Human Type 14 Replication Defective Adenovirus Vector and Preparation Method for Same and Applications Thereof

Abstract

The present invention provides a human type 14 replication defective adenovirus vector, and a preparation method for the same, the method comprising: constructing an Ad14 genome into a plasmid, with knocking out E3 and E1 genes of the Ad14 genome, and replacing open reading frames 2, 3, 4, 6, and 6/7 of an E4 gene of the Ad14 genome with corresponding reading frames of an Ad5 genome. The human type 14 replication defective adenovirus vector according to the present invention is potentially applicable in the research and development of a vaccine and a drug against human type 14 adenovirus infection, applicable as a gene vector in the research and development of other pathogen vaccines, and applicable in a biological report and trace system, etc.

Claims

1. A human type 14 replication defective adenovirus vector, prepared by the following method: constructing an Ad14 genome into a plasmid, with knocking out E3 and E1 genes of the Ad14 genome, and replacing open reading frames 2, 3, 4,6, and 6/7 of an E4 gene of the Ad14 genome with corresponding reading frames of an Ad5 genome.

2. The human type 14 replication defective adenovirus vector according to claim 1, wherein the method further comprises integrating an exogenous gene expression cassette into an E1 gene region of Ad14.

3. A method of preparing the human type 14 replication defective adenovirus vector according to claim 1, comprising the following steps: S1. obtaining left and right ends of the Ad14 genome by PCR amplification, ligating the ends into an ampicillin resistant plasmid to obtain pT-Ad14(L+R), linearizing the pT-Ad14(L+R), and recombining the linearized pT-Ad14(L+R) with the Ad14 genome to obtain a genomic plasmid pAd14; S2. obtaining left and right arms of an Ad14 E3 gene by PCR amplification, ligating the arms in a reverse direction into a kanamycin resistant plasmid, linearizing the plasmid, and obtaining a genomic plasmid pAd14E3-Kana with the E3 gene of Ad14 knocked out, through homologous recombination of the linearized plasmid with pAd14 which is linearized by partial enzyme digestion; S3. obtaining left and right arms of an Ad14 E3 gene by PCR amplification, ligating the arms in a forward direction into the kanamycin resistant plasmid, linearizing the plasmid, and obtaining a genomic plasmid pAd14E3 with a kanamycin resistant gene knocked out, through recombination of the linearized plasmid with the linearized pAd14E3-Kana; S4. obtaining left and right arms of an Ad14 E1 gene by PCR amplification, ligating the arms in a reverse direction into a kanamycin resistant plasmid, linearizing the plasmid, and obtaining a genomic plasmid pAd14E1E3-Kana with the E1 gene of Ad14 knocked out, through homologous recombination of the linearized plasmid with pAd14E3 which is linearized by partial enzyme digestion; S5. obtaining left and right arms of an Ad14 E1 gene by PCR amplification, ligating the arms in a forward direction into a kanamycin resistant plasmid, linearizing the plasmid, and obtaining a genomic plasmid pAd14E1E3 with a kanamycin resistant gene knocked out, through recombination of the linearized plasmid with the linearized pAd14E1E3-Kana; and S6. obtaining an Ad14 E4 gene by PCR amplification and ligating the Ad14 E4 gene into an ampicillin resistant plasmid to obtain p14E4; obtaining open reading frames 2, 3, 4,6, and 6/7 of E4 gene of an Ad5 genome by PCR amplification, replacing corresponding regions of the Ad14 E4 gene to obtain p14E4(5E4), linearizing the p14E4(5E4), and obtaining a genomic plasmid pAd14E1E3(5E4) with E1 and E3 genes knocked out and E4 gene replaced, through homologous recombination of the linearized p14E4(5E4) with the linearized pAd 14E1E3.

4. The preparation method according to claim 3, wherein said step S1 comprises: obtaining left and right ends L-Ad14 and R-Ad14 as recombination arms of the Ad14 genome by PCR amplification using the Ad14 genome as a template, ligating the arms into a linearized T vector to obtain pT-Ad14(L+R), while introducing EcoRI and BamHI sites as enzyme digestion sites between left and right arms of the pT-Ad14(L+R), digesting the pT-Ad14(L+R) with EcoRI+BamHI through double enzyme digestion, and recombining with the Ad14 genome after linearization of the double enzyme digestion to obtain pAd14.

5. The preparation method according to claim 3, wherein said step S2 comprises: obtaining homologous recombination arms L-E3 and R-E3of the E3 gene by PCR amplification using the Ad14 genome as a template, ligating the arms in a reverse direction into a pVax vector to obtain pVax-E3(L+R), linearizing the pVax-E3(L+R), and obtaining a plasmid pAd14E3-Kana with the E3 gene knocked out and a unique linearized enzyme digestion site SwaI introduced in the E3 gene region, through homologous recombination of the linearized pVax-E3(L+R) with pAd14 linearized by partial enzyme digestion using EcoRI and a dual-resistance screening by ampicillin and kanamycin.

6. The preparation method according to claim 3, wherein said step S3 comprises: obtaining homologous recombination arms L-K(E3) and R-K(E3) of the E3 gene by PCR amplification using the Ad14 genome as a template, ligating the arms in a forward direction into a pVax vector to obtain pVax-K(E3), linearizing the pVax-K(E3), and obtaining pAd14E3 with E3 and kanamycin resistant genes knocked out and a single enzyme digestion site SwaI introduced, through recombination of the linearized pVax-K(E3) with pAd14E3-Kana linearized by SwaI; and wherein said step S4 comprises: according to the same principle as in step S2, obtaining homologous recombination arms L-E1 and R-E1 of the E1 gene by PCR amplification, ligating in reverse direction into a pVax vector to obtain pVax-E1(L+R), linearizing the pVax-E1(L+R), and obtaining a plasmid pAd14E1E3-Kana with the E1 gene knocked out and a unique linearized enzyme digestion site PmeI introduced in the E1 gene region, through homologous recombination of the linearized pVax-E1(L+R) with pAd14E3 linearized by enzyme digestion using PacI and a dual-resistance screening by ampicillin and kanamycin.

