708 and MLN2238, which are boronic acid-based proteasome inhibitors, are known to inhibit a proteasome activity when the boronic acid ester moiety or the boronyl group as an active site covalently binds to the degradation active site of 20S proteasome as shown in the following scheme (Kisselev, A. F. et al., Chemistry & Biology, 2012, 19, 99-115).
##STR00072##
[0082] Therefore, a protein-degradation inducing tag may be obtained by replacing the boronyl group or the boronic acid ester moiety as the active sites of bortezomib, MLN9708, and MLN2238 with another structural moiety (a carboxy group, an alkyl group, an aryl group, an amino group, a hydroxy group, and the like) to inactivate the proteasome inhibitory activity.
[0083] It is noted that even for other boronic acid-based proteasome inhibitors such as CEP-18770, a protein-degradation inducing tag can be obtained by replacing the active site with another structural moiety (a carboxy group, an alkyl group, an aryl group, an amino group, a hydroxy group, and the like).
[0084] Further, ALLN, which is an aldehyde-based proteasome inhibitor, is known to inhibit a proteasome activity when the formyl group as an active site covalently binds to the degradation activity site of 20S proteasome as shown in the following scheme (Kisselev, A. F. et al., Chemistry & Biology, 2012, 19, 99-115).
##STR00073##
[0085] Therefore, a protein-degradation inducing tag can be obtained by replacing the formyl group as the active site of ALLN with another structural moiety (a carboxy group, an alkyl group, an aryl group, an amino group, a hydroxy group, and the like) to inactivate the proteasome inhibitory activity.
[0086] It is noted that even for other aldehyde-based proteasome inhibitors such as MG-132, BSc-2118, and PSI, a protein-degradation inducing tag can be obtained by replacing the formyl group as an active site with another structural moiety (a carboxy group, an alkyl group, an aryl group, an amino group, a hydroxy group, and the like).
[0087] Examples of the protein-degradation inducing tag having a structure in which the proteasome inhibitory activity of a proteasome inhibitor is inactivated are shown in the following Tables 11 and 12. Examples of the monovalent group represented by R in the tables include a carboxy group, an alkyl group having 1 to 20 carbon atoms, an aryl group having 6 to 20 atoms, an amino group, a hydroxy group, and the like.
TABLE-US-00011 TABLE 11 No. Structural formula 1
TABLE-US-00012 TABLE 12 No. Structural formula 8
[0088] Other examples of the proteasome inhibitor are shown in the following Tables 13 to 18. Even for these proteasome inhibitors, a protein-degradation inducing tag can be obtained by inactivating the proteasome inhibitory activity in a similar way as described above.
TABLE-US-00013 TABLE 13 20S proteasome inhibitor Generic name/ Molecular No. Product name Structural formula weight 15 Aspirin
TABLE-US-00014 TABLE 14 20S proteasome inhibitor Generic name/ Molecular No. Product name Structural formula weight 20 CVT-659
TABLE-US-00015 TABLE 15 20S proteasome inhibitor Generic name/ Molecular No. Product name Structural formula weight 24 Ritonavir
TABLE-US-00016 TABLE 16 19S proteasome inhibitor Generic name/ Molecular No. Product name Structural formula weight 1 RIP-4 (Rpt4) inhibitor)
TABLE-US-00017 TABLE 17 Inhibitor for a constituent factor other than 20S/19S Generic name/ Molecular No. Product name Structural formula weight Others 1 JBIR-22
TABLE-US-00018 TABLE 18 20S immunoproteasome inhibitor Generic name/ Molecular No. Product name Structural formula weight Others 1 PR-957
[0089] In another embodiment, the protein-degradation inducing tag may have a structure in which the protease inhibitory activity of a protease inhibitor (except for the proteasome inhibitors described above) is inactivated.
[0090] The term structure in which a protease inhibitory activity is inactivated as used herein encompasses a structure in which the protease inhibitory activity is attenuated in addition to a structure in which the protease inhibitory activity is completely eliminated. In a certain embodiment, the protein-degradation inducing tag has a 50% inhibition concentration (IC.sub.50) against a protease as an inhibition target of a protease inhibitor which is 2 times or more of the 50% inhibition concentration (IC.sub.50) of the original protease inhibitor.
[0091] As a protease inhibitor, any compound having a protease inhibitory activity can be used. The protease inhibitor is a compound having an affinity with a protease and inhibiting degradation of a protein by the protease. Therefore, a protein-degradation inducing tag can be obtained by replacing the active site of a protease inhibitor with another structural moiety to inactivate the protease inhibitory activity.
[0092] Examples of the protease inhibitor are shown in the following Tables 19 to 86. Protein degradation inducing tags can be obtained by replacing the active sites of these protease inhibitors with other structural moieties to inactivate the protease inhibitory activities. However, a protease inhibitor which can be used for producing protein-degradation inducing tags shall not be limited to these examples. Existing data bases (MEROPSthe peptidase database (http://merops.sanger.ac.uk/index.shtml) and the like) can be consulted for information about proteases and protease inhibitors if needed.
TABLE-US-00019 TABLE 19 -secretase inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 OM99-2
TABLE-US-00020 TABLE 20 -secretase inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 - Secretase inhibitor
TABLE-US-00021 TABLE 21 Aminopeptidase inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Cysteamine
TABLE-US-00022 TABLE 22 Angiotensin converting enzyme inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Captopril
TABLE-US-00023 TABLE 23 Bromelain inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 E-64
TABLE-US-00024 TABLE 24 Calpain inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 E-64c
TABLE-US-00025 TABLE 25 Calpain I inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Calpain Inhibitor I (ALLN, Ac- LLnL-CHO, MG-101)
TABLE-US-00026 TABLE 26 Calpain II inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 E-64c
TABLE-US-00027 TABLE 27 Carboxypeptidase A/B inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Ethylene glycol- bis(2- aminoethyl ether)- N,N,N,N- tetraacetic acid
TABLE-US-00028 TABLE 28 Carboxypeptidase P inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Diisopropyl- fluorophos- phate
TABLE-US-00029 TABLE 29 Carboxypeptidase Y inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Diisopropyl- fluorophos- phate
TABLE-US-00030 TABLE 30 Cathepsin B inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 CA-074
TABLE-US-00031 TABLE 31 Cathepsin B inhibitor (Continued) Molecular Protease to be No. Name Structural formula weight inhibited 6 Calpain Inhibitor I (ALLN, Ac- LLnL-CHO, MG-101)
TABLE-US-00032 TABLE 32 Cathepsin C inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Sodium iodoacetate
TABLE-US-00033 TABLE 33 Cathepsin D inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Antipain dihydro- choride from microbial source
TABLE-US-00034 TABLE 34 Cathepsin L inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Z-Phe-Phe- fluorometh- yl ketone (Z-FF-FMK)
TABLE-US-00035 TABLE 35 Chymotrypsin inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Diisopropyl- fluorophos- phate
TABLE-US-00036 TABLE 36 Chymotrypsin inhibitor (Continued) Molecular Protease to be No. Name Structural formula weight inhibited 1 N-p-Tosyl- L- phenylala- nine chloro- methyl ketone
TABLE-US-00037 TABLE 37 Clostripain inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 4- Chloromercuri- benzoic acid
TABLE-US-00038 TABLE 38 Collagenase inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 EDTA disodium salt
TABLE-US-00039 TABLE 39 Complement Clr/Cls inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Diisopropyl- fluoro- phosphate
TABLE-US-00040 TABLE 40 Complement factor D/B inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Diisopropyl- fluoro- phosphate
TABLE-US-00041 TABLE 41 Dipeptidyl peptidase II inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Puromycin
TABLE-US-00042 TABLE 42 Dipeptidyl peptidase III inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Opiorphin
TABLE-US-00043 TABLE 43 Dipeptidyl peptidase IV inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Ile-Pro- Ile
TABLE-US-00044 TABLE 44 Dispase inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 EDTA disodium salt
TABLE-US-00045 TABLE 45 Elastase (granulocyte) inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 N- (Methoxy- succinyl)- Ala-Ala- Pro-Val- chloromethyl ketone
TABLE-US-00046 TABLE 46 Elastase (leukocyte) inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Diisopropyl- fluoro- phosphate
TABLE-US-00047 TABLE 47 Elastase (pancreas) inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Diisorpropyl- fluoro- phosphate
TABLE-US-00048 TABLE 48 Endoproteinase Arg-C inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Diisopropyl- fluorophosphate
TABLE-US-00049 TABLE 49 Endoproteinase Glu-C inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Diisopropyl- fluoro- phosphate
TABLE-US-00050 TABLE 50 Endoproteinase Lys-C inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Diisopropyl- fluoro- phosphate
TABLE-US-00051 TABLE 51 Ficin inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 E-64
TABLE-US-00052 TABLE 52 Granzyme B inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Antipain dihydro- chloride from microbial source
TABLE-US-00053 TABLE 53 Kallikrein (tissue) inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Diisopropyl- fluoro- phosphate
TABLE-US-00054 TABLE 54 Kallikrein (plasma) inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Gabexate mesylate
TABLE-US-00055 TABLE 55 Leucine aminopeptidase inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Actinonin
TABLE-US-00056 TABLE 56 Leucine aminopeptidase (cytosol) inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Actinonin
TABLE-US-00057 TABLE 57 Leucine aminopeptidase (cytosol) inhibitor (Continued) Molecular Protease to be No. Name Structural formula weight inhibited 5 Diethylene triamine- pentaacetic acid
TABLE-US-00058 TABLE 58 Leucine aminopeptidase (microsome) inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Actinonin
TABLE-US-00059 TABLE 59 Matrix aminopeptidase inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 GM6001
TABLE-US-00060 TABLE 60 Metalloprotease inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Epiama- statin hydro- chloride
