COMPOSITIONS AND METHODS FOR IDENTIFYING RNA BINDING POLYPEPTIDE TARGETS
20190390186 ยท 2019-12-26
Assignee
Inventors
- Michael Rosbash (Waltham, MA, US)
- Aoife McMahon (Waltham, MA, US)
- Weijin Xu (Waltham, MA, US)
- Hua Jin (Waltham, MA, US)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N9/78
CHEMISTRY; METALLURGY
C07K2319/20
CHEMISTRY; METALLURGY
C12N2750/14122
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N9/78
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
Abstract
The present invention features compositions comprising fusion polypeptides comprising an RNA binding polypeptide operationally linked to an RNA modifying enzyme (e.g., adenosine deaminase, cytidine deaminase), and methods of use therefore.
Claims
1. A fusion polypeptide comprising an RNA binding polypeptide, or fragment thereof, fused to an RNA editing enzyme or fragment thereof.
2. The fusion polypeptide of claim 1, wherein the RNA editing enzyme is adenosine deaminase or cytidine deaminase.
3. The fusion polypeptide of claim 1, wherein the RNA binding polypeptide is selected from the group consisting of Zipcode binding polypeptide 1 (ZBP1), Fus, Tdp43, EIF4EBP1, and HuR.
4. The fusion polypeptide of claim 1, wherein the RNA editing enzyme is the catalytic domain of adenosine deaminase or cytidine deaminase.
5. The fusion polypeptide of claim 1, wherein the RNA editing enzyme is human ADAR2 comprising E488Q, a V493A, and/or T490A.
6. An expression vector comprising a nucleic acid sequence encoding the polypeptide of claim 1.
7-9. (canceled)
10. A host cell comprising the expression vector of claim 6.
11. The host cell of claim 10, wherein the cell is a eukaryotic cell.
12. The host cell of claim 11, wherein the cell is selected from the group consisting of a bacterial cell, a mammalian cell, and an insect cell.
13. A mammalian host cell comprising the fusion polypeptide of claim 1.
14. (canceled)
15. The host cell of claim 13, wherein the cell is a neoplastic cell.
16. The host cell of claim 13, wherein the cell is selected from the group consisting of adipocytes, bone marrow derived cells, epidermal cells, endothelial cells, fibroblasts, hematopoietic cells, hepatocytes, myocytes, neurons, pancreatic cells, and their progenitor cells or stem cells.
17. A method for producing a fusion polypeptide of claim 1, the method comprising (a) providing a cell transformed with the expression vector of any one of claims 6-9 positioned for expression in the cell; and (b) culturing the cell under conditions for expressing the fusion polypeptide.
18. A viral vector comprising a polynucleotide encoding a fusion polypeptide of claim 1.
19. An adeno-associated viral (AAV) vector comprising fusion polypeptide of claim 1, wherein the polypeptide is operably linked to a promoter positioned for expression in a mammalian cell.
20. A method for identifying an RNA binding polypeptide target, the method comprising (a) contacting a transcriptome of a cell with a fusion polypeptide comprising an RNA binding polypeptide or fragment thereof to the catalytic domain of an RNA-editing enzyme; and (b) detecting novel RNA editing events in said transcriptome.
21. The method of claim 20, wherein the RNA-editing enzyme is an adenosine deaminase or cytidine deaminase.
22. The method of claim 20, wherein the RNA binding polypeptide is selected from the group consisting of Zipcode binding polypeptide 1 (ZBP1), Fus, Tdp43, EIF4EBP1, and HuR.
23. The method of claim 20, wherein the RNA editing enzyme is the catalytic domain of adenosine deaminase or cytidine deaminase.
24-25. (canceled)
26. The method of claim 20, wherein the RNA editing enzyme is human ADAR2 comprising E488Q, a V493A, and/or T490A.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
DETAILED DESCRIPTION OF THE INVENTION
[0158] The invention features compositions and methods that are useful for identifying the functional targets of RNA binding proteins (RBPs). RNA transcripts are bound and regulated by RNA-binding proteins (RBPs). Current methods for identifying in vivo targets of an RBP are imperfect and not amenable to examining small numbers of cells.
[0159] To address these issues, the present invention uses a TRIBE (targets of RNA-binding proteins identified by editing) system, a method that couples an RBP to the catalytic domain of the Drosophila RNA-editing enzyme Adenosine deaminases acting on RNA (ADAR) and expresses the fusion polypeptide in vivo. RBP targets are marked with novel RNA editing events and identified by sequencing RNA. TRIBE has been used to identify the targets of three RBPs (Hrp48, dFMR1, and NonA). TRIBE compares favorably to other methods, including CLIP, and TRIBE has identified RBP targets from as little as 150 specific fly neurons. TRIBE can be performed without an antibody and in small numbers of specific cells.
[0160] The invention further provides methods for expressing RNA binding protein-RNA modifying enzyme fusion polypeptides in a cell, tissue, or organ that does not typically express such proteins. If desired, a viral vector (e.g., an adeno-associated viral vector) is used to express a RNA binding protein-RNA modifying enzyme fusion polypeptidefusion polypeptide. Such viral vectors may, if desired, be administered in combination with fusion polypeptides of the invention. Advantageously, the fusion polypeptides containing a RNA binding protein-RNA modifying enzyme fusion polypeptide are only transiently present in the cell, while the polypeptide or fusion polypeptide expressed in the adeno-associated viral vector are persistently expressed. If desired, the expression of a RNA binding protein-RNA modifying enzyme fusion polypeptide can persist, for constitutive expression.
Recombinant Polypeptide Expression
[0161] The invention generally provides an RNA binding polypeptide operably linked to a RNA modifying enzyme, where the RNA binding polypeptide is capable of specifically binding and editing an RBP target. The target is irreversibly marked by this editing. The transcriptome of cells of interest is subsequently sequenced, thereby identifying the RBP target.
[0162] As described in more detail below, virtually any RNA binding polypeptide of interest can be fused to a RNA modifying enzyme to form an RNA binding protein-RNA modifying enzyme fusion polypeptidefusion polypeptide. Advantageously, such fusion polypeptides can be delivered to cells in vitro or in vivo. In one embodiment, a fusion polypeptide of the invention is used to contact a cell in vitro, such that the cell takes up the fusion polypeptide. Alternatively, a fusion polypeptide of the invention is delivered to a cell, tissue, or organ in situ, such that the cell, tissue, or organ takes up the fusion polypeptide.
[0163] In embodiments of the present invention various RNA binding proteins of interest can be fused to a RNA modifying enzyme to form an RNA binding protein-RNA modifying enzyme fusion polypeptide. RNA binding proteins can include, for example, Eukaryotic translation initiation factor 4E-binding polypeptide 1 (eIF4EBP1), fragile X mental retardation protein 1 (FMRP1), dFMR1 (Drosophila melanogaster homolog of the fragile X mental retardation protein), RNA-binding polypeptide FUS, ELAV-like protein 1 (HuR), Hrp48 (also called Hrb27C), hnRNP A/B, NonA, NonO, TAR DNA-binding polypeptide 43 (TDP-43) and Zipcode-binding polypeptide 1 (ZBP1).
