ANTICANCER COMPOSITION COMPRISING TUMOR-SPECIFIC ONCOLYTIC ADENOVIRUS AND IMMUNE CHECKPOINT INHIBITOR
20190388488 ยท 2019-12-26
Assignee
Inventors
Cpc classification
A61K39/3955
HUMAN NECESSITIES
C12N2320/32
CHEMISTRY; METALLURGY
A61K39/3955
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
C07K14/535
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
C07K2317/76
CHEMISTRY; METALLURGY
C12N15/1136
CHEMISTRY; METALLURGY
International classification
A61P35/00
HUMAN NECESSITIES
Abstract
The present invention relates to an anticancer composition comprising a tumor-specific oncolytic adenovirus and an immune checkpoint inhibitor. The recombinant adenovirus having IL-12 and shVEGF, or IL-12 and GM-CSF-RLX inserted therein, according to the present invention, exhibits an excellent anticancer effect by enhancing immune functions, and such anticancer effect has been confirmed to be notably enhanced through concomitant administration with an immune checkpoint inhibitor, and thus the present invention may be used as a key technique in the field of cancer treatment.
Claims
1. A recombinant adenovirus comprising: a gene encoding Interleukin 12 (IL-12); a gene encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF); and a gene encoding relaxin.
2. The recombinant adenovirus of claim 1, wherein the recombinant adenovirus has any one or more regions selected from the group consisting of E1 and E3 regions deleted.
3. The recombinant adenovirus of claim 2, wherein in the recombinant adenovirus a gene encoding IL-12 is inserted into the E1 region, and a gene encoding GM-CSF and a gene encoding relaxin are inserted into the E3 region.
4. A pharmaceutical composition for preventing or treating cancer, the composition comprising: (a) the recombinant adenovirus of claim 1; and (b) a pharmaceutically acceptable carrier.
5. The pharmaceutical composition of claim 4, wherein the composition is administered simultaneously, separately, or sequentially in combination with an immune checkpoint inhibitor.
6. The pharmaceutical composition of claim 5, wherein the immune checkpoint inhibitor is any one selected from the group consisting of a programmed cell death-1 (PD-1) antagonist, a programmed cell death-ligand 1 (PD-L1) antagonist, a programmed cell death-ligand 2 (PD-L2) antagonist, a cluster of differentiation 27 (CD27) antagonist, a cluster of differentiation 28 (CD28) antagonist, a cluster of differentiation 70 (CD70) antagonist, a cluster of differentiation 80 (CD80, also known as B7-1) antagonist, a cluster of differentiation 86 (CD86, also known as B7-2) antagonist, a cluster of differentiation 137 (CD137) antagonist, a cluster of differentiation 276 (CD276) antagonist, a killer-cell immunoglobulin-like receptors (KIRs) antagonist, a lymphocyte-activation gene 3 (LAG3) antagonist, a tumor necrosis factor receptor superfamily, member 4 (TNFRSF4, also known as CD134) antagonist, a glucocorticoid-induced TNFR-related protein (GITR) antagonist, a glucocorticoid-induced TNFR-related protein ligand (GITRL) antagonist, a 4-1BB ligand (4-1BBL) antagonist, a cytolytic T lymphocyte associated antigen-4 (CTLA-4) antagonist, an adenosine A2A receptor (A2AR) antagonist, a V-set domain-containing T-cell activation inhibitor 1 (VTCN1) antagonist, a B- and T-lymphocyte attenuator (BTLA) antagonist, an indoleamine 2,3-dioxygenase (IDO) antagonist, a T-cell Immunoglobulin domain and Mucin domain 3 (TIM-3) antagonist, a V-domain Ig suppressor of T cell activation (VISTA) antagonist, a killer cell lectin-like receptor subfamily A (KLRA) antagonist, and a combination thereof.
7. The pharmaceutical composition of claim 4, wherein the cancer is any one selected from the group consisting of gastric cancer, lung cancer, non-small cell lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colon cancer, cervical cancer, bone cancer, non-small cell bone cancer, hematologic malignancy, skin cancer, head or neck cancer, uterine cancer, colorectal cancer, anal near cancer, colon cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulva cancer, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, kidney or hydroureter cancer, renal cell carcinoma, renal pelvic carcinoma, salivary gland cancer, sarcoma cancer, pseudomyxoma peritonei, hepatoblastoma, testicular cancer, glioblastoma, cheilocarcinoma, ovarian germ cell tumors, basal cell carcinoma, multiple myeloma, gallbladder cancer, choroidal melanoma, cancer of the ampulla of Vater, peritoneal cancer, tongue cancer, small cell cancer, pediatric lymphoma, neuroblastoma, duodenal cancer, ureteral cancer, astrocytoma, meningioma, renal pelvis cancer, pudendum cancer, thymus cancer, central nervous system (CNS) tumors, primary central nervous system lymphoma, spinal cord tumors, brain stem neuroglioma, and pituitary adenoma.
8. The pharmaceutical composition of claim 4, wherein the cancer is a recurrent cancer.
9. The pharmaceutical composition of claim 4, wherein the composition enhances anti-tumor immunity.
10. The pharmaceutical composition of claim 4, wherein the composition further comprises immune checkpoint inhibitors.
11. A method for treating cancer comprising administering a composition comprising the recombinant adenovirus of claim 1; and a pharmaceutically acceptable carrier, to an individual.
12. The method according to claim 11, wherein the composition is administrated simultaneously, separately, or sequentially in combination with an immune checkpoint inhibitor.
