METHODS AND COMPOSITIONS FOR IMAGING AMYLOID DEPOSITS
20200002410 ยท 2020-01-02
Inventors
Cpc classification
A61B5/055
HUMAN NECESSITIES
C07K2317/51
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
C07K2317/24
CHEMISTRY; METALLURGY
International classification
Abstract
Methods and diagnostic compositions for detection of amyloid deposits using a chimeric (e.g., mouse-human) antibody or antigen-binding fragment thereof linked to a detectable label are disclosed.
Claims
1. An in vivo method of detecting the presence, location and/or quantity of amyloid deposits in a patient suspected of having amyloid deposits which comprises administering to the patient an antibody or antigen binding fragment having a detectable molecule linked thereto, the antibody or antigen-binding fragment comprising: a variable heavy chain (V.sub.H) comprising: a complementarity determining region (CDR) H1 comprising SEQ ID NO: 53; a CDRH2 comprising SEQ ID NO: 53; and a CDRH3 comprising SEQ ID NO: 54; and a variable light chain (V.sub.K) comprising a CDRL1 comprising SEQ ID NO: 49; a CDRL2 comprising SEQ ID NO: 50; and a CDRL3 comprising SEQ ID NO: 51; and detecting the presence, location, and/or quantity of amyloid deposits by detecting the detectable label bound to the amyloid deposits by diagnostic imaging.
2. The method of claim 1 wherein the antibody or antigen binding fragment comprises a chimeric mouse-human antibody which comprises a V.sub.K region comprising SEQ ID NO: 47 and a V.sub.H region comprising SEQ ID NO: 48.
3. The method of claim 1 wherein the method of detection is positron emission spectroscopy (PET).
4. The method of claim 3, wherein the detectable label is .sup.124I.
5. The method of claim 3, wherein the detectable label is .sup.89Zr.
6. The method of claim 4 wherein the antibody is chimeric 11-1F4. The method of claim 5 wherein the antibody is chimeric 11-1F4.
7. The method of claim 4 wherein the antibody is CAEL-101.
8. The method of claim 5 wherein the antibody is CAEL-101.
9. The method of claim 1, wherein the amyloid deposits are in the heart.
10. A composition for detecting the presence, location, and/or quantity of amyloid deposits in a subject which comprises an antibody or antigen binding fragment having a detectable molecule linked thereto, the antibody or antigen-binding fragment comprising: a variable heavy chain (V.sub.H) comprising: a complementarity determining region (CDR) H1 comprising SEQ ID NO: 53; a CDRH2 comprising SEQ ID NO: 53; and a CDRH3 comprising SEQ ID NO: 54; and a variable light chain (V.sub.K) comprising a CDRL1 comprising SEQ ID NO: 49; a CDRL2 comprising SEQ ID NO: 50; and a CDRL3 comprising SEQ ID NO: 51.
11. The composition of claim 10, wherein the antibody or antigen binding fragment comprises a chimeric mouse-human antibody which comprises a V.sub.K region comprising SEQ ID NO: 47 and a V.sub.H region comprising SEQ ID NO: 48.
12. The composition of claim 11, wherein the detectable molecule is .sup.124I.
13. The composition of claim 11, wherein the detectable molecule is .sup.89Zr.
14. The composition of claim 12 wherein the antibody is chimeric 11-1F4.
15. The composition of claim 13 wherein the antibody is chimeric 11-1F4.
16. The composition of claim 12 wherein the antibody is CAEL-101.
17. The composition of claim 13 wherein the antibody is CAEL-101.
18. The composition of claim 11 wherein the amyloid deposits are in the heart.
19. A method of monitoring disease progression in a patient diagnosed with an amyloid deposition disease and having amyloid deposits comprising the steps of: a. administering to said patient the composition of claim 10 and conducting diagnostic imaging on the patient to detect the amount of detectable molecule bound to the amyloid deposits, b. treating the patient with a therapy intended to remove amyloid deposits, c. administering to said patient the composition of claim 10, d. conducting diagnostic imaging on the patient to detect the amount of detectable molecule bound to the amyloid deposits, and e. comparing the detected amount of detectable molecule in step d to the detected amount of detectable molecule in step a.
20. The method of claim 18, wherein the patient is treated with humanized or chimeric 11-1F4 antibody or antigen-binding fragment thereof
21. The method of claim 19 wherein the composition is the composition of claim 11.
22. The method of claim 20, wherein the method of detection is PET.
23. The method of claim 21 wherein the detectable label is .sup.124I.
24. The method of claim 21, wherein the detectable label is .sup.89Zr.
25. The method of claim 22 wherein the antibody is chimeric 11-1F4.
26. The method of claim 23 wherein the antibody is chimeric 11-1F4.
27. The method of claim 22 wherein the antibody is CAEL-101.
28. The method of claim 23 wherein the antibody is CAEL-101.
29. The method of claim 23 wherein the amyloid deposits are in the heart.
30. A method of determining the effectiveness of treatment to remove amyloid deposits in a patient comprising a) treating the patient with a therapeutically-effective dose of the chimeric 11-F4 antibody or antigen-binding fragment thereof, b) administering to the patient a diagnostically-effective amount of the diagnostic composition of claim 10, and c) measuring by diagnostic imaging the amount of detectable molecule from the diagnostic composition in the lymph nodes of the patient, wherein the higher the amount of detectable molecule detected in the lymph nodes, the more effective the treatment.
31. The method of claim 31, wherein the amyloid deposits are in the heart.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
DETAILED DESCRIPTION OF THE INVENTION
[0044] In accordance with the present disclosure, compositions comprising humanized antibodies, chimeric antibodies (e.g., mouse-human antibodies) or antigen-binding fragments thereof to which in each case is linked a detectable molecule are provided that are useful for detecting the presence, location, and amount of amyloid deposits in vivo. These compositions allow detection, localization, and/or quantification of amyloid deposits while producing little or no human anti-mouse antibody (HAMA) reaction. The disclosure provides compositions comprising at least one of said antibodies or antibody fragments linked to a detectable marker and a pharmaceutically acceptable carrier and methods of detecting the location and amount of amyloid deposits by administering to a patent an amount of said marker-linked antibody or antibody fragment effective to allow detection of amyloid deposits if such deposits are present and detecting the presence, amount, and/or location of the detectable marker bound to the amyloid deposits by diagnostic imaging.
[0045] Further in accordance with the present disclosure, methods are provided for monitoring or determining the effect of treating amyloid deposition diseases. The method of monitoring disease progression in a patient diagnosed with an amyloid deposition disease and having amyloid deposits comprises the steps of: [0046] a. administering to said patient a diagnostically effective amount of a humanized or chimeric 11-1F4 antibody or an antigen-binding fragment thereof having a detectable molecule linked thereto and detecting the amount of detectable molecule bound to the amyloid deposits, [0047] b. treating the patient with therapy intended to remove amyloid deposits, such as a humanized or chimeric 11-1F4 antibody or antigen-binding fragment thereof, [0048] c. administering to said patient a diagnostically effective amount of a humanized or chimeric 11-1F4 antibody or an antigen-binding fragment thereof having a detectable molecule linked thereto and detecting the amount of detectable molecule bound to the amyloid deposits, and [0049] d. comparing the detected amount of detectable molecule in step c to the detected amount of detectable molecule in step a.
[0050] In this embodiment, the present disclosure is directed towards measuring the extent of change in the amount of amyloid deposits of a patient (if any) by administering to said patient the marker-linked antibody or antibody fragment as described herein both prior to and after a treatment intended to remove amyloid deposits and measuring the difference in the size and extent of the detected amyloid deposits after the treatment compared to the size and extent measured prior to the treatment.
[0051] Further provided is an in vivo method of detecting amyloid deposits in a subject, the method comprising: a) administering to the subject a composition comprising one or more than one antibody or antigen-binding fragment thereof as described herein linked to a detectable molecule; and b) detecting by diagnostic imaging the detectable agent linked to the antibody or antigen-binding fragment thereof bound to the amyloid deposits.
[0052] In the method described above, the step of detecting (step b) may be performed using PET (positron emission tomography), SPECT (single-photon emission computed tomography), MRI, fluorescence imaging, or any other suitable diagnostic imaging method. PET is the preferred imaging method. The use of PET for imaging tumors or other deposits using a detectable molecule is well known. This preparation of diagnostic imaging agents and their use in PET are described, for example, in Bailly, et al.Int. J. Mol. Sci. 2017, 18, 57; Boerman, et al.J Nucl Med, 2011; 52:1171-1172; and Mayer, et al.J Nucl Med 2017; 58:538-546, all of which are incorporated herein by reference in their entirety. Although these references are directed mainly at cancerous tumor detection, the materials and methods disclosed therein are equally useful for detecting amyloid deposits.
[0053] The in vivo imaging step in the methods described above may be whole body imaging for diagnostic purposes or local imaging at specific sites, such as but not limited to heart, kidney, liver, spleen, nervous system, or digestive system in a quantitative manner to assess the progression of disease or patient response to a treatment regimen. The detection step in the methods as described above may be any diagnostic imaging technology including, but not limited to: positron emission tomography (PET), wherein the detectable agent is an isotope such as .sup.11C, .sup.13N, .sup.15O, .sup.18F, .sup.64Cu, .sup.62Cu, .sup.124I, .sup.76Br, .sup.82Rb, .sup.89Zr, or .sup.68Ga; single photon emission computed tomography (SPECT), wherein the detectable agent is a radiotracer such as .sup.99mTc, .sup.111In, .sup.123I, .sup.201Tl, or .sup.133Xe, depending on the specific application; magnetic resonance imaging (MRI), wherein the detectable agent may be, for example and not limited to, gadolinium, iron oxide nanoparticles and carbon-coated iron-cobalt nanoparticles. In illustrative examples herein, antibodies are labeled with .sup.124I or .sup.89Zr.
