Construction Method and Application of Microorganism Capable of Realizing High Production of Lacto-N-neotetraose

Abstract

Disclosed are a construction method and application of a microorganism capable of realizing high production of lacto-N-neotetraose, belonging to the field of microbial genetic engineering. Coding genes of -1,3-acetyl glucosamine transferase, -1,4-galactosyl transferase and/or UDP-glucose 4 epimerase are over-expressed on the basis of a strain which is previously constructed by the team and is subjected to related-gene knockout, thus enabling the strain to have a synthesis capability of producing the lacto-N-neotetraose. The present disclosure accurately regulates the carbon flux of a metabolic pathway and relieves the metabolic stress by screening the high-efficiency -1,4-galactosyl transferase gene and regulating the expression of IgtA, Aa--1,4-GalT and galE in a lacto-N-neotetraose synthesis pathway in a combined manner. In a shake flask experiment, the lacto-N-neotetraose production capacity of Escherichia coli is 0.91 g/L. The lacto-N-neotetraose yield in a 3 L fermentation tank reaches 12.14 g/L. Therefore, the microorganism has an industrial application prospect.

Claims

1. A recombinant Escherichia coli, wherein -1,4-galactosyl transferase derived from Aggregatibacter actinomycetemcomitans NUM4039, -1,3-acetyl glucosamine transferase derived from Neisseria meningitidis, and UDP-glucose 4 epimerase derived from E. coli are expressed, and a gene encoding UDP-N-acetyl glucosamine-2-epimerase, a gene encoding glucosamine-6 phosphate deaminase, and a gene encoding -galactosidase are knocked out; and the amino acid sequence of the -1,4-galactosyl transferase is as set forth in SEQ ID NO.4.

2. The recombinant E. coli according to claim 1, wherein a gene encoding the -1,3-acetyl glucosamine transferase is expressed by using a pACYCDuet-1, pCDFDuet-1, pRSFDuet-1, pCOLADuet-1 or pETDuet-1 vector, and a gene encoding the UDP-glucose 4 epimerase and a gene encoding the -1,4-galactosyl transferase are co-expressed by using a pACYCDuet-1, pCDFDuet-1, pRSFDuet-1, pCOLADuet-1 or pETDuet-1 vector.

3. The recombinant E. coli according to claim 2, wherein the gene IgtA encoding the 6-1,3-acetyl glucosamine transferase is expressed by using the pRSFDuet-1 vector, and the gene galE encoding the UDP-glucose 4 epimerase and the gene Aa-1,4-GalT encoding the -1,4-galactosyl transferase are simultaneously expressed by using the pRSFDuet-1 vector.

4. The recombinant E. coli according to claim 2, wherein the gene IgtA encoding the -1,3-acetyl glucosamine transferase is expressed by using the pETDuet-1 vector, and the gene galE encoding the UDP-glucose 4 epimerase and the gene Aa--1,4-GalT encoding the -1,4-galactosyl transferase are simultaneously expressed by using the pRSFDuet-1 vector.

5. The recombinant E. coli according to claim 2, wherein the gene IgtA encoding the -1,3-acetyl glucosamine transferase is expressed by using the pCDFDuet-1 vector, and the gene galE encoding the UDP-glucose 4 epimerase and the gene Aa--1,4-GalT encoding the -1,4-galactosyl transferase are expressed by using the pETDuet-1 vector.

6. The recombinant E. coli according to claim 2, wherein the gene IgtA encoding the -1,3-acetyl glucosamine transferase is expressed by using the pACYCDuet-1 vector, and the gene galE encoding the UDP-glucose 4 epimerase and the gene Aa--1,4-GalT encoding the -1,4-galactosyl transferase are simultaneously expressed by using the pCOLADuet-1 vector.

7. The recombinant E. coli according to claim 1, wherein the sequence of the gene IgtA of N. meningitidis is as set forth in SEQ ID NO.1.

8. The recombinant E. coli according to claim 7, wherein the nucleotide sequence of the gene Aa--1,4-GalT encoding the -1,4-galactosyl transferase is as set forth in SEQ ID NO.2.

9. The recombinant E. coli according to claim 8, wherein the gene galE encoding the UDP-glucose 4 epimerase is derived from E. coli K-12, and the nucleotide sequence of the gene galE is as set forth in SEQ ID NO.3.

10. The recombinant E. coli according to claim 9, wherein the amino acid sequence of the UDP-N-acetyl glucosamine-2-epimerase WecB is set forth in SEQ ID NO.5, wherein the amino acid sequence of the glucosamine-6 phosphate deaminase NagB is set forth in SEQ ID NO.6, wherein the amino acid sequence of the -galactosidase LacZ is set forth in SEQ ID NO.7.

