Genetic targeting in non-conventional yeast using an RNA-guided endonuclease

10513711 ยท 2019-12-24

Assignee

Inventors

Cpc classification

International classification

Abstract

Non-conventional yeasts are disclosed herein comprising at least one RNA-guided endonuclease (RGEN) comprising at least one RNA component that does not have a 5-cap. This uncapped RNA component comprises a sequence complementary to a target site sequence in a chromosome or episome in the yeast. The RGEN can bind to, and optionally cleave, one or both DNA strands at the target site sequence. An example of an RGEN herein is a complex of a Cas9 protein with a guide RNA. A ribozyme is used in certain embodiments to provide an RNA component lacking a 5-cap. Further disclosed are methods of genetic targeting in non-conventional yeast.

Claims

1. A non-conventional yeast comprising a Cas endonuclease and a polynucleotide sequence, wherein said polynucleotide sequence comprises an RNA polymerase (II) promoter operably linked to a first DNA sequence encoding a ribozyme and a second DNA sequence encoding an RNA component, wherein said first DNA sequence is located 5 (upstream) of said second DNA sequence, and wherein said polynucleotide sequence does not comprise a third DNA sequence encoding a ribozyme located 3 (downstream) from the second DNA sequence, wherein said RNA component comprises a variable targeting domain complementary to a target site sequence on a chromosome or episome in the yeast, and wherein the RNA component and the Cas endonuclease can form a RNA-guided endonuclease (RGEN), wherein said RGEN can bind to the target site sequence.

2. The non-conventional yeast of claim 1, wherein the RGEN can bind to and cleave the target site sequence.

3. The non-conventional yeast of claim 1, wherein said yeast is a member of a genus selected from the group consisting of Yarrowia, Pichia, Schwanniomyces, Kluyveromyces, Arxula, Trichosporon, Candida, Ustilago, Torulopsis, Zygosaccharomyces, Trigonopsis, Cryptococcus, Rhodotorula, Phaffia, Sporobolomyces, and Pachysolen.

4. The non-conventional yeast of any one of claims 1 to 3, wherein the RGEN comprises a CRISPR (clustered regularly interspaced short palindromic repeats)-associated (Cas) protein-9 (Cas9) amino acid sequence.

5. The non-conventional yeast of any one of claims 1 to 3, wherein the RNA transcribed from the nucleotide sequence autocatalytically removes the ribozyme to yield said RNA component, wherein said RNA component does not have a 5 cap.

6. The non-conventional yeast of claim 5, wherein the ribozyme is a hammerhead ribozyme, hepatitis delta virus ribozyme, group I intron ribozyme, RnaseP ribozyme, or hairpin ribozyme.

7. The non-conventional yeast of any one of claims 1 to 3, wherein the RNA transcribed from the nucleotide sequence does not autocatalytically remove the ribozyme, wherein said ribozyme cleaves any RNA sequence 5 of itself and yields a ribozyme-RNA component fusion molecule without a 5 cap.

8. A method for modifying a target site on a chromosome or episome in a non-conventional yeast, the method comprising providing to a non-conventional yeast a first recombinant DNA construct comprising a DNA sequence encoding a Cas endonuclease, and a second recombinant DNA construct comprising an RNA polymerase (II) promoter operably linked to a DNA sequence encoding a ribozyme upstream of an RNA component, wherein the second recombinant DNA construct does not comprise a ribozyme sequence located downstream from the ribozyme-RNA component, wherein the RNA transcribed from the second recombinant DNA construct autocatalytically removes the ribozyme to yield said RNA component, wherein the Cas endonuclease introduces a single or double-strand break at said target site.

9. The method of claim 8, further comprising identifying at least one non-conventional yeast cell that has a modification at said target, wherein the modification includes at least one deletion, addition or substitution of one or more nucleotides in said target site.

10. The method of claim 8, further comprising providing a donor DNA to said yeast, wherein said donor DNA comprises a polynucleotide of interest.

11. The method of claim 9, further comprising identifying at least one yeast cell comprising in its chromosome or episome the polynucleotide of interest integrated at said target site.

Description

BRIEF DESCRIPTION OF THE DRAWINGS AND SEQUENCES

(1) FIG. 1: A structural model of a single guide polynucleotide such as a single guide RNA (sgRNA). A variable targeting (VT) domain is shown in gray. A Cas9 endonuclease recognition (CER) domain is shown in black.