[0054] The detectable molecule (sometimes described herein as a label, marker, or agent) as described herein may be linked, also sometimes referred to herein as conjugated, to the antibody or fragment thereof by any suitable method known in the art. For example, and without wishing to be limiting, the detectable agent may be linked to the antibody or antibody fragment by a covalent bond or ionic interaction. The linkage may be achieved through a chemical cross-linking reaction, or through fusion using recombinant DNA methodology combined with any peptide expression system, such as bacteria, yeast or mammalian cell-based systems. Methods for linking an antibody or fragment thereof to a detectable agent are well-known to a person of skill in the art, as shown in the references cited above.
[0055] Further provided herein is a method of determining the appropriate dosage of the disclosed humanized or chimeric antibody for therapy based on the affinity of the diagnostic compositions for the amyloid deposits as determined by the uptake of the diagnostic composition by the amyloid deposits of the patient. That is, one may determine the dosing of a patient based on the detected uptake of the labeled antibody or antibody fragment. A patient showing higher uptake of the labeled antibody or antibody fragment may require a smaller amount of therapeutic antibody or antibody fragment than a patient showing a lower uptake of the labeled antibody or antibody fragment. The present disclosure therefore provides a method of determining the appropriate dosage of the disclosed humanized or chimeric antibody for therapy comprising the steps of administering to the patient a labeled antibody or antibody fragment disclosed herein, determining the uptake of the labeled antibody or antibody fragment by the amyloid deposits, and administering a dose or series of doses of chimeric or humanized antibody or antibody fragment based on the detected amount of uptake.
[0056] Further provided herein is a method of determining the effectiveness of a treatment with the chimeric or humanized antibody or antibody fragment disclosed herein to remove amyloid deposits. The method comprises: a) treating the patient with a therapeutically-effective dose of a therapy intended to remove amyloid deposits, such as the chimeric or humanized antibody or antibody fragment disclosed herein, b) administering to the patient a diagnostically-effective amount of the diagnostic composition disclosed herein, and c) measuring the amount of detectable molecule from the diagnostic composition in the lymph nodes of the patient, wherein the higher the amount of detectable molecule detected in the lymph nodes, the more effective the treatment.
Definitions
[0057] It is to be understood that methods are not limited to the particular embodiments described, and as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. The scope of the present technology will be limited only by the appended claims.
[0058] As used herein, certain terms may have the following defined meanings. As used in the specification and claims, the singular form a, an and the include singular and plural references unless the context clearly dictates otherwise. For example, the term a cell includes a single cell as well as a plurality of cells, including mixtures thereof.
[0059] As used herein, the term comprising is intended to mean that the compositions and methods include the recited elements, but not excluding others. Consisting essentially of when used to define compositions and methods, shall mean excluding other elements of any essential significance to the composition or method. Consisting of shall mean excluding more than trace elements of other ingredients for claimed compositions and substantial method steps. Embodiments defined by each of these transition terms are within the scope of this disclosure. Accordingly, it is intended that the methods and compositions can include additional steps and components (comprising) or alternatively including steps and compositions of no significance (consisting essentially of) or alternatively, intending only the stated method steps or compositions (consisting of).
[0060] As used herein, about means plus or minus 10%.
[0061] As used herein, optional or optionally means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
[0062] As used herein, the terms individual, patient, or subject can be an individual organism, a vertebrate, a mammal (e.g., a bovine, a canine, a feline, or an equine), or a human. In a preferred embodiment, the individual, patient, or subject is a human.
[0063] As used herein, the term an isolated antibody is intended to refer to an antibody which is substantially free of other antibodies having different antigenic specificities (e.g., an isolated antibody that specifically binds to an amyloid fibril is substantially free of antibodies that do not bind to amyloid fibrils). An isolated antibody that specifically binds to an epitope of an amyloid light chain fibril (e.g., a kappa and/or lambda fibril) may, however, have cross-reactivity to other proteins, such as amyloid A fibrils. However, the antibody preferably always binds to human amyloid light chain fibrils. In addition, an isolated antibody is typically substantially free of other cellular material and/or chemicals.
[0064] As used herein, the phrase diagnostically effective amount means the amount of detectable marker-linked antibody or antibody fragment which, when administered to a patient or subject, permits in vivo detection, localization, and/or quantification by diagnostic imaging of amyloid deposits in the patient or subject if any such deposits are present. It is emphasized that a diagnostically effective amount will not always be effective to detect amyloid deposits, even though such amount is deemed to be a diagnostically effective amount by those of skill in the art. The diagnostically effective amount may vary based on the route of administration and dosage form, the age and weight of the subject, and/or the subject's condition, including the type and stage of the amyloidosis at the time that diagnosis commences, among other factors.
[0065] As used herein, the term humanized antibody refers to an antibody that comprises the CDRs of antibodies derived from mammals other than human, and the framework region (FR) and the constant region of a human antibody. A humanized antibody is useful as a component in a diagnostic composition according to the present disclosure since antigenicity of the humanized antibody in human body is lowered.
[0066] As used herein, the term antibody fragment refers to a part of an antibody that comprises a CDR of the antibody but has been engineered to delete some of the structure of the intact antibody. Engineering antibody fragments is well known in the art, as shown (for example) in Holliger, et al.Nature Biotechnology: 23 (9), 1126-1135 (2005), incorporated herein by reference in its entirety. The term antigen-binding fragment as used herein means an antibody fragment that binds to amyloid deposits.
[0067] As used herein, the term pharmaceutically-acceptable carrier means a material for admixture with a pharmaceutical or diagnostic compound (e.g., a chimeric antibody linked to a detectable molecule) for administration to a patient as described, for example, in Ansel's Pharmaceutical Dosage Forms and Delivery Systems, Tenth Edition (2014).
[0068] As used herein, the synonymous terms detectable molecule, detectable marker, detectable agent, and detectable label refer to substances that may be detected in vivo by diagnostic imaging techniques, such as (but not limited to) PET, SPECT, and MRI.
[0069] As used herein, the terms diagnostic imaging or imaging mean methods of in vivo imaging of a detectable molecule in a patient or subject to determine the presence, location and/or amount of a tissue or substance (such as an amyloid deposit) in the patient or subject to which the detectable molecule has been localized, such as by being linked to an antibody or antibody fragment that binds to the tissue or substance to be detected.
Anti-AL Antibodies
Murine Anti-Fibril Antibodies
[0070] Recent animal studies have shown that the administration of the murine 11-1F4 antibody and other murine anti-human light chain specific antibodies directed against an epitope common to the R-pleated-sheet structure present on AL fibrils results in complete degradation of the human ALK and ALA amyloid deposits. Some of these murine antibodies are described in U.S. Pat. No. 8,105,594 (the '594 patent), which is incorporated herein by reference in its entirety.
[0071] Murine antibodies are generally unsuitable for administration to other animal species (such humans) because the receiving species will recognize the murine antibody as antigenic and will produce antibodies against it. The antigenicity of an antibody from one species when injected into another species is normally caused by a portion of a constant domain. Such an antigenic response will impede or prevent the desired therapeutic or diagnostic effect of the murine antibody. In humans, this antigenic response is called human anti-mouse antibody (HAMA). The antibodies described in the '594 patent have the potential to be highly immunogenic in humans via the human anti-mouse antibody (HAMA) response. Since the HAMA response usually results in the rapid clearance of a mouse antibody from the human recipient, HAMA would severely limit any potential human therapeutic or diagnostic benefit a murine antibody could have. Therefore, these murine antibodies are unsuitable for administration to a patient to detect deposits of amyloid fibrils in a patient. Thus, the present disclosure provides compositions and methods for detecting and/or monitoring amyloid deposition diseases that is less likely to produce an immunogenic HAMA response in a patient following administration.
Humanized and Chimeric Anti-Fibril Antibodies
[0072] The present disclosure provides compositions comprising humanized and chimeric antibodies or antigen-binding fragments thereof having linked thereto a detectable molecule. The disclosed compositions are useful for imaging the location and amount of amyloid deposits in a subject. Typically, an antibody consists of four polypeptides: two identical copies of a heavy (H) chain polypeptide and two copies of a light (L) chain polypeptide. Typically, each heavy chain contains one N-terminal variable (V.sub.H) region and three C-terminal constant (CH1, CH2 and CH3) regions, and each light chain contains one N-terminal variable (V.sub.L or V.sub.K) region and one C-terminal constant (CL) region. Each variable domain of the light and heavy chain in an antibody also comprises three segments called complementarity-determining regions (CDR) or hypervariable regions. Each CDR in a light chain, together with the corresponding CDR in the adjacent heavy chain, form an antigen-binding site of the antibody. The variable regions of each pair of light and heavy chains form the antigen binding site of an antibody, whereas the constant region provides structural support and modulates the immune response initiated by the antigen binding.