7. The preparation method according to claim 3, wherein said step S5 comprises: according to the same principle as in step S3, obtaining homologous recombination arms L-K(E1) and R-K(E1) of the E1 gene by PCR amplification, ligating the arms in a forward direction into a pVax vector to obtain pVax-K(E1), linearizing the pVax-K(E1), and obtaining pAd14E1E3 with E1 and kanamycin resistant genes knocked out and a single enzyme digestion site PmeI introduced, through recombination of the linearized pVax-K(E1) with pAd14E1E3-Kana linearized by PmeI; and wherein said step S6 comprises: obtaining Ad5 E4 Orf2-6 and Ad14 E4 by PCR amplification using Ad5 genome and Ad14 genome as templates respectively, ligating the Ad14 E4 into a T vector to obtain p14E4, further knocking out Ad14 E4 Orf2-6 by PCR using p14E4 as a template, then ligating the PCR product with Ad5 E4 Orf2-6 to obtain p14E4(5E4), linearizing the p14E4(5E4), and obtaining pAd14E1E3(5E4), through homologous recombination of the linearized p14E4(5E4) with the linearized pAd14E1E3.

8. The preparation method according to claim 3, wherein the method further comprises: integrating into an exogenous sequence through homologous recombination, further comprising the following step: S7. obtaining homologous recombination arms L-SE1 and R-SE1 of the E1 region by PCR using the Ad14 genome as a template, enzyme digesting the arms and ligating the enzyme digested arms into a pVax vector to obtain pSE1LR; producing an exogenous gene expression cassette CMV-EGFP-BGH by PCR using pGA1-EGFP as a template, enzyme digesting the CMV-EGFP-BGH and pSE1LR, ligating the digested CMV-EGFP-BGH and pSE1LR to obtain pGK141-EGFP, linearizing the pGK141-EGFP, and obtaining pAd14E1E3(5E4)-EGFP through homologous recombination of the linearized pGK14I-EGFP with the linearized pAd14E1E3(5E4)obtained in step S6, and then transfecting a cell after further linearization, culturing the transfected cell and obtaining Ad14E1E3(5E4)-EGFP by centrifugal purification.

9. A method of preparing the human type 14 replication defective adenovirus vector according to claim 2, comprising the following steps: S1. obtaining left and right ends of the Ad14 genome by PCR amplification, ligating the ends into an ampicillin resistant plasmid to obtain pT-Ad14(L+R), linearizing the pT-Ad14(L+R), and recombining the linearized pT-Ad14(L+R) with the Ad14 genome to obtain a genomic plasmid pAd14; S2. obtaining left and right arms of an Ad14 E3 gene by PCR amplification, ligating the arms in a reverse direction into a kanamycin resistant plasmid, linearizing the plasmid, and obtaining a genomic plasmid pAd14E3-Kana with the E3 gene of Ad14 knocked out, through homologous recombination of the linearized plasmid with pAd14 which is linearized by partial enzyme digestion; S3. obtaining left and right arms of an Ad14 E3 gene by PCR amplification, ligating the arms in a forward direction into the kanamycin resistant plasmid, linearizing the plasmid, and obtaining a genomic plasmid pAd14E3 with a kanamycin resistant gene knocked out, through recombination of the linearized plasmid with the linearized pAd14E3-Kana; S4. obtaining left and right arms of an Ad14 E1 gene by PCR amplification, ligating the arms in a reverse direction into a kanamycin resistant plasmid, linearizing the plasmid, and obtaining a genomic plasmid pAd14E1E3-Kana with the E1 gene of Ad14 knocked out, through homologous recombination of the linearized plasmid with pAd14E3 which is linearized by partial enzyme digestion; S5. obtaining left and right arms of an Ad14 E1 gene by PCR amplification, ligating the arms in a forward direction into a kanamycin resistant plasmid, linearizing the plasmid, and obtaining a genomic plasmid pAd14E1E3 with a kanamycin resistant gene knocked out, through recombination of the linearized plasmid with the linearized pAd14E1E3-Kana; and S6. obtaining an Ad14 E4 gene by PCR amplification and ligating the Ad14 E4 gene into an ampicillin resistant plasmid to obtain p14E4; obtaining open reading frames 2, 3, 4, 6, and 6/7 of E4 gene of an Ad5 genome by PCR amplification, replacing corresponding regions of the Ad14 E4 gene to obtain p14E4(5E4), linearizing the p14E4(5E4), and obtaining a genomic plasmid pAd14E1E3(5E4) with E1 and E3 genes knocked out and E4 gene replaced, through homologous recombination of the linearized p14E4(5E4) with the linearized pAd14E1 E3.

10. The preparation method according to claim 9, wherein said step S1 comprises: obtaining left and right ends L-Ad14 and R-Ad14 as recombination arms of the Ad14 genome by PCR amplification using the Ad14 genome as a template, ligating the arms into a linearized T vector to obtain pT-Ad14(L+R), while introducing EcoRI and BamHI sites as enzyme digestion sites between left and right arms of the pT-Ad14(L+R), digesting the pT-Ad14(L+R) with EcoRI+BamHI through double enzyme digestion, and recombining with the Ad14 genome after linearization of the double enzyme digestion to obtain pAd14.

11. The preparation method according to claim 9, wherein said step S2 comprises: obtaining homologous recombination arms L-E3 and R-E3of the E3 gene by PCR amplification using the Ad14 genome as a template, ligating the arms in a reverse direction into a pVax vector to obtain pVax-E3(L+R), linearizing the pVax-E3(L+R), and obtaining a plasmid pAd14E3-Kana with the E3 gene knocked out and a unique linearized enzyme digestion site SwaI introduced in the E3 gene region, through homologous recombination of the linearized pVax-E3(L+R) with pAd14 linearized by partial enzyme digestion using EcoRI and a dual-resistance screening by ampicillin and kanamycin.

