CHLOROSIS RESISTANT CYTOPLASMIC MALE STERILE BRASSICA PLANTS

Abstract

The present invention relates to a chlorosis resistant cytoplasmic male sterile (CMS) Brassica rapa plant and methods of producing the chlorosis resistant CMS Brassica rapa plant. The present invention further relates to progeny, a descendent plant, and/or seed and/or plant part of the chlorosis resistant CMS Brassica rapa plant.

Claims

1. A chlorosis resistant cytoplasmic male sterile (CMS) Brassica rapa plant, wherein: substantially 100% of the chloroplasts in the plant are Brassica rapa chloroplasts, said Brassica rapa chloroplasts are identifiable by one or more sequences selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3 and SEQ ID No. 5; the nuclear genome of the plant is a Brassica rapa nuclear genome identifiable by SEQ ID No. 7 and/or SEQ ID No. 9; and the plant does not comprise Brassica oleracea chloroplasts identifiable by one or more sequences selected from the group consisting of SEQ ID No. 2, SEQ ID No. 4, and SEQ ID No. 6.

2. Chlorosis resistant CMS Brassica rapa plant according to claim 1, wherein the plant is obtainable by a method comprising the steps of: a) protoplast fusion of protoplasts of a fertile Brassica rapa plant as the protoplast donor with protoplasts of CMS Brassica rapa plant comprising chloroplasts of another diploid species of Brassica, preferably Brassica oleracea, as cytoplasm donor; b) selecting protoplast fusion products wherein: substantially 100% of the chloroplasts in the plant are Brassica rapa chloroplasts identifiable by one or more sequences selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3 and SEQ ID No. 5; the nuclear genome of the plant is a Brassica rapa nuclear genome identifiable by SEQ ID No. 7 and/or SEQ ID No. 9; and the plant does not comprise Brassica oleracea chloroplasts identifiable by one or more sequences selected from the group consisting of SEQ ID No. 2, SEQ ID No. 4, and SEQ ID No. 6.

3. Chlorosis resistant CMS Brassica rapa plant according to claim for claim 2, wherein the plant comprises mitochondria of Raphanus sativus, Brassica oxyrhina, Diplotaxis muralis, Mentha arvensis, or Enarthrocarpus lyratus, preferably Raphanus sativus.

4. Chlorosis resistant CMS Brassica rapa plant according to any of the claims 1 to 3, wherein: substantially 100% of the mitochondria are Raphanus sativus mitochondria identifiable SEQ ID No. 11; the plant does not comprise Brassica oleracea and Brassica rapa mitochondria.

5. Chlorosis resistant CMS Brassica rapa plant according to any one of the claims 1 to 4, wherein the CMS Brassica rapa plant is selected from the group consisting of Brassica rapa subspecies: rapa, pekinensis, glabra, chinensis, rapifera, oleifera, parachinensis, perviridis, Brassica narinosa, trilocularis, mizuna, preferably rapa or pekenensis.

6. Chlorosis resistant CMS Brassica rapa plant according to any one of the claims 1 to 5 wherein: substantially 100% of the chloroplast are chloroplasts derived from NCIMB Accession Number 43622; substantially 100% of the mitochondria are mitochondria derived from NCIMB Accession Number 43622.

7. A progeny, descendent plant, seed or plant part of the chlorosis resistant CMS Brassica rapa plant of any one of the claims 1 to 6.

8. A hybrid Brassica plant produced by using the chlorosis resistant CMS Brassica rapa plant of any one of the claims 1 to 7 as a parent.