[0073] Chimeric antibodies incorporate the variable region of a non-human antibody into the constant region of a human antibody. A chimeric 11-1F4 antibody, for instance, may be created by expressing the murine variable region with the Fc region of a human antibody, such as a human IgG1.
[0074] Humanized forms of non-human (e.g., murine) antibodies can be obtained, which contain minimal sequences derived from non-human immunoglobulin. In general, a humanized antibody may comprise one or two or more variable domains in which variable regions are derived from non-human immunoglobulin and framework regions (FR) correspond to a human immunoglobulin sequence. Thus, in some embodiments, a humanized anti-AL antibody comprises a human antibody framework region. Such antibodies can be prepared by known techniques.
[0075] The murine 11-1F4 monoclonal antibody is an anti-AL antibody produced by the SP2/0 hybridoma cell deposited by Alan Solomon, MD (University of Tennessee Medical Center at Knoxville, Tenn.). The hybridoma cell line is available from the American Type Culture Collection (ATCC access PTA-105). The V.sub.K region (SEQ ID NO: 36) and the VH region (SEQ ID NO: 35) of the 11-1F4 antibody are shown in Table 1 below. The CDR sequences for the heavy and light chains and provided in Table 2.
TABLE-US-00001 TABLE1 11-1F4monoclonalantibodyvariablesequences SEQIDNO:36 V.sub.Kregion: AspValValMetThrGlnThrProLeuSerLeuPro ValSerLeuGlyAspGlnAlaSerIleSerCysArg SerSerGlnSerLeuValHisArgAsnGlyAsnThr TyrLeuHisTrpTyrLeuGlnLysProGlyGlnSer ProLysLeuLeuIleTyrLysValSerAsnArgPhe SerGlyValProAspArgPheSerGlySerGlySer GlyThrAspPheThrLeuLysIleSerArgValGlu AlaGluAspLeuGlyLeuTyrPheCysPheGlnThr ThrTyrValProAsnThrPheGlyGlyGlyThrLys LeuGluIleLys SEQIDNO:35 V.sub.Hregion: GlnValGlnLeuLysGluSerGlyProGlyLeuVal AlaProSerGlnSerLeuSerIleThrCysThrVal SerGlyPheSerLeuSerSerTyrGlyValSerTrp ValArgGlnProProGlyLysGlyLeuGluTrpLeu GlyValIleTrpGlyAspGlySerThrAsnTyrHis ProAsnLeuMetSerArgLeuSerIleSerLysAsp IleSerLysSerGlnValLeuPheLysLeuAsnSer LeuGlnThrAspAspThrAlaThrTyrTyrCysVal ThrLeuAspTyrTrpGlyGlnGlyThrSerValThr ValSerSer The complementarity determining regions (CDRs) of the variable sequences are shown in boldface type in the table above.
TABLE-US-00002 TABLE2 11-1F4monoclonalantibodyCDRsequences Sequence AminoAcid CDRL1 ArgSerSerGlnSerLeuValHis (SEQIDNO:49) ArgAsnGlyAsnThrTyrLeuHis CDRL2 LysValSerAsnArgPheSer (SEQIDNO:50) CDRL3 PheGlnThrThrTyrValProAsn (SEQIDNO:51) Thr CDRH1 SerTyrGlyValSerTrp (SEQIDNO:52) CDRH2 ValIleTrpGlyAspGlySerThr (SEQIDNO:53) AsnTyrHisProAsnLeuMetSer ArgLeuSerIleSer CDRH3 LeuAspTyr (SEQIDNO:54)
[0076] One can clone the genes for the V.sub.H and V.sub.K regions shown above to produce a chimeric 11-1F4 antibody using known human antibody sequences. The chimeric 11-1F4 antibody binds to an epitope expressed by the R-pleated sheet configuration of amyloids, just as its murine counterpart does, but surprisingly, as shown in Example 6 below, the chimeric antibody binds to AL amyloid fibrils with higher affinity than the 11-1F4 mouse antibody from which it was derived.
[0077] One can also clone the genes for the CDR regions to produce a humanized form of the antibody using known human antibody sequences. Like the chimeric form of the 11-1F4 antibody, the humanized form may also have a binding affinity for amyloid fibrils that is higher than that of the murine counterpart.
[0078] Those of skill in the art will understand that the disclosed humanized and chimeric antibodies may utilize all different types of human constant regions and/or framework regions. For example, the disclosed humanized and chimeric antibodies may comprise the constant regions and/or framework regions of a human IgG (including IgG1, IgG2, IgG3, and IgG4), IgA, IgE, IgH, or IgM. In preferred embodiments, the disclosed humanized or chimeric 11-1F4 antibody comprises a human IgG1 constant region.
[0079] In some embodiments, the disclosed antibodies may comprise one or more substitutions, insertions, or deletions, so long as the antibody maintains the ability to bind to amyloid fibrils (e.g., kappa and/or lambda light chain fibrils). For example, in some embodiments, a chimeric 11-1F4 antibody of the present disclose may comprise heavy and light chains with about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity compared to the corresponding heavy and light chain sequences disclosed herein, so long as the antibody maintains the ability to bind to amyloid fibrils. In some embodiments, a humanized 11-1F4 antibody of the present disclose may comprise CDRs that have about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity compared to the corresponding CDR sequences disclosed herein, so long as the antibody maintains the ability to bind to amyloid fibrils.
Abbreviations
[0080] Dulbecco's Modified Eagles Medium (DMEM), Fetal Bovine Serum (FBS), ribonucleic acid (RNA); messenger RNA (mRNA); deoxyribonucleic acid (DNA); copy DNA (cDNA); polymerase chain reaction (PCR); minute (min); second (sec); Tris-borate buffer (TBE).
[0081] Amino acids are represented by the IUPAC abbreviations, as follows: Alanine (Ala), Arginine (Arg), Asparagine (Asn), Aspartic acid (Asp), Cysteine (Cys), Glutamine (Gin), Glutamic acid (Glu), Glycine (Gly), Histidine (His), Isoleucine (lie), Leucine (Leu), Lysine (Lys), Methionine (Met), Phenylalanine (Phe), Proline (Pro), Serine (Ser), Threonine (Thr), Tryptophan (Trp), Tyrosine (Tyr), Valine (Val). Similarly for nucleotides: Adenine (A), Cytosine (C), Guanine (G), Thymine (T), Uracil (U), Adenine or Guanine (R), Cytosine or Thymine (Y), Guanine or Cytosine (S), Adenine or Thymine (W), Guanine or Thymine (K), Adenine or Cytosine (M), Cytosine or Guanine or Thymine (B), Adenine or Guanine or Thymine (D), Adenine or Cytosine or Thymine (H), Adenine or Cytosine or Guanine (V), and any base (N).
Humanized or Chimeric Antibodies
[0082] To produce the chimeric antibodies of the invention, the murine 11-1F4 monoclonal antibody heavy and kappa light chain variable region genes described in U.S. Pat. No. 8,105,594 were PCR modified to facilitate the expression of the chimeric 11-1F4 antibody in mammalian cells. A detailed sequence analysis of the modified variable region genes was performed. The modified variable region genes were cloned into the appropriate mammalian expression vectors, creating the constructs 11-1F4VHpG1D200 and 11-1F4VK.pKN100. A single supervector construct, pG1KD200-11-1F4, was made from the 11-1F4VHpG1D200 and 11-IF4VK.pKN100 constructs by EcoRI restriction enzyme digest and ligation. Finally, the chimeric 11-1F4 antibody was transiently expressed in COS cells by both cotransfection and single supervector transfection. While COS cells were chosen for the co-transfection or transfection as a matter of convenience, those of skill in the art would recognize that other mammalian cell lines could be used. The characterization of the binding capacity of the chimeric 11-1F4 antibody for amyloid fibrils was determined by direct binding ELISA. Unexpectedly and beneficially, the chimeric 11-1F4 antibody bound to amyloid fibrils with higher affinity than the murine 11-1F4 antibody.
[0083] Typically, an antibody consists of four polypeptides: two identical copies of a heavy (H) chain polypeptide and two copies of a light (L) chain polypeptide. Typically, each heavy chain contains one N-terminal variable (V.sub.H) region and three C-terminal constant (CH1, CH2 and CH3) regions, and each light chain contains one N-terminal variable (V.sub.L or V.sub.K) region and one C-terminal constant (CL) region. The variable regions of each pair of light and heavy chains form the antigen binding site of an antibody.
[0084] An antibody useful in the compositions and methods of the invention may be a chimeric mouse-human monoclonal antibody comprising the V.sub.K region of SEQ ID NO: 47 and the V.sub.H region of SEQ ID NO: 48 or a humanized monoclonal antibody comprising CDR sequences of SEQ ID NOs: 49-54. These antibodies bind to an epitope expressed by the -pleated sheet configuration of amyloid fibrils. Moreover, surprisingly the antibodies bind to this epitope with higher affinity than the 11-1F4 mouse antibody from which they were derived, which comprises the V.sub.K region of SEQ ID NO: 36 and the V.sub.H region of SEQ ID NO: 35. The invention includes methods of detecting amyloid deposits in a human patient which comprises administering to the patient a diagnostically effective dose of one of the above antibodies linked to a detectable molecule in a pharmaceutically-acceptable carrier. The antibody composition may be administered by any conventional route of administration, but parenteral administration (such as intravenous) is preferred. Pharmaceutically-acceptable carriers are well-known in the art and a suitable one can be selected by one of skill in the medical field.
