EXPRESSION VECTORS COMPRISING CHIMERIC CYTOMEGALOVIRUS PROMOTER AND ENHANCER SEQUENCES

20200002721 ยท 2020-01-02

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to expression vectors for the heterologous expression of a nucleic acid sequence of interest in mammalian cells, the vectors comprising a chimeric promoter regulatory sequence being operably linked to a nucleic acid sequence to be expressed, wherein the chimeric promoter regulatory sequence comprises a cytomegalovirus promoter sequence derived from murine cytomegalovirus or from human cytomegalovirus and being operably linked to the transcriptional start site of the nucleic acid sequence to be expressed; and a cytomegalovirus upstream region and/or enhancer sequence derived from human and/or the simian cytomegalovirus, wherein the upstream region and/or enhancer sequence is located 5 of and operably linked to the murine or the human promoter sequence, and wherein the chimeric promoter regulatory sequence comprises sequence elements being derived from at least two of the group consisting of murine cytomegalovirus, human cytomegalovirus and simian cytomegalovirus. In particular embodiments, the chimeric promoter regulatory sequence comprises sequence elements derived from the murine or the human cytomegalovirus IE1 promoter and from the human and/or the simian cytomegalovirus IE1 region. The invention also relates to mammalian host cells transfected with such expression vectors, a method for heterologous expression of a nucleic acid sequence in a mammalian host cell by employing such expression vectors, and the use of such expression vectors for the heterologous expression of a nucleic acid sequence.

    Claims

    1. A mammalian host cell transfected with an expression vector, the vector comprising a first chimeric regulatory sequence being operably linked to a first nucleic acid sequence to be expressed, wherein the chimeric regulatory sequence comprises: (i) a promoter sequence from the murine or the human cytomegalovirus IE1 region and being operably linked to the transcriptional start site of the nucleic acid sequence to be expressed, wherein the promoter sequence is selected from the group consisting of SEQ ID NO: 4 and SEQ ID NO: 5; and (ii) an enhancer sequence from the simian cytomegalovirus IE1 region or representing a chimera from the human and simian cytomegalovirus IE1 regions, the enhancer sequence being located 5 of and operably linked to the murine or the human promoter sequence, wherein the enhancer sequence comprises SEQ ID NO: 6.

    2. The mammalian host cell of claim 1, wherein the chimeric regulatory sequence of the expression vector comprises a nucleotide sequence being selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13.

    3. The mammalian host cell of claim 1, wherein the host cell is a CHO cell.

    4. The mammalian host cell of claim 1, wherein the expression vector further comprises a second chimeric regulatory sequence being operably linked to a second nucleic acid sequence to be expressed, wherein the second chimeric regulatory sequence is identical to the first chimeric regulatory sequence.

    5. The mammalian host cell of claim 4, wherein the first and second nucleic acid sequences to be expressed encode different polypeptides.

    6. The mammalian host cell of claim 5, wherein the different polypeptides represent subunits of a dimeric or multimeric protein.

    7. The mammalian host cell of claim 6, wherein the dimeric or multimeric protein is an antibody molecule.

    8. The mammalian host cell of claim 1, wherein the expression vector further comprises a second chimeric regulatory sequence being operably linked to a second nucleic acid sequence to be expressed, wherein the second chimeric regulatory sequence is different from the first chimeric promoter regulatory sequence.

    9. The mammalian host cell of claim 8, wherein the first and second nucleic acid sequences to be expressed encode different polypeptides.

    10. The mammalian host cell of claim 9, wherein the different polypeptides represent subunits of a dimeric or multimeric protein.

    11. The mammalian host cell of claim 10, wherein the dimeric or multimeric protein is an antibody molecule.

    12. A method for heterologous expression of a nucleic acid sequence of interest in a mammalian host cell, comprising: (i) transfecting the mammalian host cell with an expression vector, the vector comprising a first chimeric regulatory sequence being operably linked to a first nucleic acid sequence to be expressed, wherein the chimeric regulatory sequence comprises: (xi) a promoter sequence from the murine or the human cytomegalovirus IE1 region and being operably linked to the transcriptional start site of the nucleic acid sequence to be expressed, wherein the promoter sequence is selected from the group consisting of SEQ ID NO: 4 and SEQ ID NO: 5; and (xii) an enhancer sequence from the simian cytomegalovirus IE1 region or representing a chimera from the human and simian cytomegalovirus IE1 regions, the enhancer sequence being located 5 of and operably linked to the murine or the human promoter sequence, wherein the enhancer sequence comprises SEQ ID NO: 6; and (ii) culturing the transfected mammalian host cell under conditions allowing the expression of the nucleic acid sequence of interest.

    13. The method of claim 12, wherein the chimeric promoter regulatory sequence of the expression vector comprises a nucleotide sequence being selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13.

    14. The method of claim 12, wherein the transfection is stable transfection.

    Description

    DESCRIPTION OF THE DRAWINGS

    [0029] FIG. 1 illustrates expression vector pRY42 (SEQ ID NO: 1) used as parent vector for generating the mammalian expression vectors as defined herein. pRY42 encompasses two regulatory cassettes for driving heterologous gene expression (between mCMV and pA, respectively): Multiple cloning sites located 3 (i.e. downstream) of the Ex2 regions for insertion of heterologous nucleic acid sequences to be expressed. The regulatory cassettes are flanked by mutant (F5-mFRT) and wild type (wFRT) flippase recognition target sites. An in-frame initiation methionine codon has been added to the 5-end of the wFRT site (ATG+F) An SV40 early promoter (SV) is located 5 (upstream) of ATG+F. Transcription of heterologous nucleic acid sequences is driven by the promoter of the murine cytomegalovirus IE1 gene (mCMV) which is followed by the 5UTR, where exon 1 (Ex1) is a hybrid of murine (m) and human (h) CMV derived sequences, and where exon 2 (Ex2) and the intron A sequence (Int A) are derived from the hCMV sequence. The 13-lactamase selection marker gene is denoted as bla. pRY42 is used as a target vector for cloning the different chimeric promoter regulatory sequences as defined herein.

    [0030] FIG. 2 illustrates expression vector pRY57 (SEQ ID NO: 2) encoding the light (LC) and heavy (HC) chains of the mouse-human chimeric monoclonal antibody (mAb) cB72.3 (Whittle, N. et al. (1987) Protein Eng. 1, 499-505), each located between the cloning sites 3 of the Ex2 regions and the polyadenylation sites (pA), respectively. Otherwise, pRY57 is identical to pRY42. The LC and HC nucleic acid sequences of pRY57 were removed and cloned into pRY42 variants in which original the mCMV promoter sequence was replaced with the different chimeric promoter regulatory sequences as defined herein.

    [0031] FIG. 3 schematically depicts the original mCMV promoter sequence (SEQ ID NO: 3) encompassed in pRY42 (top) as well as five different chimeric promoter regulatory sequences (constructs 1 to 5), as defined herein (SEQ ID NO: 7 to SEQ ID NO: 11, respectively), which comprise murine CMV (mCMV) promoter sequences located 3 of upstream region and/or enhancer elements being derived from simian (sCMV) and/or human (hCMV) CMV. Furthermore, two additional chimeric promoter regulatory sequences (constructs 6 and 7), as defined herein (SEQ ID NO: 12 and SEQ ID NO: 13) are shown, which comprise hCMV promoter sequences located 3 of upstream region and/or enhancer elements being derived from sCMV and/or human hCMV. All mCMV and hCMV promoter sequences specifically employed herein include at their 3-ends an additional guanosine (G) nucleotide, which represents the transcriptional start site.

    [0032] FIG. 4 shows a comparison of the concentrations of mAb cB72.3 produced in stable CHO lines where gene expression of the mAb sequences was under the control of chimeric constructs 1 to 5, as illustrated in FIG. 3. Determination was performed by Protein A HPLC after 15 days growth in 50 ml growth medium in E250 shake flask culture using a fed batch overgrow (FOG) protocol. For each of chimeric constructs, n=4, representing duplicate fed batch analyses for duplicate transfections, with the exception of construct 4, where n=6 (duplicate FOG analyses for triplicate transfections) and pRY57 (original mCMV), where n=8, with data points from experiments 1 and 2 being combined.

    [0033] FIG. 5 shows a comparison of the concentrations of mAb cB72.3 produced in stable CHO lines where gene expression of the mAb sequences was under the control of chimeric constructs 6 and 7, as illustrated in FIG. 3. Determination was performed by Protein A HPLC after 7 days growth in 30 ml growth medium in E125 shake flask culture using a batch overgrow (BOG) protocol. For mCMV and construct 7, n=6 (duplicate batch analysis for triplicate transfections), and for construct 6, n=4 (duplicate batch analyses for duplicate transfections).

