Angiopoietin-like 4 and a method of its use in wound healing
10517075 ยท 2019-12-24
Assignee
Inventors
Cpc classification
H04L5/0007
ELECTRICITY
H04L5/006
ELECTRICITY
H04L5/0053
ELECTRICITY
A61K38/16
HUMAN NECESSITIES
H04W72/20
ELECTRICITY
A61P17/02
HUMAN NECESSITIES
International classification
A61K38/16
HUMAN NECESSITIES
Abstract
A method and a pharmaceutical composition for increasing wound healing in an individual in need thereof, the method comprising administering an angiopoietin like 4 (ANGPTL4) polypeptide or a therapeutically active fragment thereof.
Claims
1. A pharmaceutical composition for increasing wound healing in an individual, comprising a therapeutically active fragment of the angiopoietin like 4 protein (ANGPTL4) consisting of the amino acid sequence set forth in SEQ ID NO: 2; and a pharmaceutically acceptable carrier; wherein the individual is a mammal; wherein the pharmaceutically acceptable carrier is selected from the group consisting of vegetable oil, mineral oil, white petrolatum, ethariol, glycerol, propylene glycol, polyethylene glycol, essential oils, polyol, aluminum monostearate, gelatin, carboxyl methylcellulose, poly(glycolic acid), poly(lactic acid), poly(caprolactone), poly(lactic-co-glycolic acid), poly(trimethylene carbonate), poly(propylene glycol), polyquaternium, xanthan gum, succinoglycan, and combinations thereof.
2. The pharmaceutical composition of claim 1, further comprising a further wound treatment agent.
3. A pharmaceutical composition for increasing wound healing in an individual, comprising a therapeutically effective amount of an angiopoietin like 4 protein (ANGPTL4) consisting of the amino acid sequence set forth in SEQ ID NO:2; and a pharmaceutically acceptable carrier; wherein the individual is a mammal; wherein the ANGPTL4 comprises a modification selected from the group consisting of glycosylation, acetylation, phosphorylation, carboxylation, ubiquitination, radiolabeling, and combinations thereof.
4. The pharmaceutical composition of claim 3, wherein the carrier is carboxyl methylcellulose.
5. The pharmaceutical composition of claim 3, further comprising a further wound treatment agent.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The drawings are not necessarily drawn to scale, emphasis instead generally being placed upon illustrating the principles of various embodiments. In the following description, various embodiments of the invention are described with reference to the following drawings.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44) Scale bar: 500 m. Arrows point to the epithelial wound edge.
DETAILED DESCRIPTION
(45) We showed that topical application of ANGPTL4, specifically the C-terminal fibrinogen-like domain (cANGPTL4), accelerates wound closure of splint-wound model in diabetic mice and reduces collagen deposition i.e. scarring at the remodelling stage of wound healing. cANGPTL4 is a matricellular protein, thus it can modulate many critical regulatory networks during wound healing. Thus, matricellular protein ANGPTL4 is more efficacious than individual cytokine-mediated candidates.
(46) Accordingly, a first aspect of the invention includes a method for increasing wound healing in an individual in need thereof, the method comprising administering an angiopoietin like 4 (ANGPTL4) polypeptide or a therapeutically active fragment thereof.
(47) Polypeptides of the angiopoietin like 4 (ANGPTL4) polypeptide preferably have about 406 amino acids, encoding an enzyme having many activities such as interacting with specific matrix proteins in the wound bed, delaying their proteolytic degradation by MMPs, and directly affects cell-matrix communication by altering the availability of intact matrix proteins. ANGPTL allows crosstalk of various cells such as wound keratinocytes, dermal fibroblasts, endothelial cells or inflammatory cells with the surrounding ECM. We also showed that ANGPTL4 reduced collagen deposition towards the later stage of wound healing.
(48) Preferably, the angiopoietin like 4 (ANGPTL4) polypeptide or therapeutically active fragment thereof comprises; (i) an amino acid sequence set forth in SEQ ID NO:1; or (ii) an amino acid sequence having at least 60, at least 70, at least 80, at least 85, at least 90, at least 95, at least 97, at least 98 or at least 99% sequence identity with the amino acid sequence set forth in SEQ ID NO:1 over its entire length; or (iii) an amino acid sequence having at least 70, at least 80, at least 85, at least 90, at least 95, at least 97, at least 98 or at least 99 sequence homology with the amino acid sequence set forth in SEQ ID NO: 1 over its entire length; or (iv) a fragment of any one of (i) to (iii).
(49) Preferably the therapeutically active fragment comprises the C terminal region of the angiopoietin like 4 (ANGPTL4) polypeptide or a functional fragment thereof. In various embodiments the fragment comprises: (i) the amino acid sequence set forth in SEQ ID NO:2; or (ii) an amino acid sequence having at least 60, at least 70, at least 80, at least 85, at least 90, at least 95, at least 97, at least 98 or at least 99% sequence identity with the amino acid sequence set forth in SEQ ID NO:2 over its entire length; or (iii) an amino acid sequence having at least 70, at least 80, at least 85, at least 90, at least 95, at least 97, at least 98 or at least 99 sequence homology with the amino acid sequence set forth in SEQ ID NO: 2 over its entire length.
(50) The functional domain of the C terminal fibrinogen like domain of ANGPTL4 (cANGPTL4) comprises or consists of amino acids 186 to 406 of the amino acid sequence shown as SEQ ID NO: 1 or allelic variants, homologues or fragments, thereof. The C ANGPTL4 domain preferably comprises SEQ ID NO. 2 or a sequence having homology with the amino acid sequence set forth in SEQ ID NO: 2.
(51) The term polypeptide refers to a polymer of amino acids and its equivalent and does not refer to a specific length of the product; thus, peptides, oligopeptides and proteins are included within the definition of a polypeptide. This term also does not refer to, or exclude modifications of the polypeptide, for example, glycosylates, acetylations, phosphorylations, and the like. Included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, natural amino acids, etc.), polypeptides with substituted linkages as well as other modifications known in the art, both naturally and non-naturally occurring.
(52) The term wound refers to a type of injury where the dermis of the skin is disrupted forming a tear, cut, puncture, incision, laceration, abrasion, rip, slash, scratch, slit or rupture in the skin of an animal. Such wounds may include ulcers such as venous ulcers, pressure ulcers or diabetic foot. Diabetic foot refers to chronic slow healing wounds on the lower limbs of an individual who may have diabetes. In various embodiments the wound is selected from an ulcer, a chronic slow-healing wound and an open wound.
(53) To increase wound healing refers to reducing the size of the wound surface area preferably until the dermis is mostly or completely covering the area, essentially, healing the wound. Wound healing may be measured as a percentage of the reduction of the wound surface area to the initial surface area at the time of the application of the composition or composition described herein. Treatment and treat and synonyms thereof refer to therapeutic treatment wherein the object is to speed up (increase) wound healing by reducing the size of the wound surface area in the shortest amount of time. Increasing wound healing may include reducing the amount of collagen in the wound site, reducing visible scarring or increased expression of nitric oxide synthase (iNOS). Treatment may include prophylactic passive treatment of a patent at the time of surgery. Those in need of such treatment include those with a wound such as a cut, an ulcer or a disruption of the skin or a chronic slow healing wound common in individuals with diabetes. An individual refers to an animal, such as a mammal, preferably a human. In various embodiments the individual has diabetes.
(54) In various embodiments the methods of the invention may further comprise the step of performing an adjunct treatment. The adjunct treatment may include a debridement treatment such as the use of papain or other debridement agents known in the art. The adjunct treatment may include a cytokine treatment. The adjunct treatment may include a hyperbaric oxygen treatment. Similarly, the adjunct treatment may include dressing selection and diabetic shoes or any other treatments known in the art.
(55) Preferably the angiopoietin like 4 (ANGPTL4) polypeptide comprises; (i) an amino acid sequence set forth in SEQ ID NO:1; or (ii) an amino acid sequence having at least 60, at least 70, at least 80, at least 85, at least 90, at least 95, at least 97, at least 98 or at least 99% sequence identity with the amino acid sequence set forth in SEQ ID NO:1 over its entire length; or (iii) an amino acid sequence having at least 70, at least 80, at least 85, at least 90, at least 95, at least 97, at least 98 or at least 99 sequence homology with the amino acid sequence set forth in SEQ ID NO: 1 over its entire length; or (iv) a functional fragment of any one of (i) to (iii).
(56) Preferably the polypeptide of the C terminal region of the angiopoietin like 4 (ANGPTL4) polypeptide or the functional fragment comprise; (i) the amino acid sequence set forth in SEQ ID NO:2; or (ii) an amino acid sequence having at least 60, at least 70, at least 80, at least 85, at least 90, at least 95, at least 97, at least 98 or at least 99% sequence identity with the amino acid sequence set forth in SEQ ID NO:2 over its entire length; or (iii) an amino acid sequence having at least 70, at least 80, at least 85, at least 90, at least 95, at least 97, at least 98 or at least 99 sequence homology with the amino acid sequence set forth in SEQ ID NO: 2 over its entire length.
(57) In the context of the present invention, a homologous sequence is taken to include an amino acid sequence which is at least 60, 70, 80 or 90% identical, preferably at least 95 or 98% identical at the amino acid level over at least 20, 50, 100, 200, 300 or 400 amino acids with the amino acid sequences set out in SEQ ID. NO 1 or the amino acid sequences set out in SEQ ID. NO 2. In particular, homology should typically be considered with respect to those regions of the sequence known to be essential for the function of the protein rather than non-essential neighbouring sequences. Preferred polypeptides of the invention comprise a contiguous sequence having greater than 50, 60 or 70% homology, more preferably greater than 80 or 90% homology, to one or more of amino acids of SEQ ID NO: 1 or to one or more of amino acids of SEQ ID NO: 2.
(58) Other preferred polypeptides comprise a contiguous sequence having greater than 40, 50, 60, or 70% homology, of SEQ ID No: 1 and are capable of binding to SEQ ID No:1. Other preferred polypeptides comprise a contiguous sequence having greater than 50, 60, 70, or 80% homology, of SEQ ID No: 2 and are capable of binding to SEQ ID No:2 and having a similar effect on wound healing. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity. The terms substantial homology or substantial identity, when referring to polypeptides, indicate that the polypeptide or protein in question exhibits at least about 70% identity with an entire naturally-occurring protein or a portion thereof, usually at least about 80% identity, and preferably at least about 90 or 95% identity.
(59) Homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % homology between two or more sequences.
(60) Percentage (%) homology may be calculated over contiguous sequences, i.e. one sequence is aligned with the other sequence and each amino acid in one sequence directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an ungapped alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues (for example less than 50 contiguous amino acids).
(61) Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion will cause the following amino acid residues to be put out of alignment, thus potentially resulting in a large reduction in % homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without penalising unduly the overall homology score. This is achieved by inserting gaps in the sequence alignment to try to maximise local homology.
(62) However, these more complex methods assign gap penalties to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possiblereflecting higher relatedness between the two compared sequenceswill achieve a higher score than one with many gaps. Affine gap costs are typically used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimised alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example when using the GCG Wisconsin Bestfit package the default gap penalty for amino acid sequences is 12 for a gap and 4 for each extension.