[0085] Chimeric antibodies and antigen binding fragments thereof useful for the compositions and methods described and claimed herein (and a method of making the chimeric antibodies) are disclosed in co-owned Patent Cooperation Treaty application PCT/US18/399805 (docket 8441-0004WO with priority to U.S. patent application 62/526,835, filed Jun. 29, 2017), filed Jun. 28, 2018, and co-owned Patent Cooperation Treaty Application PCT/US2018/043374 (docket 8441-0009WO) filed Jul. 24, 2018, both of which are incorporated herein in its entirety. Materials useful to make the subject antibody include vector constructs selected from the group consisting of 11-1F4VK.pKN100 and 11-F4VH.pG1D200, shown in
[0086] Methods of making, testing, and using the humanized or chimeric 11-1F4 antibody are discussed in further detail in the Examples section below.
Diagnostic Formulations
[0087] Diagnostic compositions suitable for use in the methods described herein can include the disclosed humanized or chimeric 11-1F4 antibodies, humanized antibodies, or antigen-binding antibody fragments linked in each case to a detectable marker, and a pharmaceutically acceptable carrier or diluent.
[0088] The composition may be formulated for intravenous, subcutaneous, intraperitoneal, or intramuscular administration, although intravenous administration is preferred.
[0089] Pharmacologically acceptable carriers for various dosage forms are known in the art. For example, solvents, solubilizing agents, suspending agents, isotonicity agents, buffers, and soothing agents for liquid preparations are known. In some embodiments, the pharmaceutical compositions include one or more additional components, such as one or more preservatives, antioxidants, stabilizing agents and the like.
[0090] Sterile injectable solutions can be prepared by incorporating the marker-linked antibody or antibody fragment in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by sterilization microfiltration. Generally, dispersions are prepared by incorporating the diagnostic composition into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
Methods of Diagnosis and Monitoring
[0091] In general, amyloidosis is caused by the buildup of an abnormal protein called amyloid. Amyloid is produced in the bone marrow and can be deposited in any tissue or organ. The specific cause of the condition depends on the type of amyloidosis.
[0092] There are several types of amyloidosis or amyloid diseases, including AL amyloidosis, AA amyloidosis, and hereditary amyloidosis.
[0093] AL amyloidosis (immunoglobulin light chain amyloidosis) is the most common type and can affect the heart, kidneys, skin, nerves and liver. Previously known as primary amyloidosis, AL amyloidosis occurs when the bone marrow produces abnormal antibodies that cannot be broken down. The antibodies are deposited in various tissues as amyloid plaques (amyloid deposits), which interfere with normal function of the tissue or organ.
[0094] AA amyloidosis generally affects the kidneys but occasionally also affects the digestive tract, liver or heart. It was previously known as secondary amyloidosis. It often occurs along with chronic infectious or inflammatory diseases, such as rheumatoid arthritis or inflammatory bowel disease.
[0095] Hereditary amyloidosis (familial amyloidosis) is an inherited disorder that usually often affects the liver, nerves, heart, and/or kidneys. Many different types of gene abnormalities present at birth are associated with an increased risk of amyloid disease or hereditary amyloidosis. The type and location of an amyloid gene abnormality can affect the risk of certain complications, the age at which symptoms first appear, and the way the disease progresses over time.
[0096] When an amyloid disease affects the heart, it can cause numerous types of complications. Amyloid deposits or plaques reduce the heart's ability to fill with blood between heartbeats. Less blood is pumped with each beat, and this may lead to shortness of breath. Amyloid deposits or plaques in or around the heart may also cause irregular heartbeats and congestive heart failure, among other organ dysfunctions
[0097] When an amyloid disease affects the kidneys, it will often harm the kidneys' filtration ability, allowing protein to leak from the blood into the urine (i.e., proteinuria). Moreover, the kidneys' ability to remove waste products from your body is lowered, which may eventually lead to kidney failure.
[0098] Provided herein are methods of detecting, locating, and/or quantifying amyloid deposits in a patient suffering or suspected to be suffering from an amyloid deposition disease, such as primary (AL) amyloidosis, by administering to the patient (e.g., a human patient) a humanized or chimeric 11-1F4 antibody or an antigen-binding fragment thereof linked to a detectable marker together with a pharmaceutically acceptable carrier, in an amount effective to detect, locate, and/or quantify amyloid deposits if such are present, followed by detecting the detectable molecule bound to the amyloid deposits in the patient by diagnostic imaging to determine the extent, location, and/or amount of the amyloid deposits if such are present.
[0099] Also provided herein is a method of monitoring disease progression in a patient diagnosed with an amyloid deposition disease and having amyloid deposits comprising the steps of: [0100] a. administering to said patient a diagnostically effective amount of a humanized or chimeric 11-1F4 antibody or an antigen-binding fragment thereof having a detectable molecule linked thereto and conducting diagnostic imaging on the patient to detect the amount of detectable molecule bound to the amyloid deposits, [0101] b. treating the patient with a therapy intended to remove amyloid deposits, such as a humanized or chimeric 11-1F4 antibody or antigen-binding fragment thereof, [0102] c. administering to said patient a diagnostically effective amount of a humanized or chimeric 11-1F4 antibody or an antigen-binding fragment thereof having a detectable molecule linked thereto and conducting diagnostic imaging on the patient to detect the amount of detectable molecule bound to the amyloid deposits, and [0103] d. comparing the detected amount of detectable molecule in step c to the detected amount of detectable molecule in step a.
[0104] The above monitoring method can be conducted starting before any treatment has taken place or can be used in the midst of a treatment regimen. That is, step a) above can be performed prior to any treatment of the patient to determine a baseline amount of amyloid deposit or step a) above can be conducted after one or more courses of treatment to determine the effect of the next succeeding course of treatment.
[0105] In some embodiments, the amyloid deposition disease (e.g., primary amyloidosis) comprises involvement of at least one organ or tissue selected from the group consisting of heart, kidneys, liver, lung, gastrointestinal tract, nervous system, muscular skeletal system, soft tissue, and skin.
[0106] In some embodiments, the disclosed methods comprise monitoring the treatment of a patient suffering from relapse or refractory ALA. In some embodiments, the patient may have kappa ALA. In some embodiments, the patient may have lambda ALA.
[0107] Exemplary diagnostic amounts can vary according to the size and health of the individual being treated, as well as the condition being diagnosed. In some embodiments, the diagnostically effective amount of a radiolabeled humanized or chimeric 11-1F4 antibody for PET is about 1-10 mCi. However, in some situations and for other diagnostic imaging modalities the dose may be higher or lower. One of skill in the diagnostic imaging art would know how to select an appropriate amount of labeled antibody or antibody fragment, as described (for example) in the references listed above.
[0108] The following examples are given to illustrate the present invention. It should be understood, however, that the invention is not to be limited to the specific conditions or details described in these examples. All printed publications referenced herein are specifically incorporated by reference.
Example 1
PCR Cloning and DNA Sequencing of the Mouse 11-1F4 Antibody
[0109] The murine 11-1F4 monoclonal antibody heavy and light chain variable region genes were PCR cloned and a detailed sequence analysis of all variable region genes isolated (both pseudo and functional) was performed. Detailed DNA and amino acid sequences of the murine 11-1F4 antibody heavy and light chain variable region genes were obtained.
Materials
[0110] Media components and all other tissue culture materials were obtained from Life Technologies (UK). The RNA solution kit was obtained from Stratagene (USA), while the first strand cDNA synthesis kit was purchased from Pharmacia (UK). All the constituents and equipment for the RCR-reaction, including AmpliTaq DNA polymerase, were purchased from Perkin Elmer (USA). The TOPO TA Cloning kit was obtained from Invitrogen (USA). Agarose (UltraPure) was obtained from Life Technologies (UK). The ABI PRISM Big Dye terminator cycle sequencing ready reaction kit pre-mixed cycle sequencing kit and the ABI PRISM 310 sequencing machine were both purchased from PE Applied Biosystems (USA). All other molecular biological products were obtained from New England Biolabs (USA) and Promega (USA).
Methods
[0111] The strategy used to PCR clone the murine V.sub.H and V.sub.K genes from the hybridoma cell lines producing the murine monoclonal antibody 11-1F4 is outlined in
[0112] Two clones (B2C4 and B2D6) of the SP2/0 hybridoma cell line producing the -human light chain monoclonal antibody 11-1F4, were kindly provided by Alan Solomon, MD (University of Tennessee Medical Center at Knoxville, Tenn.). The hybridoma cell line is available from the American Type Culture Collection (ATCC access PTA-105). The cell lines were cultured using DMEM media supplemented with 20% (v/v) FBS, penicillin/streptomycin and L-Glutamine. Cells were cultured until a total viable cell count of 10.sup.8 cells was reached.
[0113] The cells were harvested separately from each clone as follows. The mouse hybridoma cell line was grown in suspension in an appropriate culture medium and in sufficient quantities to provide a total viable cell count of about 10.sup.8 cells. The culture supernatant was harvested and the hybridoma cells pelleted in a bench top centrifuge (250 g, 5 min). The cells were gently re-suspended in 20 ml PBS and a 100 l aliquot was taken for a viable cell count. The cells in the aliquot were pelleted once more and 200 l of PBS and 200 l of trypan blue were added to the 100 l of cells and mixed gently. Ten l of this mixture was pipetted into a disposable cell-counting slide and the number of white cells in 9 small squares was counted under a microscope. Blue cells (i.e., dead cells) were not counted. The count process was repeated, the results averaged, and the average results multiplied by 910.sup.5 to obtain a viable cell count for the cells in 20 ml PBS. Once sufficient cells had been harvested, they were re-suspended in 10 ml of Solution D for RNA isolation (see below, Stratagene RNA Isolation Kit).