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0023] The above and other objects, features and advantages of the present disclosure will become more apparent to those of ordinary skill in the art by describing in detail exemplary embodiments thereof with reference to the accompanying drawings, in which:
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
DESCRIPTION OS SPECIFIC EMBODIMENTS OF THE INVENTION
[0048] Hereinafter, the present invention will be described in detail.
[0049] The present invention provides a recombinant adenovirus including: a gene encoding Interleukin 12 (IL-12); a gene encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF); and a gene encoding relaxin, or a recombinant adenovirus including: a gene encoding IL-12; and a gene encoding a shRNA suppressing the expression of VEGF.
[0050] Although an immune gene therapy for cancer has developed as a more promising approach, tumors have also created numerous strategies to avoid the immune surveillance system. In order to overcome these obstacles and enhance the effects of anticancer immunity, an oncolytic adenovirus (RdB/IL12/shVEGF Ad, RdB/IL12/GMCSF-RLX Ad) system simultaneously expressing IL-12 and a vascular endothelial growth factor (VEGF) short hairpin RNA (shRNA) or IL-12 and GM-CSF-Relaxin was constructed as an appropriate therapeutic adjuvant for restoring immunosuppression and increasing anticancer immunity. IL-12 serves to increase anti-tumor immunity by inducing the differentiation of T helper 1 cells and activating the cytotoxicity of cytotoxic T lymphocytes and natural killer cells. It is known that shVEGF and GM-CSF serve to strengthen the immune response of CD4+ and CD8+ T cells by promoting the proliferation and maturation of T cells and dendritic cells and stimulating DCs to promote the differentiation of DCs into APCs, respectively, and these effects are expected to further amplify the IL-12 function. Thus, the present inventors attempted immune gene therapy using a technical feature of an adenovirus simultaneously expressing IL-2 and shVEGF, or IL-12 and GM-CSF-Relaxin in tumors for the first time. In an example of the present invention, as a result of administering the recombinant adenovirus (RdB/IL12/shVEGF Ad, RdB/IL12/GMCSF-RLX Ad) to a melanoma animal model, it was experimentally confirmed that the tumor growth inhibition rate, complete remission rate, and survival rate of mice were increased.
[0051] In addition, IL-12 has drawn much attention as a core cytokine for anticancer immunotherapy, and in particular, in an anticancer immunotherapeutic method for patients with impaired immunity in the body, repeated administration of IL-12 has been frequently considered in order to obtain effective therapeutic efficacy. However, the IL-12 is clinically known to have the cytokine-associated toxicity in the whole body, particularly, the kidneys, and thus has a technical limitation that the IL-12 has to be used as a cancer therapeutic agent within a limited dose range. Based on this technical background, the recombinant adenovirus simultaneously expressing the IL-12 gene according to the present invention and an additional gene has another technical feature of solving the toxicity problem for normal cells due to the high dose and repeated administration of IL-12, which has been pointed out as a limitation of the anticancer immunotherapy in the related art, by inducing a high oncolytic effect even at a low viral titer.
[0052] Accordingly, the recombinant adenovirus of the present invention is characterized by including a gene encoding IL-12 and including any one of a gene encoding GM-CSF, a gene encoding relaxin, and a gene encoding a shRNA suppressing the expression of VEGF.
[0053] Interleukin-12 (IL-12) is a disulfide-linked heterodimer which is composed of a 40 kDa subunit (p40 subunit, p40) encoded by IL-12B (or Interleukin-12 subunit beta) and a 35 kDa subunit (p35 subunit or p35) encoded by IL-12A (or Interleukin-12 subunit alpha) and has a molecular weight of 75 kDa. IL-12 binds to receptors on the cell surface of activated T cells, B cells, and NK cells produced by antigen presenting cells such as macrophages (Desai, B. B., et al., J. Immunol., 148:3125-3132 (1992); Vogel, L. A., et al., Int. Immunol., 8:1955-1962, (1996)). IL-12 has been reported to be an important co-stimulator of Th1 clone proliferation (Kennedy et al., Eur. J. Immunol. 24:2271-2278, 1994), and is known to increase the production of IgG2a antibodies in serum (Morris, S. C., etal., J. Immunol. 152:1047-1056 (1994); Germann, T. M., et al., Eur. J. Immunol., 25:823-829 (1995); Sher, A., et al., Ann. N.Y. Acad. Sci., 795:202-207 (1996); Buchanan, J. M., et al., Int. Immunol., 7:1519-1528 (1995); Metzger, D. W. et al., Eur. J. Imunol., 27:1958-1965 (1997)). Further, it has been reported that administration of IL-12 can temporarily reduce the production of IgG1 antibody, suggesting that IL-12 inhibits the Th2 immune response (Morris, S. C., et al., J. Immunol. 152:1047-1056 (1994); McKnight, A. J., J. Immunol. 152:2172-2179 (1994); Buchanan, J. M., et al., Int. Immunol., 7:1519-1528 (1995)).
[0054] Cloning and purification of IL-12 is disclosed in WO 92/05256, WO 90/05147, and EP 322,827, the contents of which are incorporated herein by reference. The recombinant adenoviruses of the present invention comprise an IL-12 coding nucleotide sequence in an expressible form and can secrete IL-12 in tumor cells to enhance antitumor immune responses.