11. The recombinant E. coli according to claim 10, wherein the E. coli comprises E. coli BL21 (DE3).

12. A method for producing lacto-N-neotetraose, wherein the recombinant E. coli according to claim 1 is used to fermentatively produce the lacto-N-neotetraose.

13. The method according to claim 12, wherein the recombinant E. coli is cultured under the conditions of 35-40 C. and 180-220 rpm to obtain seed liquid, and the seed liquid is added to a fermentation system containing glycerin in an amount of 2-5% and cultured until OD6.sub.00 is 0.6-0.8; and IPTG and lactose are added, the concentrations of the IPTG and the lactose in the reaction system are enabled to be 0.1-0.5 mM and 3-5 g/L, respectively, and induction culture is carried out for no less than 90 hours.

14. The method according to claim 13, wherein the recombinant E. coli is cultured under the conditions of 35-40 C. and 180-220 rpm to obtain seed liquid, and the seed liquid is added to a fermentation system in an amount of 5-10% and cultured until OD6.sub.00 is 173; and IPTG and lactose are added, the concentrations of the IPTG and the lactose in the reaction system are enabled to be 0.1-0.5 mM and 5-10 g/L, respectively, and induction culture is carried out for no less than 45 hours.

15. The method according to claim 12, wherein the recombinant E. coli is cultured under the conditions of 37 C. and 200 rpm to obtain seed liquid, and the seed liquid is added to a fermentation system in an amount of 10% and cultured until OD6.sub.00 is 173; and IPTG and lactose are added, the concentrations of the IPTG and the lactose in the reaction system are enabled to be 0.2 mM and 10 g/L, respectively, and induction culture is carried out for 47.5 hours.

16. The method according to claim 15, wherein the lactose and glycerin are supplemented in the reaction process to maintain the concentrations of the glycerin and the lactose to be not less than 6 g/L and 5 g/L, respectively.

17. The method according to claim 15, wherein when the concentration of the glycerin in the reaction system is lower than 6 g/L, glycerin with a final concentration of 6 g/L is added at once; and when the concentration of the lactose in the reaction system is lower than 5 g/L, lactose with a final concentration of 5 g/L is added at once.

Description

BRIEF DESCRIPTION OF FIGURES

[0029] FIG. 1 is a diagram showing a metabolic pathway of lacto-N-neotetraose;

[0030] FIG. 2 is a diagram showing the yield of lacto-N-neotetraose under the regulation of different copy numbers of plasmids in a metabolic pathway;

[0031] FIG. 3A to FIG. 3D are liquid phase diagrams and mass spectra of a lacto-N-neotetraose product standard sample and a lacto-N-neotetraose product sample; and

[0032] FIG. 4 is a resulting diagram showing the fermentation yield of lacto-N-neotetraose in a 3 L fermentation tank.

DETAILED DESCRIPTION

[0033] 1. The plasmids, endonucleases, PCR enzymes, column DNA extraction kits, DNA gel recovery kits, and the like used in the following examples are commercial products, and the specific operations thereof are carried out in accordance with the kit instructions. [0034] 2. Colony PCR, nucleic acid agarose gel electrophoresis, protein SDS-PAGE gel electrophoresis, heat shock transformation, electrotransformation, preparation of competent cells, extraction and preservation of bacterial genomes, and other conventional operation methods are carried out based on Molecular Cloning: A Laboratory Manual (Fourth Edition). [0035] 3. The sequencing of plasmids and DNA products was entrusted to Shanghai Sangon Biotech Company for completion. [0036] 4. Preparation of competent E. coli: TAKARA kit. [0037] 5. Fermentation process and detection of lacto-N-tetrose [0038] (1) LB liquid medium: 10 g/L of peptone, 5 g/L of a yeast extract, and 10 g/L of sodium chloride. [0039] (2) LB solid medium: 10 g/L of peptone, 5 g/L of yeast extract powder, 10 g/L of sodium chloride, and 15 g/L of agar powder. [0040] (3) Fermentation medium: 20 g/L of glucose, 13.5 g/L of potassium dihydrogenphosphate, 4.0 g/L of diammonium hydrogenphosphate, 1.7 g/L of citric acid, 1.4 g/L of magnesium sulfate heptahydrate, and 10 ml/L of trace metal elements; and the trace metal elements include: 10 g/L of ferrous sulfate, 2.25 g/L of zinc sulfate heptahydrate, 1.0 g/L of anhydrous copper sulfate, 0.35 g/L of manganese sulfate monohydrate, 0.23 g/L of sodium borate decahydrate, 0.11 g/L of ammonium molybdate, and 2.0 g/L of calcium chloride dihydrate. [0041] (4) The fermentation process of lacto-N-neotetraose: constructed strains were inoculated into the LB liquid medium and cultured overnight for 12 h under the conditions of 37 C. and 200 rpm to obtain seed liquid; the seed liquid was inoculated into the 25 ml fermentation medium (containing 20 g/L glycerin) in an inoculation dosage of 2 mL/100 mL under the conditions of 37 C. and 200 rpm, and cultured until OD6.sub.00 is 0.6; and IPTG with a final concentration of 0.2 mM was added, 5 g/L lactose was added at the same time, and induction culture was continued for 96 h under the conditions of 25 C. and 200 rpm. 1 mL of fermentation broth was taken and centrifuged at 10,000 rpm for 10 min, and supernatant was extracted for HPLC determination. [0042] (5) HPLC detection conditions: high-performance ion exchange chromatography; chromatographic column: CarboPac PA10 (4 mm250 mm); detector: pulsed amperometric detector; mobile phase: A, ultrapure water; B, 1 M of sodium acetate; C, 250 mM of sodium hydroxide; flow rate: 1.0 mL/min; and injection volume: 20 L.

