SYSTEMS AND METHODS FOR IN VIVO DUAL RECOMBINASE-MEDIATED CASSETTE EXCHANGE (dRMCE) AND DISEASE MODELS THEREOF
20190390222 ยท 2019-12-26
Assignee
Inventors
- Joshua Breunig (Los Angeles, CA)
- Moise Danielpour (Los Angeles, CA, US)
- Gi Bum KIM (North Hollywood, CA, US)
Cpc classification
C12N2015/8572
CHEMISTRY; METALLURGY
C12N2830/50
CHEMISTRY; METALLURGY
A01K2217/07
HUMAN NECESSITIES
A01K67/0275
HUMAN NECESSITIES
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/8509
CHEMISTRY; METALLURGY
A61K49/0008
HUMAN NECESSITIES
C12N2800/80
CHEMISTRY; METALLURGY
A61K48/0066
HUMAN NECESSITIES
International classification
A61K48/00
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
Abstract
Described herein are donor vectors and systems for use in in vivo dual recombinase-mediated cassette exchange. Also described are animal models for consistent, rigorous, and facile investigation of transgene expression. Further described are methods of screening for therapeutic drugs using these animal models, and methods of treatment
Claims
1. A system, comprising: a promoter-less donor vector, comprising a polyadenylation signal or transcription stop element upstream from a transgene or RNA, the transgene or RNA, and paired recombinase recognition sites; and one expression vector, comprising two genes encoding recombinases specific to the paired recombinase recognition sites, or two expression vectors, the first expression vector comprising one gene encoding a first recombinase that is specific to one of the paired recombinase recognition sites, and the second expression vector comprising one gene encoding a second recombinase that is specific to the other of the paired recombinase recognition sites.
2. The system of claim 1, wherein the promoter-less donor vector further comprises a post-transcriptional regulatory element.
3. The system of claim 1, wherein the promoter-less donor vector further comprises a polyadenylation signal downstream from the transgene or RNA.
4. The system of claim 1, wherein the promoter-less donor vector comprises: PGK polyadenylation signal (pA); trimerized SV40 pA; the transgene or RNA; loxP and flippase recognition target (FRT); a rabbit beta-globin pA; and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).
5. The system of claim 1, wherein the paired recombinase recognition sites are loxP and flippase recognition target (FRT), and the recombinases are cre and flp.
6. The system of claim 1, wherein the RNA is siRNA.
7. The system of claim 1, wherein the RNA is shRNA.
8. The system of claim 1, wherein the RNA is sgRNA.
9. The system of claim 1, wherein the transgene or the RNA comprises disease associated mutations.
10. A promoter-less donor vector, comprising: a polyadenylation signal or transcription stop element upstream from a transgene or RNA; the transgene or RNA; and paired recombinase recognition sites.
11. The promoter-less donor vector of claim 10, further comprising a post-transcriptional regulatory element.
12. The promoter-less donor vector of claim 10, further comprising a polyadenylation signal downstream from the transgene or RNA.
13. The promoter-less donor vector of claim 10, comprising: PGK polyadenylation signal (pA); trimerized SV40 pA; a transgene or RNA; loxP and flippase recognition target (FRT); a rabbit beta-globin pA; and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).
14. A non-human animal model comprising the system of claim 1.
15. The non-human animal model of claim 14, wherein dual Recombinase-Mediated Cassette Exchange has occurred.
16. The non-human animal model of claim 14, wherein the animal is a mouse.
17. A method of producing the non-human animal model of claim 14, comprising: providing the system of claim 1; administering the system to the non-human animal; and subjecting the non-human animal to electroporation.
18. A method of screening a drug candidate, comprising: providing the non-human animal model of claim 14; administering the drug candidate; and assessing the effects of the drug candidate on the non-human animal model.
19. A method of treating a disease or condition in a subject, comprising: providing a cell comprising the system of claim 1; and administering the cell to the subject.
20. The method of claim 19, wherein the cell is a stem cell.
21. The method of claim 19, wherein dual Recombinase-Mediated Cassette Exchange has occurred in the cell.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0005] Exemplary embodiments are illustrated in referenced figures. It is intended that the embodiments and figures disclosed herein are to be considered illustrative rather than restrictive.
[0006]
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
DESCRIPTION OF THE INVENTION
[0022] All references cited herein are incorporated by reference in their entirety as though fully set forth. Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 3.sup.rd ed., Revised, J. Wiley & Sons (New York, N.Y. 2006); and Sambrook and Russel, Molecular Cloning: A Laboratory Manual 4.sup.th ed., Cold Spring Harbor Laboratory Press (Cold Spring Harbor, N.Y. 2012), provide one skilled in the art with a general guide to many of the terms used in the present application.
[0023] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described.
[0024] The term control elements refers collectively to promoter regions, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites (IRES), enhancers, and the like, which collectively provide for the replication, transcription and translation of a coding sequence in a recipient cell. Not all of these control elements need always be present, so long as the selected coding sequence is capable of being replicated, transcribed and translated in an appropriate host cell.
[0025] The term promoter region is used herein in its ordinary sense to refer to a nucleotide region including a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene which is capable of binding RNA polymerase and initiating transcription of a downstream (3-direction) coding sequence.
[0026] Operably linked refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, control elements operably linked to a coding sequence are capable of effecting the expression of the coding sequence. The control elements need not be contiguous with the coding sequence, so long as they function to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered operably linked to the coding sequence.