TABLE-US-00061 TABLE 61 Papain inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 E-64
TABLE-US-00062 TABLE 62 Papain inhibitor (Continued) Molecular Protease to be No. Name Structural formula weight inhibited 5 Chymostatin
TABLE-US-00063 TABLE 63 Pepsin inhibitor Molec- Protease ular to be No. Name Structural formula weight inhibited 1 Pep- statin A
TABLE-US-00064 TABLE 64 Plasmin inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Diisopropyl- fluoro- phosphate
TABLE-US-00065 TABLE 65 Plasmin inhibitor (Continued) Molecular Protease to be No. Name Structural formula weight inhibited 6 3,4- Dichloro- isocoumarin
TABLE-US-00066 TABLE 66 Thrombin inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Diisopropyl- fluorophos- phate
TABLE-US-00067 TABLE 67 Thrombin inhibitor (Continued) Molecular Protease to be No. Name Structural formula weight inhibited 5 3,4- Dichloroiso- coumarin
TABLE-US-00068 TABLE 68 Thermolysin inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Ethylene glycol- bis (2- aminoethyl ether)- N,N,N,N- tetraacetic acid
TABLE-US-00069 TABLE 69 Trypsin inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 4-(2- Aminoethyl) benzene- sulfonyl fluoride hydro- chloride
TABLE-US-00070 TABLE 70 Pronase E inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 EDTA disodium salt
TABLE-US-00071 TABLE 71 Procaspase 3 inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 N-Acetyl- Glu-Ser- Met-Asp-al (Ac-ESMD- CHO)
TABLE-US-00072 TABLE 72 Proteinase K inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Phenylmeth- anesulfonyl fluoride
TABLE-US-00073 TABLE 73 Renin inhibitor Molec- Protease ular to be No. Name Structural formula weight inhibited 1 Pep- statin A
TABLE-US-00074 TABLE 74 Caspase inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 BOC- Asp(OMe)- fluorometh- yl ketone (Boc-D- FMK)
TABLE-US-00075 TABLE 75 Caspase 1 inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 N-Acetyl- Trp-Glu- His-Asp-al (AC-WEHD- CHO)
TABLE-US-00076 TABLE 76 Caspase 2 inhibitor Protease Molecular to be No. Name Structural formula weight inhibited 1 N-Acetyl- Val-Asp- Val-Ala- Asp-CHO (Ac-VDVAD- CHO)
TABLE-US-00077 TABLE 77 Caspase 3 inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 N-Acetyl- Glu-Ser- Met-Asp-al (Ac-ESMD- CHO)
TABLE-US-00078 TABLE 78 Caspase 5 inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 N-Acetyl- Trp-Glu- His-Asp-al (Ac-WEHD- CHO)
TABLE-US-00079 TABLE 79 Caspase 6 inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 N-Acetyl- Val Glu- Ile-Asp-al
TABLE-US-00080 TABLE 80 Caspase 7 inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Z-Asp (OMe)- Glu(OMe)- Val- Asp(OMe) fluoromethyl ketone (Z- DEVD-FMK)
TABLE-US-00081 TABLE 81 Caspase 8 inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Z-Ile- Glu(OMe)- Thr-Asp (OMe) fluoro- methyl ketone (Z- IETD-FMK)
TABLE-US-00082 TABLE 82 Caspase 9 inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Z-Leu- Glu(OMe)- His-Asp (OMe) fluoromethyl ketone (Z- LE(OMe)HD (OMe)-FMK, Z-LEHD- FMK)
TABLE-US-00083 TABLE 83 Caspase 13 inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Z-Leu- Glu(OMe)- Glu(OMe)- Asp(OMe)- fluoromethyl ketone (Z-LEED- FMK)
TABLE-US-00084 TABLE 84 Cytosol alanyl aminopeptidase inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Puromycin
TABLE-US-00085 TABLE 85 Enkephalinase inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Opiorphin
TABLE-US-00086 TABLE 86 Neprilysin inhibitor Molecular Protease to be No. Name Structural formula weight inhibited 1 Opiorphin
[0093] It is noted that in the above descriptions, proteasome inhibitors and protease inhibitors other than the proteasome inhibitors are separately discussed for convenience, but a compound is also known which can inhibit the activities of both a proteasome and a protease other than proteasomes. Therefore, a protein-degradation inducing tag having an affinity with both a proteasome and a protease other than proteasomes can be obtained when such a compound is used.
[0094] Examples of the compound which can inhibit the activities of both a proteasome and a protease other than proteasomes are shown in the following table 87. However, the compound which can inhibit the activities of both a proteasome and a protease other than proteasomes shall not be limited to these examples.
TABLE-US-00087 TABLE 87 Molecular Protease to be No. Name Structural formula weight inhibited 1 Calpain Inhibitor I (ALLN, Ac- LLnL-CHO, MG-101)
[0095] In another embodiment, a proteasome activator can be used as a protein-degradation inducing tag. A proteasome activator is a compound having an affinity with a proteasome (a protease complex) without inhibiting degradation of a protein by the proteasome, and can be used as a protein-degradation inducing tag.
[0096] Examples of the proteasome activator are shown in the following Tables 88 to 90. However, the proteasome activator which can be used for producing a protein-degradation inducing tag shall not be limited to these examples.
TABLE-US-00088 TABLE 88 20S proteasome activator Generic name/ Molecular No. Product name Structural formula weight 1 Oleuropein
TABLE-US-00089 TABLE 89 19S/11S (PA28) proteasome activator Generic name/ Molecular No. Product name Structural formula weight 1 IU1 (Usp 14 inhibitor)
TABLE-US-00090 TABLE 90 19S/11S (PA28) proteasome activator (Continued) Generic name/ Molecular No. Product name Structural formula weight 7 SNX-5422
[0097] Among the protein-degradation inducing tags as mentioned above, in particular, the protein-degradation inducing tag having an affinity with a 26S proteasome is preferable. The intracellular proteasome is generally present in a state of the 26S proteasome in which two 19S proteasomes are bonded to a 20S proteasome. Therefore, use of the protein-degradation inducing tag having an affinity with the 26S proteasome can lead the intracellular Ras protein to degradation more efficiently.
(Form of Conjugate of Ras Protein Affinity Molecule and Protein-Degradation Inducing Tag)
[0098] There is no particular limitation for the form of a conjugate of the Ras protein affinity molecule and the protein-degradation inducing tag as long as the affinity of the Ras protein affinity molecule with the Ras protein, and the affinity of the protein-degradation inducing tag with the protease are maintained. It is noted that when both the Ras protein affinity molecule and the protein-degradation inducing tag are proteins, the both proteins can be fused to each other to synthesize a fusion protein, but such fusion proteins are not included in the conjugate.
[0099] The Ras protein-degradation inducing molecule may have, for example, a structure in which at least one Ras protein affinity molecule is linked to at least one protein-degradation inducing tag. The Ras protein-degradation inducing molecule may have a structure in which one Ras protein affinity molecule is linked to one protein-degradation inducing tag, or may have a structure in which one Ras protein affinity molecule is linked to a plurality of protein-degradation inducing tags, or may have a structure in which a plurality of Ras protein affinity molecules are linked to one protein-degradation inducing tag, or may have a structure in which a plurality of Ras protein affinity molecules are linked to a plurality of protein-degradation inducing tags. In a certain embodiment, the Ras protein-degradation inducing molecule has a structure in which one Ras protein affinity molecule is linked to one protein-degradation inducing tag.
[0100] A position in the Ras protein affinity molecule at which the protein-degradation inducing tag is linked to the Ras protein affinity molecule is not particularly limited as long as the affinity with the Ras protein is maintained. Meanwhile, a position in the protein-degradation inducing tag at which the Ras protein affinity molecule is linked to the protein-degradation inducing tag is not particularly limited as long as the affinity with the protease is maintained. For example, when the protein-degradation inducing tag has, as described above, a structure in which the active site of a protease inhibitor (for example, a proteasome inhibitor) is replaced with another structural moiety, the protein-degradation inducing tag can be linked to the Ras protein affinity molecule at this replaced another structural moiety. Specifically, when the active site of the protease inhibitor is replaced with a carboxy group, the protein-degradation inducing tag can be linked to the Ras protein affinity molecule via a carboxy group.
[0101] It is noted that the Ras protein affinity molecule and the protein-degradation inducing tag may have a structure in which they can be linked to each other. When it is difficult to directly link the Ras protein affinity molecule to the protein-degradation inducing tag, it is considered that a structure capable of linking them to each other is introduced into at least one of the Ras protein affinity molecule and the protein-degradation inducing tag. For example, as the Ras protein affinity molecule, a well-known molecule having an affinity with the Ras protein can be used, but it is assumed to be difficult to directly link this well-known molecule to the protein-degradation inducing tag. In such a case, a structure which can be linked to the protein-degradation inducing tag may be introduced into the well-known molecule, and used as the Ras protein affinity molecule.
<Pharmaceutical Composition>
[0102] The pharmaceutical composition of the present disclosure includes the Ras protein-degradation inducing molecule of the present disclosure. As described above, the Ras protein-degradation inducing molecule of the present disclosure can lead a Ras protein to degradation (knockdown) by a protease (for example, a proteasome), without ubiquitination of the Ras protein (in other words, in a ubiquitin-independent manner). Therefore, the pharmaceutical composition including Ras protein-degradation inducing molecule according to the present disclosure can be used for preventing or treating Ras protein-mediated diseases or conditions. The present disclosure can also provide a method for preventing or treating Ras protein-mediated diseases or conditions. The method includes administering the pharmaceutical composition including the Ras protein-degradation inducing molecule.
[0103] The Ras protein-mediated diseases or conditions are not particularly limited as long as the preventive effect or therapeutic effect can be expected by the Ras protein degradation. Examples of the Ras protein-mediated diseases or conditions are shown in Table 91. However, the Ras protein-mediated diseases or conditions shall not be limited to these examples.