[0164] In embodiments of the present invention various RNA modifying enzymes can be operatively linked to the RNA binding proteins to form an RNA binding protein-RNA modifying enzyme fusion polypeptide. RNA modifying enzymes can include, for example, adenosine deaminase such as Adenosine deaminases that act on RNA (ADARs) and any cytidine deaminase enzyme.
[0165] Adenosine deaminases that act on RNA (ADARs) deaminateadenosines in dsRNA to produce inosines ADARs are important in mammals and are particularly important in the nervous system.
[0166] Recombinant fusion polypeptides of the invention are produced using virtually any method known to the skilled artisan. Typically, recombinant polypeptides are produced by transformation of a suitable host cell with all or part of a polypeptide-encoding nucleic acid molecule or fragment thereof in a suitable expression vehicle. Those skilled in the field of molecular biology will understand that any of a wide variety of expression systems may be used to provide the recombinant protein. The precise host cell used is not critical to the invention. A polypeptide of the invention may be produced in a prokaryotic host (e.g., E. coli) or in a eukaryotic host (e.g., Saccharomyces cerevisiae, insect cells, e.g., Sf21 cells, or mammalian cells, e.g., NIH 3T3, HeLa, or preferably COS cells). Such cells are available from a wide range of sources (e.g., the American Type Culture Collection, Rockland, Md.; also, see, e.g., Ausubel et al., Current Protocol in Molecular Biology, New York: John Wiley and Sons, 1997). The method of transformation or transfection and the choice of expression vehicle will depend on the host system selected. Transformation and transfection methods are described, e.g., in Ausubel et al. (supra); expression vehicles may be chosen from those provided, e.g., in Cloning Vectors: A Laboratory Manual (P. H. Pouwels et al., 1985, Supp. 1987).
[0167] A variety of expression systems exist for the production of the polypeptides of the invention. Expression vectors useful for producing such polypeptides include, without limitation, chromosomal, episomal, and virus-derived vectors, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof.
[0168] One particular bacterial expression system for polypeptide production is the E. coli pET expression system (e.g., pET-28) (Novagen, Inc., Madison, Wis.). According to this expression system, DNA encoding a polypeptide is inserted into a pET vector in an orientation designed to allow expression. Since the gene encoding such a polypeptide is under the control of the T7 regulatory signals, expression of the polypeptide is achieved by inducing the expression of T7 RNA polymerase in the host cell. This is typically achieved using host strains that express T7 RNA polymerase in response to IPTG induction. Once produced, recombinant polypeptide is then isolated according to standard methods known in the art, for example, those described herein.
[0169] Another bacterial expression system for polypeptide production is the pGEX expression system (Pharmacia). This system employs a GST gene fusion system that is designed for high-level expression of genes or gene fragments as fusion polypeptides with rapid purification and recovery of functional gene products. The protein of interest is fused to the carboxyl terminus of the glutathione S-transferase protein from Schistosoma japonicum and is readily purified from bacterial lysates by affinity chromatography using Glutathione Sepharose 4B. Fusion polypeptides can be recovered under mild conditions by elution with glutathione. Cleavage of the glutathione S-transferase domain from the fusion polypeptide is facilitated by the presence of recognition sites for site-specific proteases upstream of this domain. For example, proteins expressed in pGEX-2T plasmids may be cleaved with thrombin; those expressed in pGEX-3X may be cleaved with factor Xa.
[0170] Alternatively, recombinant polypeptides of the invention are expressed in Pichia pastoris, a methylotrophic yeast. Pichia is capable of metabolizing methanol as the sole carbon source. The first step in the metabolism of methanol is the oxidation of methanol to formaldehyde by the enzyme, alcohol oxidase. Expression of this enzyme, which is coded for by the AOX1 gene is induced by methanol. The AOX1 promoter can be used for inducible polypeptide expression or the GAP promoter for constitutive expression of a gene of interest.
[0171] Once the recombinant polypeptide of the invention is expressed, it is isolated, for example, using affinity chromatography. Recombinant polypeptides expressed in the selected host cell can be separated, isolated, and purified using conventional biochemical techniques, for example, treatment with a protein precipitating agent (salting out method), centrifugation, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography, gel filtration, adsorption chromatography, ion exchange chromatography, affinity chromatography, and the like can be used, such as various types of chromatography, and combinations thereof commonly used to separate the high purity protein.
[0172] In one example, an antibody raised against a polypeptide of the invention may be attached to a column and used to isolate the recombinant polypeptide. An antibody can be produced by any antibody production method generally known in the art. For example, an antibody may be produced from a B cell hybridoma cell line produced by a mammalian such as Chinese hamster ovary (CHO) cell line. As one of ordinary skill in the art would understand, the heavy chain C-terminal lysine can be absent from the version produced by CHO cells (Dick Jr. et al., Biotechnol. Bioeng. 2008; 100: 1132-1143). Further exemplary methods of antibody generation are described by U.S. Pat. Nos. 6,794,500, 7,432,367, U.S. Patent Application No. 20150266975 and International Patent Application Nos. WO 1998023744, WO 2010075303, WO 2015085003, which are incorporated herein by reference in their entirety. Lysis and fractionation of polypeptide-harboring cells prior to affinity chromatography may be performed by standard methods (see, e.g., Ausubel et al., supra). Alternatively, the polypeptide is isolated using a sequence tag, such as a hexahistidine tag, that binds to nickel column.
[0173] Once isolated, the recombinant protein can, if desired, be further purified, e.g., by high performance liquid chromatography (see, e.g., Fisher, Laboratory Techniques In Biochemistry and Molecular Biology, eds., Work and Burdon, Elsevier, 1980). Polypeptides of the invention, particularly short peptide fragments, can also be produced by chemical synthesis (e.g., by the methods described in Solid Phase Peptide Synthesis, 2nd ed., 1984 The Pierce Chemical Co., Rockford, Ill.). These general techniques of polypeptide expression and purification can also be used to produce and isolate useful peptide fragments or analogs (described herein).