(2) FIG. 2A: Yarrowia codon-optimized Cas9 expression cassette. FBA1 promoter is shown in black, and an open reading frame encoding Cas9 with a C-terminal SV40 nuclear localization signal (NLS) is shown in light grey.

(3) FIG. 2B: Yarrowia-optimized pre-sgRNA RGR expression cassette (RGR, ribozyme-sgRNA-ribozyme). FBA1 promoter is shown in black, hammerhead (HH) ribozyme is shown in dark grey, single guide RNA (sgRNA) is shown in light grey, and the HDV ribozyme is shown with vertical stripes.

(4) FIG. 2C: Yarrowia-optimized pre-sgRNA RG expression cassette (RG, ribozyme-sgRNA). FBA1 promoter is shown in black, hammerhead (HH) ribozyme is shown in dark grey, single guide RNA (sgRNA) is shown in light grey, and the Sup4 terminator is shown with vertical stripes.

(5) FIG. 3A: pZUFCas9 (SEQ ID NO: 14) plasmid contains the Yarrowia codon-optimized Cas9 expression cassette indicated in FIG. 2A. Origins of replication (ARS 18, f1 ori, ColE1) are in cross-hatch, and selectable markers (Ura3, Amp) are in grey.

(6) FIG. 3B: pZUFCas9/PolIII-sgRNA plasmid contains the Yarrowia codon-optimized Cas9 expression cassette indicated in FIG. 2A, and the Yl Snr52 (Pol III promoter, indicated as Yl52)-sgRNA expression cassette for targeting Leu2-3 in Yarrowia. Though not shown, the sgRNA cassette also contained a Saccharomyces cerevisiae Sup4 gene transcription terminator sequence. Origins of replication (ARS 18, f1 ori, ColE1) are in cross-hatch, and selectable markers (Ura3, Amp) are in grey.

(7) FIG. 3C: pRF38 plasmid (SEQ ID NO:19) contains a Yarrowia-optimized pre-sgRNA expression cassette (FBA1 promoter in white, RGR pre-sgRNA in diagonal stripes) of SEQ ID NO:18 for targeting the CAN1 gene in Y. lipolytica. Origins of replication (ARS 18, f1 ori, ColE1) are in cross-hatch, and selectable markers (Ura3, Amp) are in grey.

(8) FIG. 4B: Transient targeting efficiency in Y. lipolytica cells transformed with (i) pZUFCas9 (SEQ ID NO:14) alone or (ii) pZUFCas9 and a linear DNA comprising the Yarrowia-optimized pre-sgRNA expression cassette of SEQ ID NO:18 (refer to Example 3). The y axis indicates the frequency of cells transformed with pZUFCas9 (i.e., Ura.sup.+ cells) that are also canavanine-resistant (Can.sup.R). Error bars indicate standard deviation.

(9) FIG. 5: Sequence maps of Cas9/sgRNA cleavage sites in the CAN1 coding region of Y. lipolytica cells transformed with pZUFCas9 (SEQ ID NO:14) and a linear DNA comprising the Yarrowia-optimized pre-sgRNA expression cassette of SEQ ID NO:18 (refer to Example 3). With reference to the wild type (WT) CAN1 sequence, the Can1-1 target site sequence is shown in bold and the PAM sequence is underlined. The predicted cleavage site is immediately 5 of the third nucleotide upstream of the PAM. Inserted nucleotides are italicized. The number and frequency of each class of mutants (1-18) are represented on the right hand side. The sequences shown in this figure are included in the Sequence Listing as SEQ ID NOs:71-89, as numbered in the figure.

(10) FIG. 6: Transient targeting efficiency in Y. lipolytica cells transformed with (i) pZUFCas9 (SEQ ID NO:14) alone, (ii) pZUFCas9 and a linear DNA comprising the Yarrowia-optimized pre-sgRNA expression cassette of SEQ ID NO:18 (RGR), or (iii) pZUFCas9 and a linear DNA comprising the Yarrowia-optimized pre-sgRNA expression cassette of SEQ ID NO:25 (RG) (refer to Example 4). The y axis indicates the frequency of cells transformed with pZUFCas9 (i.e., Ura.sup.+ cells) that are also canavanine-resistant (Can.sup.R). Error bars indicate standard deviation.