Example 1: Construction of Recombinant Vector

[0043] The specific steps for constructing the recombinant expression vector were as follows (see Table 1 for primer sequences involved):

(1) Obtaining of IgtA Gene Fragments and Construction of Plasmids pAC-IgtA, pCO-IgtA, pCDF-IgtA, pET-IgtA, and pRSF-IgtA

[0044] Under the conditions that the sequence of the gene IgtA of N. meningitidis (with a nucleotide sequence as shown in SEQ ID NO.1) was used as a template, and IgtA-F/R was used as a primer, PCR amplification was performed to amplify the IgtA gene fragments, and DNA fragments were collected by means of gel extraction. Under the conditions that IgtA-VF/R was used as a primer, and pRSFDuet-1, pETDuet-1, pCDFDuet-1, pCOLADuet-1 and pACYCDuet-1 vectors were used as templates, corresponding vector fragments were respectively amplified, and DNA fragments were collected by means of gel extraction.

[0045] The IgtA gene fragments amplified above were ligated to the corresponding vector fragments by means of a Gibson kit (produced by NEB Reagent Company, USA) to obtain the plasmids pRSF-IgtA, pET-IgtA, pCDF-IgtA, pCO-IgtA and pAC-IgtA, respectively.

(2) Obtaining of Aa--1,4-GalT and galE Gene Fragments and Construction of Plasmids pAC-Aa-galE, pCO-Aa-galE, pCDF-Aa-galE, pET-Aa-galE, and pRSF-Aa-galE

[0046] A gene Aa--1,4-GalT was synthesized by Suzhou JinWeizhi through codon optimization (the nucleotide sequence was as shown in SEQ ID NO.2). Under the conditions that the synthesized gene was used as a template, and Aa-F/R was used as a primer, PCR amplification was performed to amplify an Aa-1,4-GalT gene fragment, and DNA fragments were collected by means of gel extraction. Under the conditions that the genome of E. coli K-12 was used as a template, and Aa-GalE-F/R was used as a primer, PCR amplification was performed to amplify a galE gene fragment (the nucleotide sequence of a gene galE was as shown in SEQ ID NO.3), and DNA fragments were collected by means of gel extraction. Two pairs of primers, i.e., Aa-GalE-V.sub.1-F/R and Aa-GalE-V.sub.2 -F/R, were used to amplify the plasmids pRSFDuet-1, pETDuet-1, pCDFDuet-1, pCOLADuet-1, and pACYCDuet-1, respectively, and DNA fragments were collected by means of gel extraction.

[0047] The Aa--1,4-GalT and galE gene fragments amplified above were ligated to the corresponding vector fragments by means of a Gibson kit (produced by NEB Reagent Company, USA) to obtain the plasmids pAC-Aa-galE, pCO-Aa-galE, pCDF-Aa-galE, pET-Aa-galE, and pRSF-Aa-galE, respectively.