[0055] In order to efficiently express IL-12 using the recombinant adenovirus of the present invention, an expression system can be constructed using both the p35 subunit coding nucleotide sequence and the p40 subunit coding nucleotide sequence. In the present invention, the p35 subunit and the p40 subunit comprise not only the subunits illustrated in the embodiments of the present invention but also all the analogues of the subunits that can perform the unique function of each subunit.
[0056] In one embodiment of the present invention, the amino acid sequences of the human p35 and p40 subunits that may be used in the present invention are those sequences of GenBank accession numbers AAD56385 and AAD56386, respectively (if the amino acid sequences of the mouse p35 and p40 subunits are to be expressed, AAA39292 and AAA39296).
[0057] In one embodiment of the present invention, the nucleotide sequences encoding the p35 and p40 subunits that may be used in the present invention are IL-12A (p35) gene sequence and an IL-12B (p40) gene sequence encoding the amino acid sequences of the p35 and p40 subunits. The nucleotide sequences encoding the human p35 and p40 subunits can be found in GenBank accession numbers AF180562 and AF180563, and preferably the nucleotide sequences corresponding to the coding sequence (CDS) can be used (If using the mouse p35 and p40 nucleotide sequences, refer to the CDS sequence in each of the sequences listed in GenBank Accession Numbers M86672 and M86671).
[0058] Also, the gene encoding IL-12 used in the present invention comprises an IL-12A (p35) gene sequence and an IL-12B (p40) gene sequence, and may comprise an IRES sequence or linker sequence between the IL-12A (p35) gene sequence and the IL-12B (p40) gene sequence for the effective translation of a viral protein. Preferably, in one embodiment of the present invention, the IL-12A (p35) gene sequence may comprise or consist of a sequence of SEQ ID No. 1 (mouse), SEQ ID No. 10 (human), or SEQ ID No. 11 (human); the IL-12B (p40) gene sequence may comprise or consist of a sequence of SEQ ID No. 2 (mouse), SEQ ID No. 12 (human), or SEQ ID No. 13 (human); the IRES sequence may comprise or consist of a sequence of SEQ ID No. 3 or SEQ ID No. 15; and the linker sequence may comprise or consist of a sequence of SEQ ID No. 14.
[0059] The gene encoding IL-12 of the present invention may comprise or consist a sequence of SEQ ID No. 16 (human IL-12A-linker-IL-12B) or SEQ ID No. 17 (human IL-12A-IRES-IL-12B), but are not limited thereto. The IL-12 serves to increase anti-tumor immunity by inducing the differentiation of T helper 1 cells and activating the cytotoxicity of cytotoxic T lymphocytes and natural killer cells.
[0060] The gene encoding GM-CSF and the gene encoding relaxin used in the present invention comprise a GM-CSF gene sequence and a relaxin gene sequence, respectively, and may also comprise an IRES sequence between the GM-CSF gene sequence and the relaxin gene sequence. Preferably, the GM-CSF gene sequence may comprise or consist of the sequence of SEQ ID No. 4 (mouse) or SEQ ID No. 18 (human); the relaxin gene sequence may comprise or consist of the sequence of SEQ ID No. 5 (human); the IRES sequence may comprise or consist a sequence of SEQ ID No. 3 or SEQ ID No. 15 but are not limited thereto.
[0061] The gene encoding a shRNA suppressing the expression of VEGF used in the present invention has a hairpin structure, and refers to a gene capable of mediating RNA interference or gene silencing. The gene comprises a sequence complementary to VEGF mRNA, and the term complementary means including not only the 100% complementary case, but also the incomplete complementarity sufficient to be able to suppress the expression of the VEGF gene through the RNA interference mechanism, and means preferably 90% complementarity, more preferably 98% complementarity, and most preferably 100% complementarity. In the present specification, the case of expressing the 100% complementarity is specifically described as completely complementary. In the present invention, although the gene is also described as shVEGF, but is not limited thereto, the gene may bind complementarily to the mRNA of VEGF, which is represented by SEQ ID No. 6 (mouse) or 7 (human), to suppress the expression of VEGF. In one embodiment of the present invention, a shRNA sequence suppressing the expression of mouse VEGF may comprise or consist of SEQ ID No.8 and SEQ ID No.9.
[0062] It is interpreted that the gene sequences also comprise a gene sequence exhibiting substantial identity or substantial similarity. The aforementioned substantial identity refers to a random sequence differing from the sequence of the present invention and having at least 80% homology, more preferably 90% homology, and most preferably 95% homology to the sequence of the present invention, when it is aligned to correspond to the sequence of the present invention as much as possible, and the aligned sequences are analyzed using an algorithm typically used in the art. The aforementioned substantial similarity collectively refers to all of the changes in a gene sequence, such as deletion or insertion of one or more bases, which do not affect the object of the present invention of minimizing homologous recombination with a recombinant adenovirus vector. Therefore, the gene sequence of the present invention is not limited to the sequences of exemplified SEQ ID NOS. 1 to 18, and is interpreted to be included in the scope of the rights of the present invention as long as the sequence does not substantially affect the activity of the final product desired in the present invention.