(11) FIG. 7: Comparison of mutation frequency by HR and NHEJ DNA repair pathways. The total frequency of Cas9/sgRNA-mediated DNA double-strand break repair by HR (dark grey) and NHEJ (light grey), when polynucleotide modification template DNA sequences were provided in the transformation, was determined (refer to Example 5). Error bars indicate standard deviation.

(12) FIG. 8: Frequency of HR at a Cas9/sgRNA-mediated DNA double-strand break site by type of polynucleotide modification template DNA sequence. HR frequency using the point mutation template DNA(dark grey), frameshift template DNA (light grey), and large deletion template DNA (white) are shown (refer to Example 5). Error bars indicate standard deviation.

(13) FIG. 9: Mutation frequency at the CAN1 locus in Yarrowia (repair at the Can1-1 site cleaved by Cas9/sgRNA) is not affected by the presence of polynucleotide modification template DNA. Canavanine-resistance frequency of cells resulting from transformations not including polynucleotide modification template DNA(dark grey, no template DNA) or including polynucleotide modification template DNA(light grey, with template DNA) (both transformation groups included pZUFCas9 (SEQ ID NO:14) and the RGR expression cassette [SEQ ID NO:18]) (refer to Example 5). The y axis indicates the frequency of cells transformed with pZUFCas9 (i.e., Ura.sup.+ cells) that are also canavanine-resistant (Can.sup.R). Error bars indicate standard deviation.

(14) FIG. 10A: pRF84 plasmid (SEQ ID NO:41) contains the Yarrowia codon-optimized Cas9 expression cassette indicated in FIG. 2A and the Yarrowia-optimized RGR pre-sgRNA cassette of SEQ ID NO:18 (RGR pre-sgRNA coding region [Can1 RGR] shown with diagonals lines). Origins of replication (ARS 18, f1 ori, ColE1) are in cross-hatch, and selectable markers (Ura3, Amp) are in grey.

(15) FIG. 10B: pRF85 plasmid (SEQ ID NO:42) contains the Yarrowia codon-optimized Cas9 expression cassette indicated in FIG. 2A and the Yarrowia-optimized RG pre-sgRNA cassette of SEQ ID NO:25 (RG pre-sgRNA coding region [Can1 RG] shown with diagonals lines). Origins of replication (ARS 18, f1 ori, ColE1) are in cross-hatch, and selectable markers (Ura3, Amp) are in grey.

(16) FIG. 11: Mutation frequency at the CAN1 locus in Yarrowia by expressing Cas9 alone (pZUFCas9, SEQ ID NO:14), or expressing (i) Cas9 and (ii) RGR pre-sgRNA (pRF84) or RG sgRNA (pRF85) (refer to Example 6). The y axis indicates the frequency of cells transformed with each respective vector (i.e., Ura.sup.+ cells) that are also canavanine-resistant (Can.sup.R). Error bars indicate standard deviation.

(17) FIG. 12A-12B: Example of a high-throughput cloning cassette to construct HDV-sgRNA fusion expression cassettes. FIG. 12-A illustrates in a black box a promoter sequence, in a gray box a DNA sequence encoding a HDV ribozyme, in the horizontally hatched box is a counterselectable marker for the cloning strain flanked by Type IIs restriction sites, in the black dotted box is the CER domain of the sgRNA for interaction with Cas9, and in the diagonally hatched box is the transcriptional terminator. When a DNA duplex containing a DNA sequence encoding a variable targeting domain and the appropriate overhangs for the Typells restriction sites (vertically hatched box VT) is mixed with a plasmid, DNA Ligase, and the Typells enzyme, the DNA sequence encoding a variable targeting domain (VT) will replace the counterselectable marker, thereby creating the HDV-sgRNA expression cassette (Promoter-HDV-VT-CER-Terminator). When the HDV-sgRNA expression cassette is transcribed, it produces an RNA transcript (HDV-VT-CER transcript) of which the HDV ribozyme cleaves off any 5 sequences. FIG. 12-B shows an example of a duplex DNA molecule (oligoduplex of SEQ ID NO: 99 and SEQ ID NO: 100) containing a DNA sequence encoding the Can1-1 target site and the appropriate overhangs for cloning into plasmid pRF291.