TABLE-US-00091 TABLE 91 Disease or condition References Cancer Pancreatic cancer British Journal of Cancer vol.111, pp.817-822 (2014) Colorectal cancer The New England Journal of Medicine vol. 359, pp.1757-1765 (2008) Lung cancer Annals of the American Thoracic Society vol.6, pp.201-205 (2009) Gastric cancer Oncogene vol.22, pp.6942-6945 (2003) Breast cancer Breast cancer Research and Treatment vol.62, pp.51-62 (2000) Kidney cancer Cancer Research vol.48, pp.5251-5255 (1988) Juvenile Blood vol.125, pp.2753-2758 (2015) myelomonocytic leukemia (JMML) Thyroid tumor Official Journal of the Japan Association of Endocrine Surgeons and the Japanese Society of Thyroid Surgery vol.31, pp.125-129 (2014) Melanoma Cancer Research vol.66, pp.9483-9491 (2006) Trends in Molecular Medicine vol.43, pp.38-45 (2011) Biliary tract cancer Journal of Clinical Oncology vol.28, pp.3531-3540 (2010) Head and neck cancer Journal of the National Cancer Institute vol.106, dju215 (2014) Esophageal cancer Annals of Surgical Oncology vol.20, pp.S485-S491 (2013) Liver cancer Journal of Hepatology vol.51, pp.725-733 (2010) Ovarian cancer BMC Cancer vol.9 (111) (2009) Uterine cancer Gynecologic Oncology vol.63, pp.238-246 (1996) Prostate cancer Journal of Cellular Biochemistry vol.91, pp.13-25 (2004) Bladder cancer PloS ONE vol.5, e13821 (2010) Immune Autoimmune disease Journal of Clinical Immunology vol.35, pp.454-458 (2015) disease Rheumatoid arthritis The Open Rheumatoid Journal vol.6, pp.259-272 (2012) RAS-related autoimmune PNAS vol.104, pp.8953-8958 (2007) lymphoproliferative Blood vol.117, pp.2887-2890 (2011) disorders Infection Influenza Cancer Research vol.61, pp.8188-8193 (2001) PloS ONE vol.6, e16324 (2011) Seikagaku: The Journal of the Japanese Biochemical Society vol.87, Issue 1 EBV infection Oncogene vol.23, pp.8619-8628 (2004) HIV infection Journal of Biological Chemstry vol.275, pp.16513-16517 (2000) Neurologic Alzheimer's disease Biochimica et Biophysica Acta vol.1802, pp.396-405 (2010) disease Neurobiology of Disease vol.43, pp.38-45 (2011) Parkinson's disease Biochimica et Biophysica Acta vol.1802, pp.396-405 (2010) ALS Biochimica et Biophysica Acta vol.1802, pp.396-405 (2010) RAS/MAPK Noonan syndrome Human Molecular Genetics vol.15, pp.R220-R226 (2006) syndrome Costello syndrome Genetics in Medicine vol.14, pp.285-292 (2012) CFC syndrome Human Mutation vol.29, pp.992-1006 (2008) Other Cirrhosis/chronic Gastroenterologia Japonica vol.24, pp.270-276 (1989) diseases or hepatitis conditions Memory impairment Nature Communications vol.7, 12926 (2016)
[0104] In a certain embodiment, the pharmaceutical composition of the present disclosure is used for preventing or treating a cancer. Conventionally, EGFR (epidermal growth factor receptor) inhibitors such as erlotinib and cetuximab are used as anticancer agents. However, it is known that when the Ras protein is a mutant, the response rate is low. Since the pharmaceutical composition of the present disclosure can lead the Ras protein to degradation even when the Ras protein is a mutant, the pharmaceutical composition can be used for treating a cancer that exhibits resistance to the EGFR inhibitor.
[0105] The pharmaceutical composition may include a component other than the Ras protein-degradation inducing molecule. For example, the pharmaceutical composition may include an organic or inorganic carrier which is conventionally used as a formulation material. The above carrier is formulated as an excipient, a lubricant, a binder, a disintegrating agent, and the like, in a solid preparation, and as a solvent, a solubilizing agent, a suspending agent, an isotonizing agent, a buffer agent, and the like, in a liquid preparation. Further, the pharmaceutical composition may include a formulation additive such as an antiseptic agent, an anti-oxidative agent, a coloring agent, a sweetening agent, and the like.
[0106] There is no particular limitation for the dosage form of the pharmaceutical composition. Examples of the dosage form of the pharmaceutical composition include oral preparations such as tablet, capsule, granule, powder, trochiscus, syrup, emulsion, suspension, and film preparations; parenteral preparations such injectable preparations, infusion preparations, external preparations, suppository, pellets, transnasal preparations, pulmonary preparations (inhalation), and eye drops; and the like.
[0107] The dose of the pharmaceutical composition is appropriately determined depending on the subject, route of administration, target disease, symptoms, and the like.
EXAMPLES
[0108] Below, the present invention will be described specifically with reference to Examples, but the present invention shall not be limited to these Examples. In the following Examples and Reference Examples, room temperature indicates temperatures in a range of 20 C. to 30 C.
[0109] Abbreviations of compounds used in the following Examples and Reference Examples are as follows. [0110] H-Gly-OtBu.HCl: L-Glycine t-butyl ester hydrochloride [0111] DMF: N,N-Dimethylformamide [0112] DIPEA: N,N-Diisopropylethylamine [0113] PyBOP: 1H-Benzotriazol-1-yloxy-tri(pyrrolidino)phosphonium [0114] hexafluorophosphate [0115] TFA: Trifluoroacetic acid [0116] H-Leu-OtBu.HCl: L-Leucine t-butyl ester hydrochloride [0117] HATU: O-(7-Azabenzotriazol-1-yl)-N,N,N,N-tetramethyluronium hexafluorophosphate [0118] ec: Escherichia coli [0119] DHFR: Dihydrofolate reductase [0120] RF: Restriction-free [0121] HA: Hemagglutinin [0122] GFP: Green fluorescent protein [0123] DsRed: Discosoma sp. red fluorescent protein [0124] D-MEM: Dulbecco's modified eagle's medium [0125] DMSO: Dimethyl sulfoxide [0126] PBS: Phosphate buffered saline [0127] EDTA: Ethylenediamine tetraacetic acid [0128] FBS: Fetal bovine serum [0129] SDS: Sodium dodecyl sulfate [0130] PAGE: Polyacrylamide gel ectrophoresis [0131] BPB: Bromophenol blue [0132] PVDF: Polyvinylidene difluoride [0133] TBS: Tris buffered saline [0134] GAPDH: Glyceraldehyde 3-phosphate dehydrogenase [0135] FITC: Fluorescein isothiocyanate [0136] PMSF: Phenylmethylsulfonyl fluoride [0137] DTT: Dithiothreitol [0138] TMP: Trimethoprim [0139] DMT-MM: 4-(4,6-Dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride n-hydrate [0140] AMC: 7-Amino-4-methylcoumarin
Example 1
[0141] In Example 1, a Ras protein affinity molecule and a protein-degradation inducing tag were linked to each other to synthesize TUS-007 as a Ras protein-degradation inducing molecule.
[0142] Ras-SOS-MH.sub.2 represented by the following formula was used as the Ras protein affinity molecule. Ras-SOS-MH.sub.2 is a compound obtained by reacting an amino group of Ras-SOS represented by the following formula with H.sub.2N(CH.sub.2).sub.6COOH.
##STR00306##
[0143] Ras-SOS is Compound 12 described in the document by Sun, Q. et al. (Sun, Q. et al., Angew. Chem. Int. Ed., 2012, 51, 6140-6143) (see No. 22 in Table 4). When a SOS protein is bound to the Ras protein, GDP bound to the Ras protein is replaced with GTP, and the Ras protein is activated. It is known that Ras-SOS is bound to the Ras protein to inhibit the interaction between the Ras protein and the SOS protein, thus inhibiting the activation of the Ras protein. Furthermore, it is known that Ras-SOS is bound to not only a wild-type K-Ras protein but also a G12D mutant and a G12V mutant K-Ras protein.
[0144] It is noted that Ras-SOS and Ras-SOS-MH.sub.2 were synthesized according to the method described in the document by Sun, Q. et. al.
[0145] Furthermore, as the protein-degradation inducing tag, a compound (CANDDY_MLN) in which active sites of MLN9708 and MLN2238 as the proteasome inhibitors (a boronic acid ester moiety or a boronyl group) were replaced with a carboxy group was used.
[0146] The method of synthesizing TUS-007 is described in detail as follows.
(Synthesis of CANDDY_MLN)
[0147] CANDDY_MLN was synthesized according to the following synthesis scheme.
##STR00307##
[0148] First, H-Gly-OtBu.HCl (286.8 mg, 1.69 mmol, 1 eq) was charged into a side-arm eggplant flask, and purged with nitrogen. Under nitrogen gas stream, 10 mL of dehydrate DMF and 5 mL of DIPEA were added, and stirred at room temperature. In 1 mL of dehydrate DMF and 1 mL of DIPEA, 2,5-dichlorobenzoic acid (309.3 mg, 1.62 mmol, 1 eq) was dissolved, which was then added to the reaction solution, and the resultant solution was stirred at room temperature for 20 minutes. PyBOP (1.02 g, 1.96 mmol, 1.2 eq) was dissolved in 1 mL of dehydrate DMF, then added to the reaction solution, and stirred at room temperature for 3 hours. The reaction solution was diluted with water and aqueous sodium hydrogen carbonate, and extracted twice with ethyl acetate/hexane (=4/1). After being dried over anhydrous sodium sulfate, the solvent was evaporated under reduced pressure. Separation and purification treatment was performed by silica gel chromatography (hexane/chloroform=1/1 to 0/1, gradient) to obtain a compound S1 (531.0 mg, 1.75 mmol, 103%).
[0149] Next, the compound S1 (212.4 mg, 0.70 mmol) was charged into an eggplant flask, and 5 mL of dichloromethane was then added. This was stirred at room temperature for 5 minutes, then 5 mL of TFA was added thereto, and the resultant solution was stirred at room temperature for one hour. After evaporating the solvent under reduced pressure, vacuum drying was performed to obtain a compound S2 (190.7 mg, quant.).