12. The preparation method according to claim 9, wherein said step S3 comprises: obtaining homologous recombination arms L-K(E3) and R-K(E3) of the E3 gene by PCR amplification using the Ad14 genome as a template, ligating the arms in a forward direction into a pVax vector to obtain pVax-K(E3), linearizing the pVax-K(E3), and obtaining pAd14E3 with E3 and kanamycin resistant genes knocked out and a single enzyme digestion site SwaI introduced, through recombination of the linearized pVax-K(E3) with pAd14E3-Kana linearized by SwaI; and wherein said step S4 comprises: according to the same principle as in step S2, obtaining homologous recombination arms L-E1 and R-E1 of the E1 gene by PCR amplification, ligating in reverse direction into a pVax vector to obtain pVax-E1(L+R), linearizing the pVax-E1(L+R), and obtaining a plasmid pAd14E1E3-Kana with the E1 gene knocked out and a unique linearized enzyme digestion site PmeI introduced in the E1 gene region, through homologous recombination of the linearized pVax-E1(L+R) with pAd14E3 linearized by enzyme digestion using PacI and a dual-resistance screening by ampicillin and kanamycin.

13. The preparation method according to claim 9, wherein said step S5 comprises: according to the same principle as in step S3, obtaining homologous recombination arms L-K(E1) and R-K(E1) of the E1 gene by PCR amplification, ligating the arms in a forward direction into a pVax vector to obtain pVax-K(E1), linearizing the pVax-K(E1), and obtaining pAd14E1E3 with E1 and kanamycin resistant genes knocked out and a single enzyme digestion site PmeI introduced, through recombination of the linearized pVax-K(E1) with pAd14E1E3-Kana linearized by PmeI; and wherein said step S6 comprises: obtaining Ad5 E4 Orf2-6 and Ad14 E4 by PCR amplification using Ad5 genome and Ad14 genome as templates respectively, ligating the Ad14 E4 into a T vector to obtain p14E4, further knocking out Ad14 E4 Orf2-6 by PCR using p14E4 as a template, then ligating the PCR product with Ad5 E4 Orf2-6 to obtain p14E4(5E4), linearizing the p14E4(5E4), and obtaining pAd14E1E3(5E4), through homologous recombination of the linearized p14E4(5E4) with the linearized pAd14E1E3.

14. The preparation method according to claim 9, wherein the method further comprises: integrating into an exogenous sequence through homologous recombination, further comprising the following step: S7. obtaining homologous recombination arms L-SE1 and R-SE1 of the E1 region by PCR using the Ad14 genome as a template, enzyme digesting the arms and ligating the enzyme digested arms into a pVax vector to obtain pSE1LR; producing an exogenous gene expression cassette CMV-EGFP-BGH by PCR using pGA1-EGFP as a template, enzyme digesting the CMV-EGFP-BGH and pSE1LR, ligating the digested CMV-EGFP-BGH and pSE1LR to obtain pGK141-EGFP, linearizing the pGK141-EGFP, and obtaining pAd14E1E3(5E4)-EGFP through homologous recombination of the linearized pGK141-EGFP with the linearized pAd14E1E3(5E4)obtained in step S6, and then transfecting a cell after further linearization, culturing the transfected cell and obtaining Ad14E1E3(5E4)-EGFP by centrifugal purification.

15. A vaccine, a neutralizing antibody, or a biological report and trace system prepare by using the human type 14 replication defective adenovirus vector according to claim 1.

16. A vaccine against human type 14 adenovirus or a drug against human type 14 adenovirus prepare by using the human type 14 replication defective adenovirus vector according to claim 1.

17. A vaccine, a neutralizing antibody, or a biological report and trace system prepare by using the human type 14 replication defective adenovirus vector according to claim 2.

18. A vaccine against human type 14 adenovirus or a drug against human type 14 adenovirus prepare by using the human type 14 replication defective adenovirus vector according to claim 2.

Description

DESCRIPTION OF THE DRAWINGS

[0059] FIG. 1A shows the principle of Ad14 genome cyclization through homogenous recombination. FIG. 1B is enzyme digestion identification result of pT-Ad14(L+R) with BamH I and Ndell(M1: DNA Ladder 2000; M2: DNA Ladder 15000; 1# to 6#: different pT-Ad14(L+R) clones). FIG. 1C are enzyme digestion identification results of pAd14 with BamH I and pAd14 with EcoR I and Hind III (M2: DNA Ladder 15000; 1# to 6#: different pAd14 clones).

[0060] FIG. 2A shows the principle of knocking out the E3 gene of Ad14 through a dual-resistance screening by ampicillin and kanamycin. FIG. 2B is PCR identification result of pVax-E3(L+R) (M1: DNA Ladder 2000; M2: DNA Ladder 15000; 1# to 6#: different pVax-E3(L+R) clones). FIG. 2C is PCR identification result of pAd14E3-Kana (M2: DNA Ladder 15000; 1# to 6#: different pAd14E3-Kana clones).

[0061] FIG. 3A shows the principle of knocking out kanamycin resistance from a pAd14E3-Kana plasmid. FIG. 3B is enzyme digestion identification result of pVax-K(E3) with Mlul and EcoRV (M1: DNA Ladder 2000; M2: DNA Ladder 15000; 1# to 4#: different pVax-K(E3) clones). FIG. 3C are results of enzyme digestion of pAd14E3 with HindIII and EcoRV and pAd14E3 with BamH I (M2: DNA Ladder 15000; 1# to 6#: different pAd14E3 clones).

[0062] FIG. 4A shows the principle of knocking out the E1 gene of pAd14E3 through a dual-resistance screening by ampicillin and kanamycin. FIG. 4B is PCR identification result of a shuttle plasmid with the E1 gene of pAd14E3 knocked out (pVax-E1(L+R)) (M1: DNA Ladder 2000; M2: DNA Ladder 15000; 1# to 6#: different pVax-E1(L+R) clones). FIG. 4C is enzyme digestion result of pAd14E1E3-Kana with BamH I (M2: DNA Ladder 15000; 1# to 3#: different pAd14E1E3-Kana clones).

[0063] FIG. 5A shows the principle knocking out kanamycin resistance from the pAd14E1E3-Kana plasmid. FIG. 5B is result of enzyme digestion of shuttle plasmid with kanamycin resistance knocked out from the E1 region of pAd14E3 (pVax-K(E1)) (M1: DNA Ladder 2000; 1# to 6#: different pVax-K(E1) clones). FIG. 5C is results of enzyme digestion of pAd14E1E3 with BamH I and pAd14E1E3 with HindIII and EcoRV (M2: DNA Ladder 15000; 1# to 6#: different pAd14E1E3 clones).