RNA Binding Protein-RNA Modifying Enzyme Fusion Polypeptide and Analogs
[0174] Also included in the invention are RNA binding protein-RNA modifying enzyme fusion polypeptides or fragments thereof that are modified in ways that enhance their ability to identify targets. The invention provides methods for optimizing a RNA binding protein-RNA modifying enzyme fusion polypeptide amino acid sequence or nucleic acid sequence by producing an alteration in the sequence. Such alterations may include certain mutations, deletions, insertions, or post-translational modifications. The invention further includes analogs of any naturally-occurring polypeptide of the invention. Analogs can differ from a naturally-occurring polypeptide of the invention by amino acid sequence differences, by post-translational modifications, or by both. Analogs of the invention will generally exhibit at least 85%, more preferably 90%, and most preferably 95% or even 99% identity with all or part of a naturally-occurring amino, acid sequence of the invention. The length of sequence comparison is at least 5, 10, 15 or 20 amino acid residues, preferably at least 25, 50, or 75 amino acid residues, and more preferably more than 100 amino acid residues. Again, in an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e.sup.3 and e.sup.100 indicating a closely related sequence.
[0175] The nucleic acid and protein sequences of the present invention can further be used as a query sequence to perform a search against public databases to, for example, identify related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al., J. Mol. Biol. 215:403-10 (1990). BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to the protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., Nucleic Acids Res. 25(17):3389-3402 (1997). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used (See www.ncbi.nlm.nih.gov).
[0176] Modifications include in vivo and in vitro chemical derivatization of polypeptides, e.g., acetylation, carboxylation, phosphorylation, or glycosylation; such modifications may occur during polypeptide synthesis or processing or following treatment with isolated modifying enzymes. Analogs can also differ from the naturally-occurring polypeptides of the invention by alterations in primary sequence. These include genetic variants, both natural and induced (for example, resulting from random mutagenesis by irradiation or exposure to ethanemethylsulfate or by site-specific mutagenesis as described in Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual (2d ed.), CSH Press, 1989, or Ausubel et al., supra). Also included are cyclized peptides, molecules, and analogs which contain residues other than L-amino acids, e.g., D-amino acids or non-naturally occurring or synthetic amino acids, (e.g., beta or gamma amino acids).
[0177] In addition to full-length polypeptides, the invention also provides fragments of any one of the polypeptides or peptide domains of the invention. As used herein, the term a fragment means at least 5, 10, 13, or 15 amino acids. In other embodiments a fragment is at least 20 contiguous amino acids, at least 30 contiguous amino acids, or at least 50 contiguous amino acids, and in other embodiments at least 60 to 80, 100, 200, 300 or more contiguous amino acids. Fragments of the invention can be generated by methods known to those of ordinary skill in the art or may result from normal protein processing (e.g., removal of amino acids from the nascent polypeptide that are not required for biological activity or removal of amino acids by alternative mRNA splicing or alternative protein processing events).
[0178] The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, Molecular Cloning: A Laboratory Manual, second edition (Sambrook, 1989); Oligonucleotide Synthesis (Gait, 1984); Animal Cell Culture (Freshney, 1987); Methods in Enzymology Handbook of Experimental Immunology (Weir, 1996); Gene Transfer Vectors for Mammalian Cells (Miller and Calos, 1987); Current Protocols in Molecular Biology (Ausubel, 1987); PCR: The Polymerase Chain Reaction, (Mullis, 1994); Current Protocols in Immunology (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.
[0179] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the assay, screening, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention.
EXAMPLES
[0180] TRIBE involves the fusion of an RBP to the catalytic domain of an RNA-editing enzyme (ADARcd). Because the double-stranded RNA-binding (dsRBD) regions of ADAR are missing from the fusion protein, its editing specificity was determined by the RNA recognition features of the RBP; target transcripts are edited in vivo and then identified by RNA sequencing (
Example 1The Hrp48-TRIBE Fusion Polypeptide has Editing Activity and Hrp48-Determined Specificity
[0181] Hrp48 (also called Hrb27C) is a homolog of the mammalian hnRNP AB family and implicated in splicing regulation, mRNA localization, and translation. Hrp48 was chosen as an initial RBP because it has well-characterized targets, there is an excellent antibody, and preliminary data indicated that it participates in circadian regulation.
[0182] Initial experiments were performed by creating stable Drosophila S2 cell lines that express the Hrp48-ADARcd fusion polypeptide (henceforth referred to as Hrp48-TRIBE) under inducible control. Expression of this protein in S2 cells, which have extremely low levels of endogenous editing, lead to a dramatic increase in the number of detected editing events (approximately 20-fold;
[0183] The majority of target genes are marked by a single editing site, and these events are reproducible both in their position and frequency (percent editing), indicating that Hrp48-TRIBE exhibits specificity (
Example 2CLIP and TRIBE Agree that Hrp48 Preferentially Binds to the 30 UTR of Transcripts
[0184] To assess if editing sites reflect true Hrp48 target genes, a series of CLIP-Seq experiments were performed to address target preference by this more traditional method. First, CLIP of endogenous Hrp48 shows the same binding pattern as CLIP of the Hrp48-TRIBE fusion polypeptide. Both proteins are strongly enriched in the 30 UTR, as is seen in an example gene Lam (
[0185] The 30 UTR binding preference of Hrp48 identified by CLIP is closely mirrored by the pattern of Hrp48-TRIBE editing sites. Transcriptome-wide, approximately 50% of Hrp48-TRIBE editing sites and 50% of Hrp48 CLIP peaks are found in the 30 UTR (
[0186] Indeed, Hrp48-TRIBE edits within the previously characterized binding element of Hsp83 (
[0187] Hrp48-TRIBE defines fewer targets than Hrp48 CLIP. Most expressed genes have at least one statistically significant CLIP peak, with similar results from endogenous Hrp48 and the Hrp48-TRIBE fusion polypeptide (
Example 3dFMR1-TRIBE Preferentially Edits Coding Sequence, Reflecting Prior CLIP Data
[0188] A second TRIBE protein was created by fusing dFMR1, the Drosophila ortholog of FMRP (fragile X mental retardation protein) to the ADARcd. dFMR1 has roles in mRNA localization and translational regulation in neurons.
[0189] As observed for Hrp48-TRIBE, induction of dFMR1-TRIBE expression in Drosophila S2 cells led to a robust increase in editing events (
[0190] In stark contrast to the distribution of Hrp48-TRIBE editing events, dFMR1-TRIBE editing events are distributed throughout the coding region of transcripts (
Example 4TRIBE Shows that NonA Preferentially Binds Introns
[0191] A third Drosophila RBP, NonA, is the ortholog of the mammalian protein NonO and was assayed in a similar manner as described above. NonO is a multifunctional protein involved in the function of nuclear para-speckles as well as other nuclear events like splicing, mRNA export and the regulation of transcription.
[0192] Expression of the NonA-TRIBE fusion polypeptide in S2 cells led to a small increase in mRNA editing (approximately 3-fold;
[0193] The nascent RNA edited by NonA-TRIBE has many genes with multiple editing sites per gene (
[0194] Not surprisingly, NonA-TRIBE editing sites are enriched in intronic regions of the nascent transcripts (
[0195] Gene ontology (GO) analysis reinforces the different roles of the three RBPs as the targets of each RBP have divergent functions. The cell culture experiments taken together indicate that TRIBE can determine the RNA targets of three RBPs, as well as where on a transcript they bind.