[0150] Next, the compound S2 (190.7 mg, 0.77 mmol, 1 eq) and H-Leu-OtBu.HCl (175.8 mg, 0.79 mmol, 1 eq) were charged into a side-arm eggplant flask, and purged with nitrogen. Under nitrogen gas stream, 5 mL of dehydrate DMF and 5 mL of DIPEA were added, and stirred at room temperature for 20 minutes. PyBOP (886.7 mg, 1.70 mmol, 2.2 eq) was dissolved in 1.5 mL of dehydrate DMF, then the resultant solution was added to the reaction solution and stirred at room temperature for 3 hours. The reaction solution was diluted with water and aqueous sodium hydrogen carbonate, and extracted twice with ethyl acetate/hexane (=4/1). After being dried over anhydrous sodium sulfate, the solvent was evaporated under reduced pressure. Separation and purification treatment was performed by silica gel chromatography (hexane/chloroform=1/1 to 0/1, gradient) to obtain a compound S3 (244.2 mg, 0.58 mmol, 76%).
[0151] Next, the compound S3 (240.8 mg, 0.58 mmol) was charged into an eggplant flask, and 5 mL of dichloromethane was added. This was stirred at room temperature for 5 minutes, and then 5 mL of TFA was added, and stirred at room temperature for 1 hour. After evaporating the solvent under reduced pressure, vacuum drying was performed to obtain CANDDY_MLN (214.7 mg, 0.59 mmol, 100%).
(Synthesis of TUS-007)
[0152] TUS-007 was synthesized according to the following synthesis scheme.
##STR00308##
[0153] CANDDY_MLN (52.4 mg, 0.15 mmol, 1 eq) and separately synthesized Ras-SOS-NH.sub.2 (62.4 mg, 0.12 mmol, 0.9 eq) were charged into an eggplant flask, and 4 mL of dehydrate DMF was then added. After the resultant solution was stirred at room temperature for 5 minutes, 4 mL of DIPEA was then added to neutralize the solution. After the resultant solution was stirred at room temperature for 5 minutes, HATU (114.1 mg, 0.30 mmol, 2 eq) was directly added to a reaction solution, and the reaction solution was stirred at room temperature for 6 hours. Under cooling, a saturated sodium hydrogen carbonate aqueous solution was added, an organic layer was separated, and then a water layer was extracted with ethyl acetate. Organic layers were collected, and dried over anhydrous sodium sulfate. After the solvent was evaporated under reduced pressure, a separation refining process using silica gel chromatography (chloroform/methanol=20/1 to 4/1, gradient) was performed to obtain TUS-007 (25.2 mg, 0.03 mmol, 24%, isolated yield). The obtained TUS-007 was further purified by preparative thin layer chromatography (chloroform/methanol=10/1). The physical property data of TUS-007 are shown as follows. HRMS-FAB (m/z): [M+H].sup.+ calcd for C.sub.44H.sub.55Cl.sub.2N.sub.8O.sub.5, 845.3672; found, 845.3674.
Example 2
[0154] In Example 2, degradation (knockdown) of a wild-type K-Ras protein forcibly expressed in HeLa cells (human cervical cancer cells) through TUS-007 was evaluated by FACS analysis.
(Preparation of Plasmid)
[0155] A plasmid expressing a wild-type K-Ras protein (K-Ras-WT) was prepared using a plasmid (pMIR-DsRed-IRES-ecDHFR-HA-GFP) expressing an ecDHFR protein by RF cloning. The full-length cDNA clone (Accession No. AK292510) of a human K-ras gene was purchased from Independent Administrative Institution, the National Institute of Technology and Evaluation. PCR amplification was performed using KOD-Plus-Neo (TOYOBO CO., LTD) as a PCR enzyme. Forward primers and reverse primers used for RF cloning are shown in Table 92.
TABLE-US-00092 TABLE92 SEQ ID Primername Sequence(5.fwdarw.3) No. RFC_IRES- CACGATGATAATATGGCCACAACCATGACTG 1 HsKras-HA_Fw AATATAAACTTGTGGTAG RFC_IRES- GAACGTCGTACGGGTAATCGATCATAATTAC 2 HsKras-HA_Rv ACACTTTGTCTTTGAC
(Introduction of Plasmid into HeLa Cells and Cell Seeding)
[0156] The plasmid was introduced into HeLa cells to transiently overexpress a wild-type K-Ras protein (specifically, a fusion protein of a wild-type K-Ras protein and GFP via a HA tag) or a DsRed protein for comparison in the cells.
[0157] ScreenFect A (Wako Pure Chemical Industries, Ltd.) as a transfection reagent was used to introduce the plasmid into HeLa cells by a routine procedure. The HeLa cells into which the plasmid had been introduced were seeded in a 24-well plate at a cell density of 410.sup.4 cells/well, and then cultured under conditions of 37 C. and 5 vol % CO.sub.2 for 40 hours.
(Addition of TUS-007 to HeLa Cells)
[0158] Culture was performed for 40 hours after introduction of the plasmid, and then TUS-007 was added to HeLa cells as follows. As a medium, a serum-free medium (37 C.) in which 1 mass % L-glutamine solution (Sigma-Aldrich) was added to D-MEM (high D-glucose, phenol red, sodium pyruvate (Wako Pure Chemical Industries, Ltd.)) was used. It is noted that the L-glutamine solution was added immediately before use. A DMSO solution containing TUS-007 was mixed with the medium so that the concentration of DMSO was 1 vol %, and added to each well at 500 L/well, and cultured under conditions of 37 C. and 5 vol % CO.sub.2. Furthermore, in addition to an experiment group in which a DMSO solution containing TUS-007 had been added, an experiment group in which a DMSO solution containing both TUS-007 and MLN2238, or Ras-SOS-NH.sub.2 had been added was prepared. It is noted that DMSO was used as a control.
(Evaluation of Degradation (Knockdown) of Wild-Type K-Ras Protein Through TUS-007 (FACS Analysis))
[0159] The medium was removed 24 hours after addition of TUS-007, and then PBS was added to wash the cells. After removing PBS, trypsin (0.25 w/v % Trypsin-1 mmol/L EDTA4 Na solution with phenol red) (Wako Pure Chemical Industries, Ltd.) at 37 C. was added to each well at 200 L/well, and cultured under conditions of 37 C. and 5 vol % CO.sub.2 for 1 minute. After culturing, a medium where 10 mass % FBS and 1 mass % PenStrep (100 U/mL sodium penicillin G and 100 g/mL streptomycin sulfate) (Wako Pure Chemical Industries, Ltd.) were added to D-MEM (low D-glucose, L-glutamine, phenol red) (Wako Pure Chemical Industries, Ltd.) was added to each well at 300 L/well, and suspended, and then a cell solution was collected in a 15 mL tube.
[0160] The cell solution collected was centrifuged (at 1000 rpm5 minutes, 4 C.), and the supernatant was removed, and then suspended in 2 ml of PBS (37 C.). The cell solution after suspension was centrifuged (at 1000 rpm5 minutes, 4 C.), and the supernatant was removed, and then 500 L of an FACS buffer (1 mass % FBS/PBS) at 4 C. was added, and allowed to stand on ice.
[0161] A BD FACSCanto II (BD Biosciences) was used for flow cytometry, and the expression levels of GFP and the DsRed protein in the cells were quantified. The cell solution was passed through a mesh with a pore size of 32 m, and transferred to an FACS tube immediately before FACS analysis. The GFP/DsRed ratio per cell was computed using an analysis software FlowJo (TOMY Digital Biology Co., Ltd.), and degradation (knockdown) of the wild-type K-Ras protein by TUS-007 was determined from a shift in a graph.
[0162] The results of the FACS analysis are shown in
Example 3
[0163] In Example 3, degradation (knockdown) of a forcibly expressed wild-type K-Ras protein in HeLa cells through TUS-007 was evaluated by Western blot analysis.
(Preparation of Plasmid)
[0164] A plasmid expressing the wild-type K-Ras protein (K-Ras-WT) was prepared, as in Example 2.
(Introduction of Plasmid into HeLa Cells and Cell Seeding)
[0165] As in Example 2, the plasmid was introduced into HeLa cells to transiently overexpress the wild-type K-Ras protein (specifically, a fusion protein of the wild-type K-Ras protein and GFP through a HA tag) or a DsRed protein for comparison in the cells. HeLa cells into which the plasmid had been introduced were seeded in a 24-well plate at a cell density of 410.sup.4 cells/well, and then cultured under conditions of 37 C. and 5 vol % CO.sub.2 for 40 hours.
(Addition of TUS-007 to HeLa Cells)
[0166] Culture was performed for 40 hours after introduction of the plasmid, and then TUS-007 was added to HeLa cells as follows. As a medium, a serum-free medium (37 C.) in which 1 mass % L-glutamine solution (Sigma-Aldrich) was added to D-MEM (high D-glucose, phenol red, sodium pyruvate (Wako Pure Chemical Industries, Ltd.)) was used. It is noted that the L-glutamine solution was added immediately before use. A DMSO solution containing TUS-007 was mixed with the medium so that the concentration of DMSO was 1 vol %, and added to each well at 500 L/well, and cultured under conditions of 37 C. and 5 vol % CO.sub.2. Furthermore, in addition to an experiment group in which a DMSO solution containing TUS-007 had been added, an experiment group in which a DMSO solution containing both TUS-007 and MLN2238, MLN2238 or Ras-SOS-NH.sub.2 had been added was prepared. It is noted that DMSO was used as a control.
(Evaluation of Degradation (Knockdown) of Wild-Type K-Ras Protein Through TUS-007 (Western Blot Analysis))
[0167] The medium was removed 24 hours after addition of TUS-007, and then PBS was added to wash the cells. After removing PBS, a mixed solution of a cell lysis buffer (CelLytic M, Sigma) and a protease inhibitor (cOmplete Mini, EDTA-free, Roche) was added to each well at 27 L/well. After being allowed to stand at 4 C. for 15 minutes, cells were detached with a pipette tip on ice. A cell solution was collected in a 1.5 mL tube, and flash frozen in liquid nitrogen, and then thawed on ice. After repeating this freeze-thaw cycle for three times, the solution was centrifuged (at 13800 rpm20 minutes, 4 C.), and the supernatant (cell extract) was collected.