[0064] FIG. 6A shows the principle of replacing ORF2-6 in the E4 gene of pAd14E1E3 with a corresponding sequence of ORF2-6 in the E4 gene of AdS. FIG. 6B is result of enzyme digestion of a shuttle plasmid with ORF2-6 of the Ad14 E4 gene replaced (p14E14 (5Orf2-6))(M2: DNA Ladder 15000; 1# to 6#: different p14E14 (5Orf2-6) clones). FIG. 6C is results of enzyme digestion of pAd14E1E3(5E4) with BamH I and pAd14E1E3(5E4) with HindIII and EcoRV (M2: DNA Ladder 15000; 1# to 6#: different pAd14E1E3(5E4) clones).

[0065] FIG. 7A shows the schematic diagram of construction process of pAd14E1E3(5E4)-EGFP harboring an exogenous gene cassette. FIG. 7B is result of enzyme digestion of pGK141-EGFP with HindIII and XbaI (M1: DNA Ladder 2000; M2: DNA Ladder 15000; 1# to 4#: different pGK141-EGFP clones). FIG. 7C is result of enzyme digestion of pAd14E1E3(5E4)-EGFP with HindIII and EcoRV (M2: DNA Ladder 15000; 1# to 6#: different pAd14E1E3(5E4)-EGFP clones).

[0066] FIG. 8A shows production result of a type 14 replication defective vector. FIG. 8B shows purification results of a type 14 replication defective vector.

[0067] FIG. 9 is results of virus plaques formed by type 14 replication defective vector in 293 and A549 cells.

[0068] FIG. 10A shows the time diagram of neutralizing antibody measurement. FIG. 10B is the experimental scheme of immunogenicity assessment of type 14 replication defective vector in vivo. FIG. 10C is detection result of neutralizing antibody titer after immunizing mice for two weeks by replication defective Ad14E1E3(5E4). FIG. 10D is detection result of neutralizing antibody titer after immunizing mice for six weeks by replication defective Ad14E1E3(5E4).

DETAILED DESCRIPTION OF THE INVENTION

[0069] The present invention discloses a method of preparing a human type 14 replication defective adenovirus vector. The preparation method and construction idea of the adenovirus vector in the present invention are applicable to research and development of vaccines against adenoviruses and other pathogenic viruses, screening of drugs and neutralizing antibodies against adenoviruses, and biological report and trace systems.

[0070] The term human type 14 adenovirus used herein refers to a type 14 adenovirus known to one skilled in the art, and the Ad14 genome used in the examples is also derived from these known human type 14 adenoviruses. The human type 14 replication defective adenovirus vector used herein is not limited to the particular clinical isolates employed in the examples.

[0071] The term exogenous sequence used herein refers to any DNA sequence not derived from type 14 adenoviruses. It should be understandable to one skilled in the art that the exogenous sequence may be an exogenous gene expression cassette, or a shRNA or miRNA expression cassette, or the like.

[0072] In the following examples, the exogenous gene expression cassette may comprise a eukaryotic promoter, an exogenous gene coding sequence and a transcription terminator, as one skilled in the art understood. The exogenous gene coding sequence may be, but is not limited to, coding sequences of green fluorescent proteins, other viral antigens, and shRNA, etc.

[0073] To facilitate a clearer understanding of the technical content of the present invention, the following examples are illustrated in conjunction with appended drawings. It is understood that the examples are merely intended to illustrate the present invention, instead of limiting the scope of the present invention. The following examples without experimental methods specified are generally carried out under conventional conditions, such as those described in Molecular Cloning: Laboratory Manual (Sambrook, et al., 1989, New York, Cold Spring Harbor Laboratory Press), or suggested by the manufacturers. Chemical agents used in the examples are commercially available.

[0074] Unless otherwise defined, all technical and scientific terminologies used herein have the same meaning as commonly understood by one skilled in the art. The terminologies used in the specification of the present invention are intended to describe particular examples only, instead of limiting the present invention.

EXAMPLE 1

Cyclization of Ad14 Genome

[0075] 1. Construction of a shuttle plasmid pT-Ad14(L+R) for cyclizing the Ad14 genome

[0076] A left arm (L-Ad14) and a right arm (R-Ad14) of the Ad14 genome were obtained by PCR amplification using an Ad14 genome as a template.

[0077] L-Ad14 primer:

TABLE-US-00001 L-Ad14-F, (SEQ ID NO: 1) CCTGCCGTTCGACGATGCGATCGCATCATCAATA ATATACCTTATAGATGG; L-Ad14-R, (SEQ ID NO: 2) GATCCACATACGAATTCCGGTAATCGAAACCTC CACG.

[0078] PCR conditions: 95 C., 3 min; 95 C., 30 s; 57 C., 30 s; 72 C., 30 s; cycles 30; 72 C., 5 min; stored at 12 C.

[0079] R-Ad14 primer:

TABLE-US-00002 R-Ad14-F, (SEQ ID NO: 3) GAATTCGTATGTGGATCCTGGGAACCACCAGTA ATGTCA; R-Ad14-R, (SEQ ID NO: 4) CGCGGATCTTCCAGAGATGCGATCGCATCATCA ATAATATACCTTATAGATGG.

[0080] PCR conditions: 95 C., 3 min; 95 C., 30 s; 57 C., 30 s; 72 C., 1 min; cycles 30; 72 C., 5 min; stored at 12 C.

[0081] 2. Construction of pAd14

[0082] The pT-Ad14(L+R) was linearized by enzyme digestion with EcoRI+BamHI, and then co-transformed into a BJ5183 competent cell together with the Ad14 genome for recombination. The recombined competent cell was subjected to resistance screening by an ampicillin resistant plate, and after amplification of the screened monoclone, a plasmid was extracted from the monoclone and transformed into an XL competent cell, from which a plasmid was extracted to obtain pAd14. The pAd14 was identified by different ways of enzyme digestion. The pAd14 genome had two AsisI enzyme digestion sites introduced at both sides of the pAd14 genome so as to facilitate subsequent linearization and rescue of virus of the reconstructed Ad14 genome. See a schematic of plasmid construction in FIG. 1A, endonuclease digestion result of pT-Ad14(L+R) with EcoRI and BamHI in FIG. 1B, and endonuclease digestion results of pAd14 with BamHI and pAd14 with EcoRI and HindIII in FIG. 1C.