[0114] Total RNA was then isolated separately from the cells of each clone using a Stratagene RNA isolation kit, according to the manufacturer's instructions. One ml of 2 M sodium acetate (pH 4.0) was added to the sample and the contents of the tube were thoroughly mixed by repeatedly inverting the tube. To the tube was added 10.0 ml of phenol (pH 5.3-5.7) and the contents again mixed thoroughly by inversion. To the mixture was added 2.0 ml of chloroform-isoamyl alcohol mixture, the tube was capped and vigorously shaken for 10 seconds, and the tube was incubated in ice for 15 minutes. The sample was transferred to a 50-ml thick-walled, round-bottom centrifuge tube that had been pre-chilled on ice and the tube was spun in a centrifuge at 10,000g for 20 minutes at 4 C. Two phases were visible in the tube after centrifugation. The upper, aqueous phase contained the RNA, while the lower phenol phase and interphase contained DNA and proteins. The RNA-containing upper, aqueous phase was transferred to a fresh centrifuge tube and the lower phenol phase was discarded. An equal volume of isopropanol was added to the aqueous phase and the contents mixed by inversion, following which the tube was incubated for 1 hour at 20 C. to precipitate the RNA. The tube was spun in a centrifuge at 10,000g for 20 minutes at 4 C. After centrifugation, the pellet at the bottom of the tube, which contains the RNA, was removed and the supernatant discarded. The pellet was dissolved in 3.0 ml of solution D, 3.0 ml of isopropanol was added to the tube and the contents mixed well. After incubating the tube for 1 hour at 20 C., it was again spun in a centrifuge at 10,000g for 10 minutes at 4 C. and the supernatant removed from the tube and discarded. (Note: Up to this point. the RNA had been protected from ribonucleases by the presence of guanidine isothiocyanate but was now no longer protected.) The pellet was washed with 75% (v/v) ethanol (DEPC-treated water (25%)) and the pellet was dried under vacuum for 2-3 minutes. The RNA pellet is re-suspended in 0.5-2 ml of DEPC-treated water.
[0115] Following the manufacturer's instructions, an Amersham Pharmacia Biotech first strand cDNA synthesis kit was employed to produce a single-stranded DNA copy of the 11-1F4 hybridoma mRNA using the Not I-d(T).sup.18 primer supplied with the kit. One reaction was performed for each of the two RNA samples isolated, as follows. The components used were: Bulk first strand cDNA reaction mix, Cloned FPLCpure Murine Reverse Transcriptase, RNAguard, BSA, dATP, dCTP, dGTP, and dTTP, 200 mM DIT aqueous solution, Not I-d(T).sup.18 primer: 5 d[AACTGGAAGAATTCGCGGCCGCAGGAA.sub.18]-3, and DEPC treated water.
[0116] Approximately 5 g of total RNA in 20 l DEPC water was heated to 65C for 10 min and then chilled on ice. The bulk first strand cDNA reaction mix was pipetted gently to obtain a uniform suspension and the reaction set up in a 0.5 ml microcentrifuge tube as below. 20 l denatured RNA solution, 11 l Bulk first strand cDNA reaction mix, 1 l Not I-d(T).sup.18 primer, and 1 ul DTT solution for 33 l total volume. The reactants were mixed gently by pipetting and incubated 37 C. for 1 hour.
[0117] The murine heavy and kappa light chain variable region genes (V.sub.H genes and V.sub.K genes, respectively) were then PCR amplified from the ssDNA template using the method described by Jones and Bendig (Bio/Technology 9:88).
[0118] Separate PCR reactions were prepared for each of the degenerate leader sequence specific primers (MHVI-MHV12 for V.sub.H and MKVI-MKV11 for V.sub.K) with the appropriate constant region primer (an equimolar mix of MHCI-MHC3 for V.sub.H and MKC for V.sub.K). Tables I & 2 detail the primers used to amplify the V.sub.H and V.sub.K region genes, respectively. In total, 12 heavy chain reactions and 11 kappa light chain reactions were performed. AmpliTaq DNA polymerase was used to amplify the template cDNA in all cases, as follows.
[0119] The completed cDNA first strand synthesis reaction was heated at 90 C. for 5 minutes to denature the RNA-cDNA duplex and inactivate the reverse transcriptase and chilled on ice. Eleven GeneAmp PCR reaction tubes were labeled MKV1-11. For each tube a 100 l reaction mixture was prepared, each reaction mixture containing 69.3 l of sterile water, 10 l of 10PCR buffer II, 6 l of 25 mM MgCl.sub.2, 2 l each of the 10 mM stock solutions of dNTPs, 2.5 l of 10 mM MKC primer, 2.5 l of one of the 10 mM MKV primers and 1 l of RNA-cDNA template mix. To each of the tubes was then added 0.7 l of AmpliTaq DNA polymerase and the completed reaction mix overlaid with 50 l of mineral oil.
[0120] A similar series of reaction mixes was prepared as described above to PCR-clone the mouse heavy chain variable region gene. However, this time twelve reaction tubes were labeled and one of the twelve MHV primers and the appropriate MHC primer were added to each. That is, to PCR-amplify the variable domain gene of a mouse yl heavy chain, for example, the MHC G1 primer was used.
[0121] The reaction tubes were loaded into a DNA thermal cycler and cycled (after an initial melt at 94 C. for 1.5 min) at 94 C. for 1 min, 50 C. for I min and 72 C. for 1 min over 25 cycles. The last cycle was followed by a final extension step at 72 C. for 10 min before cooling to 4 C. Except for between the annealing (50 C.) and extension (72 C.) steps when an extended ramp time of 2.5 min was used, a 30 sec ramp time was used between each step of the cycle. A 10 l aliquot from each PCR reaction was run on a 1% (w/v) agarose/1TBE buffer gel containing 0.5 g/ml ethidium bromide to determine which of the leader primers produced a PCR-product. Positive PCR-clones were about 420-500 bp in size.
[0122] The above PCR-amplification process was repeated twice more and those PCR-reactions that appeared to amplify full-length variable domain gene were selected. A 6 l aliquot of each potential PCR-product was directly cloned into the pCRII vector provided by the TA Cloning kit, as described in the manufacturers instructions. Aliquots of 10.0% (v/v), 1.0% (v/v) and 0.1% (v/v) aliquots of the transformed E. coli cells were pipetted onto individual 90 mm diameter LB agar plates containing 50 g/ml ampicillin, overlaid with 25 l of the X-Gal stock solution and 40 l of IPTG stock solution, and incubated overnight at 37 C. Positive colonies were identified by PCR-screening.
TABLE-US-00003 TABLE1 PCRprimersforcloningmousekappalightchainvariable regiongenes SEQID Name Sequence(5.fwdarw.3) NO: MICV1(31mer) ATGAAGATTGCCTGTTAGGCTGTTGGTGCTG 1 MKV2(30mer) ATGGAGWCAGACACACTCCTGYTATGGGTG 2 MKV3(30mer) ATGAGTGTGCTCACTCAGGTCCTGGSGTTG 3 MKV4(33mer) ATGAGGRCCCCTGCTCAGWTTYTTGGMWTCTTG 4 MKV5(30mer) ATGGATTTWCAGGTGCAGATTWTCAGCTTC 5 MKV6(29mer) ATGAGGTKCYYTGYTSAYCTYCTCTGRGG 6 MKV7(32mer) ATGGGCWTCAAAGATGGAGTCACAKWYYCWGG 7 MKV8(30mer) ATGTGGGGAYCTKTTTYCMMTTTTTCAATG 8 MKV9(25mer) ATGGTRTCCWCASCTCAGTTCCTTG 9 MKV10(27mer) ATGTATATATGTTTGTTGTCTATTTCT 10 MKV11(28mer) ATGGAAGCCCCAGCTCAGCTTCTCTTCC 11 MKC(20mer) ACTGGATGGTGGGAAGATGG 12
TABLE-US-00004 TABLE2 PCRprimersforcloningmouseheavychainvariableregion genes SEQID Name Sequence(5.fwdarw.3) NO: MHV1(27mer) ATGAAATGCAGCTGGGGCATSTTCTTC 13 MHV2(26mer) ATGGGATGGAGCTRTATCATSYTCTT 14 MHV3(27mer) ATGAAGWTGTGGTTAAACTGGGTTTTT 15 MHV4(25mer) ATGRACTTTGGGYTCAGCTTGRTTT 16 MHV5(32mer) ATGGGACTCCAGGCTTCAATTTAGTTTTCCTT 17 MHV6(29mer) ATGGCTTGTCYTTRGSGCTRCTCTTCTGC 18 MHV7(27mer) ATGGRATGGAGCKGGRGTCTTTMTCTT 19 MHV8(23mer) ATGAGAGTGCTGATTCTTTTGTG 20 MHV9(31mer) ATGGMTTGGGTGTGGAMCTTGCTTATTCCTG 21 MHV10(28mer) ATGGGCAGACTTACCATTCTCATTCCTG 22 MHV11(28mer) ATGGATTTTGGGCTGATTTTTTTTATTG 23 MHV12(27mer) ATGATGGTGTTAAGTCTTCTGTACCTG 24 MHCG1 CAGTGGATAGACAGATGGGGG 25 (21mer) MHCG2a CAGTGGATAGACCGATGGGGG 26 (21mer) MHCG2b CAGTGGATGAGCTGATGGGGG 27 (21mer) MHCG3(21mer) CAAGGGATAGACAGATGGGGC 28
[0123] Five l aliquots from each PCR reaction were run on a 1% agarose/TBE (pH 8.8) gel to determine which had produced a PCR product of the correct size (ca. 450 bp). Those putative positive PCR products so identified were directly cloned into the pCR2.1 vector provided by the TA Cloning kit and transformed into TOP10 competent cells as described in the manufacturer's protocol. Colonies containing the plasmid with a correctly sized insert were identified by PCR-screening the colonies using the 1212 and 1233 oligonucleotide primers (Table 3) according to the method of Gussow and Clackson (Nucleic Acids Res. 17:4000). Those putative positive clones so identified were double-stranded plasmid DNA sequenced using the ABI PRISM 310 Genetic Analyzer and the ABI PRISM BigDye terminator. Three positive clones each of the V.sub.H and V.sub.K genes from the B2C4 hybridoma cell line clone were sequenced, as were four positive clones of the V.sub.K gene and six of the V.sub.H gene from the B2D6 hybridoma cell line clone.