TABLE-US-00001 TABLE1 Primersforplasmidconstruction Primername Primersequence(5'-3') IgtA-F CTTTAAGAAGGAGATATACCATGGGCCAGCCGCTGG (SEQIDNO.8) IgtA-R GCGCCGAGCTCGAATTCTTAACGGTTTTTCAGCAGA CGGT(SEQIDNO.9) IgtA-V-F TCTGCTGAAAAACCGTTAAGAATTCGAGCTCGGCGC (SEQIDNO.10) IgtA-V-R CCAGCGGCTGGCCCATGGTATATCTCCTTCTTAAAG TTAAACAAAATTATTTC(SEQIDNO.11) Aa-F GATATACCATGGGCAGCAGCCATATGAACAGCACCG AAAACAAAAACTTTG(SEQIDNO.12) Aa-R CCTGGCTGTGGTGATGATGGTGTTAATGTTTGCGTT TTTCATATTTCAGGTTAATTTTGC(SEQIDNO. 13) Aa-GalE-F CTCAATTGGATGAGAGTTCTGGTTACCGGTGGT (SEQIDNO.14) Aa-GalE-R CCGATATTTAATCGGGATATCCCTGTGGATGGC (SEQIDNO.15) Aa-GalE- CGCAAACATTAACACCATCATCACCACAGCCAGG V.sub.1-F (SEQIDNO.16) Aa-GalE- ACCACCGGTAACCAGAACTCTCATCCAATTGAGATC V.sub.1-R TGCCATATGTATATCTCCTTC(SEQIDNO.17) Aa-GalE- GCCATCCACAGGGATATCCCGATTAAATATCGGCCG V.sub.2-F GCCACGC(SEQIDNO.18) Aa-GalE- GGTGCTGTTCATATGGCTGCTGCCCATGGTATATCT V.sub.2-R CCTTATTAAAG(SEQIDNO.19)

Example 2: Construction of Recombinant Strains

[0048] A gene wecB encoding UDP-N-acetyl glucosamine-2-epimerase WecB (NCBI sequence number: YP_026253.1), a gene nagB encoding glucosamine-6 phosphate deaminase NagB (NCBI sequence number: NP_415204.1), and a gene lacZ encoding -galactosidase LacZ (NCBI sequence number: NP_414878.1) in E. coli BL21 were knocked out. For the gene knockout method, please refer to Patent Publication No. CN111979168A. Recombinant strains were constructed.

[0049] On the basis of the aforementioned recombinant strains, the recombinant plasmids constructed in Example 1 were transferred into the aforementioned recombinant strain of E. coli whose genes wecB, nagB, and lacZ were knocked out, and the key genes of lacto-N-neotetraose were expressed in a combined manner to obtain 18 different engineered strains, which were respectively denoted as EA1-18. The constructed recombinant strains are as shown in Table 2.

Example 3: Fermentation of Recombinant Strains to Produce lacto-N-neotetraose

[0050] Plasmid pRSFDuet-1 had a larger copy number, plasmid pETDuet-1 had a medium copy number, while plasmids pCDFDuet-1 and pCOLADuet-1 had smaller copy numbers, and plasmid pACYCDuet-1 had a minimum copy number. RSF, CoIE1, CDF, CoIA and P15A were replicons for expressing plasmids pRSFDuet-1, pETDuet-1, pCDFDuet-1, pCOLADuet-1 and pACYCDuet-1, respectively, representing different copy numbers, and the copy numbers of the five replicons were 100, 40, 20-40, 20-40 and 10-12, respectively.

[0051] The strains constructed in Example 2 were respectively inoculated into an LB liquid medium and cultured overnight for 12 h under the conditions of 37 C. and 200 rpm to obtain seed liquid; the seed liquid was inoculated into a 25 ml fermentation medium (containing 20 g/L glycerin) in an inoculation dosage of 2 mL/100 mL under the conditions of 37 C. and 200 rpm, and cultured until OD6.sub.00 is 0.6; and IPTG with a final concentration of 0.2 mM was added, g/L lactose was added at the same time, and induction culture was continued for 96 h under the conditions of 25 C. and 200 rpm. 1 mL of fermentation broth was taken and centrifuged at rpm for 10 min, and supernatant was extracted for HPLC determination.

[0052] The results are as shown in Table 2: after fermentation, the lacto-N-neotetraose yields of the different engineered strains were 0.78 g/L, 0.13 g/L, 0.01 g/L, 0.61 g/L, 0.58 g/L, 0.43 g/L, g/L, 0.02 g/L, 0.64 g/L, 0.17 g/L, 0.15 g/L, 0.47 g/L, 0.23 g/L, 0.44 g/L, 0.11 g/L, 0.35 g/L, g/L, and 0.91 g/L, respectively. The engineered strain (i.e., strain EA18) containing the recombinant plasmids pAC-IgtA and pCO-Aa-galE obtained the highest yield of 0.91 g/L (see FIG. 2 for the lacto-N-neotetraose yields of all the engineered strains). Therefore, the gene IgtA expressing a relatively low gene dosage and the genes Aa--1,4-GalT and galE expressing a relatively high gene dosage can achieve higher lacto-N-neotetraose yields.