9. Method for providing a chlorosis resistant CMS Brassica rapa plant of any one of the claims 1 to 8, comprising the steps of; a) protoplast fusion of protoplasts of a fertile Brassica rapa plant as the protoplast donor with protoplasts of CMS Brassica rapa plant comprising chloroplasts of another diploid species of Brassica, preferably Brassica oleracea, as cytoplasm donor; b) selecting protoplast fusion products wherein: substantially 100% of the chloroplasts in the plant are Brassica rapa chloroplasts identifiable by one or more sequences selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3 and SEQ ID No. 5; the nuclear genome of the plant is a Brassica rapa nuclear genome identifiable by SEQ ID No. 7 and/or SEQ ID No. 9; and the plant does not comprise Brassica oleracea chloroplasts identifiable by one or more sequences selected from the group consisting of SEQ ID No. 2, SEQ ID No. 4, and SEQ ID No. 6; optionally, crossing at least one time the selected chlorosis resistant CMS Brassica rapa plant with a wild type Brassica rapa plant and selecting a chlorosis resistant CMS Brassica rapa plant.

Description

[0040] The present invention will be further detailed in the following examples and figures wherein:

[0041] FIG. 1: shows CMS B. rapa plants in a non heated glass house for winter cultivation (temperatures between 5 to 12 C.). The upper 3 to 4 rows of plants comprise the prior art old CMS B. rapa plant and show clear yellowing of the leaves, i.e. chlorosis. The lower rows of plants are CMS B. rapa plants according to present invention that is chlorosis resistant, having a B. rapa nucleus, Ogura mitochondria and B. rapa chloroplast.

[0042] FIG. 2: shows leaves of a prior art CMS B. rapa plant (left, CMS3), a CMS B. rapa plant according to present invention having a B. rapa nucleus, Ogura mitochondria and B. rapa chloroplast that is chlorosis resistant (middle, CMS7), and a wild type B. rapa plant (right, WT). The CMS B. rapa plant on the left is showing first signs of chlorosis after 3 to 4 weeks of cultivation in a non heated glass house at temperatures between 5 to 12 C. Chlorosis is especially visible from the stem of the leaves, gradually moving towards the leave. No chlorosis was visible on the CMS B. rapa plant (middle) of present invention during these 3 to 4 weeks under identical conditions, similar to the WT B. rapa. Furthermore, the CMS plant of present invention shows regular growth, comparable to the old CMS and wild type B. rapa.

[0043] FIG. 3: shows the flowers of a chlorosis resistant CMS B. rapa plant of present invention (upper picture) and a wild type male fertile B. rapa plant (lower picture). The CMS plant of present invention shows the male sterility throughout the whole plant. Pollen are clearly visible on the wild type male fertile B. rapa plant having fully developed anthers that carry pollen grains, whereas the CMS B. rapa plant of present invention shows undeveloped anthers and the anthers are carrying no pollen at all.

EXAMPLES

Generation of Chlorosis Resistant B. rapa Ogura CMS of Present Invention

[0044] A B. rapa var. cymosa (Cime di Rapa) fertile line and an Ogura CMS B. rapa (Cime di Rapa) line with Brassica oleracea chloroplasts were grown for 14 days before protoplast fusion. The leaves of a Brassica rapa var. cymosa (Cime di Rapa) fertile line grown for 14 days before protoplast fusion is used and an Ogura CMS Brassica rapa (Cime di Rapa) line with Brassica oleracea chloroplasts grown for 7 days in the dark for etiolated hypocotyl protoplasts are used. Then the leaves of the B. rapa fertile line seedling and the etiolated hypocotyl of the Ogura CMS Brassica rapa (Cime di Rapa) line were used for protoplast fusion known in the art, such as Pelletier et al.1983, Molecular and General Genetics MGG 191:244-250.

[0045] Briefly, leaf and hypocotyl material is cut into small pieces and placed in a petri dish containing a layer (12 ml) of plasmolysing solution and subsequently wrapped in aluminum foil and stored in a laminar flow cabinet for at least one hour. Next, the plasmolysing solution is replaced by equal amounts of enzyme solution and incubated overnight in aluminum foil at 25 C., wherein the petri dishes comprising the hypocotyl protoplasts is placed on a shaker at 30 rpm and an amplitude of 15 mm Next day, the obtained suspension samples are filtered over a Teflon filter holder with two nylon filters of 110 m and 53 m respectively. The filters are re-rinsed with 8-9 ml of CPW16. Then, the suspensions are centrifuged at 110g for 5 minutes providing visible protoplast bodies. The protoplasts samples are transferred to a fresh centrifuge tube via a Pasteur pipette. Then, approximately 8-9 ml of W5 is added to the protoplast, followed by centrifugation at 75g for 5 minutes.