    DETAILED DESCRIPTION OF THE INVENTION

    [0034] The present invention is based on the unexpected finding that mammalian expression vectors comprising chimeric (i.e. hybrid) promoter regulatory sequences being composed of a mCMV or a hCMV promoter sequence (in particular, a mCMV or a hCMV IE1 promoter sequence) in operable linkage to the transcriptional start site of the nucleic acid sequence to be expressed and an hCMV and/or sCMV upstream region and/or enhancer sequence (in particular, a hCMV IE1 and/or sCMV IE1 enhancer sequence) being located 5 of and operably linked to the mCMV or the hCMV promoter sequence resulted in significantly improved gene expression rates as compared to existing expression systems only based on mCMV promoter sequences, and thus also in much higher yields (up to an almost 3-fold increase) of the recombinant proteins produced.

    [0035] Accordingly, the mammalian expression vectors as defined herein represent superior molecular tools for the production of recombinant proteins, particularly in an industry-scale.

    [0036] The present invention illustratively described in the following may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein.

    [0037] Where the term comprising is used in the present description and the claims, it does not exclude other elements or steps. For the purposes of the present invention, the term consisting of is considered to be a preferred embodiment of the term comprising. If hereinafter a group is defined to comprise at least a certain number of embodiments, this is also to be understood to disclose a group, which preferably consists only of these embodiments.

    [0038] Where an indefinite or definite article is used when referring to a singular noun, e.g., a, an or the, this includes a plural of that noun unless specifically stated otherwise.

    [0039] In case, numerical values are indicated in the context of the present invention the skilled person will understand that the technical effect of the feature in question is ensured within an interval of accuracy, which typically encompasses a deviation of the numerical value given of 10%, and preferably of 5%.

    [0040] Furthermore, the terms first, second, third, (a), (b), (c), and the like, in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.

    [0041] Further definitions of term will be given in the following in the context of which the terms are used. The following terms or definitions are provided solely to aid in the understanding of the invention. These definitions should not be construed to have a scope less than understood by a person of ordinary skill in the art.

    [0042] In one aspect, the present invention relates to an expression vector for the heterologous expression of a nucleic acid sequence of interest in mammalian cells, the vector comprising a first chimeric promoter regulatory sequence being operably linked to a first nucleic acid sequence to be expressed, wherein the chimeric promoter regulatory sequence comprises:

    (i) a promoter sequence being derived from murine cytomegalovirus or from human cytomegalovirus and being operably linked to the transcriptional start site of the nucleic acid sequence to be expressed; and
    (ii) an upstream region and/or enhancer sequence being derived from human and/or simian cytomegalovirus, wherein the upstream region and/or enhancer sequence is located 5 of and operably linked to the murine or the human promoter sequence, and
    wherein the chimeric promoter regulatory sequence comprises sequence elements being derived from at least two of the group consisting of murine cytomegalovirus, human cytomegalovirus and simian cytomegalovirus.

    [0043] In other words, the provision that the chimeric promoter regulatory sequence, as defined herein, comprises sequence elements being derived from at least two of the group consisting of murine cytomegalovirus, human cytomegalovirus and simian cytomegalovirus ensures that the claimed subject matter does not include any constructs only derived from human cytomegalovirus.

    [0044] The term expression vector, as used herein, denotes a nucleic acid vehicle (plasmid) that is characterized by the presence of at least one expression cassette. The term expression cassette, as used herein, refers to a genetic construct that is capable to allow gene expression of a nucleic acid sequence of interest (i.e. a heterologous nucleic acid sequence). This requires that such expression cassette comprises regulatory sequence elements which contain information regarding to transcriptional and/or translational regulation, and that such regulatory sequences are operably linked to the nucleic acid sequence of interest. An operable linkage is a linkage in which the regulatory sequence elements and the nucleic acid sequence to be expressed are connected in a way that enables gene expression.

    [0045] The precise nature of the regulatory regions of an expression cassette that are necessary for controlling and driving gene expression may vary among species, but in general these regions comprise promoter regulatory sequences (i.e. a sequence region located 5 (upstream) of the nucleic acid sequence of interest) and 3-untranslated regulatory sequences (i.e. a sequence region located 3 (downstream) of the nucleic acid sequence of interest).

    [0046] The term promoter, (also referred to as core promoter) as used herein, denotes sequence elements that per se direct the initiation of transcription (e.g., binding sites for transcription factors and for DNA-dependent RNA-polymerase, TATA box, CAAT sequences, and 5-capping elements). As long as this functionality of promoting transcription initiation is retained or substantially retained (e.g., at least 70%, at least 80%, at least 90% or at least 95% of wild-type activity, that is, activity of a full-length sequence), any truncated, mutated or otherwise modified variants of a (naturally occurring) wild-type promoter sequence are also within the above definition. As used herein, the term core promoter refers to a sequence of minimal length that retains promoter activity. As used herein, the promoter sequence is operably linked to the transcriptional start site of the nucleic acid sequence to be expressed.

    [0047] In particular embodiments, the expression vectors of the present invention comprise (as part of an expression cassette) a first (chimeric) promoter regulatory sequence (i.e. at least one such sequence), which, in turn, encompasses a (core) promoter sequence being derived from murine cytomegalovirus (mCMV). This mCMV promoter sequence is operably linked to the transcriptional start site of a first nucleic acid sequence to be expressed. Generally, any mCMV promoter sequence can be employed. Preferably, promoter sequences of the mCMV immediate early (IE) genes, such as mCMV IE1 and mCMV IE2 (Dorsch-Hasler, K. et al. (1985) Proc. Natl. Acad. Sci. USA 82, 8325-8329; Messerle, M. et al. (1991) J. Virol. 65, 1638-1643), are employed, with the mCMV IE1 promoter being particularly preferred.

    [0048] These and additional mCMV promoters are well known in the art and can be easily derived from the mCMV genome deposited in the NCBI Viral Genomes database under accession no. U68299.1 (http://www.ncbi.nlm.nih.gov/genomes/GenomesHome; Bao, Y. et al. (2004) J. Virol. 78, 7291-7298).

    [0049] In a specific embodiment of the present invention, the mCMV IE1 promoter sequence comprised in the expression vector has a nucleic acid sequence of 492 bp in length as shown in SEQ ID NO: 3:

    TABLE-US-00001 1 tactgagtcattagggactttccaatgggttttgcccagtacataaggtc 51 aataggggtgaatcaacaggaaagtcccattggagccaagtacactgagt 101 caatagggactttccattgggttttgcccagtacaaaaggtcaatagggg 151 gtgagtcaatgggtttttcccattattggcacgtacataaggtcaatagg 201 ggtgagtcattgggtttttccagccaatttaattaaaacgccatgtactt 251 tcccaccattgacgtcaatgggctattgaaactaatgcaacgtgaccttt 301 aaacggtactttcccatagctgattaatgggaaagtaccgttctcgagcc 351 aatacacgtcaatgggaagtgaaagggcagccaaaacgtaacaccgcccc 401 ggttttcccctggaaattccatattggcacgcattctattggctgagctg 451 cgttctacgtgggtataagaggcgcgaccagcgtcggtaccg

    [0050] In a preferred embodiment, the mCMV IE1 promoter sequence comprised in the expression vector has a nucleic acid sequence of 102 bp in length (also referred to as core promoter) as shown in SEQ ID NO: 4:

    TABLE-US-00002 1 acaccgccccggttttcccctggaaattccatattggcacgcattctatt 51 ggctgagctgcgttctacgtgggtataagaggcgcgaccagcgtcggtac 101 cg

    [0051] Both SEQ ID NO: 3 and SEQ ID NO: 4 include at their respective 3-ends an additional guanosine (G) nucleotide, which represents the transcriptional start site.

    [0052] In other particular embodiments, the expression vectors of the present invention comprise (as part of an expression cassette) a first (chimeric) promoter regulatory sequence (i.e. at least one such sequence), which, in turn, encompasses a (core) promoter sequence being derived from human cytomegalovirus (hCMV). This hCMV promoter sequence is operably linked to the transcriptional start site of a first nucleic acid sequence to be expressed. Generally, any hCMV promoter sequence can be employed. Preferably, promoter sequences of the hCMV immediate early (IE) genes, such as hCMV IE1 and hCMV IE2 (You, C. Y. et al. (1992) Intervirology 34, 94-104; Klucher, K. M. et al. (1993) Mol. Cell. Biol. 13, 1238-1250), are employed, with the hCMV IE1 promoter being particularly preferred.