TABLE-US-00005 TABLE3 PrimersforPCRscreeningandsequencing transformedcolonies SEQID Name Sequence(5.fwdarw.3) NO: 1212(17mer) GTTTTCCCAGTCACGAC 29 1233(21mer) AGCGGATAATTTCACACAGGA 30
[0124] The results of the 12 PCR reactions performed for each hybridoma clone (B2C4 and BCD6) to amplify the murine 11-1F4 antibody heavy chain variable region gene are presented in Table 4(a).
[0125] The degenerate leader sequence primer MHV7, in combination with a mix of the MHCGI-3 constant region primers (Table 1), yielded a PCR product of about 600 bp from template cDNAs derived from both the B2C4 and B2D6 hybridoma cell lines. Since this band was larger than the expected size for an average V.sub.H gene (450 bp), it was not investigated further. Conversely, the degenerate leader sequence primer MHV6, in combination with a mix of the MHCGI-3 constant region primers (Table 1), yielded a PCR product of the expected size (450 bp) for a V.sub.H gene from template cDNA derived from both the B2C4 and B2D6 hybridoma cell lines.
[0126] Table 4 shows the results of the PCR amplifications performed to clone the murine 11-1F4 monoclonal antibody variable region heavy (a) and light (b) chain genes from the SP2/0 hybridoma cell lines B2C4 and B2D6. Column three contains a record of the actual PCR results. Where a band was observed for a particular combination of primers its size in base pairs (bp) was recorded in the appropriate space.
TABLE-US-00006 TABLE 4 Results of PCR amplification (a) Approximate C.sub.H Region Leader Band Size (bp) Primer Primer B2C4 B2D6 MHCG1-3 (mix) MHV1 MHV2 MHV3 MHV4 MHV5 MHV6 450 450 MHV7 600 600 MHV8 MHV9 MHV10 MHV11 MHV12 (b) Approximate C.sub.K Region Leader Band Size (bp) Primer Primer B2C4 B2D6 MKC MKV1 450 450 MKV2 <450 <450 MKV3 MKV4 MKV5 MKV6 200 MKV7 MKV8 MKV9 MKV10 MKV11
[0127] Sequence analysis of three clones from the B2C4 derived PCR product and five clones from the B2D6 derived PCR product revealed a single heavy chain variable region sequence (
[0128] The cloning strategy used (amplification of the entire variable region gene by using primers which flank this region, i.e., leader sequence and constant region sequence specific primers) allowed the complete FR1 sequence to be identified. All eight clones sequenced had identical sequence in this region (
[0129] The results of the 11 PCR reactions performed for each hybridoma clone (B2C4 and BCD6) to amplify the murine 11-1F4 antibody kappa light chain variable region gene are presented in Table 4(b).
[0130] The degenerate leader sequence primer MKV6 in combination with the MKC constant region primer (Table 2), produced a PCR product of about 200 bp from template cDNA derived from the B2C4 hybridoma cell line only. Since this band was much smaller than the expected size for a V.sub.K gene (450 bp), it was not investigated further.
[0131] The degenerate leader sequence primer MKV2, in combination with the MKC constant region primer (Table 2), produced a PCR product which was smaller than the expected 450 bp band (when viewed on an agarose gel) from template cDNA derived from both the B2C4 and B2D6 hybridoma cell lines. In addition, previous V.sub.K cloning had found that the MKV2 primer amplified a well known kappa light chain pseudogene. Therefore, sequence analysis of one clone of each PCR product was performed in order to confirm that this product was a pseudogene and not the murine 11-1F4 antibody V.sub.K gene. This sequence analysis revealed that this PCR clone was indeed the pseudogene.
[0132] Finally, the degenerate leader sequence primer MKV1, in combination with the MKC constant region primer (Table 1), produced a PCR product of about the expected size (450 bp) for a V.sub.K gene, from template cDNA derived from both the B2C4 and B2D6 hybridoma cell lines.
[0133] Sequence analysis of three clones of the B2C4 derived PCR product and four clones of the B2D6 derived PCR product revealed a single kappa light chain variable region sequence which could not be identified as a pseudogene.
[0134] Thus, the 11-1F4 antibody heavy chain variable region gene was cloned (using constant region specific and leader sequence specific primers) from the hybridoma mRNA and sequenced.
[0135] When translated, the sequence gave a TVSS peptide sequence. Analysis of 122 rearranged human V.sub.H genes, recorded in the Kabat database (Kabat et al.Sequences of Proteins of Immunological Interest), revealed that 84% of these sequences had a TVSS peptide sequence. It was therefore concluded that the V.sub.H gene isolated was the correct 11-1F4 antibody gene sequence.
[0136] The murine 11-1F4 antibody variable region kappa light chain gene was also successfully cloned and sequenced, as was a non-functional V.sub.K pseudogene gene. This pseudogene was first identified by Carroll et al (Molecular Immunology (1988) 25:991). The sequence arises from an aberrant mRNA transcript which is present in all standard fusion partners derived from the original MOPC-21 tumor (including SP2/0). As a result of the aberrant mRNA, the invariant cysteine at position 23 is replaced by a tyrosine residue, and the VJ joint is out of frame, resulting in a stop codon at position 105.
[0137] It is common for lymphoid or hybridoma cells to synthesize more than one rearranged light immunoglobulin mRNA. These mRNAs are usually non productive due to the presence of termination codons or frame shifts not usually seen in functional V.sub.K genes. These pseudo messengers often present major problems when cloning immunoglobulin genes from hybridomas because they are very good substrates for V region PCR, despite the fact that they do not encode functional polypeptides.
[0138] The 11-1F4 antibody V.sub.K gene sequence was identified after detailed sequence analysis of seven separate PCR clones, isolated from two different PCR products to yield SEQ. ID NO: 36. Since all sequences were identical, it was accepted as the correct 11-1F4 antibody kappa light chain variable region sequence.
[0139] The cloned V.sub.H and V.sub.K region genes were used to make the chimeric mouse-human 11-1F4 monoclonal antibody, which was then be analyzed to confirm specific binding to AL fibrils.
Example 2
[0140] Construction of Chimeric Mouse-Human 11-1F4 (c11-1F4) Antibody
[0141] In order to allow transient expression of the 11-1F4 V.sub.H and V.sub.K variable region genes described above in mammalian cells as part of a chimeric mouse-human antibody, it was necessary to modify the 5- and 3-ends using specifically designed PCR primers (Table 5). The oligonucleotide primers F39836 and F39837 were used to PCR modify the 11-1F4 V.sub.K gene, while primers F39835 and F58933 were used to PCR modify the 11-1F4 V.sub.H gene. The back (BAK) primers F39836 and F39835 introduced a HindIII restriction site, a Kozak translation initiation site, and an immunoglobulin leader sequence to the 5 ends of the V.sub.K and V.sub.H genes respectively. The forward (FOR) oligonucleotide primer F39837 introduced a splice donor site and a BamHI restriction site to the 3 end of the V.sub.K gene while the forward (FOR) oligonucleotide primer F58933 appended the first 22 base pairs of the gamma-1CH.sub.1 gene including an ApaI restriction site to the 3 end of the V.sub.H gene.
TABLE-US-00007 TABLE5 OligonucleotideprimersusedtoPCRmodifythe11-1F4heavy andkappalightchainvariableregiongenes SEQID Name Sequence(5.fwdarw.3) NO: F39835 AAGCTTGCCGCCACCATGGCTGTCCTGGGGCTGCTCITC 31 VHBAK TGC F58933 CCGATGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACT 32 VHFOR GAGGTTCC F39836 AAGCTTGCCGCCACCATGAAGTTGCCTGTTAGGCTGTTG 33 VKBAK GTGC F39837 GGATCCACTCACGTTTGATTTCCAGCTTGGTCCCCCCTCC 34 VKFOR GA
[0142] The Kozak consensus sequence is crucial to the efficient translation of a variable region sequence (KozakJ Mol Bio 196:947). It defines the correct AUG codon from which a ribosome commences translation, and the single most critical base is the adenine (or less preferably, a guanine) at position 3, upstream of the AUG start.