[0046] Then, the density of the protoplast suspensions is determined with a hemocytometer. The protoplasts of both suspensions protoplasts are brought together with a density of 910.sup.5 protoplasts/ml for fusion in a petri dish as drops using a micro pipette and left to rest in the dark for 15 minutes to enable the protoplasts to adhere to the bottom of the petri dishes. Then approximately 60 l of PEG1-solution (PEG4000 400 g/l, CaCl.sub.2.Math.2H.sub.2O 7.35 g/l, glucose 54.5 g/l) is added to each drop of protoplasts followed after 3-5 minutes by addition of 4 to 9 ml PEG2 (PEG4000 133 g/l, CaCl.sub.2.Math.2H.sub.2O 9.85 g/l, sorbitol 12.21 g/l, glucose 18.02 g/l) solution. After 3-5 minutes the solution is removed and 4 to 9 ml of PEG3 (PEG4000 67 g/l, CaCl.sub.2.Math.2H.sub.2O 12.2 g/l, sorbitol 15.12 g/l, glucose 9.01 g/l) is added. After 3-5 minutes the solution is removed and 4 to 9 ml of B-medium (according to Pelletier et al., 1983) is added and repeated after 3-5 min for a second time. Finally, the petri dishes are sealed and stored in the dark.

[0047] Subsequently, the fusion products being a B. rapa with the nucleus of B. rapa var. cymose, Ogura mitochondria, and B. rapa chloroplasts were grown as described in Pelletier et al. (1983). The fusion products were crossed with a B. rapa line (Cime di Rapa) as BC1. When the BC1 plants were sown and a marker analysis was performed on the three organellesmitochondria, nucleus and chloroplasts, 100% of the plants confirmed to carry the correct and predicted organelle composition (i.e. nucleus of B. rapa, Ogura mitochondria, and B. rapa chloroplasts). Furthermore, the plants were crossed with a B. rapa nipposinica var. japonica, a parachinensis and a pekinensis type. After 4-5 weeks, seeds were collected and sown for another backcross generation and were also confirmed to carry the correct and predicted organelle composition.

Identification of Chlorosis Resistant B. rapa

[0048] A marker analysis was performed on the three organellesmitochondria, nucleus and chloroplast to confirm that the B. rapa plants comprised 100% of the correct and predicted organelle composition (i.e. B. rapa chloroplasts, nucleus of B. rapa and mitochondria of Ogura). Markers in Table 1 below can be used to confirm that the mitochondria are of Ogura (R. sativus), and that the nucleus and chloroplast are of B. rapa, i.e. and to exclude that the mitochondria are comprised of other sequences not originating from Ogura or to exclude that the chloroplasts are from Brassica sources other than B. rapa, such as chloroplasts that may originate from B. oleracea.