    [0053] These and additional hCMV promoters are well known in the art and can be easily derived from the hCMV genome deposited in the NCB Viral Genomes database under accession no. NC_006273 (http://www.ncbi.nlm.nih.gov/genomes/GenomesHome; supra).

    [0054] In a preferred embodiment, the hCMV IE1 promoter sequence comprised in the expression vector has a nucleic acid sequence of 117 bp in length (also referred to as core promoter) as shown in SEQ ID NO: 5:

    TABLE-US-00003 1 gcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccat 51 tgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcaga 101 gctcgtttagtgaaccg
    SEQ ID NO: 5 includes at its 3-end an additional guanosine (G) nucleotide, which represents the transcriptional start site.

    [0055] Furthermore, the promoter regulatory sequences of an expression cassette usually comprise an enhancer sequence. The term enhancer, as used herein, denotes sequence elements that augment, improve or ameliorate transcription of a nucleic acid sequence irrespective of its location and orientation in relation to the nucleic acid sequence to be expressed. An enhancer may enhance transcription from a single promoter or simultaneously from more than one promoter. As long as this functionality of improving transcription is retained or substantially retained (e.g., at least 70%, at least 80%, at least 90% or at least 95% of wild-type activity, that is, activity of a full-length sequence), any truncated, mutated or otherwise modified variants of a (naturally occurring) wild-type enhancer sequence are also within the above definition.

    [0056] The expression vectors of the present invention comprise (as part of an expression cassette) in their respective first (chimeric) promoter regulatory sequence an upstream region (sequence) and/or enhancer sequence being derived from human cytomegalovirus (hCMV) and/or simian cytomegalovirus (sCMV). In other words, the promoter regulatory sequence may comprise an upstream region and/or enhancer sequence being solely derived from hCMV or an upstream region and/or enhancer sequence being solely derived from sCMV or a chimeric upstream region and/or enhancer sequence composed of sequences derived from hCMV and sCMV. Within the promoter regulatory sequence, the upstream region and/or enhancer sequences are located 5 (i.e. upstream) of the mCMV or the hCMV (core) promoter sequences and are in operable linkage to the murine or the human promoter sequence. Typically, the enhancer sequences are arranged in the same orientation as the promoter sequences. However, in specific embodiments, the upstream region and/or enhancer sequences are arranged in reverse orientation in relation to the promoter sequences.

    [0057] Generally, any hCMV and/or sCMV sequences can be employed as upstream region and/or enhancer sequence. Preferably, sequences of the hCMV and/or sCMV immediate early (IE) genes, such as hCMV IE1, hCMV IE2, sCMV IE1, and sCMV IE2 (Meier, J. L. and Stinski, M. F. (1996) Intervirology 39, 331-342; Kim, G. Y. et al. (2011) Biotechnol. Lett. 33, 1319-1326), are employed, with the hCMV and/or sCMV IE1 enhancer sequences being particularly preferred.

    [0058] Hence, the expression vectors of the present invention comprise a first promoter regulatory sequence which is chimeric in that it comprises mCMV promoter sequences or hCMV promoter sequences in combination with hCMV and/or sCMV upstream region and/or enhancer sequences. In particular embodiments, the promoter sequence is derived from the mCMV IE1 promoter; and/or the upstream region and/or enhancer sequence is derived from the hCMV and/or sCMV IE1 enhancer. In other particular embodiments, the promoter sequence is derived from the mCMV IE1 promoter; and/or the upstream region and/or enhancer sequence is derived from the hCMV and/or sCMV IE2 enhancer. In yet other particular embodiments, the promoter sequence is derived from the hCMV IE1 promoter; and/or the upstream region and/or enhancer sequence is derived from the hCMV and/or sCMV IE1 enhancer. In yet other particular embodiments, the promoter sequence is derived from the hCMV IE2 promoter; and/or the upstream region and/or enhancer sequence is derived from the hCMV and/or sCMV IE2 enhancer.

    [0059] These and additional hCMV and/or sCMV sequences are well known in the art and can be easily derived from the hCMV and sCMV genomes deposited in the NCBI Viral Genomes database under accession nos. X17403.1 and U38308.1, respectively.

    [0060] In further preferred embodiments, the sequence of the upstream region comprises the nucleotide sequence of 452 bp in length, as shown in SEQ ID NO: 6, being derived from the sCMV IE1 enhancer region.

    TABLE-US-00004 1 gaccatagccaattcaatatggcgtatatggactcatgccaattcaatat 51 ggtggatctggacctgtgccaattcaatatggcgtatatggactcgtgcc 101 aattcaatatggtggatctggaccccagccaattcaatatggcggacttg 151 gcaccatgccaattcaatatggcggacctggcactgtgccaactggggag 201 gggtctacttggcacggtgccaagtttgaggaggggtcttggccctgtgc 251 caagtccgccatattgaattggcatggtgccaataatggcggccatattg 301 gctatatgccaggatcaatatataggcaatatccaatatggccctatgcc 351 aatatggctattggccaggttcaatactatgtattggccctatgccatat 401 agtattccatatatgggttttcctattgacgtagatagcccctcccaatg 451 gg

    [0061] In some of these preferred embodiments, the nucleic acid sequence of SEQ ID NO: 6 is an integral part of a longer sequence element being derived from the sCMV IE1 region (cf., e.g., SEQ ID NO: 11). In some other of these preferred embodiments, the sequence element being derived from the sCMV IE1 region has the sequence of SEQ ID NO: 6, which is present in combination with a further sequence element being derived from the hCMV IE1 region (cf., e.g., SEQ ID NO: 10).

    [0062] In particularly preferred embodiments, the chimeric promoter regulatory sequence comprises a nucleotide sequence being selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13.

    [0063] The chimeric promoter regulatory sequence according to SEQ ID NO: 7 (herein also referred to as construct 1) has a total length of 1074 bp and is composed of a 582 bp hCMV IE1 upstream and mCMV IE1 enhancer sequence (shown in italics) and a 492 bp mCMV IE1 promoter sequence (also shown as SEQ ID NO: 3).

    TABLE-US-00005 1 ctgcagtgaataataaaatgtgtgtttgtccgaaatacgcgttttgagat 51 ttctgtcgccgactaaattcatgtcgcgcgatagtggtgtttatcgccga 101 tagagatggcgatattggaaaaatcgatatttgaaaatatggcatattga 151 aaatgtcgccgatgtgagtttctgtgtaactgatatcgccatttttccaa 201 aagtgatttttgggcatacgcgatatctggcgatagcgcttatatcgttt 251 acgggggatggcgatagacgactttggtgacttgggcgattctgtgtgtc 301 gcaaatatcgcagtttcgatataggtgacagacgatatgaggctatatcg 351 ccgatagaggcgacatcaagctggcacatggccaatgcatatcgatctat 401 acattgaatcaatattggccattagccatattattcattggttatatagc 451 ataaatcaatattggctattggccattgcatacgttgtatccatatcata 501 atatgtacatttatattggctcatgtccaacattaccgccatgttgacat 551 tgattattgactagttattaatagtaatcaattactgagtcattagggac 601 tttccaatgggttttgcccagtacataaggtcaataggggtgaatcaaca 651 ggaaagtcccattggagccaagtacactgagtcaatagggactttccatt 701 gggttttgcccagtacaaaaggtcaatagggggtgagtcaatgggtttt 751 cccattattggcacgtacataaggtcaataggggtgagtcattgggtttt 801 tccagccaatttaattaaaacgccatgtactttcccaccattgacgtcaa 851 tgggctattgaaactaatgcaacgtgacctttaaacggtactttcccata 901 gctgattaatgggaaagtaccgttctcgagccaatacacgtcaatgggaa 951 gtgaaagggcagccaaaacgtaacaccgccccggttttcccctggaaatt 1001 ccatattggcacgcattctattggctgagctgcgttctacgtgggtataa 1051 gaggcgcgaccagcgtcggtaccg

    [0064] The chimeric promoter regulatory sequence according to SEQ ID NO: 8 (herein also referred to as construct 2) has a total length of 1128 pb and is composed of a 1026 bp sequence including the hCMV IE1 upstream sequence and the hCMV IE1 enhancer sequence (shown in italics) and a 102 bp mCMV IE1 core promoter sequence (also shown as SEQ ID NO: 4).