(63) Calculation of maximum % homology therefore firstly requires the production of an optimal alignment, taking into consideration gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package and others known in the art. Examples of other software that can perform sequence comparisons include, but are not limited to, the BLAST package and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching.
(64) Although the final % homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrixthe default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for further details). It is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.
(65) Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.
(66) The polypeptide homologues include those having the amino acid sequences, wherein one or more of the amino acids is substituted with another amino acid which substitutions do not substantially alter the biological activity of the molecule. A ANGPTL4 or cANGPTL4 homologue according to the invention preferably has 80 percent or greater amino acid sequence identity to the polypeptide amino acid sequence set out in SEQ ID NO: 1 or SEQ ID NO:2 and has a similar effect on wound healing. Examples of polypeptide homologues within the scope of the invention include the amino acid sequence of SEQ ID NOS: 1 or 2 wherein: (a) one or more aspartic acid residues is substituted with glutamic acid; (b) one or more isoleucine residues is substituted with leucine; (c) one or more glycine or valine residues is substituted with alanine; (d) one or more arginine residues is substituted with histidine; or (e) one or more tyrosine or phenylalanine residues is substituted with tryptophan.
(67) Preferably protein or polypeptide refers to a protein or polypeptide encoded by a nucleic acid sequence expressing the amino acid sequences set forth in SEQ ID NO: 1 or SEQ ID NO.2, variants or fragments thereof. Also included are proteins encoded by DNA that hybridize under high or low stringency conditions, to the encoding nucleic acids. Closely related polypeptides or proteins retrieved by antisera to the polypeptide of SEQ ID NO. 1 or SEQ ID NO: 2 is also included.
(68) Protein modifications or fragments are provided by the present invention for the polypeptides or fragments thereof which are substantially homologous to primary structural sequences but which include, e.g., in vivo or in vitro chemical and biochemical modifications or which incorporate unusual amino acids. Such modifications include, for example, acetylation, carboxylation, phosphorylation, glycosylation, ubiquitination, labeling, e.g., with radionuclides, and various enzymatic modifications, as will be readily appreciated by those well skilled in the art. A variety of methods for labeling polypeptides and of substituents or labels useful for such purposes are well known in the art, and include radioactive isotopes such as .sup.32P, ligands which bind to labeled antiligands (e.g., antibodies), fluorophores, chemiluminescent agents, enzymes, and antiligands which can serve as specific binding pair members for a labeled ligand. The choice of label depends on the sensitivity required, ease of conjugation with the primer, stability requirements, and available instrumentation. Methods of labeling polypeptides are well known in the art.
(69) The polypeptide may include any of the polypeptides described herein made according to methods known in the art such as recombinant production in prokaryotic or eukaryotic cells for example in CHO cells or via synthetic methods such as tBoc or Fmoc as is known in the art. Alternatively, the composition may include an agonist that increases the natural expression of ANGPTL4 in a wound site. Hypoxic conditions are known to induce ANGPTL4 expression. Hypoxia induction factor alpha (HIF-) induces expression of ANGPTL4. Similarly, peroxisome proliferatoractivated receptor (PPAR) proteins are transcription factors that activates ANGPTL4 expression. As such the composition may include a PPAR protein or a HIF- protein.
(70) Another aspect of the invention includes a pharmaceutical composition for increasing wound healing in an individual, comprising an angiopoietin like 4 (ANGPTL4) polypeptide or a therapeutically active fragment thereof; and a pharmaceutically acceptable carrier.
(71) Compositions of the Invention
(72) Polypeptidess produced according to the invention, can be administered for the treatment of wounds in the form of pharmaceutical compositions.
(73) Thus, the present invention also relates to compositions including pharmaceutical compositions comprising a therapeutically effective amount of (a) an agonist to angiopoietin like 4 protein (ANGPTL4) and, or (b) an agonist of the C terminal region of angiopoietin like 4 protein (ANGPTL4) and a carrier. As used herein a compoition will be therapeutically effective if it is able to affect wound healing.
(74) Pharmaceutical forms of the invention suitable for topical application include sterile aqueous solutions such as sterile phosphate-buffered saline (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of topical solutions and or one or more carrier. Alternatively, topical solutions may be delivered encapsulated in liposomes to assist their transport across cell membrane. Alternatively or in addition such preparations may contain constituents of self-assembling pore structures to facilitate transport across the cellular membrane. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating/destructive action of microorganisms such as, for example, bacteria and fungi.
(75) The compositions of the present invention, in neat form, may be directly topically applied to an area of skin in need of treatment. In various embodiments, the resulting active compound is applied directly without dilution, or alternatively, the composition can be slightly diluted with water before being applied topically. Alternatively, the active composition of the present invention can be formulated and topically applied as a spray, soap, gel, cream, lotion, ointment or the like by the addition of pharmaceutically acceptable carriers or excipients. Preferred carriers include deionised water, vegetable or mineral oils, white petrolatum, branched chain fats or oils, animal fats and high molecular weight alcohol. Emulsifiers, stabilisers and antioxidants may also be included as well as colouring agents and essential oils to impart fragrance.
(76) It is typical that the compositions of the present invention can be formulated as a lotion or tonic, where they are either applied directly, or diluted with water and then applied. The compositions can also be formulated as creams or ointments. In such formulations the active polypeptides may be added in an amount of 10% to 60%> w/w of base moisturiser cream and mixed in with the base cream. For example, sorbolene cream or other moisturisers can have compositions of the present invention added to them in an amount of 10% to 60% w/w. Alternatively, macadamia oil, jojoba oil, almond oil or other nut and seed oils may be have the active polypeptide of the present invention added to them in an amount of 10%> to 60%> w/w.
(77) Other topical products in which the composition of the present invention can be formulated include skin products such as creams, gels, pastes, emulsions, salves, sprays, masques and peels, and the like.
(78) Suitable topical vehicles for use with the compositions of the present invention are well known in the pharmaceutical areas and include water, lipid bases materials including oils and fats, soaps, surfactants, emollients, skin conditioning agents and emulsifying agents. Examples of these vehicles are described MartindaleThe Extra Pharmacopoeia (Pharmaceutical Press). Clearly, the choice of a suitable vehicle depends on the mode of delivery of the formulation. The active composition is generally incorporated in the dermatologically acceptable vehicle/carrier in a conventional manner well known in the pharmaceutical arts.
(79) Topical application of an efficacious amount of the composition of the present invention to an area of skin in need of treatment affords fast and effective healing from the symptoms of various wounds such as ulcers, chronic non-healing wounds and acne. The area of treated skin takes on an improvement in that the surface area of the wound reduces in size as a percentage of the first application of the composition and preferably the area where the dermis has re-grown may have skin tone that appears smooth and taut.
(80) Typically, a composition of the present invention is topically applied to an animal, preferably a human, for the treatment or prophylaxis of all epidermal wounds including ulcers, insect bites, first, second and third degree burns, healing of sores, wounds and skin infections. Typically, a composition of the present invention reduces scarring and reduces effects of prolific fibrosis on the epidermis. Preferably, a general improvement in clarity, skin texture and appearance of a final scar may be observed after application of a composition of the present invention compared to a similar wound where the composition is not applied.
(81) Typically, a formulation containing a composition of the present invention, such as a composition and a carrier and/or dilutent is topically applied to the appropriate area and allowed to remain. In various embodiments several applications may be made consequently.
(82) Accordingly, it is typical that the topical compositions of the present invention can be in the form of a masque or lotion or gel, or a cream or ointment.
(83) The carrier can be a solvent or dispersion medium containing, for example, water, ethariol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The carrier may be carboxyl methylcellulose. The proper fluidity can be maintained, for example, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Preventing the action of microorganisms in the compositions of the invention is achieved by adding antibacterial and/or antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
(84) Sterile injectable solutions for local application may be prepared by incorporating the active compositions in the required amount in the appropriate solvent with several of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
(85) The active ingredient may be held within a matrix which controls the release of the active agent. Preferably, the matrix comprises a substance selected from the group consisting of lipid, polyvinyl alcohol, polyvinyl acetate, polycaprolactone, poly(glycolic)acid, poly(lactic)acid, polycaprolactone, polylactic acid, polyanhydrides, polylactide-co-glycolides, polyamino acids, polyethylene oxide, acrylic terminated polyethylene oxide, polyamides, polyethylenes, polyacrylonitriles, polyphosphazenes, poly(ortho esters), sucrose acetate isobutyrate (S AIB), and combinations thereof and other polymers. Preferably, the matrix sustainedly releases the agonist.
(86) Pharmaceutically acceptable carriers and/or diluents may also include any and all solvents, dispersion media, coatings, antibacterials and/or antifungals, isotonic and absorption delaying agents and the like. The carrier and/or diluents may be carboxyl methylcellulose. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the therapeutic compositions is contemplated.
(87) The composition may further comprising an adjunct treatment agent. In various embodiments the adjunct treatment agent may comprise a debridement agent such as papain. Preferably the polypeptide or the composition is suitable for use in the treatment of the wound site.
(88) Treatment and treat and synonyms thereof refer to therapeutic treatment wherein the object is to speed up (increase) wound healing by reducing the size of the wound surface area in the shortest amount of time, reducing the amount of collagen in the wound site, reducing visible scarring or increased expression of nitric oxide synthase (iNOS). Treatment may include prophylactic passive treatment of a patent at the time of surgery. Those in need of such treatment include those with a wound such as a cut, an ulcer or a disruption of the skin or a chronic slow healing wound common in individuals with diabetes. An individual refers to an animal, preferably a human.
(89) To close a wound site refers to reducing the size of the wound surface area preferably until the dermis is mostly or completely covering the area, essentially, healing the wound. Wound healing may be measured as a percentage of the reduction of the wound surface area to the initial surface area at the time of the application of the polypeptide or composition described herein.
(90) A therapeutically effective amount would be able to increase an angiopoietin like 4 protein (ANGPTL4) polypeptide in a wound site. As used herein a therapeutically effective amount of a composition will be an amount of active agent that is capable of speeding up (increasing) wound healing. Dosages and administration of a composition of the invention in a pharmaceutical composition may be determined by one of ordinary skill in the art of clinical pharmacology or pharmacokinetics. An effective amount of the composition to be employed therapeutically, for example a polypeptide, will depend, for example, upon the therapeutic objectives, the route of administration, and the condition of the mammal. Accordingly, it will be necessary for the therapist to titer the dosage and modify the route of administration as required to obtain the optimal therapeutic effect. A typical daily dosage might range from about 10 ng to up to 100 mg per wound or more per day, preferably about 1 g to 10 mg per wound. Doses may include protein amount any where in the range of 10 to 100 g or more preferably 25, 50, or 75 g per wound.
(91) Preferably, the angiopoietin like 4 (ANGPTL4) polypeptide or therapeutically acive fragment thereof is as described above.
(92) Wound site, refers to a type of injury where the dermis of the skin is disrupted forming a tear, cut, puncture, incision, laceration, abrasion, rip, slash, scratch, slit or rupture in the skin of an animal. Such wounds may include ulcers such as venous ulcers, pressure ulcers or diabetic foot. Diabetic foot refers to chronic slow healing wounds on the lower limbs of an individual who may have diabetes. Preferably, the wound site is selected from an ulcer, a chronic slow-healing wound and an open wound.