[0063] Meanwhile, as the recombinant adenovirus of the present invention, an oncolytic adenovirus widely known in the art may be used. In an example of the present invention, the recombinant adenovirus comprises an activated E1A gene and an inactivated E1B-19 gene, an inactivated E1B-55 gene, or an inactivated E1B-19/E1B-55 gene. In the present specification, the term inactivation used in conjunction with a gene means that the transcription and/or translation of the gene is not normally performed, and the function of a normal protein encoded by the gene is not exhibited. For example, the inactivated E1B-19 gene is a gene incapable of producing the activated E1B-19 kDa protein by a modification (substitution, addition, and partial or whole deletion) in the gene. The deletion of E1B-19 may increase the ability to kill cells, and the deletion of the E1B-55 gene makes a recombinant adenovirus tumor-specific (see Korean Patent Application No. 2002-23760). The term deletion used in conjunction with a viral genomic sequence in the present specification has a meaning including complete deletion and partial deletion of the corresponding sequence.
[0064] According to an embodiment of the present invention, the recombinant adenovirus comprises an E1A region, has an E1B region, that is, E1B-19 kDa and 55 kDa (E1B) deleted, and an E3 region (E3) deleted. The recombinant adenovirus including the E1A gene will have replicable characteristics. The gene encoding IL-12 is inserted into the deleted E1B region of the recombinant adenovirus, and the genes encoding GM-CSF and relaxin or the gene encoding a shRNA suppressing the expression of VEGF is inserted into the E3 region. Meanwhile, the E1A site has a modification in which the Glu 45 residue is substituted with Gly and a modification and in which the sequence of amino acids 121 to 127 is wholly substituted with Gly, in a nucleotide sequence encoding Rb binding site located in the E1A gene sequence.
[0065] Meanwhile, viruses other than the adenovirus may also be used in the present invention. The virus which may be used in the present invention may preferably be vaccinia viruses (Puhlmann M. et al., Human Gene Therapy 10:649-657(1999)), lentiviruses (Wang G. et al., J. Clin. Invest. 104(11): R55-62(1999)), or herpes simplex viruses (Chamber R., et al., Proc. Natl. Acad. Sci USA 92:1411-1415(1995)) but is not limited thereto.
[0066] The recombinant adenovirus used in the present invention comprises a promoter that is operable in animal cells, preferably mammal cells. A promoter suitable for the present invention comprises a promoter derived from a mammalian virus and a promoter derived from the genome of mammalian cells, and comprises, for example, a cytomegalovirus (CMV) promoter, a U6 promoter and an H1 promoter, a murine leukemia virus (MLU) long terminal repeat (LTR) promoter, an adenovirus early promoter, an adenovirus late promoter, a vaccina virus 7.5K promoter, an simian virus 40 (SV40) promoter, a Herpes simplex virus-thymidine kinase (HSV tk) promoter, an rous sarcoma virus (RSV) promoter, an elongation factor-1 alpha (EF1 ) promoter, a methallothionin promoter, a -actin promoter, a human IL-2 gene promoter, a human IFN gene promoter, a human IL-4 gene promoter, a human lymphotoxin gene promoter, a human GM-CSF gene promoter, an inducible promoter, a cancer cell-specific promoter [for example, a telomerase reverse transcriptase (TERT) promoter, a modified TERT promoter, a prostate-specific antigen (PSA) promoter, a prostate-specific membrane antigen (PSMA) promoter, a carcinoembryonic antigen (CEA) promoter, a Survivin promoter, an E2F promoter, a modified E2F promoter, an alpha-fetoprotein (AFP) promoter, a modified AFP promoter, an E2F-AFP hybrid promoter, and an E2F-TERT hybrid promoter], a tissue-specific promoter (for example, an albumin promoter), a human phosphoglycerate kinase (PGK) promoter, and a mouse phosphoglycerate kinase (PGK) promoter, but is not limited thereto. Most preferably, the promoter is a CMV promoter.
[0067] It is preferred that in an expression construct for expressing a trans gene, a polyadenylation sequence binds downstream of the trans gene. The polyadenylation sequence comprises a bovine growth hormone terminator (Gimmi, E. R., et al., Nucleic Acids Res. 17:6983-6998(1989)), an SV40-derived polyadenylation sequence (Schek, N, et al., Mol. Cell Biol. 12:5386-5393(1992)), HIV-1 polyA (Klasens, B. I. F., et al., Nucleic Acids Res. 26:1870-1876(1998)), -globin polyA (Gil, A., et al, Cell 49:399-406(1987)), HSV TK polyA (Cole, C. N. and T. P. Stacy, Mol. Cell. Biol. 5:2104-2113(1985)), or polyomavirus polyA (Batt, D. B and G. G. Biol. 15:4783-4790(1995)), but is not limited thereto.
[0068] In the recombinant adenovirus used in the present invention, the IL-12 gene sequence, the GM-CSF-Relaxin gene sequence, or the shVEGF gene sequence are operably linked to a promoter. As used herein, the term operably linked refers to a functional binding between a nucleic acid expression regulatory sequence (for example: an array of a promoter, a signal sequence, and a transcription regulating factor-binding site) and a different nucleic acid sequence, and accordingly, the regulatory sequence regulates the transcription and/or translation of the different nucleic acid sequence.
[0069] The recombinant adenovirus of the present invention may further comprise an antibiotic resistance gene and a reporter gene (for example, green fluorescence protein (GFP), luciferase and -glucuronidase) as selective markers. The antibiotic resistance gene comprises an antibiotic resistance gene typically used in the art, for example, a gene imparting resistance to ampicillin, gentamycin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin and tetracycline, and preferably, is a neomycin resistance gene. The aforementioned selective marker may be expressed even in an expression system connected by a separate promoter or an IRES (internal ribosome entry site), 2A systems (F2A system, P2A system, T2A system), and the IRES that may be used in the present invention is a regulatory sequence that is found in RNAs of some types of viruses and cells.