    TABLE-US-00006 1 ctgcagtgaataataaaatgtgtgtttgtccgaaatacgcgttttgagat 51 ttctgtcgccgactaaattcatgtcgcgcgatagtggtgtttatcgccga 101 tagagatggcgatattggaaaaatcgatatttgaaaatatggcatattga 151 aaatgtcgccgatgtgagtttctgtgtaactgatatcgccatttttccaa 201 aagtgatttttgggcatacgcgatatctggcgatagcgcttatatcgttt 251 acgggggatggcgatagacgactttggtgacttgggcgattctgtgtgtc 301 gcaaatatcgcagtttcgatataggtgacagacgatatgaggctatatcg 351 ccgatagaggcgacatcaagctggcacatggccaatgcatatcgatctat 401 acattgaatcaatattggccattagccatattattcattggttatatagc 451 ataaatcaatattggctattggccattgcatacgttgtatccatatcata 501 atatgtacatttatattggctcatgtccaacattaccgccatgttgacat 551 tgattattgactagttattaatagtaatcaattacggggtcattagttca 601 tagcccatatatggagttccgcgttacataacttacggtaaatggcccgc 651 ctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtat 701 gttcccatagtaacgccaatagggactttccattgacgtcaatgggtgga 751 gtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgc 801 caagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcat 851 tatgcccagtacatgaccttatgggactttcctacttggcagtacatcta 901 cgtattagtcatcgctattaccatggtgatgcggttttggcagtacatca 951 atgggcgtggatagcggtttgactcacggggatttccaagtctccacccc 1001 attgacgtcaatgggagtttgttttgacaccgccccggttttcccctgga 1051 aattccatattggcacgcattctattggctgagctgcgttctacgtgggt 1101 ataagaggcgcgaccagcgtcggtaccg

    [0065] The chimeric promoter regulatory sequence according to SEQ ID NO: 9 (herein also referred to as construct 3) has a total length of 509 pb and is composed of a 407 bp hCMV IE1 enhancer sequence (shown in italics) and a 102 bp mCMV IE1 core promoter sequence (also shown as SEQ ID NO: 4).

    TABLE-US-00007 1 cgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacga 51 cccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaa 101 tagggactttccattgacgtcaatgggtggagtatttacggtaaactgcc 151 cacttggcagtacatcaagtgtatcatatgccaagtacgccccctattga 201 cgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgacct 251 tatgggactttcctacttggcagtacatctacgtattagtcatcgctatt 301 accatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtt 351 tgactcacggggatttccaagtctccaccccattgacgtcaatgggagtt 401 tgttttgacaccgccccggttttcccctggaaattccatattggcacgca 451 ttctattggctgagctgcgttctacgtgggtataagaggcgcgaccagcg 501 tcggtaccg

    [0066] The chimeric promoter regulatory sequence according to SEQ ID NO: 10 (herein also referred to as construct 4) has a total length of 961 pb and is composed of a 452 bp sCMV IE1 upstream sequence (shown in bold; SEQ ID NO: 6), a 407 bp hCMV IE1 enhancer sequence (shown in italics) and a 102 bp mCMV IE1 core promoter sequence (also shown as SEQ ID NO: 4).

    TABLE-US-00008 1 gaccatagccaattcaatatggcgtatatggactcatgccaattcaatat 51 ggtggatctggacctgtgccaattcaatatggcgtatatggactcgtgcc 101 aattcaatatggtggatctggaccccagccaattcaatatggcggacttg 151 gcaccatgccaattcaatatggcggacctggcactgtgccaactggggag 201 gggtctacttggcacggtgccaagtttgaggaggggtcttggccctgtgc 251 caagtccgccatattgaattggcatggtgccaataatggcggccatattg 301 gctatatgccaggatcaatatataggcaatatccaatatggccctatgcc 351 aatatggctattggccaggttcaatactatgtattggccctatgccatat 401 agtattccatatatgggttttcctattgacgtagatagcccctcccaatg 451 ggcgcgttacataacttacggtaaatggcccgcctggctgaccgcccaac 501 gacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgcc 551 aatagggactttccattgacgtcaatgggtggagtatttacggtaaactg 601 cccacttggcagtacatcaagtgtatcatatgccaagtacgccccctatt 651 gacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgac 701 cttatgggactttcctacttggcagtacatctacgtattagtcatcgcta 751 ttaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcgg 801 tttgactcacggggatttccaagtctccaccccattgacgtcaatgggag 851 tttgttttgacaccgccccggttttcccctggaaattccatattggcacg 901 cattctattggctgagctgcgttctacgtgggtataagaggcgcgaccag 951 cgtcggtaccg

    [0067] The chimeric promoter regulatory sequence according to SEQ ID NO: 11 (herein also referred to as construct 5) has a total length of 909 bp and is composed of a 807 bp sequence including elements of the sCMV IE1 upstream region and the sCMV IE1 enhancer sequence (shown in bold; SEQ ID NO: 6 being underlined) and a 102 bp mCMV IE1 core promoter sequence (shown as SEQ ID NO: 4).

    TABLE-US-00009 1 gaccatagccaattcaatatggcgtatatggactcatgccaattcaatat 51 gatagatctggacctgtgccaattcaatatggcgtatatggactcgtgcc 101 aattcaatatggtggatctggaccccagccaattcaatatggcggacttg 151 gcaccatgccaattcaatatggcggacctggcactgtgccaactggggag 201 gggtctacttggcacggtgccaagtttgaggaggggtcttggccctgtgc 251 caagtccgccatattgaattggcatggtgccaataatggcggccatattg 301 gctatatgccaggatcaatatataggcaatatccaatatggccctatgcc 351 aatatggctattggccaggttcaatactatgtattggccctatgccatat 401 agtattccatatatgggttttcctattgacgtagatagcccctcccaatg 451 ggcggtcccatataccatatatggggcttcctaataccgcccatagccac 501 tcccccattgacgtcaatggtctctatatatggtctttcctattgacgtc 551 atatgggcggtcctattgacgtatatggcgcctcccccattgacgtcaat 601 tacggtaaatggcccgcctggctcaatgcccattgacgtcaataggacca 651 cccaccattgacgtcaatgggatggctcattgcccattcatatccgttct 701 cacgccccctattgacgtcaatgacggtaaatggcccacttggcagtaca 751 tcaatatctattaatagtaacttggcaagtacattactattggaagtacg 801 ccagggtacaccgccccggttttcccctggaaattccatattggcacgca 851 ttctattggctgagctgcgttctacgtgggtataagaggcgcgaccagcg 901 tcggtaccg

    [0068] The chimeric promoter regulatory sequence according to SEQ ID NO: 12 (herein also referred to as construct 6) has a total length of 976 bp and is composed of a 452 bp sCMV IE1 upstream region (shown in bold), a 407 bp hCMV IE1 enhancer sequence (shown in italics), and a 117 bp hCMV core promoter sequence (shown as SEQ ID NO: 5).

    TABLE-US-00010 1 gaccatagccaattcaatatggcgtatatggactcatgccaattcaatat 51 ggtggatctggacctgtgccaattcaatatggcgtatatggactcgtgcc 101 aattcaatatggtggatctggaccccagccaattcaatatggcggacttg 151 gcaccatgccaattcaatatggcggacctggcactgtgccaactggggag 201 gggtctacttggcacggtgccaagtttgaggaggggtcttggccctgtgc 251 caagtccgccatattgaattggcatggtgccaataatggcggccatattg 301 gctatatgccaggatcaatatataggcaatatccaatatggccctatgcc 351 aatatggctattggccaggttcaatactatgtattggccctatgccatat 401 agtattccatatatgggttttcctattgacgtagatagcccctcccaatg 451 ggcgcgttacataacttacggtaaatggcccgcctggctgaccgcccaac 501 gacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgcc 551 aatagggactttccattgacgtcaatgggtggagtatttacggtaaactg 601 cccacttggcagtacatcaagtgtatcatatgccaagtacgccccctatt 651 gacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgac 701 cttatgggactttcctacttggcagtacatctacgtattagtcatcgcta 751 ttaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcgg 801 tttgactcacggggatttccaagtctccaccccattgacgtcaatgggag 851 tttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaact 901 ccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctat 951 ataagcagagctcgtttagtgaaccg

    [0069] The chimeric promoter regulatory sequence according to SEQ ID NO: 13 (herein also referred to as construct 7) has a total length of 924 bp and is composed of a 807 bp sCMV IE1 upstream region and enhancer sequence (shown in bold; the portion also included in construct 4 being underlined) and a 117 bp hCMV core promoter (shown as SEQ ID NO: 5).