(93) Another aspect of the invention includes a method of determining whether a wound site will become a chronic slow-healing wound, comprising the steps of (a) determining the level of the angiopoietin like 4 protein (ANGPTL4) present in a sample taken from the wound site (b) comparing the level of the angiopoietin like 4 protein (ANGPTL4) from the sample with a control from a healthy individual (with normal wound healing), wherein a reduced level of ANGPLT4 in the sample compared with the control is indicative that the wound site will become a chronic slow-healing wound.
(94) A chronic slow-healing wound refers to impared wound healing or wounds that do not appear to follow the normal healing process in less than 4 weeks.
(95) The method may further comprising the step of determining the blood sugar level of the individual suspected of having the chronic slow-healing wound wherein a high blood sugar level compared to the blood sugar level of a healthy individual is further indicative that the wound site will become a chronic slow-healing wound.
(96) ANGPTL4 produced by wound keratinocytes interacts with specific matrix proteins in the wound bed, delaying their proteolytic degradation by MMPs, and directly affects cell-matrix communication by altering the availability of intact matrix proteins. Thus, the multifaceted roles of ANGPTL4 link inflammation, diabetes and wound healing.
(97) The management of the diabetic wound is complex requiring a multidisciplinary approach. Diabetic wounds are characterized by an accumulation of devitalized tissue, chronic inflammation, poor wound-related angiogenesis and deficiencies in several ECM components. Despite the enormous medical burden from poor diabetic wound healing, effective therapies that can regenerate this corrupted ECM have been lacking.
(98) We have showed that ANGPTL allows crosstalk of various cells such as wound keratinocytes, dermal fibroblasts, endothelial cells or inflammatory cells with the surrounding ECM thus rendering it to be more efficacious than individual cytokine-mediated candidates. We also showed that ANGPTL4 reduced collagen deposition towards the later stage of in our diabetic wound healing. Unlike PDGF, ANGTPL4 can be administered as a topical cream or via biocompatible scaffolds. ANGPTL4 can also be used as an anti-scarring agent.
(99) Our study suggested that manipulation of ANGPTL4 may provide adjunctive or new therapeutics avenues in diabetes-associated complications, such as diabetic foot ulcers. It's anti-scarring properties could revolutionize wound healing strategy, not only by improving the healing rate but the aesthetic appearance of the skin. It can also be incorporated into over-the-counter creams, wound plasters, dressings, etc for improved healing and reduced scar formation.
(100) Examples of Preferred Embodiments
(101) We showed that the topical application of recombinant ANGPTL4 facilitates wound healing in diabetic mice. ANGPTL4 increases the production of NO level in wounded keratinocytes via integrin 1 signaling/pSTAT3 induction of iNOS expression. The elevated NO in the wound microenvironment reduces collagen scar tissue via the stabilization of the ID3 mRNA, which inhibits the expression of COL1A2 in dermal fibroblasts. Our focused gene expression profiling also revealed that the majority of the dysregulated temporal and expression levels of cytokines, growth factors and transcription factors observed in diabetic mice wounds (ob/ob) when compared to wild type counterpart (ob/+), were restored upon treatment with ANGPTL4. Our study suggested that the replacement of ANGPTL4 provides an adjunctive or new therapeutic avenue in diabetics-associated complications, such as diabetic foot ulcers.
Example 1
(102) Animals.
(103) Heterozygous BTBR.V (B6)-Lep.sup.ob/WiscJ mice (+/ob) were purchased from The Jackson Laboratory (Bar Harbor, Me.). Age- and sex-matched homozygous ob/ob and wildtype (+/+) were obtained by interbreeding the +/ob littermates. At 3-wk old, offsprings were separated from their parents and genotyped using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Male C57BL/6J mice were obtained from Laboratory Animal Centre, National University of Singapore. All mice used in this study were individually caged housed in a temperature-controlled room (23 C.) on a 12 h light-dark cycle, and allowed ad libitum access to standard mouse chow diet and water. The mutant mice exhibit severe diabetic conditions from 8 weeks of age and blood glucose level of diabetic mice was 47314.6 mg/dL and non-diabetic mice was 122.55.21 mg/dL as determined by Accu-Chek Advantage glucometer (Roche Diagnostic).
Example 2
(104) Genotyping of Crossbred Mice with PCR-RFLP.
(105) A small tail biopsy was collected from each mouse for genotyping and ear tagged after anesthetics. Genomic DNA was extracted using a modified Proteinase K protocol as previously described.sup.25. Genotyping was performed on extracted DNA using PCR-RFLP assay. Primer sequences were (5-TGTCCAAGATGGACCAGACTC-3) (SEQ ID NO: 3) and (5-ACTGGTCTGAGGCAGGGAGCA-3) (SEQ ID NO: 4). PCR product was digested with DdeI restriction enzyme. Digested fragments were resolved by 2% agarose gel electrophoresis. Using PCR-RFLP, +/+ mice show a single 155-bp band; heterozygous (+/ob) and homozygous mutant (ob/ob) yield 3 bands (155, 100 and 55-bp bands) and 2 bands (100 and 55-bp bands), respectively.
Example 3
(106) Reduced ANGPTL4 Expression in Impaired Diabetic Wound Healing.
(107) To demonstrate an impaired wound healing of a diabetic (ob/ob) mice compared with normal (ob/+) mice, we evaluated the progress and dynamics of wound healing of full-thickness excisional splint wounds between ob/+ and ob/ob mice.
(108) Mice were anesthetized prior to surgery by a single intraperitoneal anaesthetized with of ketamine/xylazine (80 mg/kg+10 mg/kg). Full-thickness excisional wounds (0.50.5 cm.sup.2) were created on the dorso-medial back of each mouse. Mice were euthanized by CO.sub.2 inhalation at Day 0, 3, 5, 7 and 10 post wounding. At the indicated time, photo imaging, histomorphometric and other biological analysis of wound biopsies was done.
(109) Macroscopic observation revealed that ob/ob mice closed 40% of the wound when compared to the ob/+ mice which had complete wound closure by day 10 post-injury (
(110) Wound biopsies were fixed in 4% paraformaldehyde-PBS overnight at 4 C., embedded in OCT tissue freezing medium (Leica) and frozen immediately with liquid nitrogen. Cryosections of 8 m thickness were used for histological staining. Histomorphometric analysis of centrally dissected ob/ob wound sections revealed significantly delayed re-epithelialization between day 3-10 post-wounding (ob/+ versus ob/ob: Day 3, 52.1% vs. 79.6%, p<0.01; Day 5, 13.3% vs. 35.4%, p<0.01; Day 7, 3.0% vs. 28.6%, p<0.01; Day 10, 0% vs. 23.6%, p<0.01;
(111) ANGPTL4 is important for the healing of normal full-thickness excision wound. ANGPTL4-deficient mice showed a delay in wound healing associated with perturbed keratinocyte migration, poor wound-related angiogenesis that is highly reminiscent of diabetic wound healing. To investigate the role of ANGPTL4 in a diabetic wound, we first compared the spatiotemporal expression profile of ANGPTL4 mRNA and protein between wounded ob/ob mice and ob/+ mice.
(112) RNA extraction and reverse transcription. At indicated time, skin wound biopsies were excised as previously described.sup.26 and total RNA was extracted using Illustra RNAspin Mini (GE Healthcare) following the supplier's protocol. Five g of total RNA was reverse transcribed with oligo-dT primers using RevertAid H Minus M-MuLV. The RNAs were removed by RNase H digestion prior quantitative real-time PCR (qPCR). Total RNA was isolated from archival paraformaldehye-fixed, paraffin embedded sections (FFPE) of human diabetic wounds using RecoverAll total nucleic acid isolation (Ambion). Fifty ng of RNA was subjected to Full Spectrum Complete Transcriptome RNA Amplification (System Biosciences) according to manufacturer's recommendation prior qPCR. The quantitative real-time PCR (qPCR) analyses revealed 2-folds reduction in ANGPTL4 expression from day 3 post wounding in ob/ob mice compared with ob/+ mice (ob/ob vs ob/+: Day 3, 0.790 vs. 0.511, p<0.01; Day 5, 0.735 vs. 0.222, p<0.01; Day 7, 0.359 vs. 0.164, p<0.01;
(113) Wound biopsies were homogenized with ice-cold protein lysis buffer pH 8.0 (20 mM Na.sub.2H.sub.2PO.sub.4, 250 mM NaCl, 1% Triton X-100, 0.1% SDS and 1 mM PMSF). Total protein lysates were precipitated by a chloroform/methanol solvent method prior been resolved on 10% SDS-PAGE. The proteins were electrotransferred onto a onto polyvinylidene fluoride membrane (Millipore). The membranes were blocked with 5% skim milk in TBS (0.25 M Tris.HCl, pH 7.6, 1.5 M NaCl) containing 0.05% Tween-20. The membrane was incubated with indicated primary antibodies overnight at 4 C. and appropriate anti IgG-HRP secondary antibodies (1:10000) for 1 h at room temperature. The protein bands were revealed using Immobilon Western Chemiluminescent HRP Substrate (Millipore) and signals were quantified by densitometry with the aid of ImageJ version 1.38x (NIH). Consistent with qPCR data, the western blot analysis showed a 5-fold reduction in the level of ANGPTL4 at day 5 post wounding in ob/ob mice as compared with ob/+(ob/ob vs ob/+; Day 3, 2.36 vs. 1.43, p<0.05; Day 5, 1.90 vs. 0.38, p<0.01; Day 7, 1.21 vs. 0.93, p<0.01; Day 10, 1.25 vs. 0.62, p<0.01;
(114) Similarly, the immunofluorescence staining of day 3-10 wound biopsies of ob/ob mice revealed a lower expression of ANGPTL4 in the wound epithelia and wound bed when compared with ob/+(
Example 4
(115) Topical Application of cANGPTL4 Improves the Healing Rate of Diabetic Wounds.
(116) Next, we examined the effect of topical application of recombinant ANGPTL4 on the rate of diabetic wound healing. We inflicted two full excisional splint wounds on the dorsal surface of DB mice, and treated one wound with cANGPTL4 and the other with saline in 4% carboxymethylcellulose (
(117) Two circular 5 mm diameter full excisional wounds were created on the dorso-media back of each mouse and silicon donut-shaped splints of 10 mm diameter were centered over the wounds. The silicon splint was adhered to the skin with cyanoacrylate glue. On the day of surgery (day 0), 50 L of recombinant human ANGPTL4 (rhANGPTL4) protein of 1 mg/mL or 2 mg/mL or PBS mixed with 1% carboxyl methylcellulose (CMC) was applied topically to their respective cutaneous wound and protected with an occlusive dressing (Tegaderm, 3M) throughout the duration of the study.
(118) The wound images revealed a distinct improvement in the wound closure of cANGPTL4-treated ob/ob mice compared to saline-treated ob/ob mice on day 7 and 10 post-injury (
(119) The dysregulation of growth factors and cytokines production, and subsequent aberrant activation of signaling cascades contribute to poor diabetic wound healing. These factors and signaling mediators are known to be integral in the chemotaxis, migration, stimulation, and proliferation of cells and matrix substances necessary for wound healing. To investigate if treatment of diabetic wound with ANGPTL4 can affect the expression profiles of various genes involved several biological aspect of wound healing, focused qPCR arrays were performed on wound biopsies derived from ob/+, ob/ob and ob/ob mice treated with ANGPTL4 at various days post-wounding.