(18) FIG. 13A-13B: Example of a high-throughput cloning cassette to construct HH-sgRNA expression cassettes. FIG. 13-shows in a black box the promoter sequence; in the horizontally hatched box is a counterselectable marker for the cloning strain flanked by Type IIs restriction sites; in the black dotted box is the CER domain of the sgRNA for interaction with Cas9, in the diagonally hatched box is the transcriptional terminator. When a DNA duplex containing the target-site specific hammerhead ribozyme encoding DNA (Vertically hatched box HH, the targeting sequence and the appropriate overhangs for the Typells sites (dotted box TS) is mixed with the plasmid, DNA Ligase and the Type-II enzyme, the HH-target site duplex replaces the counterselectable marker, creating the HH-sgRNA expression cassette. When the expression cassette is transcribed, it produces a transcript and the HH ribozyme cleaves off itself and any 5 sequences. FIG. 13B shows an example of a duplex DNA molecule (of SEQ ID NO: 162 and SEQ ID NO: 163) containing a variable targeting domain for targeting the ds-temp-1 target site (VT) and the sequence specific HH ribozyme encoding DNA (HH), and the appropriate overhangs for cloning into plasmid pRF291.

(19) FIG. 14: Example of Gel electrophoresis of Can1 locus from cells transformed with pRF303 (SEQ ID NO: 103) and Can1 short editing template (SEQ ID NO: 157). Lane marked MW is the molecular weight marker. Lanes 1-16 represent individual colonies from streak purified transformants. The higher MW band is the correct size for the WT Can1 locus (SEQ ID NO: 160) or the Can1 locus with small indel mutations. The smaller molecular weight band is the correct size for the Can1 locus edited (SEQ ID NO: 161) with the short Can1 editing template (SEQ ID NO: 157).

(20) FIG. 15 shows a representative sequencing result of the plasmid and genomic URA3 genes from colony PCR and their alignment. Dash and bold indicate deletions and insertions, respectively. PAM sequence is underlined.

(21) FIG. 16-A shows relative positions of the targeting sequences for the RGR-URA3.1, RGR-URA3.2, and RGR-URA3.3 within the Yarrowia URA3 gene. FIG. 16-B shows the sequencing result and sequence alignment of the colony PCR of the pYRH222 transformants that were grown on SC medium containing 5-FOA. Bold indicates insertions. PAM sequence is underlined. The Ns represent mixed sequences. FIG. 16-C shows the sequencing result and sequence alignment of the colony PCR of the pYRH282 transformants that were grown on SC medium containing 5-FOA. Dashed line indicates deletion. PAM sequence is underlined. The Ns represent mixed sequences. FIG. 16-D shows the sequencing result and sequence alignment of the colony PCR of the pYRH283 transformants that were grown on SC medium containing 5-FOA. Dashed line indicates deletion. PAM sequence is underlined. The Ns represent mixed sequences.

(22) FIG. 17 shows different migration of PCR products from pYRH282 (colony ID. 23 and 24) and pYRH283 (colony ID. 27 and 36) transformants. DNA size from ladder is indicated on the right.

(23) FIG. 18 shows a representative sequencing result of the Can1 target sequences. Dash indicates deletions, respectively. PAM sequence is indicated in bold.