TABLE-US-00001 TABLE1 MarkersequencesorganellesBrassicaplants Sequence Chloroplastmarker CpRapa1(SEQIDNo.1) GAAATATGACCAACTGTGGTTCGAATATATATAA AAAAAGTTTGTTTTTTTACACTTCTTACTATCAGAT AGTGTGCAT CpOleracea1(SEQIDNo.2) GAAATATGACCAACTGTGGTTCGAATATATATAC AAAAAGTTTGTTTTTTTACACTTCTTACTATCAGAT AGTGTGCAT CpRapa2(SEQIDNo.3) CTCGAACAAGTAATCGAAAAGATTCTGGAGCATC TTCTGGTTTAGGTATTGCTCCTCCAATGATAGTGG TACCAAGTACTTCTTGGCGAGCTCTAATATGA CpOleracea2(SEQIDNo.4) CTCGAACAAGTAATCGAAAAGATTCTGGAGCATC TTCTGGTTTAGGTATTGTTCCTCCAATGATAGTGG TACCAAGTACTTCTTGGCGAGCTCTAATATGA CpRapa3(SEQIDNo.5) AAGGATTCATAAGTAGTTGTTAACGGAGTTGAAG TTACCAAATTCTGAGGAGTCGGTATCAATTTATGC CTAATTGCTCCGCCTATAGTTCCCTTAACTACATTT TCTAAACGAGCC CpOleracea3(SEQIDNo.6) AAGGATTCATAAGTAGTTGTTAACGGAGTTGAAG TTACCAAATTCTGAGGAGTAGGTATCAATTTATGC CTAATTGCTCCGCCTATAGTTCCCTTAACTACATTT TCTAAACGAGCC Nucleusmarker NRapa1(SEQIDNo.7) TCGGTCAAGGACTCGGATACATCGATGCTGGAGC ACAAAAAGAAGCAGAAGGAAGAGAAAACAGCGA TGGAGGAAGAGATGGAGAAGCTGAGAAGAGATC AGGCGGA NOleracea1(SEQIDNo.8) TCGGTCAAGGACTCGGATACATCGATGCTGGAGC ATAAGAAGAAGCAGAAGGAAGAGAAAACAGCGA TGGAGGAAGAGATGGAGAAGCTGAGAAGAGATC AGGCGGA NRapa2(SEQIDNo.9) CTGTGCCTCGGAAAGGTGAGTATCTTGTGTTGGAA GTTTATTTTCTTTGTCTCTCAGTGATCTCATGCATA CACAAACTTTTGTGCAGCCTGCGGATATATACCTG ATTGATGAGCCAAGTG NOleracea2(SEQIDNo.10) CTGTGCCTCGGAAAGGTGAGTATCTTGTGTTGGAA GTTTGTTTTCTTTGTCTCTCAGTGATCTCATGCATA CACAAACTTTTGTGCAGCCTGCGGATATATACCTG ATTGATGAGCCAAGTG Mitochondriamarker MtOgura(SEQIDNo.11) AAGAAGCAAAATCTCATTCAATTTGAAATAGAAG AGATCTCTATGCCCCCTGTTCTTG MtRapa1Fw(SEQIDNo.12) TCCCCTCTGTCCCTATGTTG MtRapa1Rev(SEQIDNo.13) GAGGTGTTGCCTATCCAGGT MtRapa2Fw(SEQIDNo.14) TTCGTTCGTTCACTTCGTTCT MtRapa2Rev(SEQIDNo.15) AGGCCTTTCCTTAAGCTTCCT MtRapa3Fw(SEQIDNo.16) GGAAGGATCGAACCATAGGAA MtRapa3Rev(SEQIDNo.17) TTGATGAGCCTTTACGAGTTGA MtOleracea1Fw(SEQIDNo.18) CGAAAACCTTCTGTTCTGTGG MtOleracea1Rev(SEQIDNo.19) CGGAGCGTAACCACTTTCTT MtOleracea2Fw(SEQIDNo.20) ATTCCCCACCCAACCAATAC MtOleracea2Rev(SEQIDNo.21) AAGAGCAGCTTTCTCCGTTCT MtOleracea3Fw(SEQIDNo.22) TTGCTGTATCGGAAAGTCCA MtOleracea3Rev(SEQIDNo.23) GCATGTCGTAAGCGAGTCAA

[0049] For example, the SNP marker SEQ ID No. 1 and SEQ ID No. 2 are used for the identification of the origin of the chloroplast being from B. oleracea or B. rapa. Chloroplasts that originate from the B. oleracea will have a C at position 34bp in SEQ ID No. 2, whereas chloroplasts that originate from B. rapa will have an A at position 34bp. The SNP marker SEQ ID No. 7 and SEQ ID No.8 are used for the identification of the origin of the genomic DNA being from B. oleracea or B. rapa. When the genomic DNA originates from B. oleracea there will be a T at position 36bp and a G at position 39bp in SEQ ID No. 8, whereas if the genomic DNA originates from the B. rapa there will be a C at position 36bp and an A at position 39bp. SEQ ID No. 11 was used for the identification of the origin of the mitochondria being from Ogura to confirm the CMS B. rapa.