[0027] With the unbiased identification of nearly 300 recurrent, putative cancer driver mutations, many of which are GOF oncogenes, it is imperative to create a tractable in vivo platform that can model these cancer drivers. For loss-of-function (LOF) mutations in tumor suppressors, large-scale knockout (KO) mice consortia now offer immediate access to relevant GEMMs, but modeling a tumor with multiple KOs will require many floxed alleles that can recombine independently, complicating the results. In light of this, CRISPR/Cas9-based studies have now demonstrated the ability to induce multiple KOs in vivo in mice. For GOF mutations, however, it remains a daunting prospect to compile an exhaustive catalogue of necessary GEMMs.
[0028] Focusing on the CNV, positional variability, and insertional mutagenesis problems of non-GEMM models, we sought a method that can ensure uniform gene dosage among transfected cells and thus looked to dRMCE (also discussed herein as mosaic analysis by dual recombinase-mediated cassette exchange (MADR)), which has been explored as an efficient knock-in method. Conventionally, this method necessitates antibiotic clonal selection and Southern probing of positive integrants, typically mouse embryonic stem cells (mESCs). With appropriate safeguards, we demonstrate that successful dRMCE can be catalyzed in situ in somatic cells, using an off-the-shelf reporter mouse Rosa26mTmG (mTmG) with definitive genetic labeling of recombined cells (
[0029] Rosa26mTmG is a widely used reporter line that constitutively expresses membrane tdTomato and switches to EGFP expression upon Cre-mediated excision of tdTomato cassette. In order to accommodate dRMCE in mTmG, we utilized the unused blue fluorescence channel and created a promoter-less donor plasmid encoding TagBFP2, as well as TagBFP2-tagged HrasG12V, flanked by loxP and FRT sites (
[0030] Evaluating GOF proteins are often accomplished in vitro but constitutive transgene expression can be detrimental to stable cell line generation. To obviate this issue, inducible genetic systems, such as TRE, are sometimes employed. To expand the utility of single-allele mTmGHet mNSCs, we aimed to create a pipeline for inducible cell line production by creating a single dRMCE-compatible plasmid containing rtTA-V10 and TRE-Bi element (
[0031] Given the lack of EGFP expression after puro selection in the TRE-Bi-EGFP cell line, we reasoned that we could use similar Dox-inducible plasmids to express four different spaghetti monster fluorescent proteins (SM_FPs), which allow for orthogonal detection through their different epitope tags. We used MADR with multiply-antigenic XFPs (MADR MAX) to empirically assess whether more than one copy of each plasmid could be expressed per cell (
[0032] This in vitro system will be beneficial to interrogating GOF protein functions in various primary cell lines derived from any animal carrying loxP and Frt by providing more homogeneous, inducible stable cell lines. As proof-of-principle for this, and to empirically test the utility of the potential leakiness of the 3 cistron of the TRE-Bi elementwhich could potentially be activated by upstream promoters or enhancers-we also generated a cell line that inducibly expresses the Notch signaling ligand, Dll1, with a bicistronic TRE-Bi-Dll1/EGFP donor vector (
TABLE-US-00001 TABLE1 PrimersusedforPCRscreening SEQ ID NO: F1 GCAACGTGCTGGTTATTGTGC mtmg-cagF 1 F2 CTCAATCCAGCGGACCTTCC mtmg-wpreF 2 F3 AGCAAAGACCCCAACGAGAAG EGFP-F 3 F4 TGTCTGGATCCCCATCAAGC mtmg-sv40F 4 F5 ATGCCCTGGCTCACAAATAC rbglobpAF 5 F6 ACACAGGCATAGAGTGTC SV40pA-F 6 R1 GATGACGGCCATGTTGTTGTCC mtmg-tdtomatoR2 7 R2 TTTAACAGAGAGAAGTTCGTGGC pTV-R 8 R3 GGAGCGGGAGAAATGGATATG Rosa26-wildtype-R 9 R4 CGAAAGGCCCGGAGATGAGGAAG PGKpromR 10 R5 TGATCGCGCTTCTCGTTGGG EGFP653CSseq 11
[0033] To investigate the applicability of in vivo dRMCE, we EP-ed into the neural stem/progenitor cells lining the VZ/SVZ of postnatal mTmGHet pups with TagBFP2 donor vector with Flp-Cre expression vector (
[0034] However, most TagBFP2+ cells exhibited an absence of tdTomato and EGFP expressions by 2 weeks post-EP (
[0035] In mTmGHet with HrasG12V, we saw a tumorigenic growth of blue recombined cells (i.e., single-copy HrasG12V), but green sibling cells that underwent only Cre-recombination (i.e., without HrasG12V) did not display any abnormal growth (
[0036] MADM has shown that the combined Trp53- and Nfl-LOF mutations promote the pre-malignancy hyperproliferation of oligodendrocyte progenitors (OPCs). We aimed to mimic a similar developmental phenomenon using our method. First, we created a donor construct harboring three contiguous validated miR-E-based shRNAs targeted at Nfl, Pten, and Trp53 tied to TagBFP2 expression (
[0037] Given the ability of our MADR system to independently lineage trace multiple populations of GOF and LOF cells in vivo, we reasoned that it might be useful for studying glial development. It was elegantly demonstrated using MADM that the combined Trp53- and Nfl-LOF mutations promote the pre-malignancy hyperproliferation of oligodendrocyte progenitors (OPCs). We aimed to mimic a similar developmental phenomenon using our method. First, we created a donor construct harboring three contiguous validated miR-E-based shRNAs targeted at Nfl, Pten, and Trp53 tied to TagBFP2 expression (
Generation of Focal Glioma Models Based on In Vivo MADR
[0038] Viral and EP tumor models are increasingly employed to study developmental, evolutionary aspects of cancer in various tissue, but there are issues with various gene delivery methods. We reasoned that our method could be best suited for in vivo, autochthonous modeling of putative cancer driver genes, and for proof-of-principle, chose Hras.sup.G12V, a highly-used activating oncogene. Histological analysis of growth dynamics in putatively single-copy heterozygous mice indicated that Hras.sup.G12V cells rapidly overproliferated when compared with EGFP+ populations (