[0168] The cell extract collected was subjected to Western blot analysis. An SDS-PAGE gel was prepared using TGX FastCast Acrylamide Kit, 12% (Bio-Rad). Electrophoresis samples were prepared in a 6SDS-PAGE sample buffer (62.5 mM Tris-HCl pH 6.8, 2% SDS, 5% 2-mercaptoethanol, 10% glycerol, 0.25% BPB), and placed on a heat block at 95 C. for 4 minutes. Electrophoresis was performed at 150 V for 50 minutes (electrophoresis buffer; 195 mM glycine, 25 mM Tris).
[0169] After electrophoresis, proteins were transferred to a PVDF membrane (Immobion-P, Millipore) under conditions of 100 V and 120 minutes using a tank-type blotting device and a transfer buffer (25 mM Tris-HCl, 195 mM glycine, 0.01% SDS, 15% methanol). The membrane after transfer was shaken and blocked at room temperature for 30 minutes in 5% skim milk/high-salt TBS-T (100 mM Tris-HCl, 500 mM NaCl, 0.2% Tween-20, pH 7.6). After blocking, the membrane was rinsed with high-salt TBS-T, and an antibody reaction was performed in 1% skim milk/high-salt TBS-T. As the antibody, anti-HA-peroxidase, high-affinity (3F10) Rat monoclonal antibody (25 U/mL) (Roche) diluted 1000 times was used. The membrane was shaken at room temperature for one hour, and then washed with high-salt TBS-T for 5 minutes. It is noted that washing was performed three times. Further, the membrane was washed with high-salt TBS (100 mM Tris-HCl, 500 mM NaCl, pH 7.6) for 5 minutes. Subsequently, the membrane was treated with a chemiluminescence reagent Immobilon Western (Millipore), and then chemiluminescence was detected using a lumino image analyzer LAS-3000 (FUJIFILM Corporation).
[0170] Next, a reaction for detecting GAPDH as a control was performed using the same membrane. The membrane was washed with TBS-T (100 mM Tris-HCl, 150 mM NaCl, 0.1% Tween-20, pH 7.6), and shaken and blocked in 5% skim milk/TBS-T at room temperature for 30 minutes. After blocking, a primary antibody reaction was performed in 5% skim milk/TBS-T. As the primary antibody, anti-GAPDH antibody (6C5, SantaCruz, diluted 20000 times) was used. The membrane was shaken at room temperature for 60 minutes, and then washed with TBS-T for 5 minutes. It is noted that washing was performed three times. After the primary antibody reaction, a secondary antibody reaction was performed in 2% skim milk/TBS-T. As the secondary antibody, an anti-mouse IgG (H+L) antibody (A90-116P-33, Bethyl) diluted 20000 times was used. The membrane was shaken at room temperature for 30 minutes, and then washed with TBS-T for 5 minutes. It is noted that washing was performed three times. Further, the membrane was washed with TBS (100 mM Tris-HCl, 150 mM NaCl, pH 7.6) for 5 minutes. Subsequently, the membrane was treated with a chemiluminescence reagent Immobilon Western (Millipore), and then chemiluminescence was detected using a lumino image analyzer LAS-3000 (FUJIFILM Corporation). Detected bands were quantified with an image processing software ImageJ (NIH).
[0171] The results of the Western blot analysis are shown in
Example 4
[0172] In Example 4, degradation (knockdown) of a G12D mutant and a G12V mutant K-Ras protein forcibly expressed in HeLa cells through TUS-007 was evaluated by FACS analysis.
(Preparation of Plasmid)
[0173] A plasmid expressing a G12D mutant K-Ras protein (K-Ras-G12D) or a G12V mutant K-Ras protein (K-Ras-G12V) were prepared in the same manner as in Example 2 except that mutation was introduced using a primer. Forward primers and reverse primers used for introducing mutation are shown in Table 93.
TABLE-US-00093 TABLE93 SEQ ID Primername Sequence(5.fwdarw.3) No. AK292510_G12D_Fw_2 GGAGCTGATGGCGTAGGCAAGAGTGC 3 AK292510_G12D_Rv_2 TACGCCATCAGCTCCAACTACCACAAG 4 AK292510_G12V_Fw_2 GGAGCTGTTGGCGTAGGCAAGAGTGC 5 AK292510_G12V_Rv_2 TACGCCAACAGCTCCAACTACCACAAG 6
(Introduction of Plasmid into HeLa Cells and Cell Seeding)
[0174] The plasmid was introduced into HeLa cells as in Example 2 to transiently overexpress a G12D mutant K-Ras protein or a G12V mutant K-Ras protein in a cell or a DsRed protein for comparison in the cells. HeLa cells into which the plasmid had been introduced were seeded in a 24-well plate at a cell density of 410.sup.4 cells/well, and then cultured under conditions of 37 C. and 5 vol % CO.sub.2 for 40 hours.
(Addition of TUS-007 to HeLa Cells)
[0175] TUS-007 was added to HeLa cells as in Example 2. Furthermore, in addition to an experiment group in which a DMSO solution containing TUS-007 had been added, an experiment group in which a DMSO solution containing both TUS-007 and MLN2238, or Ras-SOS-NH.sub.2 had been added was prepared. DMSO was used as a control.
(Evaluation of Degradation (Knockdown) of G12D Mutant and G12V Mutant K-Ras Protein Through TUS-007 (FACS Analysis))
[0176] Degradation of a G12D mutant and a G12V mutant K-Ras protein through TUS-007 was evaluated by FACS analysis as in Example 2.
[0177] The results of the FACS analysis are shown in
[0178] It is noted that from the results of
Example 5
[0179] In Example 5, degradation (knockdown) of the G12D mutant K-Ras protein forcibly expressed in HeLa cells through TUS-007 was evaluated by Western blot analysis.
(Preparation of Plasmid)
[0180] A plasmid expressing the G12D mutant K-Ras protein (K-Ras-G12D) was prepared, as in Example 4.
(Introduction of Plasmid into HeLa Cells and Cell Seeding)
[0181] As in Example 4, the plasmid was introduced into HeLa cells to transiently overexpress a G12D mutant K-Ras protein or a DsRed protein for comparison in the cells. HeLa cells into which the plasmid had been introduced were seeded in a 24-well plate at a cell density of 410.sup.4 cells/well, and then cultured under conditions of 37 C. and 5 vol % CO.sub.2 for 40 hours.
(Addition of TUS-007 to HeLa Cells)
[0182] TUS-007 was added to HeLa cells as in Example 4. Furthermore, in addition to an experiment group in which a DMSO solution containing TUS-007 had been added, an experiment group in which a DMSO solution containing Ras-SOS-NH.sub.2 had been added was prepared. DMSO was used as a control.
(Evaluation of Degradation (Knockdown) of G12D Mutant K-Ras Protein Through TUS-007 (Western Blot Analysis))
[0183] As in Example 3, degradation of a G12D mutant K-Ras protein through TUS-007 was evaluated by Western blot analysis.
[0184] The results of the Western blot analysis are shown in
Example 6
[0185] In Example 6, degradation (knockdown) of an endogenous wild-type K-Ras protein and wild-type H-Ras protein in HeLa cells to which TUS-007 had been added was evaluated by Western blot analysis.
(Cell Seeding)
[0186] HeLa cells were seeded in a 24-well plate at a cell density of 810.sup.4 cells/well, and then cultured under conditions of 37 C. and 5 vol % CO.sub.2 for 16 hours.
(Addition of TUS-007 to HeLa Cells)
[0187] After 16 hours from cell seeding, TUS-007 was added to HeLa cells as follows. As a medium, a serum-free medium (37 C.) in which 1 mass % L-glutamine solution (Sigma-Aldrich) was added to D-MEM (high D-glucose, phenol red, sodium pyruvate (Wako Pure Chemical Industries, Ltd.)) was used. It is noted that the L-glutamine solution was added immediately before use. A DMSO solution containing TUS-007 was mixed with the medium so that the concentration of DMSO was 1 vol %, and added to each well at 500 L/well, and cultured under conditions of 37 C. and 5 vol % CO.sub.2. As a control, DMSO was used.
(Evaluation of Degradation (Knockdown) of Endogenous Wild-Type K-Ras Protein and Wild-Type H-Ras Protein Through TUS-007 (Western Blot Analysis))
[0188] The medium was removed 48 hours after addition of TUS-007, and then PBS was added to wash the cells. After removing PBS, a mixed solution of a cell lysis buffer (CelLytic M, Sigma) and a protease inhibitor (cOmplete Mini, EDTA-free, Roche) was added to each well at 27 L/well. After being allowed to stand at 4 C. for 15 minutes, cells were detached with a pipette tip on ice. A cell solution was collected in a 1.5 mL tube, and flash frozen in liquid nitrogen, and then thawed on ice. After thawing, the solution was centrifuged (at 13800 rpm20 minutes, 4 C.), and the supernatant (cell extract) was collected.
[0189] The cell extract collected was subjected to Western blot analysis. An SDS-PAGE gel was prepared using TGX FastCast Acrylamide Kit, 12% (Bio-Rad). Electrophoresis samples were prepared in a 6SDS-PAGE sample buffer (62.5 mM Tris-HCl pH 6.8, 2% SDS, 5% 2-mercaptoethanol, 10% glycerol, 0.25% BPB), and placed on a heat block at 95 C. for 4 minutes. Electrophoresis was performed at 150 V for 50 minutes (electrophoresis buffer; 195 mM glycine, 25 mM Tris).