TABLE-US-00002 TABLE 2 Detailed information on shake flask fermentation of all engineered strains Lacto-N- Strain neotetraose yield name Plasmids contained in host, and genotype (g/L) EA1 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.78 containing plasmids pRSF-lgtA and pET-Aa-galE EA2 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.13 containing plasmids pRSF-lgtA and pCDF-Aa-galE EA3 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.01 containing plasmids pRSF-lgtA and pAC-Aa-galE EA4 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.61 containing plasmids pET-lgtA and pRSF-Aa-galE EA5 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.58 containing plasmids pET-lgtA and pCDF-Aa-galE EA6 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.43 containing plasmids pET-lgtA and pCO-Aa-galE EA7 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.42 containing plasmids pET-lgtA and pAC-Aa-galE EA8 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.02 containing plasmids pCDF-lgtA and pRSF-Aa-galE EA9 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.64 containing plasmids pCDF-lgtA and pET-Aa-galE EA10 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.17 containing plasmids pCDF-lgtA and pCO-Aa-galE EA11 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.15 containing plasmids pCDF-lgtA and pAC-Aa-galE EA12 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.47 containing plasmids pCO-lgtA and pET-Aa-galE EA13 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.23 containing plasmids pCO-lgtA and pCDF-Aa-galE EA14 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.44 containing plasmids pCO-lgtA and pAC-Aa-galE EA15 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.11 containing plasmids pAC-lgtA and pRSF-Aa-galE EA16 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.35 containing plasmids pAC-lgtA and pET-Aa-galE EA17 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.24 containing plasmids pAC-lgtA and pCDF-Aa-galE EA18 E. coli BL21 (DE3) whose genes wecB, nagB, and lacZ are knocked out, 0.91 containing plasmids pAC-lgtA and pCO-Aa-galE

Example 4: Engineered Strain Fermentation Tank with Efficient Production to Produce lacto-N-neotetraose

[0053] In order to further verify the effectiveness of the synthesis method of lacto-N-neotetraose and increase the lacto-N-neotetraose yield, the seed liquid of recombinant E. coli EA18 was inoculated into a fermentation medium with a working volume of 1 L in an inoculation dosage of 10%, where the fermentation temperature of a fermentation tank was 37 C., the stirring speed was 800 r/min, the ventilation volume was 1 vvm, and the pH was 7.0 (automatically controlled by supplementing ammonia water). Fermentation was performed for 12.5 h (OD.sub.600 was approximately 17.6), lactose with a final concentration of 10 g/L and IPTG with a final concentration of 0.2 mM were added, and culturing was carried out at 25 C. During the culturing, glycerin and lactose were manually supplemented: when the concentration of the glycerin in the reaction system was below 6 g/L, 30 mL of mother liquor (600 g/L glycerin mother liquor) was added supplementarily, and when the concentration of the lactose was below 5 g/L, 25 ml of mother liquor (200 g/L lactose mother liquor) was added supplementarily, thus maintaining the growth of strains and the synthesis of lacto-N-neotetraose. After the entire culturing process reached 47.5 h, the OD.sub.600 of the strains reached 127, and the yield of the lacto-N-neotetraose was the maximum, reaching up to 12.14 g/L (see FIG. 4).

TABLE-US-00003 TABLE 3 Dynamic changes in synthetic amount of strains and lacto-N-neotetraose during fermentation Time (h) 11.5 12.5 17.5 22.5 25.75 33.75 38 45 47.5 OD.sub.600 14 17.6 47 73 112 129 134 131 127 Lacto-N- 0 0 0.03 0.63 1.69 3.61 5.76 9.0 12.14 neotetraose (g/L) Lacto-N-triose II 0 0 0.07 0.48 1.71 2.04 5.46 8.2 9.36 (g/L) Glycerin (g/L) 18.4 12.6 5.65 10.4 17.8 10.06 19.71 14.96 4.78 Lactose (g/L) 0 10 6.22 8.4 4.22 5.94 2.47 3.84 3.43

[0054] Although the present disclosure has been disclosed as above in exemplary examples, it is not intended to limit the present disclosure. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present disclosure. Therefore, the protection scope of the present disclosure shall be as defined in the Claims.