[0039] A current unmet need in terms of mouse models of cancer is a higher throughput method of personalized tumor modeling. With the recent surge of knowledge about the putative driver mutations in cancer, there is a need for platforms that can rapidly and comprehensive model these mutations in vivo in a combinatorial manner. For example, recently, H3F3A, PDGFRA, and TRP53 were found to be recurrent in pediatric gliomas. Intriguingly, the H3F3A mutations were in two residuesK27 and G34. Notably, resulting patient tumors bearing either K27M or G34R/V mutations in H3F3A exhibit markedly different transcriptomes as well as clinical behaviors. In particular, patient K27M gliomas cluster along the midline and emerge earlier than G34R/V gliomas, which largely reside in the cerebral hemispheres. Nevertheless, H3F3A gliomas of both classes typically harbor TRP53 mutations and can exhibit PDGFRA activating mutations. To model these pediatric tumors in mice, we generated a cassette for co-expression of H3f3a mutations (tagged to EGFP), an activated Pdgfra (D842V), and mutant Trp53 (R270H) (
[0040] Mechanistically, it is thought that K27M mutations lead to hypomethylation at this residue. In fact, given the intrinsic ability of MADR to lineage trace tumor cells, we were able to confirm the hypomethylation of K27M mutant cells by K27Me antibody (
Lineage Tracing CRISPR/Cas9 Induced MADR MAX Glioma Models Reveals Tumor to Pericyte Transdifferentiation
[0041] Recently, CRISPR/Cas9 has been demonstrated to be highly efficacious for the mutation of genes in vivo using EP. However, a shortcoming of these studies is a definitive way to lineage trace modified cells. To address this issue, we created a SM_BFP2-P2a-SpCas9-containing donor plasmid to simultaneously label and mutate cells, enabling faithful tracing of mutant cells in vivo (
[0042] With the recent surge of putative driver mutations, there is a need for platforms that can rapidly and comprehensive model these mutations in vivo in a combinatorial manner. Recently, H3f3a, Pdgfra, and Trp53 were found to be recurrent in pediatric gliomas. We demonstrate that EP of two donor plasmids carrying different combinations of these mutations result in proliferating hyperplasias by P50 (
[0043] We demonstrated that dRMCE-mediated somatic transgenesis in vivo is a highly robust, cost-effective method for creating numerous somatic mosaics using one mouse line. Specifically, dRMCE has been utilized recently in vitro but suffers from relatively low efficiency of insertions, thus requiring antibiotic selection of clonal cell lines and rigorous validation of individual cell lines with molecular biological methods (PCR, southern blot, etc.). Here we demonstrate that we can achieve roughly 90% expression of transgenes in vivo with RMCE by careful plasmid design, by titration of the constituent plasmid elements and, by utilizing a safe-landing site (e.g., the ROSA26 locus for various embodiments described herein). This allows for consistent, rigorous, and facile investigation of single or dual copy transgene expression. By comparison, episomal and transposon mediated insertion often leads to the supraphysiological expression from tens or hundreds of copies of the given transgene. Moreover, episomal transgenes will more often dilute in proliferating lineages and transpon-based methods will cause cassette hopping in the presence of transposases, potentially disrupting endogenous gene function, including tumor suppressors, cell cycle genes, etc. Further, through the use of the mt/mg reporters to delineate recombinase events, by titrating plasmid constituents and by using multiple donor plasmids, one can track multiple independent lineages.
[0044] We demonstrated the ability to combine flexibly two broad modes (GOF/LOF) of tumor mutations. This strategy can be employed with any off-the-shelf GEMM harboring dual recombinase sites (e.g., Ail4, R26-CAG-LF-mTFP1, and IKMC mice), allowing for the definitive assessment of GOF and LOF protein functions in vivo at a defined dosage (
[0045] Our in vivo MADR efficiency experiment indicates that diluting the concentration of donor construct possibly mimics single-substrate-based recombination reactions that occur in double-transgenic GEMMs with floxed loci and Cre-recombinase (
TABLE-US-00002 TABLE 2 Transposition- Method GEMM Standard EP mediated EP Virus MADR Time for Months ~2 weeks per ~2 weeks per >4-6 weeks ~2 weeks per engineering plasmid plasmid plasmid and generation Copy number 1-2 per Highly Highly Variable but 1-2 knock-in Variable Variable likely less depending on than EP zygosity of recipient Breeding More Not Not Only 1 line per complex for Necessary Necessary Necessary for targeted stain conditional RCAS/Tva alleles Stability of Generally Prone to Prone to Prone to Generally Expression stable dilution silencing and silencing and stable depending on and/or insertional insertional depending on locus silencing effects effects locus silencing silencing Payload Limited by Typically Typically Limited to Typically targeting governed by governed by viral governed by construct* plasmid plasmid payloads plasmid limits* limits* limits* Focality Depends on Focality Focality Diffusion Focality cis regulatory depends on depends on pattern depends on elements electrode electrode unidirectional electrode orientation orientation from orientation injection site *BAC DNA can be utilized
New MADR EP Toolkit
[0046] Transposons, such as PB and Sleeping Beauty, are increasingly used in combination with EP to produce stable somatic trangenics with several reports utilizing these techniques in recent years. Transposons are extremely attractive tools because they allow long-term developmental studies and also in vivo tumor generation. Our new method overcomes transposon system's two major problems: random genomic insertions and copy number variability. Notch signaling is one key example of gene-dosage-sensitive molecular pathways. Additionally, several other cell-fate determinants have been shown to result in dramatically differential phenotypes based on their expression levels. For example, high Nfia expression in glial progenitors favor their differentiation into astrocytes, while low expression is observed in cells that become oligodendrocytes, and in another example, higher Fezf2 expression induces the NSC quiescence in the VZ/SVZ by upregulating Notch signaling effectors. Our method can be used for rapidly assessing such pathways in vivo. Using one-copy vs. two-copy comparison paradigm shown in this report, such nuclear factors can be investigated in one mouse with natural intra-section control cells. Our in vivo MADR is extensible and relatively inexpensive when compared with GEMM engineering. Moreover, given the fact that the postnatal EP procedure is rapid (35 minutes per litter of animals) and requires no invasive surgery, this methodology can be easily adopted by many labs.