(120) We analysed a total of 79 genes, whose temporal expression profile during wound healing can be clustered into their biological function such as proliferation, angiogenesis, cell migration, extracellular matrix (ECM), cell apoptosis and inflammation (
(121) TABLE-US-00001 TABLE1 Listofprimerpairssequences. Genes Sequence(5 to3) Sequence(5 to3) ADAMmetallopeptidase F:GGACGGAACCAGACTGCTG R:CCACTGAACAAAGTTGCCCA domain9(ADAM9) (SEQIDNO:5) (SEQIDNO:6) Adiponectin(ADIPOQ) F:AGCCGCTTATATGTATCGCTCA R:TGCCGTCATAATGATTCTGTTGG (SEQIDNO:7) (SEQIDNO:8) AKT1 F:CCAAGGCCCAACACCTTTATC R:TTCCTGCCTCTTGAGTCCATC (SEQIDNO:9) (SEQIDNO:10) ANGPT1 F:TGCACTAAAGAAGGTGTTTTGCT R:CCTCCCCCATTCACATCCATATT (SEQIDNO:11) (SEQIDNO:12) ANGPT2 F:CGAGGCGCATTCGCTGTAT R:GGCTGATGCTACTTATTTTGCCC (SEQIDNO:13) (SEQIDNO:14) ANGPTL4 F:TCCAACGCCACCCACTTAC R:TGAAGTCATCTCACAGTTGACCA (SEQIDNO:15) (SEQIDNO:16) CCL2 F:TTAAAAACCTGGATCGGAACCAA R:GCATTAGCTTCAGATTTACGGGT (SEQIDNO:17) (SEQIDNO:18) CCL11 F:GAATCACCAACAACAGATGCAC R:ATCCTGGACCCACTTCTTCTT (SEQIDNO:19) (SEQIDNO:20) Cyclin-dependentkinase F:CCAATGTTGTACGGCTGATGG R:TGTCCAGGTATGTCCTCAGGT 4(CDK4) (SEQIDNO:21) (SEQIDNO:22) Cyclin-dependentkinase F:CCCTGCCACCCTTACCAGA R:CAGATACCTCGCAATGTCACG inhibitor2B(CDKN2B) (SEQIDNO:23) (SEQIDNO:24) cystatinA(CSTA) F:TACGGAGGTGTTTCAGAGGC R:CAGCGACGGCTTGAGTTTT (SEQIDNO:25) (SEQIDNO:26) CXCL1 F:CTGGGATTCACCTCAAGAACATC R:CAGGGTCAAGGCAAGCCTC (SEQIDNO:27) (SEQIDNO:28) CXCL5 F:TGCGTTGTGTTTGCTTAACCG R:AGCTATGACTTCCACCGTAGG (SEQIDNO:29) (SEQIDNO:30) CXCL9 F:GAACGGAGATCAAACCTGCCT R:TGTAGTCTTCCTTGAACGACGA (SEQIDNO:31) (SEQIDNO:32) CXCL10 F:CCAAGTGCTGCCGTCATTTTC R:GGCTCGCAGGGATGATTTCAA (SEQIDNO:33) (SEQIDNO:34) Epidermalgrowthfactor F:GGGAGCATTTGGCACAGTGTA R:GCCATCACATAGGCTTCGTCAA receptor(EGFR) (SEQIDNO:35) (SEQIDNO:36) EPHA3 F:TTCTGGTCGGGAGGTTTTGTG R:ACTGCTTGAGTAGGGTCTTCA (SEQIDNO:37) (SEQIDNO:38) EPHB3 F:ACCGTAAGAGACTGTAACAGCA R:GTCCACTTTCACGTAGGGGTT (SEQIDNO:39) (SEQIDNO:40) Fattyacidsynthase(FAS) F:AGAGATCCCGAGACGCTTCT R:GCCTGGTAGGCATTCTGTAGT (SEQIDNO:41) (SEQIDNO:42) Fibroblastgrowthfactor F:CAGCTCAGTGCGGAAAGTG R:TGTCTGCGAGCCGTATAAAAG 1(FGF1) (SEQIDNO:43) (SEQIDNO:44) FGF2 F:GCGACCCACACGTCAAACTA R:TCCATCTTCCTTCATAGCAAGGT (SEQIDNO:45) (SEQIDNO:46) FBJosteosarcoma F:GCCACTGCCGACCACAATTC R:TTATTGGCGACAGTGCAGAACC oncogeneB(FOSB) (SEQIDNO:47) (SEQIDNO:48) Fosrelatedantigen2 F:AGCCTCCCGAAGAGGACAG R:AGGACATTGGGGTAGGTGAA (FRA2) (SEQIDNO:49) (SEQIDNO:50) Growthdifferentiation F:TAAGGTGGGCAGATTGCTTTTT R:CTGGACAGTTACCCTGGAGTA factor3(GDF3) (SEQIDNO:51) (SEQIDNO:52) GLI-Kruppelfamilymember F:GAGCCCTTCTTTAGGATTCCCA R:ACCCCGAGTAGAGTCATGTGG GLI1(GLI1) (SEQIDNO:53) (SEQIDNO:54) GM-CSF F:TCGTCTCTAACGAGTTCTCCTT R:GCAGTATGTCTGGTAGTAGCTGG (SEQIDNO:55) (SEQIDNO:56) Hepatocytegrowthfactor F:CTGCTTCATGTCGCCATCC R:TGGGTCTTCCTTGGTAAGAGTAG (HGF) (SEQIDNO:57) (SEQIDNO:58) HIF1 F:GGTCATCGCAGTTGGAACCTCC R:CGCTTGTGTCTTGGAAGGCTTG (SEQIDNO:59) (SEQIDNO:60) BaculoviralIAPrepeat- F:AGGGACCATCAAGGGCACAG R:TTTGTGTGTTTGGCGGTGTCTC containing2(IAP2) (SEQIDNO:61) (SEQIDNO:62) Insulin-likegrowthfactor F:AGAAGCCCCTGCGTACATTG R:TGTCCCCACGATCTTCATCTT bindingprotein4(IGFBP4) (SEQIDNO:63) (SEQIDNO:64) IL1R1 F:GCCAAGGTGGAGGACTCAG R:CCAGGGTCATTCTCTAACACAGT (SEQIDNO:65) (SEQIDNO:66) IL-6 F:TAGTCCTTCCTACCCCAATTTCC R:TTGGTCCTTAGCCACTCCTTC (SEQIDNO:67) (SEQIDNO:68) IL-10 F:AGAAGCATGGCCCAGAAATCA R:GGCCTTGTAGACACCTTGGT (SEQIDNO:69) (SEQIDNO:70) IL-18 F:GTGAACCCCAGACCAGACTG R:CCTGGAACACGTTTCTGAAAGA (SEQIDNO:71) (SEQIDNO:72) Inhibin,betaA(INHBA) F:ATAGAGGACGACATTGGCAGG R:ATAGAGGACGACATTGGCAGG (SEQIDNO:73) (SEQIDNO:74) Integrin,alphaV(ITGAV) F:CCTGTGCTCCATTGTACCACT R:AGCATACTCAACGGTCTTTGTG (SEQIDNO:75) (SEQIDNO:76) JunBproto-oncogene(JUN-B) F:GACCTGCACAAGATGAACCAC R:AGGCTGGAGAGTAACTGCTGA (SEQIDNO:77) (SEQIDNO:78) Keratinocytegrowthfactor F:CCGTGGCAGTTGGAATTGTG R:CCTCCGCTGTGTGTCCATTT (KGF) (SEQIDNO:79) (SEQIDNO:80) KI67 F:CTGCCTCAGATGGCTCAAAGA R:GAAGACTTCGGTTCCCTGTAAC (SEQIDNO:81) (SEQIDNO:82) Kruppel-likefactor9 F:GCCGCCTACATGGACTTCG R:GCCGTTCACCTGTATGCAC (KLF9) (SEQIDNO:83) (SEQIDNO:84) Mitogen-activatedprotein F:ACCACATTCTAGGTATCTTGGGT R:GATGCGCTTGTTTGGGTTGAA kinase3(MAPK3(1B)) (SEQIDNO:85) (SEQIDNO:86) Mitogen-activatedprotein F:CTCACAGCTCGCTCAGATCC R:GAGGGGACAGCCGTTGAAT kinasekinasekinase (SEQIDNO:87) (SEQIDNO:88) kinase1(MAP4K1) Melan-a(MLANA) F:TGGATACAGAACCTTGATGGACA R:GGGCTGATGGGATTTCTCTTG (SEQIDNO:89) (SEQIDNO:90) MMP9 F:AAACCACCTCTCCCGACTCCAG R:AGCTCGGTGGTGTTCTCCAATG (SEQIDNO:91) (SEQIDNO:92) MMP13 F:ACCTCCACAGTTGACAGGCT R:AGGCACTCCACATCTTGGTTT (SEQIDNO:93) (SEQIDNO:94) OPN F:ATCTCACCATTCGGATGAGTCT R:TCAGTCCATAAGCCAAGCTATCA (SEQIDNO:95) (SEQIDNO:96) PAI1 F:GTGCATCACTCCACAAACCTGC R:TAACGTGGGTTGCCAAGCATC (SEQIDNO:97) (SEQIDNO:98) PDGFA F:CGCTGCACTGGCTGTTGTA R:TTCCCTACGCCTTCCTGTCTC (SEQIDNO:99) (SEQIDNO:100) PDGFB F:CGAGCCAAGACGCCTCAAG R:CATGGGTGTGCTTAAACTTTCG (SEQIDNO:101) (SEQIDNO:102) PlateletandEndothelial F:TGCACCCCATCACTTACCACC R:TAAAACGCGGTCCTGTTCCTC CellAdhesionMolecule1 (SEQIDNO:103) (SEQIDNO:104) (PECAM1) PPAR F:TCGGCGAACTATTCGGCTG R:GCACTTGTGAAAACGGCAGT (SEQIDNO:105) (SEQIDNO:106) PPAR/ F:TTGAGCCCAAGTTCGAGTTTG R:CGGTCTCCACACAGAATGATG (SEQIDNO:107) (SEQIDNO:108) PPAR F:TGTGGGGATAAAGCATCAGGC R:CCGGCAGTTAAGATCACACCTAT (SEQIDNO:109) (SEQIDNO:110) Rashomologgenefamily, F:AGCCTTTCTCACCTGGACTGC R:CACCCACTGCCACCCATAAG memberA(RHOA) (SEQIDNO:111) (SEQIDNO:112) Rpl27 F: R:CTGGTGGCTGGAATTGACCGCTA CAAGGGGATATCCACAGAGTACCTT (SEQIDNO:114) (SEQIDNO:113) SKI-likeoncogene(SKIL) F:AGGCAGAGACAAGTAAGTCCA R:CGTCTGGGTAAGACACTGTTTTT (SEQIDNO:115) (SEQIDNO:116) SMAD3 F:CCCCCACTGGATGACTACAG R:TCCATCTTCACTCAGGTAGCC (SEQIDNO:117) (SEQIDNO:118) SOCS1 F:CTGCGGCTTCTATTGGGGAC R:AAAAGGCAGTCGAAGGTCTCG (SEQIDNO:119) (SEQIDNO:120) SOCS3 F:CAAGAACCTACGCATCCAGTG R:CCAGCTTGAGTACACAGTCGAA (SEQIDNO:121) (SEQIDNO:122) SPARC F:ACTACATCGGACCATGCAAATAC R:GTACAAGGTGACCAGGACATTTT (SEQIDNO:123) (SEQIDNO:124) STAT1 F:GGAGCACGCTGCCTATGATG R:CTCCAGAGAAAAGCGGCTGTA (SEQIDNO:125) (SEQIDNO:126) STAT3 F:CAATACCATTGACCTGCCGAT R:GAGCGACTCAAACTGCCCT (SEQIDNO:127) (SEQIDNO:128) STAT5A F:AGTGGTTCGACGGGGTGAT R:ATGGCTTCAGATTCCAGAGGT (SEQIDNO:129) (SEQIDNO:130) TGF F:CACTCTGGGTACGTGGGTG R:CACAGGTGATAATGAGGACAGC (SEQIDNO:131) (SEQIDNO:132) TGF1 F:CCGCAACAACGCCATCTATG R:CTCTGCACGGGACAGCAAT (SEQIDNO:133) (SEQIDNO:134) TGF2 F:TCGACATGGATCAGTTTATGCG R:CCCTGGTACTGTTGTAGATGGA (SEQIDNO:135) (SEQIDNO:136) TGF receptor1(TGFR1) F:TCCCAACTACAGGACCTTTTTCA R:GCAGTGGTAAACCTGATCCAGA (SEQIDNO:137) (SEQIDNO:138) TIMP1 F:CTTGGTTCCCTGGCGTACTC R:ACCTGATCCGTCCACAAACAG (SEQIDNO:139) (SEQIDNO:140) TIMP2 F:CTGGACGTTGGAGGAAAGAAG R:GGTGATGCTAAGCGTGTCCC (SEQIDNO:141) (SEQIDNO:142) TIMP3 F:GCGCAAGGGCCTCAATTAC R:AGAGACACTCATTCTTGGAGGT (SEQIDNO:143) (SEQIDNO:144) TLR2 F:CCAGACACTGGGGGTAACATC R:CGGATCGACTTTAGACTTTGGG (SEQIDNO:145) (SEQIDNO:146) TLR4 F:AAAGTGGCCCTACCAAGTCTC R:TCAGGCTGTTTGTTCCCAAATC (SEQIDNO:147) (SEQIDNO:148) TNC F:GCTACCGACGGGATCTTCG R:TAGCCGTGGTACTGATGGTTT (SEQIDNO:149) (SEQIDNO:150) TNF F:GGCTTTCCGAATTCACTGGAG R:CCCCGGCCTTCCAAATAAA (SEQIDNO:151) (SEQIDNO:152) TNF interactingprotein2 F:AAAGGGATACCTACTTGCTGCT R:CAAGCCCGACACCTTGAAG (TNFIP2) (SEQIDNO:153) (SEQIDNO:154) TSP-1 F:GAAGCAACAAGTGGTGTCAGT R:ACAGTCTATGTAGAGTTGAGCCC (SEQIDNO:155) (SEQIDNO:156) VEGFA F:GCACATAGAGAGAATGAGCTTCC R:CTCCGCTCTGAACAAGGCT (SEQIDNO:157) (SEQIDNO:158) VG1relatedsequence(VGR) F:TCCTTGAACCGCAAGAGTCTC R:CTCACCCTCAGGAATCTGGG (SEQIDNO:159) (SEQIDNO:160) VHL F:AAAGAGCGGTGCCTTCAGG R:CACTTGGGTAGTCCTCCAAATC (SEQIDNO:161) (SEQIDNO:162) X-rayrepaircomplementing F:TCTTCAGTCGTATCAACAAGACG R:GTTTGCTGGGAGGTTTCCTG defectiverepairinChinese (SEQIDNO:163) (SEQIDNO:164) hamstercells1(XRCC1)