[0070] Another aspect of the present invention provides: a pharmaceutical composition for preventing or treating cancer, the composition including the recombinant adenovirus; and a pharmaceutically acceptable carrier; a medicinal use of the recombinant adenovirus for the prevention or treatment of cancer; and a method for treating cancer, the method including a step of administering a therapeutically effective amount of the recombinant adenovirus to an individual.
[0071] Since the pharmaceutical composition of the present invention uses the above-described recombinant adenovirus, the description of the content common between the two will be omitted in order to avoid the excessive complexity of the present specification.
[0072] As used herein the term prevention refers to all actions that suppress cancer (tumors) or delay the onset of the cancer (tumors) by administering the pharmaceutical composition according to the present invention.
[0073] As used herein, the term treatment refers to all actions that ameliorate or beneficially change symptoms for cancer (tumors) by administering the pharmaceutical composition according to the present invention.
[0074] In the present invention, an individual refers to a subject in need of treatment of a disease, and more specifically, refers to a mammal such as a human or a non-human primate, a rodent (a rat, a mouse, a guinea pig, and the like), a mouse, a dog, a cat, a horse, a cow, a sheep, a pig, a goat, a camel, and an antelope.
[0075] Cancer, which is a disease to be prevented or treated by the pharmaceutical composition of the present invention, collectively refers to diseases caused by cells having aggressive characteristics in which the cells ignore normal growth limits and divide and grow, invasive characteristics to infiltrate surrounding tissues, and metastatic characteristics of spreading to other sites in the body. In the present invention, the cancer is used in the same sense as a malignant tumor, and may comprise a solid tumor and a blood borne tumor. For example, the cancer may be any one selected from the group consisting of gastric cancer, lung cancer, non-small cell lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colon cancer, cervical cancer, bone cancer, non-small cell bone cancer, hematologic malignancy, skin cancer, head or neck cancer, uterine cancer, colorectal cancer, anal near cancer, colon cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulva cancer, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, kidney or hydroureter cancer, renal cell carcinoma, renal pelvic carcinoma, salivary gland cancer, sarcoma cancer, pseudomyxoma peritonei, hepatoblastoma, testicular cancer, glioblastoma, cheilocarcinoma, ovarian germ cell tumors, basal cell carcinoma, multiple myeloma, gallbladder cancer, choroidal melanoma, cancer of the ampulla of Vater, peritoneal cancer, tongue cancer, small cell cancer, pediatric lymphoma, neuroblastoma, duodenal cancer, ureteral cancer, astrocytoma, meningioma, renal pelvis cancer, pudendum cancer, thymus cancer, central nervous system (CNS) tumors, primary central nervous system lymphoma, spinal cord tumors, brain stem neuroglioma, and pituitary adenoma, and may also be a recurrent cancer, but is not limited thereto.
[0076] Meanwhile, the pharmaceutical composition of the present invention may additionally comprise an immune checkpoint inhibitor.
[0077] As used herein, the term immune checkpoint collectively refers to a protein involved in causing stimulating or suppressing signals of an immune response on the surface of immune cells, and cancer cells evade the surveillance network of the immune system by being manipulated such that the stimulation of the immune response and the resulting inhibition of cancer cells are not properly performed through the immune checkpoint. Preferably, the immune checkpoint protein may be a PD-1 antagonist, a PD-L1 antagonist, a PD-L2 antagonist, a CD27 antagonist, a CD28 antagonist, a CD70 antagonist, a CD80 antagonist, a CD86 antagonist, a CD137 antagonist, a CD276 antagonist, a KIRs antagonist, a LAG3 antagonist, a TNFRSF4 antagonist, a GITR antagonist, a GITRL antagonist, a 4-1BBL antagonist, a CTLA-4 antagonist, an A2AR antagonist, a VTCN1 antagonist, a BTLA antagonist, an IDO antagonist, a TIM-3 antagonist, a VISTA antagonist, a KLRA antagonist, and a combination thereof, but is not limited thereto.
[0078] The immune checkpoint inhibitor is an antagonist or antibody targeting the immune checkpoint protein, and exhibits an anticancer effect caused by an immune response by enhancing a protein which stimulates the immune response or blocking a protein which suppresses the immune response. Since the immune checkpoint inhibitor uses an immune response system which is excellent in memory ability in addition to advantages of fewer side effects such as emesis or alopecia than general cytotoxic anticancer agents and large therapeutic effects, the therapeutic effect may be sustained for a long period of time even after the administration of a drug is stopped, but the enhancement of the anticancer effect through a co-administration with the recombinant adenovirus has not been known. Thus, the present inventors attempted co-administration with an immune checkpoint inhibitor in order to enhance the anticancer effect of the recombinant adenovirus, and there is another technical feature in that there is provided a medicinal use of the recombinant adenovirus for the prevention or treatment of cancer as a co-administration formulation with the immune checkpoint inhibitor.
[0079] The pharmaceutical composition of the present invention may comprise a pharmaceutically acceptable carrier in addition to the active ingredient. In this case, the pharmaceutically acceptable carrier is typically used during the formulation, and comprises lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidinone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, and the like, but is not limited thereto. Furthermore, the pharmaceutically acceptable carrier may further comprise a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like, in addition to the aforementioned ingredients. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
[0080] The pharmaceutical composition of the present invention may be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally, or applied topically), and according to an example of the present invention, the anti-tumor immunity enhancing composition of the present invention may be preferably directly administered intratumorally. The dose varies depending on the patient's condition and body weight, severity of the disease, drug form, administration route, and duration, but may be suitably selected by those skilled in the art.