Extensibility of MADR to Existing GEMMs
[0047] This strategy can be employed with any off-the-shelf GEMM harboring dual recombinase sites (e.g. Ail4, R26-CAG-LF-mTFP1, Ribotag, and IKMC mice), allowing for the definitive assessment of GOF and LOF protein functions in vivo at a defined dosage (
[0048] Because our method requires two different recombinases, one can also drive the expression of these recombinases with different combinations of promoters to restrict the types of cells that are recombined. For example, this method can be used to compare and contrast the fate-mapping of lineages that arise from discrete stem and progenitor subsets by using cell type-specific Flp/Cre expression. Finally, there is in vivo MADR with large-cargo bacterial artificial chromosomes (BAC). A donor plasmid harboring large chunks of genomic fragments driving the expression of fluorescent reporter or recombinases, such as vCre or sCRE, can be created with loxP and FRT sites added on each end. Then, EP can deliver this large fragment at limiting dilutions into the genome in combination with additional plasmids carrying vCre/sCre-activatable reporters. This type of study would effectively enable GEMM-like, higher-order lineage tracing studies.
[0049] Next generation sequencing has exponentially increased our understanding of the genomic and transcriptomic changes that occur in tumorigenesis. However, with the catalogue of recurrent somatic mutations in tumors continuing to grow, an emerging problem is to separate tumor-promoting driver mutations from passenger mutations. Further, it is now increasingly appreciated that similarly histologically classified tumors can often have disparate genetic underpinnings that create notably different tumor phenotypes (e.g., K27M vs. G34R tumors). GEMMS have been the critical for the understanding of glioma development. In particular, the elegant MADM methodology has provided unique insights into the tumor cell of origin and potential treatments. We show proof of principle for using MADR as a platform for rapid personalized modeling of pediatric GBM. By combining MADR GOF transgenesis, and CRISPR/Cas9 LOF manipulations, it is possible for a small lab to generate the plasmid reagents necessary to cover the spectrumand, thus, possible combinationsof mutations for most tumor types.
[0050] Our findings therefore establish in vivo MADR as a robust methodology for stable mosaic analysis, one which overcomes many of the inherent drawbacks in viral, GEMM, EP, and transposon-based approaches. Additionally, this genetic framework is adaptable to the thousands of strains of mice engineered with dual recombinase recognition sites. Thus, these tools promise to allow for efficient, higher throughput investigation of gene function in development and disease.
[0051] Accordingly, various embodiments of the present invention are based, at least in part, on these findings.
Donor Vectors
[0052] Various embodiments of the present invention provide for a promoter-less donor vector, comprising: a polyadenylation signal or transcription stop element upstream from a transgene or RNA; the transgene or RNA; and paired recombinase recognition sites.
[0053] In various embodiments, the promoter-less donor vector further comprises a post-transcriptional regulatory element.
[0054] In various embodiments, the promoter-less donor vector further comprises a polyadenylation signal downstream from the transgene or RNA.
[0055] In various embodiments, the promoter-less donor vector comprises PGK polyadenylation signal (pA); trimerized SV40 pA; a transgene or RNA; loxP; flippase recognition target (FRT); a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); and a rabbit beta-globin pA.
[0056] Various embodiments of the present invention provide for a promoter-less donor vector, comprising: a transcription stop element upstream from a transgene or RNA; paired recombinase recognition sites; rtTA-V10; the transgene or RNA; and TRE-Bi. In various embodiments, the promoter-less donor vector further comprises a post-transcriptional regulatory element. In various embodiments, the promoter-less donor vector further comprises a gene encoding puromycin.
[0057] In various embodiments the promoter-less donor vector, comprises: a transcription stop element upstream from a transgene or RNA; loxP; rtTA-V10; the transgene or RNA; TRE-Bi; and flippase recognition target (FRT). In various embodiments, the promoter-less donor vector further comprises a post-transcriptional regulatory element. In various embodiments, the promoter-less donor vector further comprises a gene encoding puromycin
[0058] Various embodiments of the present invention provide for a promoter-less donor vector, comprising: a transcription stop element upstream from a transgene or RNA; paired recombinase recognition sites; rtTA-V10; the transgene or RNA; and TRE-Bi-Dll1. In various embodiments, the promoter-less donor vector further comprises a post-transcriptional regulatory element. In various embodiments, the promoter-less donor vector further comprises a gene encoding puromycin.