(122) Heatmaps were constructed from the qPCR focused array data (table 2, 3 and 4) for comparison (
(123) TABLE-US-00002 TABLE 2 Gene expression in ob/+ wound GenBank Accession No. Symbol Gene Description Day 0 Day 3 Day 5 Day 7 NM_021274.1 CXCL10 chemokine (C-X-C motif) ligand 10 0.091558 2.265794 0.299061 0.121755 NM_009283 STAT 1 signal transducer and activator of 0.762617 1.325453 1.484704 0.605908 transcription 1 NM_008808.3 PDGFA platelet derived growth factor, alpha 1.034881 1.46755 2.094767 0.580995 BC109135 IL1R1 interleukin 1 receptor, type I 0.496046 1.924439 1.098497 0.982171 NM_011577.1 TGFB1 transforming growth factor, beta 1 0.208501 2.552748 0.930714 0.555158 NM_008402 ITGAV integrin alpha V 0.846653 1.623685 1.197204 1.11023 NM_011905 TLR2 toll-like receptor 2 0.503839 2.670658 0.809051 0.342864 NM_011333.3 CCL2 chemokine (C-C motif) ligand 2 0.086708 1.764824 1.228643 0.195532 NM_008279.2 MAP4K1 mitogen-activated protein kinase 0.520385 0.820073 0.924272 0.432847 kinase kinase kinase 1 NM_009532 XRCC1 x-ray repair complementing defective 0.409888 4.198295 1.129176 1.564693 repair in Chinese hamster cells 1 NM_011593 TIMP1 tissue inhibitor of metalloproteinase 1 0.097499 4.77994 0.615597 0.657043 NM_010548.2 IL-10 interleukin 10 0.020473 1.212068 1.264306 0.534042 NM_010431 HIF1A hypoxia inducible factor 1, alpha 0.7528 2.806556 1.038764 0.718689 subunit NM_008599.4 CXCL9 chemokine (C-C motif) ligand 9 0.345309 0.727598 1.372522 0.509822 NM_009141.2 CXCL5 chemokine (C-X-C motif) ligand 5 0.149996 3.936088 1.464851 0.594453 NM_007707 SOCS3 Suppressor of cytokine signaling 3 0.526876 4.127815 1.742194 0.582746 NM_009507.3 VHL von Hippel-Lindau tumor suppressor 1.001643 1.742515 1.298497 0.697237 NM_009263 OPN secreted phosphoprotein 1 0.159337 3.38626 4.407381 0.200014 (Spp1) NM_013693 TNFA Tumor necrosis factor, alpha 0.037312 10.2316 0.468858 0.201943 NM_008176 CXCL1 chemokine (C-X-C motif) ligand 1 0.083437 11.05786 0.793785 0.412259 NM_009652.3 AKT1 thymoma viral proto-oncogene 1 0.594666 3.446702 1.482059 1.029804 NM_020581.2 ANGPTL4 angiopoietin-like 4 0.03546 0.790093 0.735691 0.349754 NM_011057.3 PDGFB platelet derived growth factor, B 0.938039 1.825587 1.79318 0.734739 polypeptide NM_001081117.2 Ki67 antigen identified by monoclonal 0.588614 5.438939 2.334188 3.044264 antibody Ki 67 NM_010427.4 HGF hepatocyte growth factor 0.291696 1.172812 1.299929 0.511323 AF016189.1 Smad3 MAD homolog 3 0.661817 1.268314 1.040053 0.561323 NM_010143 EPHB3 Eph receptor B3 0.529828 0.904733 1.098044 1.303584 NM_008037 FOSL2 fos-like antigen 2 0.304307 2.714392 0.578645 1.117775 (FRA2) NM_010140 EPHA3 Eph receptor A3 0.171504 1.410735 1.281664 0.694695 NM_207655 EGFR epidermal growth factor receptor 0.664681 1.006642 0.765933 0.826478 NM_009505 VEGFA vascular endothelial growth factor A 1.256536 4.690086 2.205454 0.986008 NM_009870 CDK4 cyclin-dependent kinase 4 0.63752 1.941299 1.289818 1.160359 NM_007556 BMP6 bone morphogenetic protein 6 1.221781 2.120903 0.357451 0.136682 NM_001033239 CSTA Cystatin A 0.188826 4.410111 19.62685 6.133511 NM_008108 GDF3 growth differentiation factor 3 0.229432 6.458987 2.496683 1.439967 NM_011386.2 SKIL Ski like 0.933885 6.077622 5.291099 2.646154 (SnoN) NM_008416 JUN-B Jun-B oncogene 0.156725 6.554231 0.686169 0.660104 NM_008380 INHBA Inhibin, beta A 0.182848 3.492547 1.07148 0.774788 NM_009896 SOCS1 suppressor of cytokine signaling 1 0.75182 2.01507 2.614084 0.980315 NM_021297 TLR4 toll-like receptor 4 0.503916 1.382422 1.054945 0.449261 NM_007404 ADAM9 a disintegrin and metallopeptidase 0.395403 1.213515 0.922171 0.414878 domain 9 NM_008607 MMP13 matrix metallopeptidase 13 0.23244 1.656137 0.666829 0.152405 NM_008871 PAI1 serine (or cysteine) peptidase inhibitor, 1.71784 0.88462 0.889975 0.345461 (Serpine 1) clade E, member 1 NM_013599 MMP9 matrix metallopeptidase 9 0.531998 4.645245 6.016101 1.260028 NM_007426.3 ANGPT2 angiopoietin 2 0.110251 0.61129 1.77125 0.371325 NM_011607 TNC tenascin C 0.338232 4.641325 7.72361 5.58079 NM_031168.1 IL-6 interleukin 6 0.366964 1.705026 2.175877 0.588519 NM_011580 TSP-1 thrombospondin 1 0.476082 2.211606 1.336181 1.212617 NM_011145.3 PPAR/ peroxisome proliferator activated 0.858071 0.998435 1.025421 1.068006 receptor beta/delta NM_009242 SPARC secreted acidic cysteine rich 0.480204 0.790912 1.80714 0.794548 glycoprotein NM_031199.3 TGFA transforming growth factor, alpha 1.10904 2.309913 2.735879 1.88485 NM_007670.4 p15 cyclin-dependent kinase inhibitor 2B 0.86872 1.674337 1.06653 1.406527 (CDKN2B) NM_009969.4 GM-CSF Colony stimulating factor 2 1.305664 0.628033 1.980158 0.103102 NM_009370.2 TGFBR1 transforming growth factor, beta 0.968227 0.932627 0.91463 1.035229 (ALK5) receptor I NM_010296.2 GLI1 GLI-Kruppel family member GLI1 1.502637 0.463211 0.562287 0.518731 NM_029993.1 Mlana melan-A 0.366231 0.608786 0.160862 0.869004 NM_009640.3 ANGPT1 angiopoietin 1 0.312981 0.223352 0.185313 0.194421 NM_008816.2 PECAM1 platelet/endothelial cell adhesion 1.588275 0.80874 0.777321 0.542357 molecule 1 NM_010638 KLF-9 Kruppel-like factor 9 0.68505 0.86225 0.386243 0.307509 NM_011330.3 CCL11 chemokine (C-C motif) ligand 11 0.529826 0.320064 0.593788 0.211562 NM_008008.4 KGF fibroblast growth factor 7 0.514706 1.121522 0.805334 0.499904 (FGF7) NM_007987.2 FAS Fas (TNF receptor superfamily 0.208006 0.226172 0.034424 0.357528 member 6) NM_011488 STAT 5A signal transducer and activator of 0.453144 0.918977 0.756884 0.516671 transcription 5A NM_008036 FOSB FBJ osteosarcoma oncogene B 0.844083 1.618836 0.867265 0.398194 BC003806 STAT 3 signal transducer and activator of 0.704101 1.526852 1.145983 0.598204 transcription 3 NM_011952 MAPK3 mitogen-activated protein kinase 3 0.3517 1.10514 0.604718 0.454422 (1b) NM_007464 IAP2 intracisternal A particle 2 0.665846 1.51123 1.13886 0.551961 NM_008360.1 IL-18 interleukin 18 0.366857 0.606514 0.960225 0.558545 NM_010517 IGFBP4 insulin-like growth factor binding 0.614106 0.888844 0.794956 0.476489 protein 4 NM_009396.2 TNFAIP2 tumor necrosis factor, alpha-induced 0.906535 0.835809 0.654888 0.250271 protein 2 NM_016802 RHOA ras homolog gene family, member A 0.981261 0.993775 0.959051 0.495424 NM_008006.2 FGF2 fibroblast growth factor 2 0.424226 0.758342 0.404547 0.155131 NM_009367.3 TGFB2 transforming growth factor, beta 2 1.28443 0.576548 0.736159 0.443463 NM_011594 TIMP2 tissue inhibitor of metalloproteinase 2 0.497669 0.489931 1.041379 0.386715 NM_010197.3 FGF1 fibroblast growth factor 1 1.506516 0.845095 0.630055 0.504144 NM_011595.2 TIMP3 tissue inhibitor of metalloproteinase 3 0.896732 0.560416 0.344548 0.387725 NM_011144.6 PPAR peroxisome proliferator activated 1.376648 0.632694 0.50422 0.457501 receptor alpha NM_001127330.1 PPAR peroxisome proliferator activated 1.202532 0.414603 0.380897 0.311466 receptor gamma NM_009605 Adipoq adiponectin, C1Q and collagen 0.257089 0.063623 0.0252 0.106677 domain containing