(24) TABLE-US-00001 TABLE 1 Summary of Nucleic Acid and Protein SEQ ID Numbers Nucleic acid Protein Description SEQ ID NO. SEQ ID NO. Cas9 endonuclease recognition (CER) domain of a gRNA. 1 (80 bases) Y. lipolytica Leu2-1 target site, or alternatively, 2 (20 bases) DNA encoding Leu2-1 variable target domain of a gRNA. Y. lipolytica Leu2-2 target site, or alternatively, 3 (20 bases) DNA encoding Leu2-2 variable target domain of a gRNA. Y. lipolytica Leu2-3 target site, or DNA encoding 4 (20 bases) Leu2-2 variable target domain of a gRNA. S. cerevisiae Snr52 promoter. 5 (300 bases) S. cerevisiae Rpr1 promoter. 6 (300 bases) Y. lipolytica Snr52 promoter. 7 (300 bases) S. cerevisiae Sup4 terminator. 8 (20 bases) Streptococcus pyogenes Cas9 open reading frame 9 (4107 bases) codon-optimized for expression in Y. lipolytica. Streptococcus pyogenes Cas9 including C-terminal 10 (4140 bases) 11 (1379 aa) linker and SV40 NLS (Cas9-NLS); open reading frame codon-optimized for expression in Y. lipolytica. Y. lipolytica FBA1 promoter. 12 (543 bases) Cas9-NLS expression cassette (promoter and 13 (4683 bases) Cas9-NLS open reading frame). pZUFCas9 plasmid. 14 (10706 bases) Hammerhead (HH) ribozyme. 15 (43 bases) HDV ribozyme. 16 (68 bases) Y. lipolytica Can1-1 target site, or alternatively, 17 (20 bases) DNA encodinq Can1-1 variable target domain of a gRNA. FBA1 promoter: HH-sgRNA-HDV (RGR) pre-sgRNA expression 18 (760 bases) cassette, or alternatively, RGR expression cassette. pRF38 plasmid. 19 (6793 bases) RGR forward PCR primer. 20 (19 bases) RGR reverse PCR primer. 21 (19 bases) CAN1 forward PCR primer. 22 (20 bases) CAN1 reverse PCR primer. 23 (21 bases) CAN1 sequencing primer. 24 (21 bases) FBA1 promoter: HH-sgRNA-Sup4 terminator (RG) 25 (709 bases) pre-sgRNA expression cassette, or alternatively, RG expression cassette. Poly-A. 26 (10 bases) Poly-T. 27 (10 bases) CAN1 frameshift template DNA. 28 (100 bases) CAN1 frameshift template DNA complement. 29 (100 bases) CAN1 point mutation template DNA. 30 (106 bases) CAN1 point mutation template DNA complement. 31 (106 bases) CAN1 upstream template arm. 32 (655 bases) Forward PCR primer for amplifying CAN1 upstream 33 (29 bases) template arm. Reverse PCR primer for amplifying CAN1 34 (37 bases) upstream template arm. CAN1 downstream template arm. 35 (658 bases) Forward PCR primer for amplifying CAN1 36 (37 bases) downstream teamplate DNA arm. Reverse PCR primer for amplifying CAN1 37 (22 bases) downstream template DNA arm. CAN1 large deletion template DNA. 38 (1276 bases) RG/RGR forward PCR primer. 39 (31 bases) RG/RGR reverse PCR primer. 40 (29 bases) pRF84 plasmid. 41 (11568 bases) pRF85 plasmid. 42 (11507 bases) RNA loop-forming seguence (GAAA). 43 (4 bases) RNA loop-forming seguence (CAAA). 44 (4 bases) RNA loop-forming seguence (AAAG). 45 (4 bases) Example of a Cas9 target site: PAM sequence. 46 (23 bases) PAM sequence NGG. 47 (3 bases) PAM sequence NNAGAA. 48 (6 bases) PAM sequence NNAGAAW. 49 (7 bases) PAM sequence NGGNG. 50 (5 bases) PAM sequence NNNNGATT. 51 (8 bases) PAM sequence NAAAAC. 52 (6 bases) PAM sequence NG. 53 (2 bases) TracrRNA mate sequence example 1. 54 (22 bases) TracrRNA mate sequence example 2. 55 (15 bases) TracrRNA mate sequence example 3. 56 (12 bases) TracrRNA mate sequence example 4. 57 (13 bases) TracrRNA example 1. 58 (60 bases) TracrRNA example 2. 59 (45 bases) TracrRNA example 3. 60 (32 bases) TracrRNA example 4. 61 (85 bases) TracrRNA example 5. 62 (77 bases) TracrRNA example 6. 63 (65 bases) gRNA example 1. 64 (131 bases) gRNA example 2. 65 (117 bases) gRNA example 3. 66 (104 bases) gRNA example 4. 67 (99 bases) gRNA example 5. 68 (81 bases) gRNA example 6. 69 (68 bases) gRNA example 7. 70 (100 bases) WT sequence shown in FIG. 5. 71 Sequence 1 shown in FIG. 5. 72 Sequence 2 shown in FIG. 5. 73 Sequence 3 shown in FIG. 5. 74 Sequence 4 shown in FIG. 5. 75 Sequence 5 shown in FIG. 5. 76 Sequence 6 shown in FIG. 5. 77 Sequence 7 shown in FIG. 5. 78 Sequence 8 shown in FIG. 5. 79 Sequence 9 shown in FIG. 5. 80 Sequence 10 shown in FIG. 5. 81 Sequence 11 shown in FIG. 5. 82 Sequence 12 shown in FIG. 5. 83 Sequence 13 shown in FIG. 5. 84 Sequence 14 shown in FIG. 5. 