[0190] After electrophoresis, proteins were transferred to a PVDF membrane (Immobion-P, Millipore) under conditions of 100 V and 2 hours using a tank-type blotting device and a transfer buffer (25 mM Tris-HCl, 195 mM glycine, 0.01% SDS, 15% methanol). The membrane after transfer was shaken and blocked at room temperature for 30 minutes in 5% skim milk/TBS-T (100 mM Tris-HCl, 150 mM NaCl, 0.1% Tween-20, pH 7.6). After blocking, a primary antibody reaction was performed in 5% skim milk/TBS-T. As the primary antibody, an anti-K-Ras antibody (C-17, SantaCruz, diluted 500 times), an anti-H-Ras antibody (C-20, SantaCruz, diluted 1000 times), and an anti-SOS1 antibody (C-23, SantaCruz, diluted 1000 times) were used. The membrane was shaken at 4 C. for 16 hours, and then washed with TBS-T for 5 minutes. It is noted that washing was performed three times. Further, the membrane was washed with TBS-T for 5 minutes. Subsequently, the membrane was treated with a chemiluminescence reagent Immobilon Western (Millipore), and then chemiluminescence was detected using a lumino image analyzer LAS-3000 (FUJIFILM Corporation).
[0191] Next, a reaction for detecting GAPDH as a control was performed using the same membrane. The membrane was washed with TBS-T, and shaken and blocked in 5% skim milk/TBS-T at room temperature for 30 minutes. After blocking, primary antibody reaction was performed in 5% skim milk/TBS-T. As the primary antibody, anti-GAPDH antibody (6C5, SantaCruz, diluted 20000 times) was used. The membrane was shaken at room temperature for 60 minutes, and then washed with TBS-T for 5 minutes. It is noted that washing was performed three times. After the primary antibody reaction, secondary antibody reaction was performed in 2% skim milk/TBS-T. As the secondary antibody, anti-mouse IgG (H+L) antibody (A90-116P-33, Bethyl) diluted 20000 times was used. The membrane was shaken at room temperature for 30 minutes, and then washed with TBS-T for 5 minutes. It is noted that washing was performed three times. Further, the membrane was washed with TBS (100 mM Tris-HCl, 150 mM NaCl, pH 7.6) for 5 minutes. Subsequently, the membrane was treated with a chemiluminescence reagent Immobilon Western (Millipore), and then chemiluminescence was detected using a lumino image analyzer LAS-3000 (FUJIFILM Corporation). Detected bands were quantified with an image processing software ImageJ (NIH).
[0192] The results of the Western blot analysis are shown in
Example 7
[0193] In Example 7, apoptosis induction in a case where TUS-007, Ras-SOS, or Ras-SOS-NH.sub.2 was added to HeLa cells or SW1990 cells (human pancreatic cancer cells) had been added was evaluated by the FACS analysis. It is noted that in HeLa cells, the wild-type K-Ras protein (K-Ras-WT) is expressed, and in SW1990 cells, the G12D mutant K-Ras protein (K-Ras-G12D) is expressed.
(Cell Seeding)
[0194] HeLa cells or SW1990 cells were seeded in a 24-well plate at a cell density of 810.sup.4 cells/well, and then cultured under conditions of 37 C. and 5 vol % CO.sub.2 for 16 hours.
(Addition of TUS-007, Ras-SOS, or Ras-SOS-NH.SUB.2 .to HeLa Cells or SW1990 Cells)
[0195] After 16 hours from cell seeding, TUS-007, Ras-SOS, or Ras-SOS-NH.sub.2 were added to HeLa cells or SW1990 cells as follows. As a medium, a serum-free medium (37 C.) in which 1 mass % L-glutamine solution (Sigma-Aldrich) was added to D-MEM (high D-glucose, phenol red, sodium pyruvate (Wako Pure Chemical Industries, Ltd.)) was used. It is noted that the L-glutamine solution was added immediately before use. A DMSO solution containing TUS-007, Ras-SOS, or Ras-SOS-NH.sub.2 was mixed with the medium so that the concentration of DMSO was 1 vol %, and added to each well at 500 L/well, and cultured under conditions of 37 C. and 5 vol % CO.sub.2. As a control, DMSO was used.
(Apoptosis Induction by TUS-007, Ras-SOS, or Ras-SOS-NH.SUB.2 .(FACS Analysis))
[0196] The medium was removed 24 hours after addition of TUS-007, Ras-SOS, or Ras-SOS-NH.sub.2, and then PBS was added to wash the cells. After removing PBS, trypsin (0.25 w/v % trypsin-1 mmol/L EDTA4 Na solution with phenol red) (Wako Pure Chemical Industries, Ltd.) at 37 C. was added to each well at 200 L/well, and cultured under conditions of 37 C. and 5 vol % CO.sub.2 for 1 minute. After culturing, a medium where 10 mass % FBS and 1 mass % PenStrep (100 U/mL sodium penicillin G and 100 g/mL streptomycin sulfate) (Wako Pure Chemical Industries, Ltd.) had been added to D-MEM (low D-glucose, L-glutamine, phenol red) (Wako Pure Chemical Industries, Ltd.) was added to each well at 800 L/well, and suspended, and then a cell solution was collected in a 15 mL tube.
[0197] The cell solution collected was centrifuged (at 1000 rpm5 minutes, 4 C.), and the supernatant was removed, and then 85 L of a binding buffer (Annexin V-FITC Kit, Medical & Biological Labolatories) was added thereto and cells were re-suspended. Furthermore, 10 L of Annexin V-FITC and 5 L of propidium iodide (PI) were added and incubated in a dark place at room temperature for 15 minutes, thereby staining the cells. After incubation, 400 L of the binding buffer was added on ice.
[0198] A BD FACSCanto II (BD Biosciences) was used for flow cytometry. Immediately before FACS analysis, a cell solution was passed through a mesh having a 32 m-hole diameter, and transferred to an FACS tube. The proportion of Annexin V-positive and PI-negative cells was calculated using an analysis software FlowJo (TOMY Digital Biology Co., Ltd.), and the proportion was defined as a proportion of apoptosis cells.
[0199] The proportion of apoptosis cells in the HeLa cells is shown in
Example 8
[0200] In Example 8, apoptosis induction in a case where TUS-007, Ras-SOS-NH2, or erlotinib as an anticancer agent (EGFR inhibitor) was added to HeLa cells or SW1990 cells was evaluated by FACS analysis as in Example 7.
[0201] The proportion of apoptosis cells in the HeLa cells is shown in
Example 9
[0202] In Example 9, in a mouse individual to which TUS-007 had been administered, the degradation (knockdown) of an endogenous wild-type K-Ras protein and wild-type H-Ras protein was evaluated by Western blot analysis.
(Administration of TUS-007 to Mice)
[0203] TUS-007 was dissolved in DMSO, and then dissolved in corn oil so that the concentration of DMSO was 10 vol %, and then intraperitoneally administered to C57BL/6J wild-type mice (8 to 9 weeks old, male) (CLEA Japan, Inc.) in an amount of 40 mg/kg body weight or 80 mg/kg body weight (n=3 to 4). Furthermore, in addition to a group in which TUS-007 was administered, a group in which Ras-SOS had been administered in a dose of 80 mg/kg body weight was prepared. As a control, an injection carrier (corn oil containing 10 vol % DMSO) was used. The mice were kept under an environment of ad libitum access to food and water. The mice were dissected under deep anesthesia 48 hours after administration. The pancreas and colon were excised, and flash frozen in liquid nitrogen.
(Western Blot Analysis of Mouse Tissues)
[0204] The frozen pancreas and colon were each triturated, and then TKM tissue lysis buffer (50 mM triethanolamine (pH 7.8), 50 mM KCl, 5 mM MgCl.sub.2, 0.25 M sucrose, 1 mM PMSF, Protein Inhibitors Cocktail-EDTA free (Nacalai Tesque, Inc.), 1 mM DTT, and a recombinant RNase inhibitor (0.2 U/L, Takara Bio) were added, and subjected to centrifugation (at 13800 rpm30 minutes, 4 C.), and the supernatants (pancreatic tissue extract and colorectal tissue extract) were collected. The concentration of the extracted proteins was quantified with a spectrophotometer.
[0205] Each tissue extract collected was subjected to Western blot analysis. An SDS-PAGE gel was prepared using TGX FastCast Acrylamide Kit, 12% (Bio-Rad). Electrophoresis samples were prepared in a 6SDS-PAGE sample buffer (62.5 mM Tris-HCl pH 6.8, 2% SDS, 5% 2-mercaptoethanol, 10% glycerol, 0.25% BPB), and placed on a heat block at 95 C. for 5 minutes. Electrophoresis was performed at 180 V for 50 minutes (electrophoresis buffer; 195 mM glycine, 25 mM Tris).
[0206] After electrophoresis, proteins were transferred to a PVDF membrane (Immobion-P, Millipore) under conditions of 200 mA and 90 minutes using a tank-type blotting device and a transfer buffer (25 mM Tris-HCl, 195 mM glycine, 0.01% SDS, 15% methanol). The membrane after transfer was shaken and blocked in 5% skim milk/TBS-T (100 mM Tris-HCl, 150 mM NaCl, 0.1% Tween-20, pH 7.6) at room temperature for 30 minutes. After blocking, a primary antibody reaction was performed in 5% skim milk/TBS-T. As the primary antibody, an anti-K-Ras antibody (F-234, SantaCruz, diluted 500 times), an anti-H-Ras antibody (M-90, SantaCruz, diluted 500 times), an anti-SOS1 antibody (C-23, SantaCruz, diluted 1000 times), and an anti-GAPDH antibody (6C5, SantaCruz, diluted 20000 times) were used. The membrane was shaken at room temperature for 2 hours, and then washed with TBS-T for 5 minutes. It is noted that washing was performed three times. Furthermore, the membrane was washed with TBS-T for 5 minutes. Subsequently, the membrane was treated with a chemiluminescence reagent Immobilon Western (Millipore), and then chemiluminescence was detected using a lumino image analyzer LAS-3000 (FUJIFILM Corporation).