    TABLE-US-00011 1 gaccatagccaattcaatatggcgtatatggactcatgccaattcaatat 51 gatagatctggacctgtgccaattcaatatggcgtatatggactcgtgcc 101 aattcaatatggtggatctggaccccagccaattcaatatggcggacttg 151 gcaccatgccaattcaatatggcggacctggcactgtgccaactggggag 201 gggtctacttggcacggtgccaagtttgaggaggggtcttggccctgc 251 caagtccgccatattgaattggcatggtgccaataatggcggccatattg 301 gctatatgccaggatcaatatataggcaatatccaatatggccctatgcc 351 aatatggctattggccaggttcaatactatgtattggccctatgccatat 401 agtattccatatatgggttttcctattgacgtagatagcccctcccaatg 451 ggcggtcccatataccatatatggggcttcctaataccgcccatagccac 501 tcccccattgacgtcaatggtctctatatatggtctttcctattgacgtc 551 atatgggcggtcctattgacgtatatggcgcctcccccattgacgtcaat 601 tacggtaaatggcccgcctggctcaatgcccattgacgtcaataggacca 651 cccaccattgacgtcaatgggatggctcattgcccattcatatccgttct 701 cacgccccctattgacgtcaatgacggtaaatggcccacttggcagtaca 751 tcaatatctattaatagtaacttggcaagtacattactattggaagtacg 801 ccagggtgcaccaaaatcaacgggactttccaaaatgtcgtaacaactcc 851 gccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatat 901 aagcagagctcgtttagtgaaccg

    [0070] In specific embodiments, the chimeric promoter regulatory sequence is composed of a hCMV and/or sCMV IE2 upstream region and/or enhancer sequence and a mCMV IE2 promoter sequence. In other specific embodiments, the chimeric promoter regulatory sequence is composed of a hCMV and/or sCMV IE2 upstream region and/or enhancer sequence and a hCMV IE2 promoter sequence In yet other specific embodiments, the chimeric promoter regulatory sequence is composed of a hCMV and/or sCMV IE1 upstream region and/or enhancer sequence and a mCMV IE2 promoter sequence. In yet other specific embodiments, the chimeric promoter regulatory sequence is composed of a hCMV and/or sCMV IE1 upstream region and/or enhancer sequence and a hCMV IE2 promoter sequence. In yet other specific embodiments, the chimeric promoter regulatory sequence is composed of a hCMV and/or sCMV IE2 upstream region and/or enhancer sequence and a mCMV IE1 promoter sequence. In yet other specific embodiments, the chimeric promoter regulatory sequence is composed of a hCMV and/or sCMV IE2 upstream region and/or enhancer sequence and a hCMV IE1 promoter sequence.

    [0071] The 3-regulatory sequences of an expression cassette as defined herein typically encompass regulatory elements involved in transcriptional termination, polyadenylation, or the like. If, however, these termination sequences are not satisfactory functional in a particular host cell, then they may be substituted with signals functional in that cell.

    [0072] Further regulatory elements comprised in such an expression cassette include inter alia internal ribosome entry sites (IRES; allowing for the expression of polycistronic nucleic acid sequences) as well as translated signal sequences for targeting the native polypeptide to a specific compartment of a host cell. Exemplary signal sequences suitable for CHO cells are disclosed, for example, in WO 2008/148519 A2. The skilled person is also well aware of all these regulatory elements and how to select such elements suitable for the expression of a nucleic acid sequence in a particular cellular setting.

    [0073] The expression vector of the present invention may be, e.g., a plasmid, cosmid, phagemid, artificial chromosome, or another vehicle commonly used in genetic engineering.

    [0074] Such expression vectors typically include, aside from one or more expression cassettes encompassing the regulatory sequences described above, one or more multiple cloning sites in order to facilitate insertion and/or removal of nucleic acid sequences. The multiple cloning sites may be located upstream and downstream of the expression cassettes described above, thus allowing replacement of the entire cassette. Multiple cloning sites may also be located within such an expression cassette downstream of the promoter regulatory sequences and upstream of the 3-regulatory sequences, thus allowing insertion or replacement of a nucleic acid sequence to be expressed. For stable transfections (cf. below), the expression vectors may further comprise recognition sequences for site-specific integrases or recombinases in order to facilitate recombination and stable integration in the genome of the host cell.

    [0075] In addition, the expression vectors as defined herein typically comprise at least one origin of replication as well as control sequences derived from a species compatible with the host cell employed in order to ensure autonomous replication/episomal maintenance of the expression vector (in particular, for use in transient transfections; cf. below). Exemplary origins of replication in mammalian include the SV40 or and the EBV origin of replication. Specifically designed expression vectors (i.e. shuttle vectors) comprising more than one origin of replication allow the shuttling between different hosts, such as between bacterial and animal cells. Suitable origins of replication for prokaryotic cells include, for example, the ColE1 and M13 origins of replication.

    [0076] Furthermore, an expression vector as defined herein may comprise one or more selection markers conferring a selectable phenotype on transfected cells. Suitable selection markers include inter alia the hygromycin B phosphatase gene, the thymidine kinase gene, the ornithine decarboxylase gene, the dihydrofolate reductase gene, and the glutamine synthase gene. Preferably, the glutamine synthase (GS) gene is employed (Cockett, D. K. et al. (1990) Bio/Technology 8, 662-667; Bebbington, C. R. et al. (1992) Bio/Technology 10: 169-175;).

    [0077] Numerous methods that can be used to design and/or modify recombinant expression vectors are well established in the art (see, e.g., Sambrook, J., and Russel, D. W. (2001), Molecular cloning: A laboratory manual (3rd Ed.) Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al. (2001) Current Protocols in Molecular Biology, Wiley & Sons, Hoboken, N.J., USA). Large numbers of suitable mammalian expression vectors are also commercially available and well known to the skilled person who is also able to determine which vectors are suitable for expressing a nucleic acid molecule of interest in a given setting. Examples of such vectors include inter alia pcDNA3, pFRT, pTARGET, pSV2 dhfr as well as derivatives of the vectors pRY42 (SEQ ID NO: 1) and pRY57 (SEQ ID NO: 2) described herein below.

    [0078] The nucleic acid sequences to be expressed by employing the expression vectors of the invention may be monocistronic (i.e. encode a single polypeptide or protein including fusion proteins) or polycistronic (i.e. encode two or more individual polypeptides or proteins).

    [0079] In particular embodiments, the expression vector comprises a single (i.e. first) chimeric promoter regulatory sequence being operably linked to a (first) nucleic acid sequence to be expressed,

    [0080] In other particular embodiments, the expression vector further comprises a second chimeric promoter regulatory sequence being operably linked to a second nucleic acid sequence to be expressed, wherein the second chimeric promoter regulatory sequence is identical to the first chimeric promoter regulatory sequence. For example, the first and second chimeric promoter regulatory sequences are composed of an hCMV/sCMV IE1 upstream region and/or enhancer sequence in combination with a mCMV IE1 or hCMV IE1 promoter sequence.

    [0081] In alternative particular embodiments, the expression vector further comprises a second chimeric promoter regulatory sequence being operably linked to a second nucleic acid sequence to be expressed, wherein the second chimeric promoter regulatory sequence is different from the first chimeric promoter regulatory sequence. For example, the first chimeric promoter regulatory sequence is composed of an hCMV and/or sCMV IE2 upstream region and/or enhancer sequence and a mCMV IE2 or a hCMV IE2 promoter sequence, whereas the second chimeric promoter regulatory sequence is composed of an hCMV and/or sCMV IE1 upstream region and/or enhancer sequence and a mCMV IE1 or a hCMV IE1 promoter sequence.

    [0082] In specific embodiments, the expression vector comprises a third chimeric promoter regulatory sequence being operably linked to a third nucleic acid sequence to be expressed, wherein the third chimeric promoter regulatory sequence may be identical to the first and/or second promoter regulatory sequence or may be different from both the first and second chimeric promoter regulatory sequences. In further specific embodiments, the expression vector comprises more than three chimeric promoter regulatory sequences.

    [0083] The nucleic acid sequences to be expressed by employing the expression vectors of the present invention may encode any polypeptides or proteins of interest, in particular polypeptides or proteins having diagnostic or therapeutic applicability, such as inter alia growth factors, cytokines (interferons, interleukins), hormones, tyrosine kinases, receptors (GPCRs), integrins, transcription factors, blood clotting factors, single-chain antibodies, antibody fragments or antibody-like molecules (anticalins), and the like.