[0143] The immunoglobulin leader sequence ensures that the expressed antibody is secreted into the medium and therefore is easily harvested and purified. The leader sequences used in this instance were the murine 11-1F4 V.sub.K and V.sub.H leader sequences cloned from the hybridoma cDNA during the V.sub.H and V.sub.K cloning process.
[0144] The splice donor sequence is important for the correct in-frame attachment of the light chain variable region to its appropriate constant region, thus splicing out the 130 bp V.sub.K:C.sub.K intron. The heavy chain variable region was attached directly to its appropriate constant region gene via the ApaI site, thus eliminating the need for a splice donor site.
[0145] The sub-cloning restriction sites HindIII and BamHI, and HindIII and ApaI, respectively, bracket the modified V.sub.K and V.sub.H variable region genes, while the use of different unique restriction sites ensured directional sub-cloning into the appropriate mammalian expression vector.
[0146] The 11-1F4 light chain variable region gene was first carefully analyzed to identify any unwanted splice donor sites, splice acceptor sites, and Kozak sequences (see Table 6). Both the heavy and light chain variable region genes were analyzed for the presence of any extra sub-cloning restriction sites which would later interfere with the subcloning and/or expression of functional whole antibody. None were found.
TABLE-US-00008 TABLE6 Sequencesimportantfortheefficientexpressionof immunoglobulingenesinmammaliancells Name ConsensusDNASequences Kozaktranslationinitiationsite CCGCCRCCAUGG Kappalightchainsplicedonorsite AC::GTRAGT Heavychainsplicedonorsite AG::GTRAGT Immunoglobulinspliceacceptorsite YYYYYYYYYYNCAG::G Bases shown in bold are considered to be invariant within each consensus sequence.
[0147] Separate PCR reactions were prepared as follows, one for each variable region gene. The plasmids 11-1F4 V.sub.H.pCR2.1 and 11-1F4 V.sub.K.pCR2.1 described above were used as templates. A 100 l reaction mixture was prepared in each PCR tube, each mixture containing up to 41 l of sterile water, 10 l of 10PCR buffer I, 8 l of the 10 mM stock solution of dNTPs, 1 l of 10 mM of 5 forward primer, 1 l of the 10 mM 3 Reverse primer, and 1 l of a 1/10 dilution of template DNA. Finally, 0.5 l of AmpliTaq DNA polymerase (2.5 units) was added before overlaying the completed reaction mixture with 50 l of mineral oil. The reaction tubes were loaded into a DNA thermal cycler and cycled (after an initial melt at 94 C. for 1 min) at 94 C. for 30 sec, 68 C. for 30 sec and 72 C. for 50 sec over 25 cycles. The completion of the last cycle was followed with a final extension step at 72 C. for 7 min before cooling to 4 C. A 10 l aliquot from each PCR reaction tube was run on a 1.2% (w/v) agarose/1TBE buffer gel containing 0.5 g/ml ethidium bromide to determine size and presence of a PCR-product. Positive PCR-clones were about 420 bp in size. Those putative positive PCR products so identified were directly cloned into the pCR2.1 vector, provided by the Topo TA Cloning kit, and transformed into TOP10 competent cells as described in the manufacturer's protocol. Colonies containing the plasmid with a correctly sized insert were identified by PCR-screening the colonies using the 1212 and 1233 oligonucleotide primers (Table 3) according to the method of Gussow and Clackson. Those putative positive clones so identified were double-stranded plasmid DNA sequenced using the ABI PRISM 310 Genetic Analyzer and the ABI PRISM BigDye terminator. Two positive clones each of the Topo TA cloned V.sub.H and V.sub.K genes were sequenced.
[0148] Clones containing the correctly modified 11-1F4 V.sub.H and 11-1F4 V.sub.K genes were identified and the modified V genes from these clones were subcloned into their respective expression vectors to facilitate the expression of chimeric heavy and kappa light chains in mammalian cells. The modified 11-1F4 V.sub.K gene was subcloned into the expression vector pKN100 (
Example 3
Construction of a Single Supervector for Transient Expression of Chimeric 11-1F4 in COS Cells.
[0149] A single supervector expressing both immunoglobulin chains of the chimeric 11-1F4 antibody was constructed as follows. The 11-1F4 kappa light chain expression cassette (which contained the HCMVi promoter, the 11-1F4 kappa light chain variable region gene, and the kappa light chain constant region gene) was restriction enzyme digested (EcoRI at positions 1 and 2490) out of the 11-1F4VK.pKN100 construct (
Example 4
[0150] Transient expression of the chimeric 1/K.11-1F4 whole antibody in COS cells
[0151] The chimeric 11-1F4 antibody was transiently expressed in COS cells from the European Collection of Cell Cultures (ECACC) in two ways: [0152] (i) By cotransfection of 10 g of each of the vector constructs 11-1F4VK.pKN100 and 11-1F4VH.pG1D200. Co-transfections were carried out in duplicate. [0153] (ii) By transfection of 13 g of the single supervector construct pG1KD200-11-1F4. Supervector transfections were carried out five times.
[0154] The following transfection method was used. The COS cell line was grown in DMEM supplemented with 10% (v/v) FCS, 580 g/ml L-glutamine and 50 Units/ml penicillin/50 g/ml streptomycin (media) in a 150 cm.sup.2 flask until confluent. The cells were trypsinized, spun down in a bench top centrifuge (250 g for 5 min), then re-suspended in 6 ml of media before dividing them equally between three 150 cm.sup.2 flasks, each containing 25 ml of fresh, pre-warmed media. The cells were incubated overnight at 37 C. in 5% CO.sub.2 and then harvested the next day while they are still growing exponentially. Each flask contained approximately 110.sup.7 cells. The cells were trypsinized again, pelleted as before, and washed in 20 ml of PBS, following which they were re-suspend in sufficient PBS to create a cell concentration of 110.sup.7 cells/ml. 700 l of these washed COS cells were pipetted into a Gene Pulser cuvette, to which was then added 1 l of both the heavy chain and kappa light chain expression vector DNA (each at 10 g) or 13 g of the super-vector construct. A 1900 Volt, 25 pFarad capacitance pulse was delivered to the mixture using the Bio-Rad Gene Pulser apparatus. The pulsing was repeated for each experimental transfection and a no DNA control (in which the COS cells were electroporated in the absence of any DNA). A positive control of a previously-expressed antibody was also carried out to test the efficiency of the COS cells.
[0155] The COS cells were allowed to recover at room temperature for 10 min, then gently pipetted the into a 10 cm diameter tissue culture dish containing 8 ml of pre-warmed DMEM supplemented with 10% (v/v) -globulin free FBS, 580 g/ml L-glutamine and 50 Units/ml penicillin/50 g/ml streptomycin, and incubated in 5% CO.sub.2 at 37 C. for 72 hours before harvesting the COS cell supernatant for analysis. After incubation for 72 hours the medium was collected, spun to remove cell debris and analyzed by ELISA for chimeric antibody production and antigen binding of the c11-1F4 antibody.
Example 5
Quantification of the Chimeric 1/K 11-1F4 Antibody Via Capture ELISA
[0156] Following expression, the whole IgG molecules present in the COS cell supernatant were quantified using a capture ELISA assay. IgG molecules were captured on a Nunc-Immuno MaxiSorb plate via an immobilized goat anti-human IgG, Fc fragment-specific antibody, and detected via an anti-human kappa light chain peroxidase conjugated antibody. A standard curve was generated by capturing and detecting known concentrations of a standard IgG antibody on the same plate in the same way as follows. Each well of a 96-well immunoplate was coated with 100 l aliquots of 0.4 g/ml goat anti-human IgG antibody diluted in PBS and incubated overnight at 4 C. The excess coating solution was removed and the plate was washed three times with 200 l/well of washing buffer (1PBS, 0.1% TWEEN). Into all wells except the wells in column 2, rows B to G, was dispensed 100 l of SEC buffer. A 1 g/ml solution of the human IgG1/kappa antibody in SEC buffer was prepared to serve as a standard and 200 l/well was pipetted into the wells in column 2, rows B and C. The medium from the transfected cos cells was centrifuged (250 g, 5 min), saving the supernatant. An aliquot of 200 l of the supernatant from the no DNA control (in which COS cells were transfected in the absence of DNA) was pipetted into the well in column 2, row D, and aliquots of 200 l/well of experimental supernatants were pipetted into the wells in column 2, rows E, F, and G. The 200 l aliquots in the wells of column 2, rows B to G were mixed and then 100 l was transferred from each well to the neighboring well in column 3. This process was continued to column 11 with a series of 2-fold dilutions of the standard, control, and experimental samples, following which all were incubated at 37 C. for 1 hour and all the wells were rinsed six times with 200 l aliquots of washing buffer. The goat anti-human kappa light chain peroxidase conjugate was diluted 5000-fold in SEC buffer and 100 l of the diluted conjugate added to each well, followed by a repetition of the incubation and rinsing steps. To each well was added 150 l of K-BLUE substrate, followed by incubation in the dark at 25 C. for 10 min. The reaction was stopped by adding 50 l of RED STOP solution to each well and the optical density was read at 655 nm.