[0081] The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, pharmaceutically effective amount means an amount sufficient to treat diseases at a reasonable benefit/risk ratio applicable to medical treatment, and an effective dosage level may be determined according to factors including type of disease of patients, the severity of disease, the activity of drugs, sensitivity to drugs, administration time, administration route, excretion rate, treatment period, and simultaneously used drugs, and other factors well known in the medical field. Another pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with therapeutic agents in the related art, and may be administered in a single dose or multiple doses. It is important to administer the composition in a minimum amount that can obtain the maximum effect without any side effects, in consideration of all the aforementioned factors, and this amount may be easily determined by those skilled in the art.
[0082] Hereinafter, preferred Examples for helping the understanding of the present invention will be suggested. However, the following Examples are provided only to more easily understand the present invention, and the contents of the present invention are not limited by the following Examples.
EXAMPLES
Experimental Materials and Experimental Methods
[0083] 1. Animal Experiment
[0084] 6-week to 8-week old male C57BL/6 mice were purchased from Charles River Laboratories International, Inc. (Wilmington, Mass.) and bred in a laminar air flow cabinet under a pathogen free condition. All animal experiments were carried out under the approval of the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC), and performed in accordance with the guidelines established by the University of Hanyang Institutional Animal Care and Use Committee.
[0085] 2. Manufacture of Oncolytic Adenovirus
[0086] An adenovirus (Ad), in which IL-12 and GM-CSF-Relaxin or shVEGF were introduced into the E1 region and the E3 region, respectively, was manufactured as illustrated in
[0087] Specifically, in order to construct an Ad E1 shuttle vector expressing IL-12, a pXC1RdB/IL12 E1 shuttle vector was manufactured by excising a mouse IL-12 gene from pCA14/IL12 and sub-cloning the gene into a pXC1RdB E1 shuttle vector. Further, in order to construct a shVEGF-expressing E3 shuttle vector, full-length mouse shVEGF complementary DNA was cloned by RT-PCR using total RNA obtained from bone marrow-derived active dendritic cells. The shVEGF complementary DNA (nucleotides 53-982 of the National Center for Biotechnology Information L15435) was manufactured using the following primer set: sense (5-gatcccggaaggagagcagaagtcccatgttcaagagacatgggacttctgctctcctttttttttggaaa-3), antisense (5-tttccaaaaaaa aaggagagcagaagtcccatgtctcttgaacatgggacttctgctctccttccgggatc-3). The PCR product was digested with BamHI/Hind III, and then cloned in a BamHI/Hind III-treated pSP72 E3/CMV-polA Ad E3 shuttle vector, thereby manufacturing a pSP72 E3/shVEGF E3 shuttle vector. Further, a pSP72 E3/GMCSF-RLX E3 shuttle vector was manufactured by cloning GMCSF-IRES-Relaxin gene in a pSP72 E3/CMV-polA Ad E3 shuttle vector.
[0088] For homologous recombination, E. coli BJ5183 was transformed simultaneously with the pXC1RdB/IL12 E1 shuttle vector and pdE1/shVEGF or pdE1/GMCSF-RLX, thereby manufacturing pRdB/IL12/shVEGF Ad and pRdB/IL12/GMCSF-RLX Ad. All viruses were manufactured using 293 cells, and the purification, titration, and quality analysis of the adenovirus were carried out according to the prior art.
[0089] 3. Evaluation of Anticancer Effect Using Animal Model
[0090] B16-F10 cells (5105) were injected subcutaneously into the right flank of 6- to 7-week old male C57BL/6 immune-competent mice. When the tumor volume reached approximately 100 mm3, the mice were divided into groups with similar tumor sizes, and the oncolytic adenoviruses (RdB/IL12/shVEGF Ad; RdB/IL12/GMCSF-RLX Ad) were administered intratumorally at a concentration of 5109 VP on day 1, 3, and 5. In addition, in order to confirm the anticancer effect according to the co-administration with an immune checkpoint inhibitor, an anti PD-L1 antibody, an anti PD-1 antibody, and an anti CTLA-4 antibody as immune checkpoint inhibitors were administered intraperitoneally at a concentration of 200 g to the oncolytic adenovirus-administered mice on day 3, 6, and 9, and in order to further evaluate a synergistic effect by the co-administration with the immune checkpoint inhibitor, the same experiment as described above was performed again using the oncolytic adenovirus at a dose (1109 VP) which is five times lower than that of the previous experiment using 5109 VP. Meanwhile, in the present experiment, a PBS-treated group (PBS) and groups treated with the immune checkpoint inhibitor alone (anti PD-L1 antibody, anti PD-1 antibody, and anti CTLA-4 antibody) were used as controls.
[0091] Thereafter, an anticancer effect was evaluated using an animal model by measuring a perpendicular tumor diameter using calipers to monitor the growth of tumors every day and confirming a change in survival rate over time. Meanwhile, tumor volume was calculated using the following formula: volume=0.523 L (W)2, in which L indicates a length and W indicates a width.
[0092] 4. Evaluation of Anticancer Effect by Immune Memory
[0093] On day 50 after a primary tumor was injected into 3 animal models in which melanoma was induced, a secondary tumor was reinjected (rechallenge) into successfully treated mice (on day 25 from the time point when the primary tumor could not be promoted). Thereafter, in the same manner as described above, an anti-tumor immune memory effect was evaluated by measuring a perpendicular tumor diameter to monitor the growth of tumors every other day and calculating an average tumor volume. In the present experiment, a group in which melanoma was induced in normal mice (Normal) was used as a control.