85 Sequence 15 shown in FIG. 5. 86 Sequence 16 shown in FIG. 5. 87 Sequence 17 shown in FIG. 5. 88 Sequence 18 shown in FIG. 5. 89 Primer Aarl-removal-1 90 Primer Aarl-removal-2 91 Plasmid pRF109 92 modified Aar1- Cas9 gene 93 Plasmid pRF141 94 High throughput cloning cassette 95 yI52 promoter 96 Escherichia coli counterselection cassette rpsL 97 Plasmid pRF291 98 Oligonucleotide Can1-1F 99 Oligonucleotide Can1-1R 100 Can1-1 target site and PAM sequence 101 Recombinant HDV-sgRNA expression cassette for 102 targeting Can1-1 Plasmid pRF303 103 HDV ribozyme-guide RNA 104 Can1 gene from Yarrowia lipolytica 105 Can1-2 target site 106 Sou2-1 target site 107 Sou2-2 target site 108 Variable targeting domain of Can1-2 109 Variable targeting domain of Sou2-1 110 Variable targeting domain of Sou2-2 111 Tgl1-1 target site 112 Acos10-1 target site 113 Fat1-1 target site 114 Variable targeting domain of ura3-1 115 URa3-1 target site 116 Cas9-SV40 NLS D10A H840A 117 Primer D10AF 118 Primer D10AR 119 Yarrowia optimized Cas9 D10A gene 120 Plasmid pRF111 121 Primer H840A1 122 Primer H840A2 123 Yarrowia codon optimized inactivated Cas9 gene 124 pRF143 125 Yarrowia optimized dsREDexpress ORF 126 Yarrowia optimized dsREDexpress cloning 127 fragment FBA1-dsREDexpress expression cassette 128 pRF165 129 FBA1 Yarrowia dsREDexpress cassette from 130 pRF165 on Pmel Notl fragment p2PO69 integration vector 131 pRF201 132 Ascl/Sphl integration fragment from pRF201 133 HY026 134 HY027 135 pRF169 136 GPD Promoter 137 GPD promoter-counterselectable marker-CER- 138 terminator ds-temp-1 target site 139 ds-temp-2 target site 140 ds-nontemp-3 target site 141 Hammerhead ribozyme-VTD fusion 142 Hammerhead ribozyme-VTD fusion 143 ds-temp-1F 144 ds-temp-1R 145 ds-temp-2F 146 ds-temp-2R 147 ds-nontemp-1F 148 ds-nontemp-1R 149 pRF296 150 pRF298 151 pRF300 152 pRF339 153 pRF341 154 pRF343 155 pRF80 156 short Can1 deletion editing template 157 Primer 80F 158 Primer 80R 159 Can1 locus WT (wild type) 160 Can1 Loci deletion strains 161 Forward Oligonucleotide of FIG. 13-B 162 Reverse Oligonucleotide of FIG. 13-B 163 pre-sgRNA URA3.1 (RGR-URA3.1) 164 URA3.1 target sequence 165 pre-sgRNA URA3.2 (RGR-URA3.2 166 URA3.2 target sequence 167 FBA1L promoter 168 acetohydroxyacid synthase gene 169 primer RHO705 170 primer RHO719 171 primer RHO733 172 primer RHO734 173 primer RHO707 174 fragment of wild type URA3 sequence 175 fragment of Plasmid URA3 from colony 1 176 fragment of Plasmid URA3 from colony 2 177 fragment of Plasmid URA3 from colony 3 178 fragment of Plasmid URA3 from colony 5 179 fragment of Plasmid URA3 from colony 6 180 fragment of Genomic URA3 from colony 1 181 fragment of Genomic URA3 from colony 2 182 fragment of Genomic URA3 from colony 3 183 fragment of Genomic URA3 from colony 5 184 fragment of Genomic URA3 from colony 6 185 hygromycin antibiotic resistant selection marker 186 TDH1 or GPD promoter 187 primer RHO804 188 primer RHO805 189 TDH1 promoter-RGR-URA3.3 fusion 190 pre-sgRNA URA3.3 (RGR-URA3.3) 191 primer RHO610 192 primer RHO611 193 primer RHO704 194 fragment of Wild type URA3 sequence 195 Fragment of URA3 sequence from colony 3 196 Fragment of URA3 sequence from colony 4 197 Fragment of URA3 sequence from colony 5 198 Fragment of URA3 sequence from colony 6 199 Fragment of URA3 sequence from colony 9 200 Fragment of URA3 sequence from colony 10 201 fragment of wild type URA3 sequence 202 Fragment of URA3 sequence from colony 23 203 Fragment of URA3 sequence from colony 24 204 fragment of wild type URA3 sequence 205 Fragment of URA3 sequence from colony 27 206 Fragment of URA3 sequence from colony 36 207 ARS18 sequence 208 Yarrowia codon optimized P. aeruginosa Csy4 209 Yarrowia FBA1 promoter 210 TDH1: 28 bp-gCAN1-28 bp 211 Csy4 recognition sequence 212 Csy4 recognition sequence flanked sgRNA 213 CAN1 target sequence 214 fragment of wild type CAN1 sequence 215 fragment of CAN1 from colony 14 216 fragment of CAN1 from colony 16 217 fragment of CAN1 from colony 18 218 fragment of CAN1 from colony 19 219 fragment of CAN1 from colony 24 220 fragment of CAN1 from colony 25 221 sgRNA processed by Csy4 222 5-flanking sequence after Csy4 cleavage 223 3-flanking sequence after Csy4 cleavage 224