EXAMPLE 2

[0083] Knocking out of E3 gene and construction of pAd14E3-Kana plasmid

[0084] 1. Construction of a shuttle plasmid pVax-E3(L+R) with the E3 gene knocked out

[0085] A left arm (L-E3) and a right arm (R-E3) of the E3 gene were obtained by PCR amplification using an Ad14 genome as a template.

[0086] L-E3 primer:

TABLE-US-00003 L-E3-F, (SEQ ID NO: 5) GATATCTAGAGTGAATTCGTCCAAATGACTAATG CAGGTGC; L-E3-R, (SEQ ID NO: 6) CCAGTAGAAGCGCCGGATTTAAATAGGAAAAGT TTCGTTCTTCTGGTTG.

[0087] PCR conditions: 95 C., 3 min; 95 C., 30 s; 61 C., 30 s; 72 C., 50 s; cycles 30; 72 C., 5 min; stored at 12 C.

[0088] R-E3 primer:

TABLE-US-00004 R-E3-F, (SEQ ID NO: 7) ATTATTGACTAGAGTAATTTAAATGGACTAAGAG ACCTGCTACCCATG; R-E3-R, (SEQ ID NO: 8) GAATTCACTCTAGATATCCCACTTTTAGCTGTAG AGAC CCG.

[0089] PCR conditions: 95 C., 3 min; 95 C., 30 s; 60 C., 30 s; 72 C., 30 s; cycles 30; 72 C., 5 min; stored at 12 C.

[0090] The L-E3, R-E3, and a plasmid skeleton obtained by digesting a pVax vector with Bstz17I +SgrAI through double enzyme digestion were subjected to a triple-fragment ligation using an Exnase enzyme to obtain pVax-E3(L+R). Detection of pVax-E3(L+R) by PCR assay were shown in FIG. 2B.

[0091] 2. Construction of pAd14E3-Kana

[0092] The pVax-E3(L+R) was digested with EcoRI +EcoRV through double enzyme digestion, and the pAd14 was enzyme digested with EcoRI. Fragments recovered from the two enzyme digested products were co-transformed into a BJ5183 competent cell for recombination. The recombined BJ5183 competent cell was subjected to resistance screening by ampicillin and kanamycin dual-resistance plates. After amplification of the screened monoclone, the plasmid was extracted from the screened monoclone and transformed into an XL competent cell, from which a plasmid was extracted, to obtain pAd14E3-Kana. The pAd14E3-Kana was identified by different ways of enzyme digestion, and the pAd14E3-Kana introduced two SwaI enzyme digestion sites at both sides of the kanamycin gene introduced in the E3 region, so as to facilitate subsequent cloning. See a schematic of plasmid construction in FIG. 2A and PCR analysis result of pAd14E3-Kana in FIG. 2C.

EXAMPLE 3

[0093] Construction of Plasmid pAd14E3 with a Kanamycin Resistant Gene Knocked Out from pAd14E3-Kana Plasmid

[0094] 1. Construction of a shuttle plasmid pVax-K(E3) with a kanamycin resistant gene knocked out from the E3 region

[0095] A left arm L-K(E3) and a right arm R-K(E3) of the E3 gene were obtained by PCR amplification using an Ad14 genome as a template.

[0096] L-K(E3) primer:

TABLE-US-00005 L-K(E3)-F, (SEQ ID NO: 9) TGATTATTGACTAGAGTATACGTCCAAATGACT AATGCAGGTGC; L-K(E3)-R, (SEQ ID NO: 10) GATATCATTTAAATACTAGTAGGAAAAGTTTCGTTCT TCTGGTTG.

[0097] PCR conditions: 95 C., 3 min; 95 C., 30 s; 60 C., 30 s; 72 C., 50 s; cycles 30; 72 C., 5 min; stored at 12 C.

[0098] R-K(E3) primer:

TABLE-US-00006 R-K(E3)-F, (SEQ ID NO: 11) ACTAGTATTTAAATGATATCGGACTAAGAGAC CTGCTACCCATG; R-K(E3)-R, (SEQ ID NO: 12) ACCGCCCAGTAGAAGCGCCGGTGCCACTTTT AGCTGTAGAGACCCG.

[0099] PCR conditions: 95 C., 3 min; 95 C., 30 s; 60 C., 30 s; 72 C., 30 s; cycles 30; 72 C., 5 min; stored at 12 C.

[0100] The L-K(E3), R-K(E3), and a plasmid skeleton obtained by digesting a pVax vector with Bstz17I +SgrAI through double enzyme digestion were subjected to a triple-fragment ligation using an Exnase enzyme to obtain pVax-K(E3).

[0101] 2. Construction of pAd14E3

[0102] The pVax-K(E3) was linearized with Bstz 17I +SgrAI through double enzyme digestion, and the pAd14E3-Kana was linearized with SwaI through enzyme digestion. Fragments recovered from the two enzyme digested products were co-transformed into a BJ5183 competent cell for recombination. The recombined BJ5183 competent cell was subjected to resistance screening by an ampicillin resistant plate. After amplification of the screened monoclone, a plasmid was extracted from the screened monoclone and transformed into an XL competent cell, from which a plasmid was extracted, to obtain pAd14E3. A plasmid was extracted from the pAd14E3 and identified by enzyme digestion. The pAd14E3 and pVax-K(E3) were recombined with a single enzyme digestion site SwaI introduced in the E3 region while knocking out the kanamycin resistant gene. See a schematic of plasmid construction in FIG. 3A, endonuclease digestion result of pVax-K(E3) with Mlul and EcoRV in FIG. 3B, and endonuclease digestion results of pAd14E3 with HindIII and EcoRV and pAd14E3 with BamH I in FIG. 3C.