[0059] In various embodiments, the promoter-less donor vector comprises: a transcription stop element upstream from a transgene or RNA; loxP; rtTA-V10; the transgene or RNA; TRE-Bi-Dll1; and flippase recognition target (FRT). In various embodiments, the promoter-less donor vector further comprises a gene encoding puromycin.
[0060] The orientation of the paired recombinase sites are dictated by the engineered locus in the transgenic animal (i.e., the recombinase sites will exactly mimic the outer pair of recombinase sites if the transgene is to be inserted in the sense direction of the upstream promoter). Accordingly, in various embodiments, the paired recombinase recognition sites are in the correct orientation. In various embodiments, the loxP is not in an inverted orientation.
[0061] In various embodiments, the paired recombinase recognition sites are loxP and flippase recognition target (FRT), and the recombinases are cre and flp. Examples of Flp include flpE and flpO.
[0062] Other examples of recombinases (and sites) include but are not limited to VCre (Vlox and derivatives), SCre (Slox and derivatives), Dre (Rox and derivatives), and phiC31 (attb).
[0063] In various embodiments, the RNA is siRNA, shRNA, or sgRNA.
[0064] In various embodiments, the transgene or the RNA comprises disease associated mutations. In various embodiments, the transgene or the RNA comprises a gain-of-function (GOF) mutation. In various embodiments, the transgene or the RNA comprises a loss-of-function (LOF) mutation.
[0065] Examples of transgenes include but are not limited to oncogenic gain-of-function mutations, including Ras, H3f3a, Pdgfra, Trp53 point mutations, Idh1. Examples of RNAs (shRNA and sgRNA) include but are not limited to tumor suppressor targets such as Trp53, Nfl, Atrx, or Pten.
[0066] Examples of post-transcriptional regulatory element include but are not limited to Hepatitis B virus post-transcriptional regulatory element (HPRE) and Woodchuck Hepatitis virus post-transcriptional regulatory element (WPRE).
[0067] In various embodiments, the promoter-less donor vectors describe above and below further comprise a gene encoding an antibiotic. In various embodiments, the promoter-less donor vector further comprises a gene encoding puromycin, or eukaryotic alternatives (kanomycin, blasticidin, etc.). In various embodiments, the promoter-less donor vector described above and below further comprises a gene encoding a doxycycline-regulated transactivator or CRISPR/Cas based variant (e.g., SpCas9 or Cpf1) for DNA cleavage, gene activation (Crispra), or gene repression (Crispri) when paired with an sgRNA.
[0068] In various embodiments, the promoter-less donor vectors described above and below further comprises a gene encoding one or more spaghetti monster fluorescent proteins (SM_FPs). In various embodiments, the one or more SM_FPs are each different SM_FPs. In various embodiments, the one or more SM_FPs are four different SM_FPs.
[0069] In various embodiments, the promoter-less donor vector further comprises a gene encoding one or more epitope tags. For example, 2, 3, 4, 5, 6, 7 8, 9, 10, 11, 12, 13, 14, or 15 epitope tags. The epitope tags may be the repeats or different tags. In various embodiments, the epitope tag is an HA tag, Myc tag, V5 tag, or Flag tag.
[0070] In various embodiments, the promoter-less donor vector comprises a large-cargo bacterial artificial chromosomes (BAC).
Systems
[0071] Various embodiments of the present invention provide for a system for use in in vivo dual recombinase-mediated cassette exchange.
[0072] In various embodiments, the system comprises: a promoter-less donor vector as disclosed herein; and one expression vector, comprising two genes encoding recombinases specific to the paired recombinase recognition sites.
[0073] In various embodiments, the system, comprises: a promoter-less donor vector as disclosed herein; and two expression vectors, the first expression vector comprising a first gene encoding a first recombinase that is specific to one of the paired recombinase recognition sites, and the second expression vector comprising a second gene encoding a second recombinase that is specific to the other of the paired recombinase recognition sites.
[0074] In various embodiments, the system, comprises: a promoter-less donor vector, comprising a polyadenylation signal or transcription stop element upstream from a transgene or RNA, the transgene or RNA, and paired recombinase recognition sites; and one expression vector, comprising two genes encoding recombinases specific to the paired recombinase recognition sites.
[0075] In various embodiments, the system, comprises: a promoter-less donor vector, comprising a polyadenylation signal or transcription stop element upstream from a transgene or RNA, the transgene or RNA, and paired recombinase recognition sites; and two expression vectors, the first expression vector comprising a first gene encoding a first recombinase that is specific to one of the paired recombinase recognition sites, and the second expression vector comprising a second gene encoding a second recombinase that is specific to the other of the paired recombinase recognition sites.
[0076] In various embodiments, the promoter-less donor vector further comprises a post-transcriptional regulatory element. In various embodiments, the promoter-less donor vector further comprises a polyadenylation signal downstream from the transgene or RNA.
[0077] In various embodiments, the promoter-less donor vector comprises: PGK polyadenylation signal (pA); trimerized SV40 pA; a transgene or RNA; loxP; flippase recognition target (FRT); a rabbit beta-globin pA; and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).
[0078] The orientation of the paired recombinase sites are dictated by the engineered locus in the transgenic animal (i.e., the recombinase sites will exactly mimic the outer pair of recombinase sites if the transgene is to be inserted in the sense direction of the upstream promoter). Accordingly, in various embodiments, the paired recombinase recognition sites are in the correct orientation. In various embodiments, the loxP is not in an inverted orientation.
[0079] In various embodiments, the paired recombinase recognition sites are loxP and flippase recognition target (FRT), and the recombinases are cre and flp. Examples of Flp include flpE and flpO.