(124) TABLE-US-00003 TABLE 3 Gene expression in ob/ob wound GenBank Accession No. Symbol Gene Description Day 0 Day 3 Day 5 Day 7 NM_021274.1 CXCL10 chemokine (C-X-C motif) ligand 10 0.250498 1.126345 1.284465 0.778731 NM_009283 STAT 1 signal transducer and activator of 1.007855 1.307954 2.155304 0.929762 transcription 1 NM_008808.3 PDGFA platelet derived growth factor, alpha 0.300793 0.745053 1.267399 0.900313 BC109135 IL1R1 interleukin 1 receptor, type I 0.921124 1.726157 3.633038 0.723038 NM_011577.1 TGFB1 transforming growth factor, beta 1 0.549678 1.355657 3.658518 1.551075 NM_008402 ITGAV integrin alpha V 1.486966 2.218466 3.554344 1.225875 NM_011905 TLR2 toll-like receptor 2 0.489705 2.922228 2.985972 0.923871 NM_011333.3 CCL2 chemokine (C-C motif) ligand 2 0.214683 8.392496 5.935198 0.475682 NM_008279.2 MAP4K1 mitogen-activated protein kinase 0.278249 0.832453 0.819214 0.485642 kinase kinase kinase 1 NM_009532 XRCC1 x-ray repair complementing defective 3.86801 0.530499 1.031126 1.463049 repair in Chinese hamster cells 1 NM_011593 TIMP1 tissue inhibitor of metalloproteinase 1 0.092007 0.675698 0.641478 0.402068 NM_010548.2 IL-10 interleukin 10 0.297165 1.451524 1.288575 0.369205 NM_010431 HIF1A hypoxia inducible factor 1, alpha 0.895448 1.387657 0.906589 0.679313 subunit NM_008599.4 CXCL9 chemokine (C-C motif) ligand 9 1.157953 2.190138 2.601004 2.928437 NM_009141.2 CXCL5 chemokine (C-X-C motif) ligand 5 0.501839 40.88581 49.65191 1.426044 NM_007707 SOCS3 Suppressor of cytokine signaling 3 1.077089 5.065714 2.008733 0.98434 NM_009507.3 VHL von Hippel-Lindau tumor suppressor 1.440808 2.150269 2.576122 1.480475 NM_009263 OPN secreted phosphoprotein 1 0.321897 11.29194 9.79651 2.078165 (Spp1) NM_013693 TNFA Tumor necrosis factor, alpha 0.058466 1.534815 0.864856 0.825961 NM_008176 CXCL1 chemokine (C-X-C motif) ligand 1 0.103358 7.129337 4.410788 0.470175 NM_009652.3 AKT1 thymoma viral proto-oncogene 1 1.134636 1.321611 2.016966 0.934964 NM_020581.2 ANGPTL4 angiopoietin-like 4 0.052951 0.511414 0.222601 0.264857 NM_011057.3 PDGFB platelet derived growth factor, B 0.669607 1.105467 1.523259 1.420103 polypeptide NM_001081117.2 Ki67 antigen identified by monoclonal 1.853563 3.629809 4.337301 2.799198 antibody Ki 67 NM_010427.4 HGF hepatocyte growth factor 0.160628 1.743398 2.166984 0.765072 AF016189.1 Smad3 MAD homolog 3 0.742435 0.750201 0.441932 0.334552 NM_010143 EPHB3 Eph receptor B3 0.389309 1.173355 0.966125 0.874948 NM_008037 FOSL2 fos-like antigen 2 0.389147 1.190892 0.566979 0.473821 (FRA2) NM_010140 EPHA3 Eph receptor A3 0.856996 0.32359 2.581308 0.473749 NM_207655 EGFR epidermal growth factor receptor 1.023921 0.713711 1.00082 0.563818 NM_009505 VEGFA vascular endothelial growth factor A 1.317539 1.37243 1.666211 0.653953 NM_009870 CDK4 cyclin-dependent kinase 4 0.813738 1.337735 1.360731 1.260869 NM_007556 BMP6 bone morphogenetic protein 6 4.061546 1.445786 2.047303 0.103315 NM_001033239 CSTA Cystatin A 0.508856 27.13025 12.53943 3.082821 NM_008108 GDF3 growth differentiation factor 3 0.136515 4.965691 6.24347 2.480356 NM_011386.2 SKIL Ski like 2.759996 8.323164 7.297358 4.831205 (SnoN) NM_008416 JUN-B Jun-B oncogene 0.152556 3.172094 1.526778 1.134647 NM_008380 INHBA Inhibin, beta A 0.919534 2.784224 5.537288 1.897602 NM_009896 SOCS1 suppressor of cytokine signaling 1 1.497767 4.148567 3.142511 1.11581 NM_021297 TLR4 toll-like receptor 4 0.713236 2.706313 2.601621 0.831974 NM_007404 ADAM9 a disintegrin and metallopeptidase 1.481524 1.773434 1.590105 0.674012 domain 9 NM_008607 MMP13 matrix metallopeptidase 13 0.196111 1.485535 1.072455 1.113487 NM_008871 PAI1 serine (or cysteine) peptidase inhibitor, 0.82794 0.50429 0.910365 1.288952 (Serpine 1) clade E, member 1 NM_013599 MMP9 matrix metallopeptidase 9 0.48696 9.389738 5.523574 1.92419 NM_007426.3 ANGPT2 angiopoietin 2 2.597985 0.522414 1.412809 0.544707 NM_011607 TNC tenascin C 0.196003 9.033474 22.59936 7.270111 NM_031168.1 IL-6 interleukin 6 0.195309 8.340513 5.607855 1.92322 NM_011580 TSP-1 thrombospondin 1 0.178282 2.934585 1.655054 1.467634 NM_011145.3 PPAR/ peroxisome proliferator activated 0.514494 2.530547 2.382542 1.719608 receptor beta/delta NM_009242 SPARC secreted acidic cysteine rich 0.766017 0.643615 1.251748 0.803739 glycoprotein NM_031199.3 TGFA transforming growth factor, alpha 2.332045 5.16867 4.421783 2.799128 NM_007670.4 p15 cyclin-dependent kinase inhibitor 2B 1.499122 0.705773 1.415514 1.639463 (CDKN2B) NM_009969.4 GM-CSF Colony stimulating factor 2 0.532663 1.575585 0.216542 3.897695 NM_009370.2 TGFBR1 transforming growth factor, beta 2.250052 2.189751 1.554899 1.632469 (ALK5) receptor I NM_010296.2 GLI1 GLI-Kruppel family member GLI1 0.777933 0.523369 0.833232 0.629003 NM_029993.1 Mlana melan-A 0.163832 0.130891 0.13634 1.018998 NM_009640.3 ANGPT1 angiopoietin 1 0.271623 0.541881 0.486119 0.274159 NM_008816.2 PECAM1 platelet/endothelial cell adhesion 1.026536 1.012497 1.271402 0.708473 molecule 1 NM_010638 KLF-9 Kruppel-like factor 9 1.401337 0.431655 0.642859 0.400448 NM_011330.3 CCL11 chemokine (C-C motif) ligand 11 0.969593 0.610924 0.957601 0.415014 NM_008008.4 KGF fibroblast growth factor 7 0.595196 1.110988 0.99184 0.680341 (FGF7) NM_007987.2 FAS Fas (TNF receptor superfamily 0.439816 0.099373 0.224529 0.189167 member 6) NM_011488 STAT 5A signal transducer and activator of 0.852498 0.754894 1.008012 0.39186 transcription 5A NM_008036 FOSB FBJ osteosarcoma oncogene B 0.474459 2.473119 0.902717 0.39987 BC003806 STAT 3 signal transducer and activator of 0.838114 1.418559 0.857724 0.241829 transcription 3 NM_011952 MAPK3 mitogen-activated protein kinase 3 0.597765 0.716862 0.944315 0.538358 (1b) NM_007464 IAP2 intracisternal A particle 2 0.881733 0.995298 0.952775 0.67237 NM_008360.1 IL-18 interleukin 18 0.599095 0.486806 0.888455 0.438703 NM_010517 IGFBP4 insulin-like growth factor binding 0.847077 0.400526 1.231736 0.448635 protein 4 NM_009396.2 TNFAIP2 tumor necrosis factor, alpha-induced 1.334465 0.900658 0.394656 0.630798 protein 2 NM_016802 RHOA ras homolog gene family, member A 0.656541 1.501634 1.183005 0.931674 NM_008006.2 FGF2 fibroblast growth factor 2 1.317701 0.766727 0.71361 0.258482 NM_009367.3 TGFB2 transforming growth factor, beta 2 1.267494 1.106269 0.693061 0.685656 NM_011594 TIMP2 tissue inhibitor of metalloproteinase 2 0.615494 0.690985 1.270724 0.564646 NM_010197.3 FGF1 fibroblast growth factor 1 1.809058 1.298661 1.220293 0.831763 NM_011595.2 TIMP3 tissue inhibitor of metalloproteinase 3 1.082271 0.327056 0.547626 0.453588 NM_011144.6 PPAR peroxisome proliferator activated 1.358423 0.585544 0.716725 0.619864 receptor alpha NM_001127330.1 PPAR peroxisome proliferator activated 1.476165 0.92328 0.820091 0.4815 receptor gamma NM_009605 Adipoq adiponectin, C1Q and collagen 0.525416 0.118814 0.081237 0.050903 domain containing