    [0084] In case of expression vectors as defined herein comprising two chimeric promoter regulatory sequences (as part of expression cassettes), the first and second nucleic acid sequences to be expressed encode different polypeptides (or proteins). In specific embodiments, the different polypeptides represent subunits of a dimeric or multimeric protein, such as inter alia homomeric or heteromeric receptor molecules, peptide hormones, DNA/RNA polymerases, hemoglobins, vaccines, and the like.

    [0085] In particularly preferable embodiments, the dimeric or multimeric protein is a classical antibody molecule comprising the light chain as the first subunit and the heavy chain as the second subunit. The antibody molecule may be a naturally occurring or a genetically engineered antibody, either a full-length antibody or a truncated variant thereof (such as Fab fragments, Fab fragments, F(ab).sub.2 fragments). IgG immunoglobulin antibodies are particularly preferred. Depending on the specific application, the antibody molecules may be chimeric (e.g., murine/human), humanized or fully human.

    [0086] In other embodiments employing expression vectors comprising two chimeric promoter regulatory sequences, the first and second nucleic acid sequence to be expressed encode a target protein to be analyzed and a corresponding reporter protein (such as green fluorescent protein, luciferase, alkaline phosphatase, -galactosidase, and horseradish peroxidase) for monitoring, e.g., cellular localization or functional activity of the target protein.

    [0087] When using two (or more) chimeric promoter regulatory sequences exhibiting different rates of gene expression it may be possible to produce certain molar ratios of the corresponding proteins of interest.

    [0088] In another aspect, the present invention relates to a mammalian host cell transfected with an expression vector as defined herein above.

    [0089] Suitable host cells include any type of mammalian cells, the cells being of human or non-human origin. Mammalian cells of non-human origin include inter alia cells derived from mouse, rat, hamster, rabbit, cat, dog, pig, cow, horse or monkey.

    [0090] Suitable mammalian host cells include immortalized cell lines such as human Hela, MRC5 fibroblasts, 983M melanoma, HEK293, H9, MCF7, and Jurkat cells; MOCK canine kidney cells; RF cultured rat lung fibroblasts isolated from Sprague-Dawley rats; murine NIH3T3, C127, P815 mastocytoma, MT1A2 mammary adenocarcinoma, and L cells; simian COS1 and COS? cells, quail QC1-3 cells; and Chinese hamster ovary (CHO) cells or cell lines.

    [0091] In preferred embodiments, the host cells employed are CHO cells or CHO cell lines.

    [0092] Suitable CHO cell lines include inter alia CHO KI (Tjio, J. T. and Puck, T. T. (1958) J. Exp. Med. 108, 945-955), CHO pro3, CHO DG44, CHO P12, dhfr-negative DUK-811 (Urlaub, G. and Chasin L. A. (1980) Proc. Natl. Acad. Sci. USA 77, 4216-4220), and particularly CHOK1SV (Lonza Ltd. Basel, Switzerland). CHOK1SV is a suspension, protein-free adapted CHOK1 derivative utilizing the glutamine synthetase (GS) gene expression system: positive transfectants were obtained under dual selection of methionine sulfoximine and glutamine-free media.

    [0093] All these host cells or cell lines may be obtained from depositories such as the American Type Culture Collection (Manassas, Va., USA) or the Deutsche Sammlung von Mikroorganismen and Zellkulturen (Braunschweig, Germany) as well as from various commercial suppliers. Also within the present invention are primary mammalian cells, that is, cells directly obtained from an organism (at any developmental stage including inter alia blastocytes, embryos, larval stages, and adults). Examples of suitable primary cells comprise cardiomyocytes, primary hepatocytes, fibroblasts, neuronal cells, as well as stem cells. Also within the present invention are immortalized stable cell lines derived from primary cells.

    [0094] In some embodiments, the host cell of the present invention constitutes a part of a multi-cellular organism. In other words, the invention also relates to transgenic mammalian organisms comprising at least one host cell as defined herein.

    [0095] Within the present invention, the expression vector introduced may be propagated and maintained in the host cell as an independent genetic unit (i.e. episomally) (herein also referred to as transient transfection) or vector fragments may become stably integrated into the host cell's genome (herein also referred to herein as stable transfection). Such recombination may either occur at random positions of the genome by non-homologous recombination or at specific positions of the genome by homologous recombination or via site-specific integrases. Preferably, the vector fragments (including the heterologous nucleic acid sequences to be expressed) become integrated in the host cell's genome as a single copy.

    [0096] For introducing the expression vectors as defined herein into a mammalian host cell any transfection technique may be employed that is appropriate for the particular cell type employed. Numerous transfection methods are well established in the art including inter alia electroporation, calcium phosphate co-precipitation, chemical transfection (e.g., cyclodextrin, DEAE-dextran, polyethylenimine), lipofection, magnetofection, and gene gun (see, e.g., Sambrook, J., and Russel, D. W. (2001), supra; Ausubel, F. M. et al. (2001), supra).

    [0097] In yet another aspect, the present invention relates to a method for heterologous expression of a nucleic acid sequence of interest in a mammalian host cell, comprising:

    (i) transfecting the mammalian host cell with an expression vector as defined herein above; and
    (ii) culturing the transfected mammalian host cell under conditions allowing the expression of the nucleic acid sequence of interest.

    [0098] In other words, the present invention is also directed to a process for the recombinant (i.e. heterologous) production of polypeptides or proteins of interest in mammalian host cells being transfected with an expression vector as defined herein that comprise the corresponding nucleic acid sequences encoding said polypeptides or proteins. Transfection can be performed with a single expression vector or, as a co-transfection, with two or more different expression vectors.

    [0099] As already outlined above, numerous methods are available for the transient or stable transfection of mammalian host cell. In preferred embodiments, the transfection is stable transfection in order to establish cells or cell lines the continuously express the heterologous nucleic acid sequences encoding the polypeptides or proteins of interest.

    [0100] In some embodiments, the method further comprises the step of harvesting (and optionally purifying) the recombinant polypeptides or proteins produced. Depending on the nature of said polypeptides or protein they may become secreted into the cell culture supernatant, integrated in membrane of the host cell, or remain in an intracellular compartment.

    [0101] Typically, if a unicellular mammalian host cell is employed the person skilled in the art can revert to a variety of cell culture conditions which allow the expression of the nucleic acid sequence of interest. Conveniently, the polypeptides or proteins produced are harvested (and optionally purified) from the culture medium, lysates or extracts of the cultured cells or from isolated (biological) membranes by established techniques, such as inter alia fractionated precipitation with salts or organic solvents, ion exchange chromatography, gel chromatography, size exclusion chromatography, HPLC, affinity chromatography (see, e.g., Sambrook, J., and Russel, D. W. (2001), supra). In case, the host cell is part of a multi-cellular organism, a fraction of these cells may serve as source for isolating the peptide of the invention.

    [0102] Appropriate culture media and conditions for the above-described host cells are well known in the art (cf., e.g., Fresney, R. I. (2000) Culture of Animal cells. A manual (4th Ed.) Wley-Liss, New York). Depending on the specific growth requirements of the host cell employed, mammalian cell culture can be performed, e.g., in RPMI 1640 medium, Ham's F12 medium or DMEM (Dulbecco's Modified Eagle Medium). Alternatively, a growth medium with a reduced serum concentration, such as OptiMEM, may be used. The media may optionally be supplemented with 10% (v/v) FCS (fetal calf serum), various growth factors, amino acids, antibiotics, and other additives Cell culture media specially adapted for CHO cells are described in, e.g., EP 0 481 791 81 and EP 1 525 320 81. The transfected mammalian host cells may be incubated at 37 C. in a 5% CO.sub.2, water saturated atmosphere. The respective growth media, kits, and reagents are commercially available from various suppliers.

    [0103] In a further aspect, the present invention relates to the use of an expression vector as defined herein above for the heterologous expression of a nucleic acid sequence of interest in a mammalian host cell. Preferably, the nucleic acid sequence of interest may encode a polypeptide or protein intended for diagnostic or therapeutic applications.

    [0104] In preferred embodiments, the expression vector is used for the concomitant expression of two or more nucleic acid sequences of interest that are inserted into the expression vector under the control of separate chimeric promoter regulatory sequences. For example, an expression vector may be used for the expression of a gene of interest along with a reporter gene for monitoring cellular targeting and/or functionality of the gene of interest.