[0080] Other examples of recombinases (and sites) include but are not limited to VCre (Vlox and derivatives), SCre (Slox and derivatives), Dre (Rox and derivatives), and phiC31 (attb).
[0081] In various embodiments, the RNA is siRNA, shRNA, or sgRNA.
[0082] In various embodiments, the transgene or the RNA comprises disease associated mutations. In various embodiments, the transgene or the RNA comprises a gain-of-function (GOF) mutation. In various embodiments, the transgene or the RNA comprises a loss-of-function (LOF) mutation.
[0083] Examples of transgenes include but are not limited to oncogenic gain-of-function mutations, including Ras, H3f3a, Pdgfra, Trp53 point mutations, Idh1. Examples of RNAs (shRNA and sgRNA) include but are not limited to tumor suppressor targets such as Trp53, Nfl, Atrx, or Pten.
[0084] Examples of post-transcriptional regulatory element include but are not limited to Hepatitis B virus post-transcriptional regulatory element (HPRE) and Woodchuck Hepatitis virus post-transcriptional regulatory element (WPRE).
[0085] In various embodiments, the promoter-less donor vectors describe above and below further comprise a gene encoding an antibiotic. In various embodiments, the promoter-less donor vector further comprises a gene encoding puromycin, or eukaryotic alternatives (kanomycin, blasticidin, etc.). In various embodiments, the promoter-less donor vector described above and below further comprises a gene encoding a doxycycline-regulated transactivator or CRISPR/Cas based variant (e.g., SpCas9 or Cpf1) for DNA cleavage, gene activation (Crispra), or gene repression (Crispri) when paired with an sgRNA.
[0086] In various embodiments, the promoter-less donor vectors described above and below further comprises a gene encoding one or more spaghetti monster fluorescent proteins (SM_FPs). In various embodiments, the one or more SM_FPs are each different SM_FPs. In various embodiments, the one or more SM_FPs are four different SM_FPs.
[0087] In various embodiments, the promoter-less donor vector further comprises a gene encoding one or more epitope tags. For example, 2, 3, 4, 5, 6, 7 8, 9, 10, 11, 12, 13, 14, or 15 epitope tags. The epitope tags may be the repeats or different tags. In various embodiments, the epitope tag is an HA tag, Myc tag, V5 tag, or Flag tag.
[0088] In various embodiments, the promoter-less donor vector comprises a large-cargo bacterial artificial chromosomes (BAC).
Animal Models
[0089] Various embodiments of the present invention provide for a non-human animal model and methods of generating the non-human animal model. The animal model can be used to model cancer driver mutations (e.g., gain of function oncogenes).
[0090] In various embodiments, generating the non-human animal model comprises providing a system for dual recombinase-mediated cassette exchange; administering the system for dual recombinase-mediated cassette exchange to the non-human animal, and subjecting the non-human animal to electroporation.
[0091] The system for dual recombinase-mediated cassette exchange provided and used to generate the non-human animal model is a system for dual recombinase-mediated cassette exchange of present invention as described herein.
[0092] In various embodiments, the method further comprises administering hypBase and/or reporter plasmids.
[0093] The system for dual recombinase-mediated cassette exchange electroporation can be administered to a location wherein testing is desired. For example, experiments to study the brain, the system can be injected into the lateral ventricle and electroporation can be conducted at that location. In another example, for experiments to study the spinal cord, the system can be injected, for example, into the cerebral spinal fluid, or into or near the spinal cord, and electroporation can done at or near the spinal cord.
[0094] In various embodiments, the non-human animal model comprises a system for dual recombinase-mediated cassette exchange as disclosed herein, wherein the dual Recombinase-Mediated Cassette Exchange has occurred.
[0095] In various embodiments, the non-human animal is a mouse. In other embodiments, the non-human animal is a rat, hamster, gerbil, pig, guinea pig, rabbit, monkey (e.g., rhesus monkey), baboon, chimpanzee, sheep, or dog. In various embodiments, the non-human animal is a genetically engineered mouse. In various embodiments, the non-human animal is a genetically engineered mouse with paired dual recombinase sites. In various embodiments, the mouse is a Rosa26mTmG (mTmG), Ai14, R26-CAG-LF-mTFP1, or IKMC mouse or mouse with similar paired dual recombinase sites.
Drug Screening
[0096] Various embodiments of the present invention provide for a method of screening a drug candidate, comprising: providing a non-human animal model of the present invention, administering the drug candidate, and assessing the effects of the drug candidate on the non-human animal model.
[0097] In various embodiments, the method further comprises selecting the drug candidate as a drug when the drug candidate provides a beneficial result to the non-human animal model. In various embodiments, the method further comprises validating the drug candidate as a drug when the drug candidate provides a beneficial result to the non-human animal model.
[0098] Beneficial result may include, but are in no way limited to, lessening or alleviating the severity of the disease condition, preventing the disease condition from worsening, curing the disease condition and prolonging a patient's life or life expectancy.
Methods of Treatment
[0099] Various embodiments of the present invention provide a method of treating a disease or condition in a subject, comprising: providing a cell comprising a system for dual recombinase-mediated cassette exchange of the present invention and administering the cell to the subject.
[0100] In various embodiments, the cell is a stem cell.
[0101] In various embodiments, dual Recombinase-Mediated Cassette Exchange has occurred in the cell.