EXAMPLE 4

Knocking Out of E1 Gene and Construction of pAd14E1E3-Kana Plasmid

[0103] 1. Construction of a shuttle plasmid pVax-E1(L+R) with the E1 gene knocked out

[0104] A left arm (L-E1) and a right arm (R-E1) of the E1 gene were obtained by PCR amplification using an Ad14 genome as a template.

[0105] L-E1 primer:

TABLE-US-00007 L-E1-F, (SEQ ID NO: 13) GATATCTAGAGTGAATTCGGGGTGGAGTGTTTTT GCAAG; L-E1-R, (SEQ ID NO: 14) CGCCCAGTAGAAGCGCCGGGTTTAAACGTAATC GAAACCTCCACGTAATGG.

[0106] PCR conditions: 95 C., 3 min; 95 C., 30 s; 62 C., 30 s; 72 C., 30 s; cycles 30; 72 C., 5 min; stored at 12 C.

[0107] R-E1 primer:

TABLE-US-00008 R-E1-F, (SEQ ID NO: 15) CCAGATATACGCGTGTATAGTTTAAACGAGACCG GATCATTTGGTTATTG; R-E1-R, (SEQ ID NO: 16) GAATTCACTCTAGATATCGGGAAATGCAAATCTG TGAG GG.

[0108] PCR conditions: 95 C., 3 min; 95 C., 30 s; 61 C., 30 s; 72 C., 1 min; cycles 30; 72 C., 5 min; stored at 12 C.

[0109] The L-E1, R-E1, and a plasmid skeleton obtained by digesting a pVax vector with Bstz17I +SgrAI through double enzyme digestion were subjected to a triple-fragment ligation using an Exnase enzyme to obtain pVax-E1(L+R).Detection of pVax-E1(L+R) by PCR assay were shown in FIG. 4B.

[0110] 2. Construction of pAd14E1E3-Kana

[0111] The pVax-E1(L+R) was linearized with EcoRI +EcoRV through double enzyme digestion, and the pAd14E3 was linearized with PacI through enzyme digestion. Fragments recovered from the two enzyme digested products were co-transformed into a BJ5183 competent cell for recombination. The recombined BJ5183 competent cell was subjected to resistance screening by ampicillin and kanamycin dual-resistance plates. After amplification of the screened monoclone, a plasmid was extracted from the screened monoclone and transformed into an XL competent cell, from which a plasmid was extracted, to obtain pAd14E1E3-Kana. The pAd14E1E3-Kana was identified by different ways of enzyme digestion, and introduced two PmeI enzyme digestion sites at both sides of the kanamycin gene introduced in the E1 gene region, so as to facilitate subsequent cloning. See a schematic of plasmid construction in FIG. 4A and endonuclease digestion result of pAd14E1E3-Kana with BamH I in FIG. 4C.

EXAMPLE 5

Construction of Plasmid pAd14E1E3 with Kanamycin Resistant Gene Knocked Out from pAd14E1E3-Kana

[0112] 1. Construction of a shuttle plasmid pVax-K(E1) with a kanamycin resistant gene knocked out from the E1 region

[0113] A left arm L-K(E1) and a right arm R-K(E1) of the E1 gene were obtained by PCR amplification using an Ad14 genome as a template.

[0114] L-K(E1) primer:

TABLE-US-00009 L-K(E1)-F, (SEQ ID NO: 17) ACCGCCCAGTAGAAGCGCCGGTGGGGGTGG AGTGTTTTTGCAAG; L-K(E1)-R, (SEQ ID NO: 18) ACTAGTGTTTAAACGATATCGTAATCGAAACC TCCA CGTAATGG.

[0115] PCR conditions: 95 C., 3 min; 95 C., 30 s; 61 C., 30 s; 72 C., 30 s; cycles 30; 72 C., 5 min; stored at 12 C.

[0116] R-K(E1) primer sequence:

TABLE-US-00010 R-K(E1)-F, (SEQ ID NO: 19) GATATCGTTTAAACACTAGTGAGACCGGATCA TTTGGTTATTG; R-K(E1)-R, (SEQ ID NO: 20) CCAGATATACGCGTGTATACGGGAAATGCAAA TCTGTGAGGG.

[0117] PCR conditions: 95 C., 3 min; 95 C., 30 s; 61 C., 30 s; 72 C., 1 min; cycles 30; 72 C., 5 min; stored at 12 C.

[0118] The L-K(E1), R-K(E1), and a plasmid skeleton obtained by digesting a pVax vector with Bstz17I +SgrAI through double enzyme digestion were subjected to a triple-fragment ligation using an Exnase enzyme to obtain pVax-K(E1).

[0119] 2. Construction of pAd14E1E3

[0120] The pVax-K(E1) was linearized with Bstz 17I +SgrAI through double enzyme digestion, and the pAd14E1E3-Kana was linearized with PmeI through enzyme digestion. Fragments recovered from the two enzyme digested products were co-transformed into a BJ5183 competent cell for recombination. The recombined BJ5183 competent cell was subjected to resistance screening by an ampicillin resistant plate. After amplification of the screened monoclone, the plasmid was extracted from the screened monoclone and transformed into an XL competent cell, from which a plasmid was extracted, to obtain pAd14E1E3. A plasmid was extracted from the pAd14E1E3 and identified by enzyme digestion. The pAd14E1E3 and pVax-K(E1) were recombined with a single enzyme digestion site SwaI introduced in the E1 region while knocking out the kanamycin resistant gene. See a schematic of plasmid construction in FIG. 5A, endonuclease digestion result of pVax-K(E1) with Mlul and EcoRV in FIG. 5B, and endonuclease digestion results of pAd14E1E3 with BamH I and pAd14E1E3 with HindIII and EcoRV in FIG. 5C.

EXAMPLE 6

Modification of Ad14 E4 Gene and Construction of pAd14E1E3(5E4)

[0121] 1. Construction of a shuttle plasmid p14E4(5ORF2-6) integrated with Ad5 E4 ORF2-6

[0122] 1) An E4 gene of Ad14 was obtained by PCR amplification using an Ad14 genome as a template.