    [0105] Particularly preferably, the expression vector is used for the concomitant expression of two or more nucleic acids sequences of interest that encode subunits of a dimeric or multimeric protein, for example, light and heavy chains of an antibody molecule or subunits of a vaccine. By employing different chimeric promoter regulatory sequences resulting in different gene expression rates an expression vector as defined herein may be used for the expression of two or more nucleic acid sequences of interest in a particular (molar) ratio.

    [0106] In a specific embodiment, the expression vectors as defined herein are used as medicaments (or as parts of a medicament or kit-of-parts) for gene therapy.

    [0107] The invention is further described by the figures and the following examples, which are solely for the purpose of illustrating specific embodiments of this invention, and are not to be construed as limiting the scope of the invention in any way.

    EXAMPLES

    Rationale:

    [0108] Seven different chimeric promoter regulatory sequences, as specified in the claims, were generated based on sequences from the murine, human and simian cytomegalovirus (mCMV, hCMV, and sCMV) genomes (see Table 1, FIG. 3). These constructs were analyzed for their efficacy in controlling heterologous gene expression of the light and heavy chains (LC and HC) of a monoclonal antibody in Chinese hamster ovary (CHO) cells.

    Example 1: Vector Construction

    [0109] Gene synthesis was used to generate the seven different chimeric promoter regulatory constructs employed herein (i.e. constructs 1-7). The constructs were provided ready for cloning into the empty targeting vector pRY42 (cf. FIG. 1, SEQ ID NO: 1), in order to replace the original murine cytomegalovirus (mCMV) promoters (SEQ ID NO: 3) contained therein. Parent vector pRY42 comprises two expression cassettes, each under the control of a promoter regulatory sequence (originally derived from mCMV).

    [0110] The chimeric constructs (cf. Table 1, FIG. 3, SEQ ID NO: 7 to SEQ ID NO: 13) were synthesized to include additional DNA sequences at the 5 and 3 ends flanking the promoter regulatory sequences, thus allowing for the incorporation of endonuclease restriction sites (i.e. also present in pRY42) in order to facilitate exchange of nucleic acid fragments.

    [0111] Table 1 illustrates the various sequence elements comprised in the chimeric promoter regulatory constructs 1-7 employed herein. Shown are the respective lengths and genetic locations of the individual regulatory sequences, as indicated in the NCBI Viral Genomes database (http://www.ncbi.nlm.nih.gov/genomes/GenomesHome; Bao, Y. et al. (2004) J. Virol. 78, 7291-7298). Notably, all mCMV or hCMV promoter sequences employed herein include at their 3-end an additional guanosine (G) nucleotide, which represents the transcriptional start site.

    TABLE-US-00012 NCBI viral NCBI viral sCMV genome hCMV genome Construct length accession no. Coordinates length accession no. Coordinates 1 582 X17403.1 174272-174873 2 1026 X17403.1 173848-174873 3 407 X17403.1 173848-174254 4 452 U38308.1 3873-4324 407 X17403.1 173848-174254 5 807 U38308.1 3873-4679 6 452 U38308.1 3873-4324 524 X17403.1 173731-174254 7 807 U38308.1 3873-4679 117 X17403.1 173731-173847 NCBI viral mCMV genome Construct length accession no. Coordinates 1 492 U68299.1 182895-183386 2 102 U68299.1 182895-182996 3 102 U68299.1 182895-182996 4 102 U68299.1 182895-182996 5 102 U68299.1 182895-182996

    [0112] The new vectors comprising chimeric constructs 1-7 were each constructed by a four way ligation reaction according to the scheme illustrated in Table 2. The chimeric promoter regulatory sequence for expression of the antibody light chain nucleic acid sequence was inserted 3 (i.e. downstream) of the mutated FRT (Flippase Recognition Target) site (F5-mFRT) of pRY42, followed by an inter-chain fragment and the chimeric promoter regulatory sequence for expression of the antibody heavy chain nucleic acid sequence.

    [0113] Ligation reactions were performed using the Rapid DNA Ligation Kit (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer's instructions. The resulting plasmid vectors were transformed int DH5 E. coli competent cells (Invitrogen/Life Technologies GmbH; Darmstadt, Germany). Samples were plated onto Luria-Bertani (LB) agar supplemented with 50 g/ml ampicillin and incubated over-night at 37 CC. Single colonies were used to inoculate 500 ml shake flasks containing 200 ml LB liquid media plus 50 g/ml ampicillin. Flasks were incubated over-night in a shaking incubator at 37 C., 200 rpm. Resultant cultures were used for preparation of plasmid DNA using a Nucleobond Maxi Kit (Macherey-Nagel GmbH, Duren, Germany) according to the manufacturer's instructions. Plasmids produced were verified by diagnostic restriction digest.

    [0114] Table 2 shows the cloning scheme for generating chimeric promoter regulatory sequence constructs 1-5.

    TABLE-US-00013 Inter-chain Vector LC fragment HC backbone regulatory (derived from regulatory (derived from Construct element pRY42) element pRY42) 1 AatlI-PacI PacI-EcoRI EcoRI-XhoI XhoI-AatlI 2 PvuI-SaclI SaclI-EcoRI EcoRI-Bsu36I Bsu36I-PvuI 3 SspI-SaclI SaclI-EcoRI EcoRI-Bsu36I Bsu36I-SspI 4 SspI-SaclI SaclI-EcoRI EcoRI-Bsu36I Bsu36I-SspI 5 SspI-SaclI SaclI-EcoRI EcoRI-Bsu36I Bsu36I-SspI 6 SspI-SaclI SaclI-EcoRI EcoRI-Bsu36I Bsu36I-SspI 7 SspI-SaclI SaclI-EcoRI EcoRI-Bsu36I Bsu36I-SspI

    [0115] In a subsequent step, the LC and HC of IgG4 monoclonal antibody cB72.3 (Whittle, N. et al. (1987) Protein Eng. 1, 499-505) were cloned into each of the seven vectors comprising chimeric constructs 1-7. The nucleic acid sequences encoding the antibody chains were derived from vector pRY57 (FIG. 2, SEQ ID NO: 2) as EcoRI/HindIII (LC) and BamHI/NruI (HC) restriction fragments and cloned sequentially into the vectors for each promoter construct, using the same restriction endonucleases. Methods used were as described above. The resulting plasmid vectors were verified by diagnostic restriction digest and DNA sequencing of promoter regions, respectively.

    Example 2: Transfection and Cell Line Construction

    [0116] A cell line derived from suspension adapted Chinese hamster ovary cell line CHOK1SV was used for all experiments (Lonza Ltd., Basel, Switzerland). In this cell line, nucleic acid expression constructs are inserted at a specific genomic locus of the host cell and in defined copy number by means of a site-specific integration (SSI) system.

    [0117] Positive selection for integration is accomplished by functional restoration of a hygromycin B resistance cassette present at the SSI site. Integration of the expression construct into the host genome also removes a copy of the thymidine kinase gene, which converts the pro-drug ganciclovir into a toxic, phosphorylated nucleotide analogue. Thus, addition of hygromycin B and ganciclovir during cell line construction provides positive and negative selection pressures, respectively, for integration at the target genomic locus.

    [0118] The host cell line was revived from cryopreserved vials and sub-cultured. All cell culture was performed in CD-CHO medium (Invitrogen/Life Technologies GmbH; Darmstadt, Germany). 48 h prior to transfection, cells were seeded in 30 ml CD-CHO medium, at a final concentration of 0.310.sup.6 cells/ml.

    [0119] On the day of transfection, 1.210.sup.7 cells were pelleted and re-suspended in 1 ml CD-CHO before co-transfection with 45 g of pOG44 plasmid (Invitrogen/Life Technologies GmbH; Darmstadt, Germany) and 5 g of each targeting vector (comprising chimeric constructs 1-7, respectively) was performed using electroporation in a 0.4 cm Bio-Rad GenePulser Xcell cuvette (single pulse 300 V I 900 F, time constant 12-16 msec). The pOG44 plasmid encompasses an expression cassette for the yeast FLP recombinase (flippase) required to facilitate recombination at the FRT sites present at the target locus. All transfection experiments were performed at least in duplicate.

    [0120] Each electroporation sample was transferred to 20 ml of CD-CHO medium in a T75 flask (BD Biosciences, Heidelberg, Germany) and incubated in static mode at 36.5 C., in a humidified incubator (5% (v/v) CO.sub.2 in air). 48 h post-transfection cells were pelleted (150g, 5 min) and re-suspended in 20 ml of CD-CHO medium containing 200 g/ml hygromycin B (positive selection). The culture was maintained in static mode and after 72 h the medium exchanged with fresh CD-CHO containing 200 g/ml hygromycin B.