[0102] Administering the cell to the subject can be performed by a route of administration that is appropriate for the disease condition. Route of administration may refer to any administration pathway known in the art, including but not limited to aerosol, nasal, oral, transmucosal, transdermal or parenteral. Transdermal administration may be accomplished using a topical cream or ointment or by means of a transdermal patch. Parenteral refers to a route of administration that is generally associated with injection, including intraorbital, infusion, intraarterial, intracapsular, intracardiac, intradermal, intramuscular, intraperitoneal, intrapulmonary, intraspinal, intrasternal, intrathecal, intrauterine, intravenous, subarachnoid, subcapsular, subcutaneous, transmucosal, or transtracheal. Via the parenteral route, the compositions may be in the form of solutions or suspensions for infusion or for injection, or as lyophilized powders.
[0103] Via the enteral route, the pharmaceutical compositions can be in the form of tablets, gel capsules, sugar-coated tablets, syrups, suspensions, solutions, powders, granules, emulsions, microspheres or nanospheres or lipid vesicles or polymer vesicles allowing controlled release. Via the parenteral route, the compositions may be in the form of solutions or suspensions for infusion or for injection.
[0104] Via the topical route, the pharmaceutical compositions based on compounds according to the invention may be formulated for treating the skin and mucous membranes and are in the form of ointments, creams, milks, salves, powders, impregnated pads, solutions, gels, sprays, lotions or suspensions. They can also be in the form of microspheres or nanospheres or lipid vesicles or polymer vesicles or polymer patches and hydrogels allowing controlled release. These topical-route compositions can be either in anhydrous form or in aqueous form depending on the clinical indication.
[0105] Via the ocular route, they may be in the form of eye drops.
[0106] In various embodiments, the cell is administered by transplantation. Treatments include using transplanted cells with the dRMCE event to deliver growth factors, exosomal, or peptide therapies in diseases such as cancer, neurodegenerative disease, stroke, or epilepsy.
[0107] In various embodiments, the cell is transplanted and then subsequently targeted for dRMCE by electroporation or viral transduction.
EXAMPLES
[0108] The following examples are provided to better illustrate the claimed invention and are not to be interpreted as limiting the scope of the invention. To the extent that specific materials are mentioned, it is merely for purposes of illustration and is not intended to limit the invention. One skilled in the art may develop equivalent means or reactants without the exercise of inventive capacity and without departing from the scope of the invention.
Example 1
Cloning
[0109] Flp-Cre constructs were generously provided by Y. Voziyanov and previously validated in the context of dRMCE. Our donor plasmids were derived from PGKneotpAlox2, using In-Fusion technique (Clontech) in combination with standard restriction digestion techniques. FRT site was created by annealing two oligos and infusing the insert into PGKneotpAlox2. Downstream generation of other donor plasmids were done by removing the existing ORF and adding a new cassette using In-Fusion or ligation. PB-CAG-plasmids were previously described.
Mice and Electroporation
[0110] Gt(ROSA)26Sortm4(ACTB-tdTomato, -EGFP)Luo/J mice were purchased from the Jackson Laboratory. mTmG were bred with wildtype CD1 mice (Charles River) to generate heterozygous mice. All mice were used in accordance with the Cedars-Sinai Institutional Animal Care and Use Committee. Postnatal lateral ventricle EPs were performed as previously described. P1-3 pups were placed on ice for 5 min. All DNA mixtures contained 0.5-1 g/l of Flp-Cre expression vector, donor plasmid, hypBase, or CAG-reporter plasmids diluted in Tris-EDTA buffer unless noted otherwise. Fast green dye was added (10% v/v) to the mixture, which was injected into the lateral ventricle. Platinum Tweezertrodes delivered 5 pulses of 120 V (50 ms; separated by 950 ms) from the ECM 830 System (Harvard Apparatus). SignaGel was applied to increase conductance. Mice were warmed under a heat lamp and returned to their cages.
Tissue Preparation
[0111] After anesthesia, mouse brains were isolated and fixed in 4% PFA overnight at 4 C. Brains were embedded in 4% low melting point agarose and sectioned at 70 m on a vibratome (Leica).
Immunohistochemistry
[0112] Immunohistochemistry was performed using standard methodology as previously described. All secondary antibodies (Jackson ImmunoResearch) were used at 1:500. Details on the primary antibodies can be found in Table 3.
TABLE-US-00003 TABLE 3 Antibodies used in the study Abcam 13970 Chicken anti-EGFP 1:5000 Abcam 95038 Goat anti-V5 1:1000 Active Motif rb anti-H3f3a pS31 1:500 Aves Chicken anti-Myc 1:500 BD Pharmingen Rat anti-PDGFR 1:500 BD Pharmingen Rt anti-Pecam1 1:250 Calbiochem Sheep anti-p53 1:1000 Cell Signaling rb anti-H3K27Me 1:1000 Cell Signaling rb anti-Pdgfrb 1:500 Cell Signaling rb anti-des 1:500 Cell Signaling 3724 Rabbit anti-HA 1:2000 Cell Signaling 9308 Rabbit anti-pRb1 1:500 Clontech 9G9 Mouse anti-tetR 1:1000 Clontech 9G9 rb anti-dsred 1:1000 Dawen Cai (Univ of Mich) Rabbit anti-dsRed 1:1000 Dawen Cai (Univ of Mich) Guinea pig anti-mKate2 1:500 Invitrogen 46-0705 Mouse anti-V5 1:1000 Kerafast rat anti-tdtomato 1:2000 R&D Systems Sheep anti-Dll1 1:500 R&D Systems Gt anti-Olig2 1:500 Revmab rb anti-H3f3a 1:100 Sigma Mouse anti-Flag 1:2500
Cell Culture and Nucleofection
[0113] Three heterozygous P0 mTmG pup brains were dissociated to establish the mouse neural stem cell line used in the study. The cell line was maintained as previously described. Cells were grown in media containing Neurobasal-A Medium (Life Technologies 10888-022) supplemented with B-27 without vitamin A (Life Technologies 12587-010), GlutaMAX (Life Technologies 35050), Antibiotic-Antimycotic (Life Technologies 15240), hEGFP (Sigma E9644), heparin (Sigma H3393), and bFGF (Millipore GF003). Neural stem cell nucleofection was performed using the Nucleofector 2b device and Mouse Neural Stem Cell Kit according to manufacturer's recommendations (Lonza AG). The nucleofection mixture contained plasmids with equal concentrations of 10 ng/l.