[0094] 5. Statistical Analysis
[0095] All data was expressed as meanstandard error. Comparisons were made using Stat View software (Abacus Concepts, Inc., Berkeley, Calif.) and the Mann-Whitney test (non-parametric rank sum test). P values equal to or less than 0.05 indicate statistically significance (*, P<0.05; **, P<0.01).
Experimental Results
[0096] 1. Confirmation of Anticancer Effect in Melanoma Mice
[0097] The present inventors intended to confirm the anticancer effect of the recombinant adenovirus and/or the immune checkpoint inhibitor by comparing the volume of a tumor injected into melanoma mice, the presence of complete remission, and the survival rate of the mice.
[0098] As a result, it was confirmed that in the control treated with PBS or the anti PD-L1 antibody, tumors had proliferated rapidly enough for the tumor volume to reach 3,000 mm3 or more on day 11 or 15, respectively, thereby exhibiting aggressive tumor growth, whereas in the group treated with RdB/IL12/shVEGF Ad or RdB/IL12/GMCSF-RLX Ad, as a result of comparison with the PBS-treated group on day 22, tumor growth was suppressed by 99.3% or 99.5% (
[0099] 2. Anticancer Effect by Co-Administration with Immune Checkpoint Inhibitor
[0100] The present inventors compared the anticancer effects between only administration of the recombinant adenovirus and the co-administration of the recombinant adenovirus and the immune checkpoint inhibitor using the oncolytic adenovirus at a dose (1109 VP) which is five times lower than that of the previous experiment using 5109 VP, in order to evaluate the synergistic effect by the co-administration with the immune checkpoint inhibitor in more detail. Further, based on the results, when the anti PD-L1 antibody, the anti PD-1 antibody, or the anti CTLA-4 antibody was used as the immune checkpoint inhibitor, the anticancer effects of these antibodies were compared, and in the present experiment, RdB/IL12/GMCSF-RLX Ad was used as the recombinant adenovirus.
[0101] As a result, on day 18, as a result of comparison with the tumor volume of the PBS-treated group, the tumor growth suppression rate of the RdB/IL12/shVEGF Ad group was 92.9%, but the tumor growth suppression rate was increased to 99.7% by the co-administration with the anti PD-1 antibody, and the tumor growth suppression rate of the RdB/IL12/GMCSF-RLX Ad group (90.1%) was also greatly increased to 98.9% by the co-administration with the anti PD-1 antibody (
[0102] Meanwhile, in order to confirm whether other types of recombinant adenoviruses also exhibited the synergistic effect by the co-administration with the immune checkpoint inhibitor, HmT-Rd19-K35/IL21 Ad, RdB/GMCSF/shVEGF Ad, or YKL-1/GMCSF/B7.1 Ad and the anti PD-1 antibody were co-administered, and then the anticancer effects thereof were confirmed. As a result, as illustrated in
[0103] Further, it was confirmed that as a result of confirming the anticancer effect by the type of immune checkpoint inhibitor, the control mice treated with PBS, the anti PD-L1 antibody, the anti PD-1 antibody, or the anti CTLA-4 antibody had proliferated rapidly enough for the tumor volume to reach 3,000 mm3 or more on day 11, 15, 18, or 11, respectively, thereby exhibiting aggressive tumor growth, whereas in the case of the groups treated with RdB/IL12/GMCSF-RLX Ad+anti PD-L1 antibody, RdB/IL12/GMCSF-RLX Ad+anti PD-1 antibody, and RdB/IL12/GMCSF-RLX Ad+anti CTLA-4 antibody, on day 21, as a result of comparison with the PBS-treated group, tumor growth was greatly suppressed by 99.9%, 99.9%, or 99.2%, respectively (
[0104] 3. Confirmation of Immune Memory Effect Against Recurrent Cancer
[0105] The present inventors intended to confirm an immune memory effect and an anticancer effect against a recurrent cancer according to the recombinant adenovirus of the present invention, or the co-administration of the recombinant adenovirus and the immune checkpoint inhibitor by comparing the volume of secondary tumors injected into melanoma mice, and the like.
[0106] As a result, it could be confirmed that in the RdB/IL12/shVEGF Ad group, the growth of secondary tumors was markedly inhibited (
[0107] 4. Verification of Anticancer Effect of RdB/IL12/GMCSF-RLX Ad
[0108] (1) Confirmation of Expression Patterns of IL-12, GM-CSF, and Relaxin
[0109] In order to verify the anticancer effect according to the co-expression of IL-12, GM-CSF, and relaxin (RLX) genes, RdB/IL12/GMCSF-RLX Ad, which is an adenovirus in which the IL-12 gene was inserted into the E1 region of an adenovirus and GM-CSF and relaxin genes were inserted into the E3 region of the adenovirus, was manufactured as described above. The RdB/IL12/GMCSF-RLX Ad is a cancer cell-specific oncolytic adenovirus in which an E1B gene as an initial gene of an adenovirus was deleted and an E1A gene was modified, and the expression level of IL-12, GM-CSF, or RLX by the manufactured adenovirus was confirmed. Specifically, a Syrian hamster pancreatic cancer cell line (Hap-T1) was infected with RdB/IL12/GMCSF-RLX at a multiplicity of infection (MOI) of 0.2, 0.5, 1, 2, and 5, and 48 hours later, the media thereof were collected. Thereafter, the expression levels of IL-12 and GM-CSF were confirmed through enzyme-linked immunosorbent assay (ELISA), and the expression level of relaxin was confirmed through a reverse transcription polymerase chain reaction (RT-PCR).