[0207] The results of the Western blot analysis are shown in
Example 10
[0208] In Example 10, TUS-007 was administered to mice subcutaneously implanted with human pancreatic cancer cells (SW1990 cells), and an anti-tumor effect was evaluated.
(Preparation of Mice with Subcutaneously Implanted SW1990 Cells)
[0209] To the subcutis of T-cell deficient mice (BALB/cAJcl-nu/nu, 4 weeks old, female) (CLEA Japan, Inc.), 0.1 mL of cell suspension in which SW1990 cells were suspended in PBS so as to be 110.sup.7 cells/mL was implanted using a 26-gauge injection needle (TERUMO CORPORATION).
(Oral Administration of TUS-007)
[0210] Immediately before administration, TUS-007 was dissolved in DMSO, 0.5 mass % carboxymethyl cellulose (Code No. 039-01335, Wako Pure Chemical Industries, Ltd.) solution was added so that the concentration of DMSO became 2.5 vol %, followed by pulverization by ultrasonic treatment to prepare a suspension of TUS-007. When the tumors of mice with subcutaneously implanted SW1990 cells grew to a size of approximately 100 mm.sup.3, the prepared TUS-007 suspension was orally administered by gavage with a gastric tube (Code No. 5202K, Fuchigami Kikai) at a dose of 80 mg/kg body weight once every 3 days for a total of 7 doses (n=6 to 9). As a control (Vehicle), 0.5 mass % carboxymethyl cellulose solution containing 2.5 vol % DMSO was administered in the same manner.
(Evaluation of Anti-Tumor Effect)
[0211] Change over time of a tumor volume by administration of TUS-007 is shown in
(Evaluation of Change of Body Weight)
[0212] The change over time of body weight by administration of TUS-007 is shown in
(Evaluation of Acute Toxicity)
[0213] Acute toxicity when TUS-007 was orally administered to Jcl:ICR mice (8 weeks old, female) (CLEA Japan, Inc.) in a single dose of 80 mg/kg body weight, 300 mg/kg body weight, or 1000 mg/kg body weight was evaluated. At all doses, there was no abnormality in the general condition of the mice, and LD.sub.50>1000 mg/kg body weight was satisfied.
Reference Example 1
[0214] In Reference Example 1, a protein affinity molecule and a protein-degradation inducing tag were linked to each other to synthesize TMP-CANDDY_DMT as a protein-degradation inducing molecule.
[0215] As the protein affinity molecule, a TMP derivative (TMP-NH.sub.2) was used. The TMP derivative was obtained by introducing a functional group including an amino group into TMP that is a dihydrofolate reductase inhibitor to be bonded to an ecDHFR protein. Furthermore, as the protein-degradation inducing tag, a compound (DMT) in which R.sup.1 and R.sup.2 in the aforementioned formula (I) are each a methoxy group was used. DMT is a compound which is not derived from a proteasome inhibitor, but has an affinity with a proteasome.
[0216] The method of synthesizing TMP-CANDDY_DMT is described in detail as the following synthesis scheme.
##STR00309##
[0217] TMP-NH.sub.2 (Long, M. J. et al., Chem. Biol., 2012, 19 (5), 629-637) (31.7 mg, 0.073 mmol) was charged into an eggplant flask, and 0.3 mL of dehydrate DMF was added. After the resultant solution was stirred at room temperature for 10 minutes, 0.1 mL of DIPEA was added, and stirred at room temperature for 10 minutes. DMT-MM (33.6 mg, 0.12 mmol, 1.6 eq, Wako Pure Chemical Industries, Ltd.) was directly added to the reaction solution, and stirred at room temperature for 18 hours. The reaction solution was diluted with water and aqueous sodium hydrogen carbonate, and extracted with chloroform for five times. After being dried over anhydrous sodium sulfate, the solvent was evaporated under reduced pressure. Separation and purification treatment was performed by silica gel chromatography (chloroform/methanol=92/8) to obtain TMP-CANDDY_DMT (25.8 mg, 0.045 mmol, 62%, isolated yield).
Reference Example 2
[0218] In Reference Example 2, the proteasome inhibitory activity of TMP-CANDDY_DMT and the affinity of TMP-CANDDY_DMT with a proteasome were evaluated. As a positive control, MG-132 as a proteasome inhibitor was used.
[0219] For evaluation, 20S Proteasome StressXpress Assay Kit Gold (Bioscience) was used. AMC was measured by using Multi-Detection Microplate Reader (Synergy HT, BIO-TEK). The AMC was produced by cleaving the C-terminus of an AMC-binding proteasome fluorescence substrate specific to subunits of a 20S proteasome, including 5 (chymotrypsin-like activity), 2 (trypsin-like activity), and 1 (caspase-like activity). The measuring wavelengths were 360 nm for excitation light (Ex.), and 460 nm for fluorescence (Em.).
[0220]
Reference Example 3
[0221] In Reference Example 3, degradation (knockdown) of a forcibly expressed ecDHFR protein in HeLa cells through TMP-CANDDY_DMT was evaluated by FACS analysis.
(Preparation of Plasmid)
[0222] A plasmid (pMIR-DsRed-IRES-ecDHFR-HA-GFP) expressing an ecDHFR protein was amplified in E. coli, and then purified with Miniprep Kit (QIAGEN).
(Introduction of Plasmid into HeLa Cells and Cell Seeding)
[0223] As in Example 2, the plasmid was introduced into HeLa cells to transiently overexpress an ecDHFR protein (specifically, a fusion protein of an ecDHFR protein and GFP through a HA tag) or a DsRed protein for comparison in the cells. HeLa cells into which the plasmid had been introduced were seeded in a 24-well plate at a cell density of 610.sup.4 cells/well, and then cultured under conditions of 37 C. and 5 vol % CO.sub.2 for 40 hours.
(Addition of TMP-CANDDY_DMT to HeLa Cells)
[0224] Culture was performed for 40 hours after introduction of the plasmid, and then TMP-CANDDY_DMT was added to HeLa cells as follows. As a medium, a serum-free medium (37 C.) in which 1 mass % L-glutamine solution (Sigma-Aldrich) was added to D-MEM (high D-glucose, phenol red, sodium pyruvate (Wako Pure Chemical Industries, Ltd.)) was used, and 297 L of the medium was added to each well. It is noted that the L-glutamine solution was added immediately before use. A DMSO solution containing TMP-CANDDY_DMT was added to each well at 3 L/well, and cultured under conditions of 37 C. and 5 vol % CO.sub.2. As a control, a TMP-containing DMSO solution or DMSO was used.
(Evaluation of Degradation (Knockdown) of ecDHFR Protein Through TMP-CANDDY_DMT (FACS Analysis))
[0225] The medium was removed 24 hours after addition of TMP-CANDDY_DMT, and then PBS was added to wash the cells. After removing PBS, trypsin (0.25 w/v % trypsin-1 mmol/L EDTA4 Na solution with phenol red) (Wako Pure Chemical Industries, Ltd.) at 37 C. was added to each well at 300 L/well, and cultured under conditions of 37 C. and 5 vol % CO.sub.2 for 1 minute. After culturing, a medium, in which 10 mass % FBS and 1 mass % PenStrep (100 U/mL sodium penicillin G and 100 g/mL streptomycin sulfate) (Wako Pure Chemical Industries, Ltd.) had been added to D-MEM (low D-glucose, L-glutamine, phenol red) (Wako Pure Chemical Industries, Ltd.), was added to each well at 500 L/well, and suspended, and then a cell solution was collected in a 15 mL tube.
[0226] The cell solution collected was centrifuged (at 1000 rpm5 minutes, 4 C.), and the supernatant was removed, and then suspended in 2 mL of PBS (37 C.). The cell solution after suspension was centrifuged (at 1000 rpm5 minutes, 4 C.), and the supernatant was removed, and then 500 L of an FACS buffer (1 mass % FBS/PBS) at 4 C. was added, and allowed to stand on ice.
[0227] A BD FACSCanto II (BD Biosciences) was used for flow cytometry, and the expression levels of GFP and the DsRed protein in the cells were quantified. The cell solution was passed through a mesh with a pore size of 32 urn, and transferred to an FACS tube immediately before FACS analysis. The GFP/DsRed ratio per cell was computed using an analysis software FlowJo (TOMY Digital Biology Co., Ltd.), and the degradation (knockdown) of the ecDHFR protein by TMP-CANDDY_DMT was determined from a shift in a graph.
[0228] The results of the FACS analysis are shown in
Reference Example 4
[0229] In Reference Example 4, degradation (knockdown) of a forcibly expressed ecDHFR protein in HeLa cells through TMP-CANDDY_DMT was evaluated by Western blot analysis.
(Preparation of Plasmid)
[0230] A plasmid expressing an ecDHFR protein was prepared, as in Reference Example 3.
(Introduction of Plasmid into HeLa Cells and Cell Seeding)
[0231] As in Reference Example 3, the plasmid was introduced into HeLa cells to transiently overexpress an ecDHFR protein or a DsRed protein for comparison in the cells. HeLa cells into which the plasmid had been introduced were seeded in a 24-well plate at a cell density of 410.sup.4 cells/well, and then cultured under conditions of 37 C. and 5 vol % CO.sub.2 for 40 hours.
(Addition of TMP-CANDDY_DMT to HeLa Cells)
[0232] Culture was performed for 40 hours after introduction of the plasmid, and then TMP-CANDDY_DMT was added to HeLa cells as follows. As a medium, a serum-free medium (37 C.) in which 1 mass % L-glutamine solution (Sigma-Aldrich) was added to D-MEM (high D-glucose, phenol red, sodium pyruvate (Wako Pure Chemical Industries, Ltd.)) was used. It is noted that the L-glutamine solution was added immediately before use. A DMSO solution containing TMP-CANDDY_DMT was mixed with the medium so that the concentration of DMSO was 1 vol %, and added to each well at 300 L/well, and cultured under conditions of 37 C. and 5 vol % CO.sub.2. Furthermore, in addition to an experiment group in which a DMSO solution containing TMP-CANDDY_DMT had been added, an experiment group in which a DMSO solution containing both TMP-CANDDY_DMT and bortezomib had been added was prepared. Cycloheximide as a protein synthesis inhibitor was added to the medium so as to give a concentration of 50 g/mL 12 hours after addition of TMP-CANDDY_DMT. It is noted that as a control, a TMP-containing DMSO solution or DMSO was used.