Imaging and Processing
[0114] All fixed images were collected on a Nikon AIR inverted laser confocal microscope. The live image of mNSCs was obtained on an EVOS digital fluorescence inverted microscope. For whole brain images, the automated stitching function of Nikon Elements was used. ND2 files were then imported into ImageJ to create Z-projection images, which were subsequently edited in Adobe Photoshop CS6. Adobe Illustrator CS6 was used for the final figure production.
Flow Cytometry
[0115] Cells were collected as previously described. Cells were briefly rinsed in PBS, removed by enzymatic dissociation suing Accutase (Millipore), pelleted at 250 g for 3 min, and resuspended in the media. FACS was done on a Beckman Coulter MoFlo at the Cedars-Sinai Flow Cytometry.
Western Blot
[0116] The cell pellets were re-suspended in Laemmli buffer and boiled for 5 min at 95 C. Protein concentrations were measured on a ThermoScientific NanoDrop 2000. After SDS-PAGE separation and transfer onto nitrocellulose membranes, proteins were detected using the antibodies listed on Table 3, diluted in 5% milk in 0.1% PBS-Tween. All secondary antibodies (Li-cor IRDye) were used at 1:15000. Infrared detection was accomplished by the Li-Cor Odyssey CLX Imaging System.
Doxycycline and Puromycin Administration
[0117] Doxycycline (Clontech 631311) was added to culture media at the final concentration of 100 ng/ml. Puromycin (Clontech 631305) was used at 1 g/ml.
Multi-miR-E Knockdown Efficiency Quantification
[0118] We have previously used FlEx-based transgene expression, specifically Cre-mediated inversion and activation of EGFP cassette (FlEx-EGFP). To test our multi-miR-E targeting Nfl, Pten, and Trp53, we made a CAG-driven FlEx-based construct harboring the multiple miR-Es (FlEx-multi-miR-E). Postnatal mNSC line was established by dissociating CD1 pup brains, transfected with EGFP or FlEx-multi-miR-E and Cre-recombinase vector. Fluorescent cells were sorted and subjected to mRNA extraction and SYBR-based Fluidigm BioMark dynamic array using qPCR probes for Nfl, Pten, and Trp53.
Quantification of In Vivo MADR Efficiency
[0119] For each condition, two pups were electroporated with pCAG-TagBFP2-nls, pDonor-smFP-HA, and Flp-2A-Cre. The brains were taken two days post-EP, and two non-adjacent sections from each brain were stained with HA-Tag antibody and EGFP. For each section, 25 BFP+ cells were randomly selected, among which HA+ and EGFP+ cells among BFP+ cells were counted. The proportions were averaged over four sections for each group.
PCR-Generation of U6-sgRNA Fragments
[0120] A short reverse primer and an ultramer forward primer (IDT DNA) were combined in a PCR reaction and subsequent purification to make concentrated sgRNAs (Ran et al., 2013). 100 ng of each fragment was combined with plasmid DNA for EP.
Sequencing InDel Mutations in Murine Tumor Cells
[0121] A pure population of tumor cells was obtained by FACS and genomic DNA was isolated (Qiagen DNeasy). Using primers flanking the gRNA target site, we PCR amplified the regions expected to contain InDel mutations for NF1, Trp53, and Pten. The PCR amplified fragments were topo cloned using the Thermo Fisher Zero Blunt TOPO kit and transformed into One Shot MAX Efficiency DH5-T1R cells.
[0122] Various embodiments of the invention are described above in the Detailed Description. While these descriptions directly describe the above embodiments, it is understood that those skilled in the art may conceive modifications and/or variations to the specific embodiments shown and described herein. Any such modifications or variations that fall within the purview of this description are intended to be included therein as well. Unless specifically noted, it is the intention of the inventors that the words and phrases in the specification and claims be given the ordinary and accustomed meanings to those of ordinary skill in the applicable art(s).
[0123] The foregoing description of various embodiments of the invention known to the applicant at this time of filing the application has been presented and is intended for the purposes of illustration and description. The present description is not intended to be exhaustive nor limit the invention to the precise form disclosed and many modifications and variations are possible in the light of the above teachings. The embodiments described serve to explain the principles of the invention and its practical application and to enable others skilled in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated. Therefore, it is intended that the invention not be limited to the particular embodiments disclosed for carrying out the invention.
[0124] While particular embodiments of the present invention have been shown and described, it will be obvious to those skilled in the art that, based upon the teachings herein, changes and modifications may be made without departing from this invention and its broader aspects and, therefore, the appended claims are to encompass within their scope all such changes and modifications as are within the true spirit and scope of this invention. It will be understood by those within the art that, in general, terms used herein are generally intended as open terms (e.g., the term including should be interpreted as including but not limited to, the term having should be interpreted as having at least, the term includes should be interpreted as includes but is not limited to, etc.).