Example 6
Binding Analysis of the Chimeric 11-1F4 Antibody
[0157] The chimeric 11-1F4 antibody was tested for binding to amyloid fibrils using a direct binding ELISA assay. Synthetic fibrils were formed from an immunoglobulin light chain protein and used to monitor the reactivity of the antibody in a solid-state ELISA-based assay using a low-binding polystyrene plates (Costar, #3474). Immediately prior to coating the plate, a mass of 250 g of fibrils was diluted to 1 ml with coating buffer (0.1% bovine serum albumin in phosphate buffered saline pH 7.5). The sample was then sonicated for 20 sec using a Tekmar Sonic Disruptor sonicating probe, with the power set to 40% of maximum, resulting in a solution of short fibrils composed of up to 2-5 protofiliments each. This solution was then diluted to 5 ml, mixed well by vortex, and aliquoted into the wells of the plate. This process yielded 50 l of fibril solution having a concentration of 50 g/ml in each well. The plate was then dried overnight by placing it uncovered in a 37 C. incubator.
[0158] The ELISA assay was then performed as follows within 48 hours of preparing the plate. The wells were blocked by the addition of 100 l of 1% BSA in PBS and incubated for 1 hour at room temperature on a shaker. The plate was washed 3 in PBS, 0.05% Tween 20 (v/v). To each well of the plate was added 50 l of a solution of c11-1F4 (3 g/ml antibody in 0.1% BSA/PBS) and the plate incubated at room temperature for 1 hour on a shaker. The plate was again washed 3 (as before) and detection of bound antibody was accomplished using a biotinylated goat anti-mouse IgG antibody (Sigma# B-8774, anti-heavy and light-chain).
[0159] Sequence analysis of the successfully modified V.sub.H and V.sub.K genes revealed the correct sequence was present. Detailed DNA and amino acid sequences of the modified 11-1F4 V.sub.K and V.sub.H genes are presented in
[0160] The 11-1F4VK.pKN100 and 11-1F4VHpG1D200 constructs were also subsequently used to construct a single supervector (pG1 KD200-11-1F4), which expressed the chimeric 11-1F4 antibody in mammalian cells. The chimeric II-1F4 antibody expression levels, from both cotransfections and supervector transfections of ECACC COS cells were assayed. The expression levels observed from the pG1KD200-11-1F4 supervector transfections (10326 ng/ml) were 3.7 fold higher than the levels observed from the corresponding co-transfections of the 11-1F4VK.pKN100 and 11-1F4VHpG1D200 constructs (2820 ng/ml).
[0161] Following expression and quantification, the chimeric 11-1F4 antibody was tested for binding to target antigen (amyloid fibrils kindly supplied by the NCI) by direct binding ELISA. The results of the binding ELISA are presented in
[0162] The results indicated that the chimeric 11-1F4 antibody bound to the amyloid fibrils with a higher affinity than its murine equivalent. This result is surprising and unexpected because normally a chimeric antibody would be expected to have a binding affinity comparable to the original murine antibody. Without intending to be bound by the particular mechanism, the inventors believe it is possible that the net effect of combining the 11-1F4 murine V regions with the human yl/K C regions used to create the chimeric 11-1F4 antibody produced an antibody of higher affinity.
[0163] Samples of CHO cells (identified as CAEL-101) that secrete one embodiment of the chimeric 11-1F4 monoclonal antibody (which embodiment is sometimes referred to herein as CAEL-101 or as the antibody CAEL-101) used herein were deposited with the American Type Culture Collection (ATCC Acc. No: PTA-125146) on Jun. 27, 2018, in compliance with the Budapest Treaty.
Example 7
Imaging Human Amyloid Deposits in Mice
[0164] Human amyloid extracts from the heart (1), liver (1), spleen (1) and kidney (6) were kindly provided by Tufts University. Lyophilized human amyloid extracts were suspended in 25 ml of sterile PBS and homogenized for 3 minutes and centrifuged at 12,000 g for 30 minutes. 100 mg of the resulting pellet was resuspended in sterile saline. Balb/c mice were then injected subcutaneously with amyloid extract.
[.SUP.124.I]CAEL-101:
[0165] cGMP grade CAEL-101 was radiolabeled with .sup.124I, a positron emitting radioisotope used for PET imaging, with the standard iodegen reaction. (Fraker, et al.Biochem Biophys Res Commun 80(4): 849-57; Markwell et al.Biochem 17:4807-17) Approximately 5 days after human amyloid extract was implanted to form subcutaneous amyloidomas, the mice were injected with 50-200 Ci of [.sup.124I]CAEL-101 and imaged up to 14 days post injection using an Inveon microPET scanner. SUVmax for amyloidomas and contralateral background were obtained by drawing regions of interest in the PMOD software package and calculating tumor-to-background (amyloid deposit-to-background) (T:B) ratios at 1 and 4 days post tracer infusion.
[0166] [.sup.124I]CAEL-101 successfully imaged 100% of mice bearing human amyloid extracts (1, 1 and 6 subtypes derived from heart, liver, spleen, and kidney). We demonstrated for the first time imaging of cardiac derived amyloidosis (shown in
[0167] This result of heterogeneous uptake among the various amyloidomas supports using real time PET imaging to stratify patients for therapy with the chimeric or humanized antibody described herein as well as to determine the appropriate dose of the antibody therapy. That is, one may determine the dosing of a patient based on the detected uptake of the labeled antibody or antibody fragment. A patient showing strong uptake (affinity) for the labeled antibody or antibody fragment may require a smaller amount of therapeutic antibody or antibody fragment than a patient showing a weaker uptake (affinity) for the labeled antibody or antibody fragment. The present disclosure therefore provides a method of determining the appropriate dosage of the disclosed humanized or chimeric antibody for therapy comprising the steps of administering to the patient a labeled antibody or antibody fragment disclosed herein, determining the uptake of the labeled antibody or antibody fragment by the amyloid deposits of the patient, and administering a dose or series of doses of chimeric or humanized antibody or antibody fragment to the patient based on the determined amount of uptake of the labeled antibody or antibody fragment.
[.SUP.89.Zr]CAEL-101:
[0168] Although [.sup.124I]CAEL-101 demonstrated significant binding to amyloidamas, the .sup.124I radiolabel dehalogenates, causing much of the detected activity to be in the thyroid or untargeted (if thyroid is blocked). We therefore sought a method to radiolabel with a more stable radioisotope that can be imaged after blood clearance of unbound radiolabel (7-10 days). We radiolabeled CAEL-101 with 89-Zirconium (.sup.89Zr), using two different strategies to create [.sup.89Zr]-CAEL-101. One strategy employed the standard NCS linker that binds to random lysines on an antibody. (Eur J Nucl Mol Imaging. 2010 February 37(2): 250-59; Curr Radiopharm. 2011 Apr. 1; 4(2): 131-139) This method is used in many clinical applications but has been shown to create multiple radioisomers that can theoretically alter binding or biodistribution between batches. We therefore also radiolabeled CAEL-101 using a site specific approach that targets cystienes using the bifunctional deferoxamine-maleimide cross linker. (Nuclear Medicine and Biology 37 (2010) 289-297) Approximately 5 days after human cardiac amyloid extract was implanted to form subcutaneous amyloidomas, animals were injected with 50-200 Ci of [.sup.89Zr]CAEL-101 and imaged 1, 4, 7, 11 and 14 days post injection using an Inveon microPET scanner.
[0169] Both variants of [.sup.89Zr]CAEL-101 successfully imaged mice bearing cardiac amyloid extracts. They retained their immunoreactivity and demonstrated superior T:B compared to [.sup.124I]CAEL-101 (18:1 vs 6:1). Furthermore, there was an actual increased T:B at day 7 in the higher binding subtype after [.sup.89Zr]CAEL-101 injection, in contrast to the significant decrease seen with [.sup.124I]CAEL-101. Human amyloidomas were visualized very well throughout the entire term of the experiment (14 days post tracer injection) with no evidence of significant breakdown of radiotracer. This is in contrast to what we found with the [.sup.124I]CAEL-101 that had significantly broken down by day 4 and 7. This long duration of imaging of amyloid deposits enables one to use this labeled antibody for imaging deposits after significant blood clearance of unbound labeled antibody, which improves tumor-to-background (amyloid deposit-to-background) ratios and is important for imaging disease in organs that have high adjacent blood compartments, such as cardiac amyloid deposition. We found long term in vivo stability of the antibody binding component as we observed amyloidoma even 14 days after tracer injection. We again demonstrated imaging of cardiac derived amyloidosis, which had been reported to not work in prior literature. We observed for the first time ipsilateral uptake in lymphatic tissue, likely caused by amyloid in immune cells after phagocytosis migrating to draining nodes, possibly due to the fact that we implanted the amyloidomas in immunocompetent mice. This model undergoes spontaneous amyloid clearance due to the presence of human amyloid. This novel observation may provide a basis for a method of imaging response to therapy by looking for PET tracer uptake in lymph nodes.
[0170] In the description and claims of this specification the word comprise and variations of that word, such as comprises and comprising are not intended to exclude other features, additives, components, integers or steps but rather, unless otherwise stated explicitly, the scope of these words should be construed broadly such that they have an inclusive meaning rather than an exclusive one.
[0171] Although the compositions and methods of the invention have been described in the present disclosure by way of illustrative examples, it is to be understood that the invention is not limited thereto and that variations can be made as known by those skilled in the art without departing from the teachings of the invention defined by the appended claims.