(Evaluation of Degradation (Knockdown) of ecDHFR Protein Through TMP-CANDDY_DMT (Western Blot Analysis))
[0233] The medium was removed 24 hours after addition of TMP-CANDDY_DMT, and PBS was added to wash the cells. After removing PBS, a mixed solution of a cell lysis buffer (CelLytic M, Sigma) and a protease inhibitor (cOmplete Mini, EDTA-free, Roche) was added to each well at 55 L/well. After being allowed to stand at 4 C. for 15 minutes, cells were detached with a pipette tip on ice. A cell solution was collected in a 1.5 mL tube, and flash frozen in liquid nitrogen, and then thawed on ice. After repeating this freeze-thaw cycle three times, the solution was centrifuged (at 13000 rpm20 minutes, 4 C.), and the supernatant (cell extract) was collected.
[0234] The cell extract collected was subjected to Western blot analysis. An SDS-PAGE gel was prepared using TGX FastCast Acrylamide Kit, 12% (Bio-Rad). Electrophoresis samples were prepared in a 6SDS-PAGE sample buffer (62.5 mM Tris-HCl pH 6.8, 2% SDS, 5% 2-mercaptoethanol, 10% glycerol, 0.25% BPB), and placed on a heat block at 95 C. for 4 minutes. Electrophoresis was performed at 150 V for 50 minutes (electrophoresis buffer; 195 mM glycine, 25 mM Tris).
[0235] After electrophoresis, proteins were transferred to a PVDF membrane (Immobion-P, Millipore) under conditions of 100 V and 40 minutes using a tank-type blotting device and a transfer buffer (25 mM Tris-HCl, 195 mM glycine, 0.01% SDS, 15% methanol). The membrane after transfer was shaken and blocked at room temperature for 30 minutes in 5% skim milk/high-salt TBS-T (100 mM Tris-HCl, 500 mM NaCl, 0.2% Tween-20, pH 7.6). After blocking, the membrane was rinsed with high-salt TBS-T, and an antibody reaction was performed in 1% skim milk/high-salt TBS-T. As the antibody, anti-HA-peroxidase and high-affinity (3F10) rat monoclonal antibody (25 U/mL) (Roche) diluted 1000 times was used. The membrane was shaken at room temperature for 1 hour, and then washed with high-salt TBS-T for 5 minutes. It is noted that washing was performed three times. Further, the membrane was washed with high-salt TBS (100 mM Tris-HCl, 500 mM NaCl, pH 7.6) for 5 minutes. Subsequently, the membrane was treated with a chemiluminescence reagent Immobilon Western (Millipore), and then chemiluminescence was detected using a lumino image analyzer LAS-3000 (FUJIFILM Corporation).
[0236] Next, a reaction for detecting GAPDH as a control was performed using the same membrane. The membrane was washed with TBS-T (100 mM Tris-HCl, 150 mM NaCl, 0.1% Tween-20, pH 7.6), and blocked by shaking at room temperature for 30 minutes in 5% skim milk/TBS-T. After blocking, a primary antibody reaction was performed in 5% skim milk/TBS-T. As the primary antibody, an anti-GAPDH antibody (6C5, SantaCruz, diluted 20000 times) was used. The membrane was shaken at room temperature for 60 minutes, and then washed with TBS-T for 5 minutes. It is noted that washing was performed three times. After the primary antibody reaction, a secondary antibody reaction was performed in 2% skim milk/TBS-T. As the secondary antibody, anti-mouse IgG (H+L) antibody (A90-116P-33, Bethyl) diluted 20000 times was used. The membrane was shaken at room temperature for 30 minutes, and then washed with TBS-T for 5 minutes. It is noted that washing was performed three times. Further, the membrane was washed with TBS (100 mM Tris-HCl, 150 mM NaCl, pH 7.6) for 5 minutes. Subsequently, the membrane was treated with a chemiluminescence reagent Immobilon Western (Millipore), and then chemiluminescence was detected using a lumino image analyzer LAS-3000 (FUJIFILM Corporation). Detected bands were quantified with an image processing software ImageJ (NIH).
[0237] The results of the Western blot analysis are shown in
Reference Example 5
[0238] In Reference Example 5, a protein affinity molecule and a protein-degradation inducing tag were linked to each other to synthesize TMP-CANDDY_ALLN as a protein-degradation inducing molecule.
[0239] As the protein affinity molecule, as in Reference Example 1, TMP-NH.sub.2 was used. Furthermore, as the protein-degradation inducing tag, a compound (CANDDY_ALLN) in which an active site (formyl group) of ALLN as a proteasome inhibitor was substituted with a carboxy group was used.
[0240] The method of synthesizing TMP-CANDDY_ALLN is described in detail as the following synthesis scheme.
##STR00310##
(Synthesis of CANDDY_ALLN)
[0241] ALLN (87.2 mg, 0.23 mmol, 1 eq, Code No. 07036-24, Nacalai Tesque, Inc.) was charged into an eggplant flask, and 2 mL of dehydrate DMF was added. After the resultant solution was stirred at room temperature for 5 minutes, Oxone (212.1 mg, 0.69 mmol, 3 eq, Code No. 228036, Sigma-Aldrich) was directly added to a reaction solution, and the reaction solution was stirred at room temperature for 5 hours. The reaction solution was diluted with water, and extracted with chloroform three times. After being dried over anhydrous sodium sulfate, the solvent was evaporated under reduced pressure. Separation and purification treatment was performed by silica gel chromatography (Code No. 30511-35, Nacalai Tesque, Inc.) (chloroform/methanol=20/1 to 10/1, gradient) to obtain CANDDY_ALLN (27.0 mg, 0.068 mmol, 30%).
(Synthesis of TMP-CANDDY_ALLN)
[0242] CANDDY_ALLN (26.8 mg, 0.067 mmol, 1 eq) and separately synthesized TMP-NH.sub.2 (Long, M. J. et al., Chem. Biol., 2012, 19(5), 629-637) (26.0 mg, 0.060 mmol, 0.9 eq) were charged into an eggplant flask, and 2 mL of dehydrate DMF was added. After the resultant solution was stirred at room temperature for 5 minutes, 0.1 mL of DIPEA was added to neutralize the solution. This was stirred for 5 minutes at room temperature, then DMT-MM (30.0 mg, 0.11 mmol, 1.6 eq, Code No. 329-53751, Wako Pure Chemical Industries, Ltd.) was directly added to a reaction solution, and stirred at room temperature for 2 hours. Under cooling conditions, 10 mL of 10 mass % brine/0.1 N aqueous hydrochloric acid was added, and extracted with ethyl acetate three times. This was washed with 0.5 N aqueous hydrochloric acid and then brine, and then dried over anhydrous sodium sulfate. After evaporating the solvent under reduced pressure, separation and purification treatment was performed by silica gel chromatography (Code No. 30511-35, Nacalai Tesque, Inc.) (chloroform/methanol=10/1) to obtain TMP-CANDDY_ALLN (8.2 mg, 0.010 mmol, 15%, isolated yield).
Reference Example 6
[0243] In Reference Example 6, as in Reference Example 2, a proteasome inhibitory activity of TMP-CANDDY_ALLN and an affinity of TMP-CANDDY_ALLN with a proteasome were evaluated.
[0244]
Reference Example 7
[0245] In Reference Example 7, degradation (knockdown) of a forcibly expressed ecDHFR protein in HeLa cells through TMP-CANDDY_ALLN was evaluated by FACS analysis.
(Preparation of Plasmid)
[0246] A plasmid (pMIR-DsRed-IRES-ecDHFR-HA-GFP) expressing the ecDHFR protein was prepared, as in Reference Example 3.
(Introduction of Plasmid into HeLa Cells and Cell Seeding)
[0247] As in Reference Example 3, the plasmid was introduced into HeLa cells to transiently overexpress an ecDHFR protein or a DsRed protein for comparison in the cells. HeLa cells into which the plasmid had been introduced were seeded in a 24-well plate at a cell density of 410.sup.4 cells/well, and then cultured under conditions of 37 C. and 5 vol % CO.sub.2 for 40 hours.
(Addition of TMP-CANDDY_ALLN to HeLa Cells)
[0248] Culture was performed for 40 hours after introduction of the plasmid, and then TMP-CANDDY_ALLN was added to HeLa cells as follows. As a medium, a serum-free medium (37 C.) in which 1 mass % L-glutamine solution (Sigma-Aldrich) was added to D-MEM (high D-glucose, phenol red, sodium pyruvate (Wako Pure Chemical Industries, Ltd.)) was used, and added to each well at 300 L/well. It is noted that the L-glutamine solution was added immediately before use. A DMSO solution containing TMP-CANDDY_ALLN was added to each well at 3 L/well, and cultured under conditions of 37 C. and 5 vol % CO.sub.2. As a control, a TMP-containing DMSO solution or DMSO was used.
(Evaluation of Degradation of Protein (Knockdown) of ecDHFR Protein Through TMP-CANDDY_ALLN (FACS Analysis))
[0249] As in Example 2, degradation of the ecDHFR protein through TMP-CANDDY_ALLN was evaluated by FACS analysis.
[0250] The results of the FACS analysis are shown in
[0251] The disclosure of Japanese Patent Application No. 2016-222683 filed on Nov. 15, 2016 is entirely incorporated herein by reference. All documents, patent applications, and technical standards cited herein are incorporated herein by reference to the same extent as if each of the documents, patent applications, and technical standards was specifically and individually indicated to be incorporated by reference.