[0123] Ad14 E4 primer:

TABLE-US-00011 E4-F, (SEQ ID NO: 21) AGAGTGCACCATATGGAATTCGGACTAAGAGACCTG CTACCCATG; E4-R, (SEQ ID NO: 22) GCTGTGTGGTAATTGGCTGTGGG.

[0124] PCR conditions: 95 C., 3 min; 95 C., 30 s; 62 C., 30 s; 72 C., 4 min; cycles 30; 72 C., 5 min; stored at 12 C.

[0125] An end of the E4 gene fragment obtained by PCR amplification was phosphorized, and the phosphorized end was ligated into a T vector at the flat end to obtain p14E4.

[0126] 2) By using the following primers, Ad5 E4 ORF2-6 was obtained by PCR amplification using an Ad5 genome as a template.

TABLE-US-00012 5(ORF2-6)-F, (SEQ ID NO: 23) CATTCAAAACTAACAATGCAGAAACCCGCAG ACATG; 5(ORF2-6)-R, (SEQ ID NO: 24) GAGTCTGGATCACGGCTACATGGGGGTAGA GTCATAATCG.

[0127] PCR conditions: 95 C., 3 min; 95 C., 30 s; 62 C., 30 s; 72 C., 2 min; cycles 30; 72 C., 5 min; stored at 12 C.

[0128] 3) By using the following primers, a p14E4 skeleton was obtained by PCR amplification using the p14E4 as a template.

TABLE-US-00013 p14E4-F, (SEQ ID NO: 25) CCGTGATCCAGACTCCGGAG; p14E4-R, (SEQ ID NO: 26) TGTTAGTTTTGAATGAGTCTGCAAA.

[0129] PCR conditions: 95 C., 3 min; 95 C., 30 s; 60 C., 30 s; 72 C., 5 min; cycles 30; 72 C., 5 min; stored at 12 C.

[0130] The 5(ORF2-6) and the p14E4 plasmid skeleton were subjected to a double ligation with Exnase to obtain p14E4(5Orf2-6). The endonuclease digestion result of p14E4(5Orf2-6) by HindIII and XbaI was shown in FIG. 6B.

[0131] 2. Construction of a plasmid pAd14E1E3(5E4)

[0132] The p14E4(5Orf2-6) was linearized with EcoRI, and the pAd14E1E3 was linearized with PsiI. Fragments recovered from the two enzyme digested products were co-transformed into a BJ5183 competent cell for recombination. The recombined BJ5183 competent cell was subjected to resistance screening by an ampicillin resistant plate. After amplification of the screened monoclone, the plasmid was extracted from the screened monoclone and transformed into an XL competent cell, from which a plasmid was extracted, to obtain pAd14E1E3(5E4). A plasmid was extracted from the pAd14E1E3(5E4) and identified by enzyme digestion. See a schematic of plasmid construction in FIG. 6A and endonuclease digestion results of pAd14E1E3(5E4) with BamH I and pAd14E1E3(5E4) with HindIII and EcoRV in FIG. 6C.

EXAMPLE 7

Construction of shuttle plasmid harboring exogenous genes such as EGFP and construction of replication defective Ad14 genomic plasmid

[0133]
pAd14E14E3(5E4)-EGFP

[0134] 1. Construction of a shuttle plasmid pSE1LR harboring recombination arms at both sides of the E1 gene

[0135] A left arm (L-SE1) and a right arm (R-SE1) of the E1 gene were obtained by PCR amplification using an Ad14 genome as a template.

[0136] L-SE1 primer:

TABLE-US-00014 L-SE1-F, (SEQ ID NO: 27) ACCGCCCAGTAGAAGCGCCGGTGGGGGTGGAGT GTTTTTGCAAG; L-SE1-R, (SEQ ID NO: 28) ACTAGTGTTTAAACGATATCGTAATCGAAACCTC CACGTAATGG.

[0137] PCR conditions: 95 C., 3 min; 95 C., 30 s; 61 C., 30 s; 72 C., 30 s; cycles 30; 72 C., 5 min; stored at 12 C.

[0138] R-SE1 primer:

TABLE-US-00015 R-SE1-F, (SEQ ID NO: 29) GATATCGTTTAAACACTAGTGAGACCGGATCATT TGGTTATTG; R-SE1-R, (SEQ ID NO: 30) CCAGATATACGCGTGTATACGGGAAATGCAAATC TGTGAGGG.

[0139] PCR conditions: 95 C., 3 min; 95 C., 30 s; 61 C., 30 s; 72 C., 1 min; cycles 30; 72 C., 5 min; stored at 12 C.

[0140] The L-SE1, R-SE1, and a plasmid skeleton obtained by digesting a pVax vector with Bstz17I +SgrAI through double enzyme digestion were subjected to a triple-fragment ligation with an Exnase enzyme to obtain pSE1(L+R).

[0141] 2. Construction of a shuttle plasmid pGK141-EGFP harboring an exogenous gene such as EGFP

[0142] The CMV-EGFP-BGH was obtained by PCR amplification using pGA1-EGFP as a template.

[0143] Primer sequence:

TABLE-US-00016 CMV-EGFP-BGH-F, (SEQ ID NO: 31) AGATATACGCGTTGACATTGATTATTGA CTAG; CMV-EGFP-BGH-R, (SEQ ID NO: 32) GCTGGTTCTTTCCGCCTCAGAAG.

[0144] PCR conditions: 95 C., 3 min; 95 C., 30 s; 65 C., 30 s; 72 C., 1 min 50 s; cycles 30; 72 C., 5 min; stored at 12 C.

[0145] The CMV-EGFP-BGH expression cassette was digested with SpeI through enzyme digestion, and the pSE1(L+R) was digested with HindIII+XbaI through double enzyme digestion. The two enzyme digested products were ligated to obtain pGK141-EGFP. The endonuclease digestion result of pGK141-EGFP by HindIII and XbaI was shown in FIG. 7B.