[0050] In addition, SEQ ID No. 12 to 23 are primer sequences to determine if the mitochondria comprise B. rapa or B. oleracea mitochondrial sequences. PCR reaction was performed on plant total genomic DNA to discriminate between B. rapa and R. sativus mitochondrial genome as well as between B. oleracea and R. sativus mitochondrial genome. Following PCR, the product was incubated with restriction enzyme, according to table 2 and scored for their expected fragment sizes to determine the mitochondrial genome origin. The product after digestion was put on a 2% agarose gel and fragment sizes were analysed. For example, following PCR with SEQ ID No. 14 and 15 and digestion with DdeI, the R. sativum specific mitochondrion DNA product contains 4 fragments of 357, 81, 63 and 57 base pairs in size, whereas the B. rapa specific mitochondrion DNA product contains 5 fragments of 285, 81, 75, 63 and 57 base pairs in size.

TABLE-US-00002 TABLE 2 Mitochondrial genome analysis Brassica Primer Product combination size Restriction Products after restriction (nt) per mitochondria (SEQ ID No.) (nt) Enzyme B. rapa B. oleracea R. sativus 12 + 13 1417 Hpy188I 687 + 397 + 571 + 397 + 281 + 39 + 281 + 117 + 17 39 + 17 14 + 15 549 Dde1 285 + 81 + 357 + 81 + 75 + 63 + 63 + 57 57 16 + 17 673 HaeIII 377 + 164 + 377 + 246 + 82 + 50 50 18 + 19 420 Bsp119l 420 341 + 40 + 40 20 + 21 773 ApoI 773 474 + 303 22 + 23 568 SacI 317 + 182 + 317 + 255 77

[0051] Four plants have been included for marker analysis; B. rapa (wild type), B. oleracea (wild type), B. rapa old CMS (chlorotic), B. rapa new CMS (non-chlorotic, plant of present invention). Table 3 provides an overview, wherein + indicated that the marker was present and a indicated that the markers were absent in the plants. In respect to the PCR markers (SEQ ID No. 12 to 23) on the basis of the product fragments the plants were scored R (rapa) or O (oleracea), indicating the origin of the mitochondrial genome, and the indicated that the PCR did not yield a PCR product, i.e. an absence of B. rapa or B. oleracea mitochondrial sequences.

TABLE-US-00003 TABLE 3 Marker analysis on organelles of Brassica plants. Chloroplast Nucleus Mitochondria Seq ID No. 1 2 3 4 5 6 7 8 9 10 11 12 + 13 14 + 15 16 + 17 18 + 19 20 + 21 22 + 23 B. rapa + + + + + R R R B. oleracea + + + + + O O O B. rapa + + + + + + old CMS B. rapa + + + + + + new CMS

[0052] Results show that plants of present invention (B. rapa new CMS) only comprise chloroplasts and a nucleus that originate from B. rapa, wherein the chloroplasts are 100% associated with markers for B. rapa chloroplasts, and the nucleus is associated with markers for B. rapa nucleus. The chlorosis resistant CMS B. rapa plant of present invention was also tested to comprise only a mitochondrial genome of the Ogura type associated with SEQ ID No. 11, i.e. being a sterile (CMS) plant. No mitochondria genome of B. rapa or B. oleracea was present in the plant of present invention as indicated with the markers SEQ ID No 12 to 23.