Example 5Hrp48-TRIBE can Identify RBP Targets in Specific Cells
[0196] Because the targets of many RBPs are likely to be different between tissue and cell types, test were conducted to determine whether TRIBE can identify cell-specific RBP targets within the fly brain. To achieve cell-specific expression of the TRIBE proteins, the Drosophila UAS/Gal4 system was employed. Transgenic fly lines harboring the Hrp48-TRIBE transgene under the control of the UAS promoter were generated. Cell-specific expression was achieved using a range of Gal4 driver lines, which express the UAS transcriptional activator Gal4 only in specific subsets of neurons. The neuronal groups examined were the core circadian PDF neuropeptide expressing cells (pdf-Gal4, 16 cells/brain), dopaminergic neurons (Tyrosine hydroxylase, TH-Gal4, 1,000 cells/brain) and all neurons (pan-neuronal driver, elav-Gal4, 100,000 cells/brain). A fluorescent protein (UAS-eGFP) was co-expressed to allow manual cell sorting of TRIBE protein-expressing and control neurons from dissociated Drosophila brains.
[0197] Similar to the cell culture result, neuronal expression of the Hrp48-TRIBE protein caused a large increase in the number of editing sites, far more than the level of endogenous editing (range of endogenous editing sites, 300-2,000; range of TRIBE editing sites, 8,000-11,000;
[0198] Similar numbers of Hrp48 target genes were identified in each of the three cell types (1743-2798); the target gene sets were overlapping, but not identical (
[0199] However, some genes were identified as a target in only one or two cell types despite being expressed in all three. For example, the genes galectin, aret, and Spp were expressed in all three cell types, but aret is identified as a target only in TH cells. Galectin was identified as a target in pdf and TH cells, and Spp is a target in pdf and elav cells (
[0200] Another set of targets are identified in only one or two cell types due to bonafide cell-type-specific gene expression differences: for example, pdf is only identified as a target in pdf neurons because it is only expressed there; similarly, the transcription factor Dll is only expressed in dopaminergic (TH) neurons where it is also identified as a Hrp48 target (
[0201] These Hrp48 target genes were also analyzed by gene ontology (GO) terms. Common target genes are not surprisingly enriched for general neuronal functions, consistent with the newly described role of Hrp48 in axon guidance and branching, whereas cell-specific target gene functions were distinct. This probably reflects cell-specific gene expression patterns as well as cell-specific binding of Hrp48 to commonly expressed genes.
Example 6dFMR1-TRIBE can Identify RBP Targets in Specific Cells
[0202] dFMR1-TRIBE was also expressed in specific neurons. Based on evidence from mammalian systems where the balance between excitation and inhibition is affected when FMRP is altered (e.g. Human Fragile X syndrome), the targets of dFMR1 in excitatory (cholinergic; Cha-Gal4) and inhibitory (GABAergic; GAD-Gal4) cells were selected for experimentation. They were purified as described above and the resulting isolated mRNA sequenced.
[0203] dFMR1-TRIBE editing sites were found throughout coding regions in neurons, which mirrors the cell culture results described above. Many fewer target genes were identified in GABAergic neurons than in cholinergic neurons (
[0204] Gene Ontology (GO) analysis indicated that common targets are enriched for general neuronal functions, including genes associated with the known role of FMRP as a regulator of the microtubule network. Overall, 45% of robust mouse brain CLIP targets (Darnell et al.) that have clear fly homologs were also dFMR1 TRIBE targets in excitatory fly neurons (
Example 7TRIBE Identifies Targets of 4E-BP
[0205] The eukaryotic initiation factor eIF4F complex consists of many components including: eIF4E, the subunit that binds to the 5 cap of mRNA, which brings the complex to the mRNA; eIF4G, the scaffolding protein to which the other components bind; mitogen-activated protein kinase-interacting kinase 1 (Mnk1), an eIF4E kinase; and eIF4A, an RNA helicase. The functionality of the eIF4F complex relies on the association between eIF4E and eIF4G. However, the binding of 4E-BP to eIF4E displaces eIF4E from eIF4G and the remainder of the complex, and thus inhibits cap-dependent translation. mTOR complex 1 (mTORC1) controls whether or not 4E-BP binds eIF4E by controlling 4E-BP phosphorylation.
[0206] When mTORC1 is active, under positive growth conditions it phosphorylates 4E-BP, which is then unable to bind to eIF4E. Thus, eIF4E is free to bind to eIF4G, which completes the eIF4F complex on the 5 cap and permits translation to proceed. Under negative growth conditions, for example, during stress or pharmacological inhibition of mTORC1 by rapamycin or torin 1, mTORC1 is inactive and 4E-BP therefore becomes hypophosphorylated. As a consequence of hypophosphorylation, 4E-BP binds efficiently to eIF4E, thereby removing it from the eIF4F complex and inhibiting cap-dependent translation.
[0207] To identify the binding partners of Thor, the Drosophila RBP that is an ortholog of the mammalian protein eIF4E-BP, additional experiments were conducted as described above. Two fusion polypeptides were generated to operatively link the catalytic domain of an ADAR with Thor, one fusion polypeptide contained a spatial linker region between Thor and the ADAR. Withholding serum or adding rapamycin enhanced target mRNA labeling as predicted from the literature on 4E-BP (
[0208] Next, a fusion polypeptide was generated by introducing a mutation to the ADAR operatively linked to Thor. The ADAR mutation (E488Q) resulted in dramatically increased target mRNA labeling, especially after activation of Thor by serum depletion or rapamycin treatment (
[0209] In additional to the Thor-ADAR-E488Q mutant, a constitutively active form of Thor (ThorLLAA) was used to label RNA targets. ThorLLAA can label RNA targets well under normal induction conditions in the presence and absence of rapamycin (
[0210] Frequency distributions of common RNA binding targets of 4E-BP under rapamycin (RAPA_1, RAPA_2) and torin (Torin_1, Torin_2) treatment conditions from different replicates are shown in the left panel of
TABLE-US-00023 TABLE 2 Thor TRIBE mRNA Data >10 reads, >20 reads, Thor-ADAR, no mapped 10% 10% linker-FACS-160902 reads edited sites edited sites 1 pMTA-Thor-Adar, cu 16870372 388 14 (92.3% of input) 2 pMTA-Thor-Adar, +cu 15572458 365 11 (92.9% of input) 3 pMTA-Thor-Adar, +cu 16905329 442 11 no FBS (90.6% of input) Thor-linker-ADAR, FACS-160323-160407 1 Thor_link- 19693224 449 8 er_TRIBE (76.2% of cu + FBS input) 2 Thor_link- 27227844 471 16 er_TRIBE + (82.3% of cu + FBS input) 3 Thor_link- 19680364 588 18 er_TRIBE + (77.0% of cu FBS input) 4 Thor_link- 21373906 614 26 er_TRIBE + (76.0% of cu FBS + Rapamycin input) 5 pMT cu + FBS 15897789 514 11 (80.0% of input)
TABLE-US-00024 TABLE 3 Thor TRIBE mRNA Data reads > 20, 1st >20% 2nd avg edited pMT-thor-linker-E488Q Mapped reads Edited sites Mapped reads Edited sites sites GFP only Induced 16175589 18 18 (88.7% of input) pMT-thor- Uninduced 14945919 17 13890567 17 linker-E488Q (87.8% of input) (93.1% of input) Induced 14072457 373 17864090 1427 900 (80.7% of input) (91.0% of input) Induced, Serum starvation 18714759 877 24724653 3191 2034 (88.3% of input) (90.4% of input) Induced, Serum starvation 20420937 1745 30906558 4406 3075.5 Rapamycin (85.9% of input) (89.3% of input) ADAR hyper Induced 24135561 144 7690514 16 80 only (88.6% of input) (88.2% of input)
[0211] Furthermore, known binding partners of eIF4E regulated by the mTOR pathway, such as TOP and TOP-like mRNAs, were identified by the Thor analysis. Sequences of interest are provided in Table 4. TOP mRNAs start with a cytidine immediately after the 5 mRNA cap, followed by an uninterrupted segment of 4-14 bp of pyrimidines (underlined regions).