[0146] 3.Construction of pAd14E1E3(5E4)-EGFP

[0147] The pGK141-EGFP was linearized by Bstz17I +SgrAI, and the pAd14E1E3(5E4) was linearized by PmeI. Fragments recovered from the two enzyme digested products were co-transformed into a BJ5183 competent cell for recombination. The recombined BJ5183 competent cell was subjected to resistance screening by an ampicillin resistant plate. After amplification of the screened monoclone, the plasmid was extracted from the screened monoclone and transformed into an XL competent cell, from which a plasmid was extracted, to obtain pAd14E1E3(5E4)-EGFP. A plasmid was extracted from the pAd14E1E3(5E4)-EGFP and identified by enzyme digestion. See a schematic of plasmid construction in FIG. 7A and endonuclease digestion result of pAd14E1E3(5E4)-EGFP with HindIII and EcoRV in FIG. 7C.

EXAMPLE 8

Rescue and Production of Replication Defective Ad14 Vectors

[0148] The pAd14E1E3(5E4) and pAd14E1E3(5E4)-EGFP were linearized with AsisI through enzyme digestion, respectively, then recovered by ethanol precipitation, and transfected into 293 cells by using Lipofectamine2000. The 293 cells were cultured in a DMEM medium containing 5% FBS 8h later of transfection. From the 7.sup.th day of culture, the cells were observed every day to look for cytopathic effect (CPE). Once obviously CPE were observed, the cells and culture supernatant were collected, and repeatedly frozen and thawed for 3 times in a liquid nitrogen container and a water bath kettle at 37 C., and then cell debris was removed by centrifugation. A suitable amount of supernatant was added to a 10 cm cell-culture dish to infect 293 cells. When the CPE was observed after infection for 2 to 3 days, the cells and supernatant were collected and repeatedly frozen and thawed for 3 times, and thereafter, cell debris was removed by centrifugation. A supernatant was collected and added to 15 cm cell-culture dishes to infect eight to nine 293 cells for propagation. When the CPE was observed after infection for 2 to 3 days, the cells and supernatant were collected and repeatedly frozen and thawed for 3 times, and thereafter, cell debris was removed by centrifugation. A supernatant was collected and added in a centrifuge tube of cesium chloride gradient, balanced, and centrifuged for 4 hours at 4 C., 30000 rpm. After centrifugation, a virus band was extracted carefully, desalted and packaged. An appropriate amount of the virus was used for OD260 concentration measurement, and virus concentration was calculated by the equation below: virus concentration =OD260dilution factor36/genome length (Kb). The collected and purified virus was stored at 80 C. The production result of a type 14 replication defective vector was shown in FIG. 8A. The purification result of a type 14 replication defective vector was shown in FIG. 8B.

EXAMPLE 9

Replication Assay of Replication Defective Ad14 in 293 and A549 Cells

[0149] Replication capacities of replication defective Ad14 vectors in helper cell 293 and non-helper cell A549 were detected by a plaque assay. 293 or A549 cells were cultured in a 12-well cell plate. When the cell density approximated to 100%, the harvested P1-generation Ad14E1E3(5E4)-EGFP virus stock solution was undergone gradient dilution, and then infected into 293 or A549 cells, respectively. Duplicated wells were performed for each virus concentration. After the virus was infected into cells for 2h, the medium was removed, and each well was covered with 1.2% agarose gel about 1 ml (containing 1.2% agarose, 5% fetal bovine serum, 1MEM medium, 1penicillin-streptomycin). After about 9 to 12 days of culture, a green fluorescence expression in the virus was observed and formation of virus clone was sought by fluorescence microscope. Graphs were taken. The results of virus plaques formed by type 14 replication defective vector in 293 and A549 cells were shown in FIG. 9. The Ad14E3-EGFP with only E3 gene knocked out could form typical virus plaques in both 293 and A549 cells, and thus had a replication capacity; the Ad14E1E3(5E4)-EGFP with both E1 and E3 genes knocked out could form virus plaques only in helper cells 293, but not in normal human A549 cells. The above results indicate that a replication defective Ad14 vector can replicate in a helper cell 293, but it cannot replicate in normal human cells such as A549 cells, and thus it exhibits an attenuated phenotype. In addition, a replication defective Ad14 vector can express the carried reporter genes in the infected cells and thus can be applied in biological report and trace systems.

EXAMPLE 10

Immunogenicity Evaluation of Replication Defective Ad14 Vectors in Mice

[0150] A scheme of evaluating immunogenicity of replication defective Ad14 in mice was designed (shown in the FIG. 10A and FIG. 10B). The immunogenicity of the replication defective Ad14 was evaluated according to the designed immunization scheme.

[0151] Balb/c mice at 6-8 weeks of age was selected and divided into 3 groups and each group included 6 mice. By intramuscular injection, mice in Group 1 was immunized with Ad5E1E3; mice in Group 2 was immunized with heat-inactivated Ad14E3-EGFP; and mice in Group 3 was immunized with Ad14E1E3(5E4)-EGFP. On day 14 after immunization, blood samples were collected from orbit and the serum was separated, and neutralizing antibody against Ad14 was measured. Compared with the inactivated Ad14E3-EGFP, Ad14E1E3(5E4)-EGFP could induce higher-level neutralizing antibodies against Ad14. On day 42 after immunization, blood samples were collected again from orbit, and valence of the neutralizing antibodies against Ad14 in serum was measured. The detection result of neutralizing antibody titer after immunizing mice for two weeks by replication defective Ad14E1E3(5E4) was shown in FIG. 10C. The detection result of neutralizing antibody titer after immunizing mice for six weeks by replication defective Ad14E1E3(5E4) was shown in FIG. 10D. At this moment, Ad14E1E3(5E4)-EGFP and inactivated Ad14E3-EGFP could induce equivalent level of valence of neutralizing antibodies against Ad14. These results indicate that compared with the inactivated Ad14E3-EGFP, Ad14E1E3(5E4)-EGFP can induce higher-level neutralizing antibodies against Ad14 at the early stage of immunizing mice.

[0152] The examples described above are merely illustrations of several embodiments of the present invention, and the specific and detailed examples are not intended to limit the scope of the patent invention. It should be noted that within the scope of the present patent invention, a number of modifications and variations may occur to one skilled in the art without departing from the scope and inventive ideas of the present patent invention. Accordingly, the scope of the present patent invention should be subject to the appended claims.