[0110] As a result, as illustrated in
[0111] (2) Enhancement of Anticancer Effect by Co-Administration with PD-1 in Syrian Hamster Tumor Animal Model
[0112] In order to verify the enhancement of the anticancer effect by the co-administration of RdB/IL12/GMCSF-RLX Ad and PD-1, 7107 viral particles (VP)/30 l of RdB/IL12/GMCSF-RLX Ad was administered intratumorally to a Syrian hamster tumor animal model induced by subcutaneously injecting a HaP-T1 pancreatic cancer cell line, and along with this, 10 mg/kg of PD-1 was administered intraperitoneally, and then the resulting change in volume of tumors was observed. Meanwhile, an RdB/IL12/GMCSF-RLX Ad only administration group was used as a comparative group.
[0113] As a result, as illustrated in
[0114] (3) Change in Tumor Tissue by Co-Administration with PD-1 in Syrian Hamster Tumor Animal Model
[0115] In order to specifically confirm the change in tumor tissues by the co-administration of RdB/IL12/GMCSF-RLX Ad and PD-1, after 7107 VP of RdB/IL12/GMCSF-RLX Ad and 10 mg/kg of PD-1 were co-administered as described above, the collected tumor tissues were immunohistologically evaluated. Meanwhile, an PD-1 or RdB/IL12/GMCSF-RLX Ad only administration group and a PBS administration group were used as a comparative group and a control, respectively.
[0116] As a result, as illustrated in
[0117] (4) Change in Expression of Cell Populations and IFN- in Tumor Tissues by Co-Administration with PD-1
[0118] In order to evaluate whether the infiltration and activation of T cells in tumor tissues could be induced as the infiltration of PD-1 in tumor tissues was increased by RdB/IL12/GMCSF-RLX Ad, a change in population of interferon (IFN)--expressing CD4+ or CD8+ T cells was evaluated in the infiltrated lymphocytes in the draining lymph node (DLN) and tumor tissues. As a result, as illustrated in
[0119] In addition, in order to evaluate the expression level of IFN- in the tumor tissue to which the adenovirus was administered, tumor tissues were extracted from mice to which the adenovirus and the like were administered and finely ground, and then an IFN- ELISA analysis was carried out. As a result, as illustrated in
[0120] (5) Confirmation of Anticancer Effect Under Condition of Resistance to Immune Checkpoint Inhibitor
[0121] In order to evaluate whether the co-administration of RdB/IL12/GMCSF-RLX Ad and PD-1 could exhibit effective therapeutic efficacy under a condition of resistance to the immune checkpoint inhibitor, the effect of the co-administration to tumors pre-treated with PD-1 on suppression of the growth of tumors was evaluated. Specifically, when the growth of tumors was not effectively suppressed by the administration of PD-1 alone (on day 9 after the first treatment of the antibody), RdB/IL12/GMCSF-RLX Ad was administered four times in total at an interval of 2 days. Meanwhile, an PD-1 only administration group was used as a comparative group.
[0122] As a result, as illustrated in
[0123] (6) Change in Infiltration of PD-1 into Tumor Tissues by Administration of RdB/IL12/GMCSF-RLX Ad
[0124] It was predicted that the expression of RLX in tumor tissues would exhibit synergistic anticancer therapeutic efficacy by promoting the intratumoral infiltration of PD-1. Accordingly, it was intended to evaluate whether RdB/IL12/GMCSF-RLX Ad increased the intratumoral infiltration of PD-1 into a desmoplastic pancreatic tumor tissue. RdB/IL12/GMCSF-RLX Ad was directly administered to tumor tissues on day 0 or day 2, PD-1 was administered intraperitoneally on day 2 (c: RdB/IL12/GMCSF-RLX+Alexa 488-anti PD-1), and an Alexa 488-conjugated PD-1 only administration group (b; Alexa 488-anti PD-1) and a PBS only administration group (a; PBS) were used as a comparative group and a control, respectively. The tumor tissue treated as described above was collected on day 7, and the accumulation of Alexa 488-PD-1 in the tumor tissue was quantified through an immunofluorescence analysis. As a result of quantifying the accumulation of Alexa 488-PD-1 per tissue area, as illustrated in
[0125] In order to evaluate the intratumoral infiltration of PD-1 for the whole body, 64Cu-PD-1 in which PD-1 and 64Cu were conjugated was administered along with RdB/IL12/GMCSF-RLX Ad to HaP-Ti-transplanted hamsters using 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid by the above-described method, thereby obtaining an immuno-PET image. PET scanning was carried out at 2, 12, 36, and 60 hours after the administration of 64Cu-PD-1, and main PET imaging was carried out along with CT for anatomical description. A 64Cu-PD-1 only administration group was used as a comparative group. As a result, as illustrated in
[0126] The above-described description of the present invention is provided for illustrative purposes, and the person skilled in the art to which the present invention pertains will understand that the present invention can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. Therefore, it should be understood that the above-described Examples are illustrative only in all aspects and are not restrictive.
[0127] All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, any priority document(s) of this application is/are hereby incorporated herein by reference in its/their entirety.