TABLE-US-00025 TABLE4 TOP-likemRNASequencesinThorTargets mRNA Sequence CG3164 TTTCAGTTGCGATCGCGGCGCGAGCG CG11454 TTATCTTCTGCCATCACTACGT CG4822 CTTTACTCAGCAGCTCGCCATGCCAC MFS10 GTTTGTGTGTGTGTGT CG14629 CCAGTTAGTGCGA Ntf-2 TCGACGTTGTTCCACCC RpL7 GGTCTTTCTTTCCCTTTCTTTTACCAG RpL35 TTCCTTTTCTTTTCGCCGCGTTTCCGGAGAGGT Src42A AGTCTTTTGGTATTTCTCGAGTCC CoVIb CGCTATAGCTATCGCCAGGCTCGT
[0212] Gene Ontology (GO) analysis of the common targets of 4E-BP of 4E-BP in rapamycin and torin 1 treatment conditions indicated that 4E-BP is enriched in a translation related pathway. Examples of genes of interest identified by GO term analysis are provided in Table 5.
TABLE-US-00026 TABLE 5 Gene Ontology (GO) Analysis of Common Targets of 4E-BP of 4E-BP in Rapamycin and Torin 1 treatment conditions. Term RT Genes Count % P-Value structural constituent RT 42 7.7 1.1E17 of ribosome Ribosome subunit structural molecule RT
51 9.3 2.9E8 activity translation factor RT
14 2.6 1.6E4 activity, nucleic acid binding Translation factor SUMO binding RT
12 2.2 2.5E4 small conjugating RT
12 2.2 2.9E4 protein binding mRNA binding RT
20 3.7 1.6E3 translation initiation RT
10 1.8 1.7E3 factor activity Translation Initiation factor aminoacyl-tRNA ligase RT
9 1.6 1.9E3 activity ligase activity, forming RT
9 1.6 1.9E3 carbon-oxygen bonds ligase activity, forming RT
9 1.6 1.9E3 aminoacyl-tRNA and related compounds small protein activating RT
5 0.9 2.0E3 enzyme activity nucleotide binding RT
80 14.6 2.3E3 ATPase activity, coupled RT
11 2.0 3.1E3 to transmembrane movement of ions, phosphorylative mechanism ATPase activity, coupled RT
11 2.0 4.5E3 to transmembrane movement of ions
Example 8TRIBE Identification of Translating RNAs
[0213] Poly(A)-binding polypeptide (PABP) and Ribosomal Protein S2 (RPS2) are important components of the cellular machinery that enables protein synthesis. The TRIBE method was utilized in conjunction with PABP and RPS2 to form fusion polypeptides operatively linked to the catalytic subunit of an ADAR, as described above, to edit and identify translating mRNAs.
[0214] PABP is a RNA-binding polypeptide which binds to the poly(A) tail located on the 3 end of mRNA. PABP is also involved in mRNA precursors by helping Polyadenylate polymerase add the Poly(A) nucleotide tail to the pre-mRNA before translation. PABP is also present during stages of mRNA metabolism including Nonsense-mediated decay and nucleocytoplasmic trafficking. PABP may also protect the poly(A)tail from degradation and regulate mRNA production. PABP binding is designed to edit and identify polyadenylated mRNAs engaged in translation.
[0215] RPS2 is a component of the 40S subunit of the ribosome. During translation the 40S subunit binds to 70S subunits to form the ribosomal machinery responsible for the translation of mRNAs to form polypeptides. Together the 40S and 70S ribosomal subunits assemble on a strand of mRNA, where additional cellular components such as tRNAs are recruited for translation. RPS2 binding is designed to edit and identify mRNAs engaged in translation.
[0216] PABP-E488Q and RPS2-E488Q TRIBE fusion polypeptides were generated and assayed in a similar manner as described above. The PABP-E488Q fusion polypeptide produced a robust response in the induced group, which increased the amount of edited sites (
[0217] TRIBE was developed to allow the identification of RBP targets in small numbers of specific cells in vivo. To show that TRIBE is applicable to different types of RBPs, it was applied to three Drosophila RBPs (Hrp48, dFMR1 and NonA). The fusion polypeptides maintain catalytic activity, and expression of all three TRIBE fusion polypeptides results in robust and reproducible introduction of new editing sites. The three RBP-fusions have dramatically different editing patterns, indicating that the RBPs play a major role in determining editing specificity. Hrp48-TRIBE editing sites are enriched in the 30 UTR, as is the CLIP signal of both the fusion and endogenous proteins, demonstrating that TRIBE editing correctly reflects the endogenous binding pattern of Hrp48. dFMR1-TRIBE editing sites are dispersed throughout the coding sequence of transcripts, which is the observed binding pattern of mammalian FMRP as reported by Darnell et al. and is consistent with its role as a translation regulator. The third RPB fusion protein, NonA-TRIBE, edits RNA preferentially in introns, consistent with its published role as a splicing factor (Kozlova et al., Exp. Cell Res. 2006, 312, 2619-2630; Kaneko et al., Genes Dev. 2007, 21, 1779-1789).
[0218] Negative controls (the truncated ADAR catalytic domain alone and Hrp48-TRIBE with mutagenized RNA-binding domains) do not result in any additional editing sites, further indicating that editing is specified by the RBP. The data confidently indicates that the TRIBE editing sites faithfully mark transcript targets of the RBPs. Additional experiments expressing Hrp48-TRIBE and dFMR1-TRIBE in specific neurons demonstrate the ability to identify cell-specific RBP targets. Comparing these targets between neuronal subtypes illustrates the diversity of cell-type-specific RBP targets and therefore the importance of a method for defining RBP-target interactions in individual cell types.