(125) TABLE-US-00004 TABLE 4 Gene expression of ANGPTL4 treated ob/ob wound GenBank Accession No. Symbol Gene Description Day 0 Day 3 Day 5 Day 7 NM_021274.1 CXCL10 chemokine (C-X-C motif) ligand 10 0.304805 0.72315 0.61108 0.735198 NM_009283 STAT 1 signal transducer and activator of 0.874987 1.040915 1.396994 1.175607 transcription 1 NM_008808.3 PDGFA platelet derived growth factor, alpha 0.621069 0.776066 0.783335 1.075653 BC109135 IL1R1 interleukin 1 receptor, type I 0.733946 0.774809 1.310378 0.999163 NM_011577.1 TGFB1 transforming growth factor, beta 1 0.369609 1.017253 0.795357 0.789618 NM_008402 ITGAV integrin alpha V 0.911172 0.888832 1.301828 1.306485 NM_011905 TLR2 toll-like receptor 2 0.586327 0.942771 0.810887 0.921544 NM_011333.3 CCL2 chemokine (C-C motif) ligand 2 0.17887 0.676531 0.822543 0.350045 NM_008279.2 MAP4K1 mitogen-activated protein kinase 0.206677 0.70255 0.531403 0.559055 kinase kinase kinase 1 NM_009532 XRCC1 x-ray repair complementing defective 0.778193 0.964759 0.794793 0.816166 repair in Chinese hamster cells 1 NM_011593 TIMP1 tissue inhibitor of metalloproteinase 1 0.12779 0.481093 0.376945 0.322528 NM_010548.2 IL-10 interleukin 10 0.361614 0.923416 0.915123 0.573573 NM_010431 HIF1A hypoxia inducible factor 1, alpha 1.107043 0.888913 1.23845 1.028589 subunit NM_008599.4 CXCL9 chemokine (C-C motif) ligand 9 0.337254 0.683759 0.951498 1.139836 NM_009141.2 CXCL5 chemokine (C-X-C motif) ligand 5 0.506209 0.506209 0.588989 0.520007 NM_007707 SOCS3 Suppressor of cytokine signaling 3 0.586651 0.546553 0.535127 0.743986 NM_009507.3 VHL von Hippel-Lindau tumor suppressor 0.730746 0.713839 1.030148 1.036704 NM_009263 OPN secreted phosphoprotein 1 0.231809 0.246915 0.584065 0.477398 (Spp1) NM_013693 TNFA Tumor necrosis factor, alpha 0.073604 0.323993 0.097211 0.288435 NM_008176 CXCL1 chemokine (C-X-C motif) ligand 1 0.142404 0.409071 0.213149 0.343446 NM_009652.3 AKT1 thymoma viral proto-oncogene 1 1.016809 1.022835 1.141897 1.084718 NM_020581.2 ANGPTL4 angiopoietin-like 4 0.118174 0.551698 0.776718 0.951234 NM_011057.3 PDGFB platelet derived growth factor, B 0.838878 0.937201 0.865232 1.155474 polypeptide NM_001081117.2 Ki67 antigen identified by monoclonal 0.80973 0.731895 0.984001 0.912941 antibody Ki 67 NM_010427.4 HGF hepatocyte growth factor 0.529111 0.883645 1.340757 1.247646 AF016189.1 Smad3 MAD homolog 3 0.954324 0.885912 0.521233 0.896738 NM_010143 EPHB3 Eph receptor B3 0.638463 0.648164 0.967867 1.213741 NM_008037 FOSL2 fos-like antigen 2 0.517498 0.504218 0.424239 0.81525 (FRA2) NM_010140 EPHA3 Eph receptor A3 0.8117 0.984998 0.709375 0.800224 NM_207655 EGFR epidermal growth factor receptor 0.99315 0.900182 1.408017 1.057561 NM_009505 VEGFA vascular endothelial growth factor A 1.205035 0.925818 1.175286 0.980901 NM_009870 CDK4 cyclin-dependent kinase 4 0.796204 1.070902 0.861631 0.894941 NM_007556 BMP6 bone morphogenetic protein 6 0.997043 0.875784 1.168805 0.787381 NM_001033239 CSTA Cystatin A 0.344823 0.271149 0.836511 1.096416 NM_008108 GDF3 growth differentiation factor 3 0.441969 0.933849 0.607563 0.893294 NM_011386.2 SKIL Ski like 0.714242 0.601057 1.014233 1.240276 (SnoN) NM_008416 JUN-B Jun-B oncogene 0.259351 0.412261 0.324982 0.478694 NM_008380 INHBA Inhibin, beta A 0.437202 0.407295 0.243947 0.607651 NM_009896 SOCS1 suppressor of cytokine signaling 1 1.154803 0.952236 0.621538 1.058868 NM_021297 TLR4 toll-like receptor 4 0.439488 0.821909 1.18585 1.06559 NM_007404 ADAM9 a disintegrin and metallopeptidase 0.908046 0.828969 1.205345 0.672844 domain 9 NM_008607 MMP13 matrix metallopeptidase 13 0.37852 0.430121 0.446309 0.750303 NM_008871 PAI1 serine (or cysteine) peptidase inhibitor, 0.693599 0.265534 0.833235 0.82168 (Serpine 1) clade E, member 1 NM_013599 MMP9 matrix metallopeptidase 9 0.417162 0.256081 0.727659 0.86045 NM_007426.3 ANGPT2 angiopoietin 2 1.188643 0.909358 1.040691 0.437665 NM_011607 TNC tenascin C 0.195806 0.688135 0.605638 1.082937 NM_031168.1 IL-6 interleukin 6 0.370696 0.403678 0.662347 0.550118 NM_011580 TSP-1 thrombospondin 1 0.417082 0.823719 0.698756 0.862384 NM_011145.3 PPAR/ peroxisome proliferator activated 0.88324 0.938287 1.672059 0.818705 receptor beta/delta NM_009242 SPARC secreted acidic cysteine rich 0.702669 0.944087 0.739896 0.682164 glycoprotein NM_031199.3 TGFA transforming growth factor, alpha 0.894606 0.816341 0.857122 1.168371 NM_007670.4 p15 cyclin-dependent kinase inhibitor 2B 0.644314 0.440738 0.691463 1.036704 (CDKN2B) NM_009969.4 GM-CSF Colony stimulating factor 2 0.578629 0.584404 0.182076 1.03733 NM_009370.2 TGFBR1 transforming growth factor, beta 1.091881 1.005272 1.024559 1.24505 (ALK5) receptor I NM_010296.2 GLI1 GLI-Kruppel family member GLI1 1.202765 0.587583 1.879333 1.169478 NM_029993.1 Mlana melan-A 0.363229 0.317839 0.34455 0.61259 NM_009640.3 ANGPT1 angiopoietin 1 0.309335 0.558083 0.808304 0.402088 NM_008816.2 PECAM1 platelet/endothelial cell adhesion 1.000219 1.019195 1.595884 1.206357 molecule 1 NM_010638 KLF-9 Kruppel-like factor 9 1.108882 1.096597 0.619882 0.588176 NM_011330.3 CCL11 chemokine (C-C motif) ligand 11 0.74805 1.011156 1.428584 0.610392 NM_008008.4 KGF fibroblast growth factor 7 0.66413 0.814812 1.356676 1.011362 (FGF7) NM_007987.2 FAS Fas (TNF receptor superfamily 0.482059 0.886083 0.957834 0.456364 member 6) NM_011488 STAT 5A signal transducer and activator of 0.781767 1.043411 0.924494 0.786155 transcription 5A NM_008036 FOSB FBJ osteosarcoma oncogene B 0.52427 0.49588 0.562765 0.468561 BC003806 STAT 3 signal transducer and activator of 0.903481 1.014231 0.678205 0.801492 transcription 3 NM_011952 MAPK3 mitogen-activated protein kinase 3 0.669488 0.992064 0.553663 0.610035 (1b) NM_007464 IAP2 intracisternal A particle 2 0.897358 0.903178 1.243896 0.923667 NM_008360.1 IL-18 interleukin 18 0.629251 0.846648 1.027115 0.944054 NM_010517 IGFBP4 insulin-like growth factor binding 0.811006 1.044133 0.837465 0.835327 protein 4 NM_009396.2 TNFAIP2 tumor necrosis factor, alpha-induced 1.362517 0.820266 0.973071 1.117801 protein 2 NM_016802 RHOA ras homolog gene family, member A 0.897189 0.894252 1.133156 1.211557 NM_008006.2 FGF2 fibroblast growth factor 2 1.11818 0.719789 1.409345 0.467684 NM_009367.3 TGFB2 transforming growth factor, beta 2 1.141916 1.096597 0.866636 0.981726 NM_011594 TIMP2 tissue inhibitor of metalloproteinase 2 0.656663 0.976303 1.102946 0.68267 NM_010197.3 FGF1 fibroblast growth factor 1 1.271444 0.853071 0.962985 1.246809 NM_011595.2 TIMP3 tissue inhibitor of metalloproteinase 3 0.953652 1.081293 1.029595 0.691683 NM_011144.6 PPAR peroxisome proliferator activated 1.227201 0.859424 1.228189 1.207679 receptor alpha NM_001127330.1 PPAR peroxisome proliferator activated 0.951977 0.809746 1.381111 1.150956 receptor gamma NM_009605 Adipoq adiponectin, C1Q and collagen 0.420466 0.858938 1.396699 0.220694 domain containing NM_021274.1 CXCL10 chemokine (C-X-C motif) ligand 10 0.304805 0.72315 0.61108 0.735198
(126) To further understand how ANGPTL4 improves the healing rate of diabetic wounds, we examined the time course expression of specific protein markers such as endothelial cell marker (CD31), alpha smooth muscle actin (SMA), cell proliferating marker (PCNA), and macrophage marker (F4/80) in ob/ob treated with ANGPTL4 compared with ob/+ and ob/ob using western blotting as described in Example 3. As expected, saline-treated ob/ob wounds displayed a reduced expression of CD31 and SMA since day 3 post wounding when compared with the normal ob/+ wounds (
(127) Consistent with the western blot data, immunofluorescence staining of CD31, as described in Example 3, on day 5 post wounded biopsies showed increase in endothelial vasculature in cANGPTL4-treated ob/ob wounds compared with saline-treated ob/ob wounds (
Example 5
(128) ANGPTL4 Regulate the NO Production Profile in Ob/Ob Wounds.