    [0121] Subsequently, every 72 h the viable cell concentration was determined and the medium exchanged with 20 ml fresh CD-CHO containing 200 g/ml hygromycin B and 3 M ganciclovir (negative selection). Once the culture in the T75 flask reached a total cell concentration of 910.sup.6 cells/ml, the culture was adjusted to a final volume of 30 ml CD-CHO containing 200 g/ml hygromycin B and 3 M ganciclovir. Each diluted culture was then transferred to an E125 shake flask.

    Example 3: Fed Batch Overgrow (FOG) Suspension Culture for Determining the Concentration of Monoclonal Antibody Produced by Using Promoter Constructs 1-5

    [0122] Fed batch overgrow (FOG) shake flask analysis was performed as described in international patent publication WO 2008/148519 A2. All FOG experiments for a given transfected cell suspension culture were performed at least in duplicate.

    [0123] In brief, transfected cells were seeded at a concentration of 210.sup.5 cells/ml in 250 ml shake flasks, each containing 50 ml of CM42/SPE growth medium (Lonza Ltd., Basel, Switzerland) and incubated at 37 C. in a humidified orbital shaking incubator (5% (v/v) C0.sub.2 in air) at 140 rpm. Cells were fed, starting on day 3 of the culture, with a feed consisting of mixture of amino acids and trace elements. Daily viabilities and viable cell concentrations were determined using a Cedex Automated Cell Viability Analyzer (Roche Diagnostics GmbH, Mannheim, Germany). Antibody concentration in the medium was determined by Protein A-HPLC on day 15 of culture (harvest of the overgrown cultures).

    Example 4: Determination of the Concentration of Monoclonal Antibody Produced by Means of Protein A-HPLC (Using Promoter Constructs 1-5)

    [0124] The concentrations of the cB72.3 IgG4 monoclonal antibody (mAb) produced by the respective cell lines harboring the LC/HC gene expression cassettes under the control of the different chimeric constructs 1-5 and secreted to the cell culture medium were determined by Protein A-high performance liquid chromatography (HPLC). Cell-free supernatants (passed through a 0.22 m filter unit) were loaded onto a POROS Protein A Immunodetection Column (applied Biosystems Inc., Foster City, Ca, USA), connected to an Agilent 1200 HPLC. The column was washed and bound mAb was eluted by lowering the pH of the solvent.

    [0125] The concentration of the mAb was determined by comparison to a standard curve generated with serial dilutions of MabSelect SuRe-purified (GE Healthcare GmbH, Freiburg, Germany) cB72.3 IgG4 (range of standard curve: 1025 ng/l to 200 ng/l).

    [0126] The results of the above experiments are summarized in Table 3 and FIG. 4, respectively: for each of chimeric constructs employed herein, n=4, representing duplicate FOG analyses for duplicate transfections, with the exception of construct 4, where n=6 (duplicate FOG analyses for triplicate transfections) and pRY57 (original mCMV), where n=8, with data points from experiments 1 and 2 being combined. The calculations of cell culture parameters were performed as described previously (Porter et al. (2010) Biotechnol. Progr. 26, 1446-1454).

    [0127] From FIG. 4, it is evident that at the day of culture harvest (i.e. day 15), the use of any one of chimeric constructs no. 2-5 resulted in the production of higher antibody concentrations than with the use of the original mCMV promoter sequence (i.e. vector pRY57). The use of chimeric construct no. 1 also resulted in a higher antibody concentration than with the mCMV promoter (a factor of 1.31), even though the result does not reach statistical significance.

    [0128] The best results were obtained with chimeric construct no. 4 resulting in an about 2.88 times higher gene expression as compared to the mCMV promoter, followed by (in descending order) chimeric construct no. 5 (factor of about 2.54), chimeric construct no. 2 (factor of about 1.80), and chimeric construct no. 3 (factor of about 1.45).

    [0129] Table 3 illustrates the growth rates and the amounts of mAb produced by the different transfected host cell lines employed herein (comprising chimeric promoter regulatory sequences/constructs 1-5).

    TABLE-US-00014 Max. (10.sup.6 IVC (10.sup.6 [mAb] Transfectant pool/FOG cells/ml (1/h) cells .Math. h/ml P (mg/l) Experiment 1 mCMV 9.36 1.02 0.0183 0.0018 1523.35 164.78 0.29 0.02 439.74 23.51 Construct 1 8.5 0.75 0.0206 0.0013 1445.11 70.55 0.46 0.07 638.87 110.18 Construct 2 7.97 0.41 0.0198 0.0008 1409.29 87.92 0.71 0.06 883.10 109.78 Construct 3 11.17 1.02 0.0191 0.0009 1873.58 250.14 0.40 0.03 707.98 80.28 Experiment 2 mCMV 9.29 0.82 0.0143 104.97 1790.34 104.97 0.29 0.05 539.31 76.24 Construct 4 10.39 0.90 0.0165 0.0023 1848.05 306.29 0.73 0.22 1408.44 337.47 Construct 5 11.58 0.46 0.0139 0.0028 2261.28 50.84 0.46 0.03 1244.15 74.90 Legend: Max.maximal viable cell concentration (10.sup.6 cells/ml); specific growth rate (1/h); IVGtime integral of viable cell concentration (10.sup.6 cells .Math. h/ml); Pspecific production rate of the mAb (pg/cell .Math. h); and [mAb]concentration of the mAb produced at harvest (mg/l).

    [0130] The above data show that the use of chimeric promoter regulatory sequences comprising sCMV and/or hCMV upstream region and/or enhancer elements in combination with mCMV promoter elements represent superior genetic tools for obtaining highly efficient heterologous gene expression systems for mammalian cells.

    Example 5: Batch Overgrow (BOG) Suspension Culture for Determining the Concentration of Monoclonal Antibody Produced by Using Promoter Constructs 6-7

    [0131] Batch cultures were performed in vented E125 flasks containing 30 ml CD-CHO in suspension mode (Kuhner 4 tier incubator, 36.5 C., 5% CO.sub.2 in air (v/v) and 85% humidity (v/v)). In brief, transfected cells were seeded at a concentration of 210.sup.5 cells/ml and viable cell concentrations were monitored throughout culture. Medium samples were taken at day seven of culture (high culture viability) for determination of the concentration of cB72.3 in medium using Protein A HPLC. All BOG experiments for a given transfected cell suspension culture were performed at least in duplicate.

    Example 6: Determination of the Concentration of Monoclonal Antibody Produced by Means of Protein A-HPLC (Using Promoter Constructs 6-7)

    [0132] The concentrations of the cB72.3 IgG4 monoclonal antibody (mAb) produced by the respective cell lines harboring the LC/HG gene expression cassettes under the control of the different chimeric constructs 6-7 and secreted to the cell culture medium were determined by Protein A-high performance liquid chromatography (HPLC). Cell-free supernatants (passed through a 0.22 m filter unit) were loaded onto a POROS Protein A Immunodetection Column (applied Biosystems Inc., Foster City, Ca, USA), connected to an Agilent 1100 HPLC. The column was washed and bound mAb was eluted by lowering the pH of the solvent.

    [0133] The concentration of the mAb was determined by comparison to a standard curve generated with serial dilutions of MabSelect SuRe-purified (GE Healthcare GmbH, Freiburg, Germany) cB72.3 IgG4 (range of standard curve: 1025 ng/l to 64 ng/l).

    [0134] The results of the above experiments are summarized in FIG. 5: For mCMV and construct 7, n=6 (duplicate batch analysis for triplicate transfections), and for construct 6, n=4 (duplicate batch analysis for duplicate transfections).

    [0135] From FIG. 5, it is evident that at day 7 of culture the use of any one of chimeric constructs 6 and 7 resulted in the production of higher antibody concentrations than with the use of the original mCMV promoter sequence (i.e. vector pRY57).

    [0136] The best results were obtained with chimeric promoter construct 6 resulting in about 2.27 times higher mAb productivities as compared to the mCMV promoter.

    [0137] The above data show that the use of chimeric promoter regulatory sequences comprising sCMV and/or hCMV upstream region and/or enhancer elements in combination with hCMV core promoter elements represent superior genetic tools for obtaining highly efficient heterologous gene expression systems for mammalian cells.

    [0138] The present invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms comprising, including, containing, etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by embodiments and optional features, modifications and variations of the inventions embodied therein may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.

    [0139] The invention has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

    [0140] Other embodiments are within the following claims. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.