Comparison of TRIBE to CLIP
[0219] The current standard for the identification of RBP targets is CLIP and variants thereof. Although most TRIBE sites are within 500 bp of a CLIP site, CLIP is important for determining precise RBP binding position. Nonetheless, the absence of alternative high-resolution methods for measuring in vivo binding has made it difficult to critically assess CLIP data for systematic biases or sources of false positives and false negatives.
[0220] CLIP false positives are a particular concern as transcripts that are functionally unaffected by knockdown of the RBP are often identified as targets (Lambert et al., Mol. Cell, 2014, 54, 887-900). Biases include the preferential crosslinking of uridines; the choice of RNase and fragmentation conditions, all of which have a significant impact on the detected targets. Most importantly perhaps, the low efficiency steps of the CLIP protocol necessitates large numbers of cells and as such is not amenable to the study of discrete, small numbers of cells.
[0221] Many of these drawbacks are avoided by TRIBE. It is not a biochemical technique and does not require an antibody. Alternatively, RNA tagging is a method to identify a target RNA by using a RBP fused to a Caenorhabditis elegans poly (U) polymerase, to tag target RNAs by attaching poly U tails bound by the RBP, which are used to identify the identity of the bound not (Lapointe et al., Nat. Methods 12, 1163-1170). Although it is too soon to compare the two methods, RNA tagging fundamentally differs from TRIBE since RNA tagging does not identify the region of the mRNA bound by the RBP, and target identification requires a special library protocol. Furthermore, in contrast to RNA tagging, the method of the present invention uses standard library methods and therefore needs very little RNA. Indeed, TRIBE has been used to identify RBP targets in tiny numbers of specific neurons from the fly brain. The smallest group of neurons used in this study is the key circadian pacemaker neurons, the pdf cells, of which there are 16 in a single fly brain. The minimum number of cells required to generate TRIBE sequencing libraries is 150 neurons. Given recent advances and the trajectory of developments in RNA sequencing (RNA-Seq), TRIBE could be applicable to individual cells and provide an unprecedented level of resolution on RBP targets.
[0222] TRIBE involves sequencing the transcriptome of specific cells and therefore also captures their specific gene expression features, e.g., alternative splicing and 30 UTR patterns, and therefore it may be possible to correlate transcriptional, post-transcriptional and RBP binding events. However, the expression of the TRIBE fusion polypeptide may affect gene expression, transient expression and gene expression analysis of a parallel sample without TRIBE expression are advisable. In contrast, CLIP is typically done from mixed tissue, making it difficult to correlate the binding data with a specific gene expression state. For example, if CLIP is performed on brain in which the RBP is not ubiquitously expressed (e.g., FMRP is expressed in neurons but not glia or blood vessels), the corresponding transcriptome, expression levels as well as isoform features, are an average of all cell types. This also makes normalization difficult if not impossible, as noted by Darnell et al. As a result, CLIP targets are biased toward highly-expressed and long genes. Although TRIBE requires a minimum expression level of target, above that threshold there is no bias toward highly expressed genes.
[0223] Although optimization of CLIP can be challenging (e.g., the optimal crosslinking parameters differ between proteins, over-digestion of crosslinked complexes by RNase can affect the results), TRIBE is comparatively simple to perform and should also be amenable to mammalian systems. It only requires cloning and expression, the RNA is then purified and sequenced, and novel editing events detected via a bioinformatics pipeline.
Potential Shortcomings of TRIBE
[0224] A risk of hijacking the function of ADAR is that some of its own editing selectivity may remain. Obviously the ADARcd-TRIBE protein has an absolute requirement for an editable substrate (an adenosine) proximal to the RBP binding site, the absence of which may preclude the editing of some targets and result in false negatives. In addition, endogenous ADARs have preferences for bases proximal to the editing site and all TRIBE proteins maintain these published preferences (e.g., 50 U enriched, 30 G enriched;
[0225] However, the most prominent cause of false negatives is probably the strong preference of the ADAR catalytic domain for double-stranded RNA even without its dsRBDs (Macbeth et al., Science. 2005, 309, 1534-1539; Eggington et al.; Montiel-Gonzalez et al., Proc. Natl. Acad. Sci. 2013, 110, 18285-18290; Vogel et al., Chem. Int. Ed. Engl. 2014, 53, 6267-6271; Vogel and Stafforst. ChemMedChem. 2014, 9, 2021-2025; Phelps et al., Nucleic Acids Res. 2015, 43, 1123-1132). Although endogenous ADAR exhibits considerable plasticity, e.g., it edits regions of highly complex structure as well long stretches of duplex RNA, it was assumed that RBP-ADARcd proteins will not label their bound targets if they are composed exclusively of single stranded RNA. Indeed, the comparison of edited regions with those CLIP targets that have no editing (
[0226] Yet the data indicates that 40%-50% of target mRNAs have sufficient double-stranded character near the RBP binding site to be edited by the TRIBE ADARcd (
Improvements and Extensions
[0227] The study presented herein is the first demonstration of TRIBE. Possible modifications may be made. For example, an additional editing moiety may be used. Experiments were conducted in an effort to perform TRIBE using cytidine deaminases, which edit single-stranded RNA and catalyze the conversion of cytidine and uridine. Seven characterized and putative cytidine deaminases were tried and the mouse APOBEC1 ADAR was selected. In one embodiment, a characterized ADAR mutant having enhanced catalytic activity and having less of a nearest-neighbor preference than wild-type ADAR (Kuttan and Bass, 2012) may be used. In another embodiment, an endogenous locus knockin may be used to achieve endogenous levels of RBP-TRIBE expression. In another embodiment, TRIBE can be extended by fusing the ADARcd to other proteins and expressing them in a cell-type-specific manner, for example, polyA binding polypeptide for transcriptome identification or ribosomes for translational profiling, all of which can be done without any biochemistry. In another embodiment, a light-, biochemical- or chemical-activatable domain to provided spatial and temporal control to TRIBE editing may be used.
Cell Specificity
[0228] Experiments expressing Hrp48-TRIBE and dFMR1-TRIBE in specific subsets of neurons identified cell-specific targets. Comparing them between neuronal subtypes illustrates the diversity of cell-type-specific RBP targets and thus the importance of TRIBE for defining RBP-target interactions in particular cell types. Although recent advances in sequencing technology have revealed the distinct regulation of individual cell types at the transcriptional and post-transcriptional level, it has been extremely difficult to define the cell-type-specific roles and tar-gets of individual RBPs. TRIBE ameliorates this issue and should therefore contribute to addressing the long-standing question of how more broadly expressed proteins have cell-specific effects. This issue is particularly relevant to several RNA-binding proteins associated with human diseases, e.g., FMRP, FUS, and TDP43.