(129) To understand how ANGPTL4 modulate angiogenesis, we examined the level of NO, which is a potent mediator of angiogenesis. Our earlier focused gene array analysis also revealed that the expression of iNOS was dramatically increased in ANGPTL4-treated ob/ob wounds compared with saline treatment (see
(130) Intracellular level of NO from wound biopsies were measured using cell-permeable 4,5-diamino-fluorescein (DAF-FM diacetate) (Invitrogen, USA). Wound biopsies were lysed in Krebs buffer, and incubated with 10 M DAF-FM diacetate for 30 min at 37 C. in darkness. The fluorophore signal was recorded immediately at 495 nm excitation and 515 nm emission wavelengths using a GloMax 20/20 Luminometer (Promega, USA). Fluorescence was expressed as arbitrary fluorescence units (AU), and was measured with the same instrument settings for all experiments.
(131) Using DAF-FM diacetate, we compared the NO level in post-wound biopsies from saline- and ANGPTL4-treated ob/ob. We observed overall reduced NO level in ob/ob wounds when compared with ob/+ wounds (
Example 6
(132) ANGPTL4 Regulates iNOS Expression.
(133) ANGPTL4.sup./ mice showed impaired angiogenesis during wound healing. Diabetic wounds are characterized by poor wound-related angiogenesis.sup.1, which similarly expressed low level of ANGPTL4 protein (
Example 7
(134) ANGPTL4 Reduce Collagen Deposition in Ob/Ob Wounds.
(135) Delayed diabetic wound healing lead to excessive production and deposition of collagen at the wound bed, which at least in part may be attributed to reduce NO level. Studies have shown that expression of NOS and NO production are decreased in human hypertrophic scar and diabetic wounds.sup.27,28. To address whether ANGPTL4 may influence the level of scarring, we measure collagen deposition in the saline- and cANGPTL4-treated ob/ob wounds. First, we measured the amount of hydroxyproline, a major component of collagen, from each wound biopsies of saline-treated and ANGPTL4-treated ob/ob wounds.
(136) Hydroxyproline Assay.
(137) Wound biopsies were frozen in liquid nitrogen, and then homogenized thoroughly in distilled water. The net weight of the wound biopsies was predetermined for normalization. In addition, trans-4-hydroxy-L-proline (0-300 g/mL) was included as standards. Aliquots of samples (50 L) were hydrolyzed in 2 N NaOH at 120 C. for 2 hours, and then oxidized with chloramine-T reagent (0.0127 g/mL) for 25 min at room temperature. The chromophore was then developed with the addition of p-dimethylaminobenzaldehyde (DMBA) reagent (0.3 g/mL dissolved in methanol/hydrochloric acid solution (2:1 v/v)). The absorbance of reddish hue complex formed was measured at 550 nm using SpectraMax M2e Multi-Mode Microplate Reader and SoftMax Pro Microplate Data Acquisition & Analysis Software (Molecular Devices, USA). Absorbance values were plotted against the concentration of standard hydroxyproline, and the value of unknown hydroxyproline were then determined from the standard curve.
(138) We detected a reduced level of hydroxyproline only with wound biopsies at day 10 post-injury, where complete wound closure was observed in ANGPTL4-treated wounds (
(139) Next, we co-treated ob/ob wounds with ANGPTL4 and aminoguanidine, a selective inhibitor of iNOS. Consistent with our above findings, wound re-epithelialisation was delayed (
Example 8
(140) Reagents.
(141) Antibodies used: Ki67 and keratin 6 (NovoCastra); PCNA (PC10) and SMA (alpha-SM1) (Santa Cruz Biotechnology); CD31 (BD Pharmingen); CD68 (FA-11) (Biolegend); F4/80 (AbD Serotec); cANGPTL4: monoclonal antibodies against the C-terminal mouse (190-410 amino acids) of ANGPTL4 were produced by ProSci, respectively; goat anti-rabbit and anti-mouse IgG-HRP (Santa Cruz Biotechnology); Alexa Fluor 488 or 594 goat anti-mouse IgG, anti-rat IgG and anti-rabbit IgG (Molecular probes). DAB peroxidase substrate kit (Vector Laboratories). Unless mentioned otherwise, all chemicals were from Sigma-Aldrich and molecular biology enzymes from Fermentas. All oligonucleotides were synthesized by Sigma-Proligo.
Example 9
(142) Assessment of Wound Healing.
(143) Images of wounds were captured at Day 1, 3, 5, 7 and 10 post-wounding using a Canon G12 digital camera. A ruler was included in each image to allow standard calibration of measurements. Surface wound area was quantified using Image-Pro Plus version 5.1.0.20 software (Media Cybernetics, USA). Surface wound area at each time point were standardized and expressed as a percentage of initial wound area at Day 1 (100%). Histomorphometric measurement was made from sections through the center of the wound to obtain the actual wound representation. Sections of wound biopsies over the indicated time were stained by haematoxylin-eosin staining. Histological images were visualized with Nikon Eclipse 90i brightfield microscope using a Plan Fluor, 10/0.30 objective and taken with QCapture Pro version 5.0.1.26 software (QImaging). The measurements were performed three times from random sections using Adobe Photoshop CS5.1 and image pixel was calibrated to m using the scale bar.
(144) By comprising it is meant including, but not limited to, whatever follows the word comprising. Thus, use of the term comprising indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present.
(145) By consisting of is meant including, and limited to, whatever follows the phrase consisting of. Thus, the phrase consisting of indicates that the listed elements are required or mandatory, and that no other elements may be present.
(146) The inventions illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms comprising, including, containing, etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
(147) By about in relation to a given numberical value, such as for temperature and period of time, it is meant to include numerical values within 10% of the specified value.
(148) The invention has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
(149) Other embodiments are within the following claims and non-limiting examples. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
REFERENCES
(150) 1. Brem H and Tomic-Canic M, Cellular and molecular basis of wound healing in diabetes. J Clin Invest. 2007; 117: 1219-1222. 2. Delmas L, Best practice in the assessment and management of diabetic foot ulcers. Rehabil Nurs. 2006; 31: 228-234. 3. Werner S and Grose R, Regulation of wound healing by growth factors and cytokines. Physiol Rev. 2003; 83: 835-870. 4. Coulombe P A, Wound epithelialization: accelerating the pace of discovery. J Invest Dermatol. 2003; 121: 219-230. 5. Falanga V, Wound healing and its impairment in the diabetic foot. Lancet. 2005; 366: 1736-1743. 6. Blakytny R and Jude E B, Altered molecular mechanisms of diabetic foot ulcers. Int J Low Extrem Wounds. 2009; 8: 95-104. 7. Sharma A, Singh A K, Warren J, Thangapazham R L and Maheshwari R K, Differential regulation of angiogenic genes in diabetic wound healing. J Invest Dermatol. 2006; 126: 2323-2331. 8. Galkowska H, Wojewodzka U and Olszewski W L, Chemokines, cytokines, and growth factors in keratinocytes and dermal endothelial cells in the margin of chronic diabetic foot ulcers. Wound Repair Regen. 2006; 14: 558-565. 9. Chong H C, Tan C K, Huang R L and Tan N S, Matricellular proteins: a sticky affair with cancers. Journal of oncology. 2012; 2012: 351089. 10. Bornstein P, Matricellular proteins: an overview. Matrix Biol. 2000; 19: 555-556. 11. Bornstein P and Sage E H, Matricellular proteins: extracellular modulators of cell function. Curr Opin Cell Biol. 2002; 14: 608-616. 12. Zhu P, Goh Y Y, Chin H F A, Kersten S and Tan N S, Angiopoietin-like 4: a decade of research. Biosci Rep. 2012; 32: 211-219. 13. Huang R L, Teo Z, Chong H C, Zhu P, Tan M J and Tan C K et al., ANGPTL4 modulates vascular junction integrity by integrin signaling and disruption of intercellular VE-cadherin and claudin-5 clusters. Blood. 2011; 118: 3990-4002. 14. Le Jan S, Amy C, Cazes A, Monnot C, Lamand N and Favier J et al., Angiopoietin-like 4 is a proangiogenic factor produced during ischemia and in conventional renal cell carcinoma. Am J Pathol. 2003; 162: 1521-1528. 15. Ito Y, Oike Y, Yasunaga K, Hamada K, Miyata K and Matsumoto S I et al., Inhibition of angiogenesis and vascular leakiness by angiopoietin-related protein 4. Cancer Res. 2003; 63: 6651-6657. 16. Goh Y Y, Pal M, Chong H C, Zhu P, Tan M J and Punugu L et al., Angiopoietin-like 4 interacts with matrix proteins to modulate wound healing. J Biol Chem. 2010; 285: 32999-33009. 17. Goh Y Y, Pal M, Chong H C, Zhu P, Tan M J and Punugu L et al., Angiopoietin-Like 4 Interacts with Integrins {beta}1 and {beta}5 to Modulate Keratinocyte Migration. Am J Pathol. 2010; 177: 2791-2803. 18. Chin L C, Kumar P, Palmer J A, Rophael J A, Dolderer J H and Thomas G P L et al., The influence of nitric oxide synthase 2 on cutaneous wound angiogenesis. Br J Dermatol. 2011; 165: 1223-1235. 19. Schffer M R, Tantry U, Efron P A, Ahrendt G M, Thornton F J and Barbul A, Diabetes-impaired healing and reduced wound nitric oxide synthesis: a possible pathophysiologic correlation. Surgery. 1997; 121: 513-519. 20. Luo J D and Chen A F, Nitric oxide: a newly discovered function on wound healing. Acta Pharmacol Sin. 2005; 26: 259-264. 21. Zhu P, Tan M J, Huang R L, Tan C K, Chong H C and Pal M et al., Angiopoietin-like 4 protein elevates the prosurvival intracellular O2():H.sub.2O.sub.2 ratio and confers anoikis resistance to tumors. Cancer Cell. 2011; 19: 401-415. 22. Aktan F, iNOS-mediated nitric oxide production and its regulation. Life Sci. 2004; 75: 639-653. 23. Kuwano Y, Rabinovic A, Srikantan S, Gorospe M and Demple B, Analysis of nitric oxide-stabilized mRNAs in human fibroblasts reveals HuR-dependent heme oxygenase 1 upregulation. Mol Cell Biol. 2009; 29: 2622-2635. 24. Wang S, Zhang J, Theel S, Barb J J, Munson P J and Danner R L, Nitric oxide activation of Erk1/2 regulates the stability and translation of mRNA transcripts containing CU-rich elements. Nucleic Acids Res. 2006; 34: 3044-3056. 25. Tan C K, Leuenberger N, Tan M J, Yan Y W, Chen Y and Kambadur R et al., Smad3 deficiency in mice protects against insulin resistance and obesity induced by a high-fat diet. Diabetes. 2011; 60: 464-476. 26. Tan N S, Michalik L, Di-Po N, Ng C Y, Mermod N and Roberts A B et al., Essential role of Smad3 in the inhibition of inflammation-induced PPARbeta/delta expression. EMBO J. 2004; 23: 4211-4221. 27. Wang R, Ghahary A, Shen Y J, Scott P G, Tredget E E. Nitric oxide synthase expression and nitric oxide production are reduced in hypertrophic scar tissue and fibroblasts. J Invest Dermatol. 1997; 108: 438-44. 28. Luo, J D. and Chen, A. F. Nitric oxide: a newly discovered function on wound healing. Acta Pharmacol. Sin. 2005; 26, 259-264.