Evaluation of Chlorosis in B. rapa

[0053] To evaluate yellowing in the developed plant materials, CMS B. rapa plant according to present invention (new), a CMS B. rapa plant known in the art (old) and a wild type B. rapa plant have been tested for chlorosis under cold conditions. At the same time, the flower quality, plant growth and stability of sterility have been evaluated. Chlorosis was evaluated prior to flowering in a cold greenhouse was done by eye. After four weeks of seedlings of B. rapa growing in a glass house were transferred to a non heated glass house for winter cultivation (at temperatures of between 5 to 12 C.).

[0054] Chlorosis was scored by visual inspection of the colour of the plant tissues, which gradually turn from green into yellow as the result of from partial failure to develop chlorophyll. A reduction of chlorophyll leads to yellowing of the tissue. Wild type B. rapa plants that are unaffected (i.e. not affected by a pathogen or nutrient deficiency which causes chlorophyll degradation) are have a normal green phenotype, where no chlorosis was observed and where the plant develops regular, green plant tissue. These plants obtain a score of 5 and are used as the benchmark in a scoring scale ranging from 1 to 5. A score of 1 refers to plants that show severe chlorosis with upper leaves markedly yellow and lower leaves very chlorotic. A score of 2 refers to very chlorotic with pronounced interveinal yellowing. A score of 3 refers to mild to moderate chlorosis, interveinal yellowing on the leaves. A score of 4 refers to near normal (wild type) phenotype, light green/interveinal yellowing, no chlorotic leaves. And a score of 5 thus refers to a green non yellowing phenotype of the B. rapa plant. B. rapa plants that obtain a score of 1 to 4, thus show chlorosis and these plants are not acceptable for commercial sale.

[0055] After 3-4 weeks and until commercial maturity in the non heated glass house (at temperatures between 5-12 C.), chlorotic symptoms were visible on the old CMS B. rapa plants (plant not according to present invention), scoring a 3 on the chlorosis as defined above. No chlorisos was observed on the new CMS B. rapa plants of present invention, which were scored a 5 on the chlorosis and was comparable to the wild type B. rapa plant. FIGS. 1 and 2 show plants and leaves of a CMS B. rapa plant according to present invention (new) having a B. rapa nucleus, Ogura mitochondria and B. rapa chloroplast that is chlorosis resistant, a wild type B. rapa plant, and a prior art CMS B. rapa plant (old) having a B. rapa nucleus, Ogura mitochondria and B. oleracea chloroplast. Chlorosis is especially visible as interveinal yellowing on upper trifoliates and on the stem of the leaves, gradually moving towards the leave on the old B. rapa plants. No chlorosis was visible on the CMS B. rapa plant of present invention during these 3 to 4 weeks under identical conditions. All plants in the three B. rapa groups were similar in size and shape, showing no adverse affects of the on plant growth and development. Also after further backcrosses in F1 no chlorosis and adverse effects on plant growth and plant development was observed in the CMS B. rapa plants of present invention.

[0056] Furthermore, the flower quality was assessed and plant sterility was conformed at the initial flowering stage. In the B. rapa plant of present invention, no pollen development and no self-pollination occurrence was observed. This assessment was followed twice a week in order to control newly opened flowers over the different stages of flowering until all flowers were opened. In addition, controlled normal development of petals, stigmas and nectar was observed, apart from the expected abnormal pollen anthers carrying no pollen in comparison with a wild type B. rapa plants (Cima di Rapa), see FIG. 3. FIG. 3 shows the flowers of a chlorosis resistant CMS B. rapa plant of present invention (upper picture) and a wild type male fertile B. rapa plant (lower picture). Pollen are clearly visible on the wild type plant having fully developed anthers that carry pollen grains, whereas the CMS B. rapa plant of present invention shows undeveloped anthers and the anthers are carrying no pollen at all.

[0057] Confirmation of female fertility of the B. rapa plant of present invention was performed by artificial hand pollination of sterile flowers with a wild type B. rapa pollen collected from neighbouring plant in the same greenhouse. Seed setting, ripening and drying were controlled during the season every week from pollination to harvest.