[0229] The results described herein above, were obtained using the following methods and materials.
Molecular Biology
[0230] The RBP of interest was cloned upstream of the Drosophila ADAR catalytic domain (the whole C terminus downstream of the second dsRBD was used, starting with Y268 to terminal E669 of AHN59262.1) with minimal linker region into a pMT-A vector (Invitrogen, V4120-20, also harboring a blasticidin-resistance gene). Stable S2 cell lines were made by transfecting with the pMT-RBP-ADARcd-V5-Blasticidin plasmid, followed by subsequent blasticidin-resistance selection. Fusion polypeptide expression was induced by introduction of copper sulfate for 24 hr, prior to harvesting protein and RNA. S2 cell expression of all fusion polypeptides was assayed by western blot for the V5 tag (Invitrogen, 46-1157). Nascent RNA was extracted from S2 cells, in accordance with Khodor et al., and depleted of ribosomal RNA, in accordance with Pennington et al. (Proc. Natl. Acad. Sci. 2013, 110, 7678-7683), and mRNA (two rounds of pA depletion using Invitrogen Dynabeads Oligo dT, in accordance with the manufacturer's protocol).
[0231] Fluorescently labeled neurons were isolated from dissected, triturated fly brains by manual sorting using a glass micro-pipette, as described in Abruzzi et al. (Methods Enzymol. 2015, 551, 369-386). RNA-Seq libraries from S2 cells were constructed using the standard Illumina Truseq Kit protocol. RNA-Seq libraries from manually sorted neurons were made as described in Abruzzi et al.
RNA Editing Analysis
[0232] RNA-editing events are defined as loci where there are A>80% and zero G in genomic DNA and G>0% in RNA (in the reverse strand, the reverse complement was evaluated). Genomic DNA was also sequenced from either S2 cells or yw flies, to provide a reference which contains SNPs. Analysis of RNA-Seq data was performed as previously published (Rodriguez et al., Mol. Cell 2012, 47, 27-37), with some modifications, described in detail below.
[0233] In neurons, removal of endogenous editing events from the analysis was required. A lower threshold (ten reads, 10% editing) was used to define endogenous editing events. All endogenous events identified, including sites from all non-TRIBE expressing negative controls in all lines used in a given experiment were removed from the data from TRIBE-expressing neurons. Gene ontology (GO) analysis was performed using DAVID (Huang da et al, Nat. Protoc. 2009, 4, 44-57).
CLIP
[0234] CLIP libraries of Hrp48 and Hrp48-ADARcd were constructed as described in Cho et al. (Cell. 2012, 151:765-777), with some modifications as described below. Significant regions of binding were determined using the CLIPper algorithm (Lovci et al., Nat. Struct. Mol. Biol. 2013, 20, 1434-1442) and as described in Moore et al., Nat. Protoc. 2014, 9, 263-293.
Fly Lines
[0235] TRIBE flies were generated by cloning the RBP-ADARcd-V5 transgene into a modified pJFRC7-20x UAS construct (RBP in locus of removed mCD8-GFP, Addgene #26220), which was injected by BestGene. UAS-RBP-ADARcd-V5; UAS-eGFP flies (Bloomington stock center #1522) were crossed to a range of driver lines (pdf-Gal4, TH-Gal4, elav-gsg-Gal4, Cha-Gal4, and GAD-Gal4) to achieve cell-type-specific expression of the fusion polypeptide. Constitutive pan-neuronal expression of Hrp48-TRIBE (elav-Gal4 and UAS-Hrp48-ADARcd) was lethal, so adult-specific expression was achieved using the gene-switch system (Osterwalder et al., Proc. Natl. Acad. Sci. 2001, 98, 12596-12601), elav-gsg-Gal4. Young flies (3 days old) were maintained on food containing RU486 (0.2 mg/ml, Sigma #8046) for 5-8 days prior to dissection and cell sorting. Additional details are described below.
Cloning
[0236] TRIBE component cDNA clones were acquired from various sources; Hrp48 (P48809) from Donald Rio; dFMR1 (AF305881) provided by Tom Jongens, dADAR provided by Robert Reenan (Palladino et al., 2000), NonA (clone RE58280, Drosophila Genomics Resource Centre, Bloomington, Ind.). Cytidine deaminases assayed were mouse APOBEC1 (BC003792), yeast CDD1 (Gene ID 850946), putative Drosophila cytidine deaminases CG5292 (FBgn0038491) and CG6951 (FBgn0036959), human APOBEC3A (Sharma et al., 2015) and plant QED1 and RARE1, (Wagoner et al., 2015). Mutations of the two RNA recognition motifs of Hrp48 (P48809, F50V, F52V and F139V, F141V) were modeled after mutations performed by Mayeda et al. (1994) on hnRNP A1.
Cell Sorting
[0237] A detailed description of the cell sorting and RNA-Seq library generation protocol is provided in Abruzzi et al. Briefly, between 20 and 50 fly brains were dissected in the presence of tetrodotoxin only (0.1 uM), digested in L-cysteine-activated papain (Worthington) for 20 minutes, before manual dissociation using fire-polished pipette tips. Dissociated cells are allowed to settle in a large volume of sorting medium on Sylgard coated plates. Using a dissecting microscope fluorescently labeled neurons are then manually aspirated using micropipettes pulled from capillary tubes (World Precision Glass Capillaries #1B100-4, Sutter Instrument Company). Three rounds of sorting are performed until approximately 150-400 fluorescent cells are sorted into 50 ul of Lysis/Binding buffer (Invitrogen; Dynabeads mRNA direct kit) and frozen at 80 C.
Generation of Sequencing Libraries from Manually Sorted Neurons
[0238] Generation of sequencing libraries was performed as is described in Abruzzi et al. It is estimate between 200-500 pg of total or 5 pg of mRNA is gathered from 100 manually sorted neurons. mRNA is isolated on poly dT beads (Dynabeads mRNA direct kit; Invitrogen) using a scaled down version of the manufacturer's protocol, and concentrated by vacuum centrifugation (SpeedVac RC1010, Jouan, Winchester, Va.). A modified linear amplification method is then used to amplify this RNA; reverse transcription using random hexamers and dT primers containing T7 promoters generates a cDNA template that is used for one round of in vitro transcription (MEGAscript kit, Ambion). The cRNA is isolated (RNA MinElute column, Qiagen), concentrated by vacuum centrifugation, and used as input for the RNA Tru-Seq library generation kit (Illumina). Resulting libraries are somewhat 3 biased and approximately 20-60% of reads map to the fly genome (as discussed in Abruzzi et al.). All sequencing was performed on either an Illumina HiSeq or MiSeq.
Analysis of Sequencing Data for RNA Editing.
[0239] Analysis of RNA sequencing data was performed as previously published Rodriguez et al., with some modifications. All raw sequencing data and identified RNA editing sites are available for download from NCBI Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/), accession number (GSE78065). (Except yw gDNA which is in Series GSE37232, sample GSM914095).
[0240] In brief, sequencing reads are trimmed with Trimmomatics (Bolger et al., Bioinformatics. 2014, 30:2114-2120) by 6 bp at each end, additional low quality bases from either end are removed and reads with average quality score of 30 or greater are kept. Genomic DNA reads are aligned using bowtie2 (parameters: --sensitive) to the reference genome (Release 5/dm3) and RNA sequencing reads are aligned using tophat2 (Trapnell et al., Bioinformatics. 2009, 25:1105-1111.) (parameters: -m 1 -p 5 -g 2 -I 50000 --microexon-search --no-coverage-search).
[0241] PCR duplicates were not removed for editing analysis. Following re-analysis of a select number of data sets there was only a small change in the number or identity of editing sites and essentially no change in the overlap with CLIP data. The gtf file used throughout the analysis was downloaded from iGenomes (via Illumina, dm3 build). The editing analysis pipeline used RefSeq annotation of genes, which were downloaded from UCSC genome browser. Only uniquely mapped reads are considered for editing analysis. As number of editing events detected will change with sequencing depth, within each experiment each sample was sequenced to roughly the same depth. Initial experiments with Hrp48 TRIBE in S2 cells are an exception, experimental samples were sequenced to 200 million reads to determine if many events were not being detected with less coverage. 70-90 edit sites were detected in wild type cells and cells expressing the dADARcd alone, and on GEO (these likely represent SNPs, PCR errors, endogenous editing sites and may include sites edited by the dADARcd alone).
[0242] Only events with minimum 20 reads and 10% editing were considered to be an editing events, gDNA coverage and uniformity of nucleotide identity were also required to avoid inclusion of single nucleotide polymorphisms. RNA editing data is converted to bedgraph file format for display, where the editing percentage (# edit bases/# total bases) is the height of the displayed black bar. RNA editing data is manipulated as bed/bedgraph format using bedtools.
HITS-CLIP
[0243] The CLIP libraries of Hrp48 were constructed as described previously with slight modification (Cho et al.). S2 cells or head powder of CS flies were irradiated twice for 300 mJ/cm2 at 254 nm (CL-1600 Ultraviolet crosslinker). For RNaseA treatment, 40 l of 40 ng/ml RNaseA was added to 1 ml of lysate. For Immunoprecipitation of Hrp48, dynabeads protein A (Invitrogen) and rabbit anti-Hrp48 antibody (a gift from Donald Rio, (Hammond et al., Molecular and cellular biology. 1997, 17:7260-7267) were used. For Immunoprecipitation of Hrp48-ADAR-V5, dynabeads protein A (Invitrogen), rabbit anti-mouse IgG antibody (Millipore, 06-371) and mouse monoclonal anti-V5 antibody (Invitrogen, 46-1157) were used. Following linkers and primers were used for making libraries. 3 linker (RA3), /5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/; 5 linker (RA5-N4), rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrCrNrNrNrN; RNA RT Primer (RTP), GCCTTGGCACCCGAGAATTCCA; RNA PCR Primer (RP1, forward primer), AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA; RNA PCR Primer-Index 7 (RPI7, reverse primer), CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCCTTGGCACCCG AG AATTCCA; RNA PCR Primer-Index 8 (RPI8, reverse primer), CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCCTTGGCACCCG AG AATTCCA; RNA PCR Primer-Index 9 (RPI9, reverse primer), CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCCTTGGCACCCG AG AATTCCA.
CLIP, Motif Analysis and Gene Ontology
[0244] CLIP sequence reads were aligned using Novoalign, (novoalign -t 85-l 23 -s 1 -r None). Subsequent bioinformatic analysis of CLIP data was performed as described in Moore et al. (2014) and using the CLIPper algorithm (available at https://github.com/YeoLab/clipper) with default settings. To calculate a per gene CLIP enrichment value, the peak heights of each CLIP region were locally normalized to the mRNA-Seq reads extracted for that region, and summed these values across each gene (using CLIPper peaks). Motif analysis using MEME was conducted (Bailey et al., Nucleic acids research. 2009, 37:W202-208), version 4.10.0) (parameters: meme -minw 6 -maxw 10 -maxsize 1000000 -dna -nmotifs 5 -mod zoops) around significant CLIP sites as defined by the Darnell pipeline (Moore et al., 2014). MEME analysis for TRIBE data was performed by inputting the region around the editing site. Gene ontology analyses were performed using DAVID (Huang da et al.), TRIBE target genes (in FBgn format) were analyzed against a background of all genes expressed in the fly brain (>2 fpkm, 8000 genes). Gene expression levels were quantified using Cufflinks2.
RNA Structure Analysis
[0245] RNA structure folding with UNAFOLD was carried out on flanking sequences near TRIBE editing sites and CLIP binding sites identified by CIMS analysis (Cross Linking induced Mutation Site) that lack editing by TRIBE. A flanking region of 250nt both 5 and 3 of the site (501nt in total) was folded with UNAFold parameters (hybrid-ss-min--suffix DAT--mfold=5,8,200 --noisolate), base pairing was counted in the predicted minimum free energy (MFE) and predicted suboptimal structures within G=5 Kcal/mol of the MFE [1] for each site and five nucleotides on either side of the sites to create a profile of double strandedness. All profiles for each site are averaged to create a plot (mean+/SEM, n=17 TRIBE editing sites) for the TRIBE sites and CIMS CLIP sites.
Notes on Analysis of RNA Editing Data
[0246] All analysis of TRIBE data performed here are binary; either a gene has a TRIBE editing site or not, e.g., the mRNA is a target or not. Alternatively, two possible metrics to rank the strength of RBP targets, the number of editing sites in a gene and the extent to which they are edited (editing percentage) could have been used. However, such metrics should be interpreted with caution. First, longer genes obviously have more capacity for harboring more editing sites. Second, editing percentage may be affected by the propensity of the target region to participate in double stranded structures (discussed above) as well as by the strength of interaction between an RBP and its target.
[0247] The number of sites caused by a particular RBP-TRIBE protein will presumably vary quite widely so it is difficult to recommend a specific sequencing depth. Factors that could affect the number of editing events include the strength of binding of the endogenous RBP, the strength of binding of the TRIBE-RBP, the structure preference of the RBP, the expression level of the TRIBE-RBP, in addition sequencing depth effects the number of sites detected. The deeper the sequencing depth the more editing sites will be detected. For the experiments the deepest sequencing is 200 million mapped reads (Hrp48-TRIBE, s2 cells), however, in the data indicates 20-30 million mapped reads can be sufficient (
Other Embodiments
[0248] From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.
[0249] The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
[0250] All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.