DETAILED DESCRIPTION OF THE INVENTION

(25) The disclosures of all cited patent and non-patent literature are incorporated herein by reference in their entirety.

(26) As used herein, the term invention or disclosed invention is not meant to be limiting, but applies generally to any of the inventions defined in the claims or described herein. These terms are used interchangeably herein.

(27) The term non-conventional yeast herein refers to any yeast that is not a Saccharomyces (e.g., S. cerevisiae) or Schizosaccharomyces yeast species. Non-conventional yeast are described in Non-Conventional Yeasts in Genetics, Biochemistry and Biotechnology: Practical Protocols (K. Wolf, K. D. Breunig, G. Barth, Eds., Springer-Verlag, Berlin, Germany, 2003), which is incorporated herein by reference. Non-conventional yeast in certain embodiments may additionally (or alternatively) be yeast that favor non-homologous end-joining (NHEJ) DNA repair processes over repair processes mediated by homologous recombination (HR). Definition of a non-conventional yeast along these linespreference of NHEJ over HRis further disclosed by Chen et al. (PLoS ONE 8:e57952), which is incorporated herein by reference. Preferred non-conventional yeast herein are those of the genus Yarrowia (e.g., Yarrowia lipolytica). The term yeast herein refers to fungal species that predominantly exist in unicellular form. Yeast can alternative be referred to as yeast cells herein.

(28) The term RNA-guided endonuclease (RGEN) herein refers to a complex comprising at least one CRISPR (clustered regularly interspaced short palindromic repeats)-associated (Cas) protein and at least one RNA component. Briefly, an RNA component of an RGEN contains sequence that is complementary to a DNA sequence in a target site sequence. Based on this complementarity, an RGEN can specifically recognize and cleave a particular DNA target site sequence. An RGEN herein can comprise Cas protein(s) and suitable RNA component(s) of any of the four known CRISPR systems (Horvath and Barrangou, Science 327:167-170) such as a type I, II, or III CRISPR system. An RGEN in preferred embodiments comprises a Cas9 endonuclease (CRISPR II system) and at least one RNA component (e.g., a crRNA and tracrRNA, or a gRNA).

(29) The term CRISPR (clustered regularly interspaced short palindromic repeats) refers to certain genetic loci encoding factors of class I, II, or III DNA cleavage systems, for example, used by bacterial and archaeal cells to destroy foreign DNA (Horvath and Barrangou, Science 327:167-170). Components of CRISPR systems are taken advantage of herein for DNA targeting in non-conventional yeast cells.

(30) The terms type II CRISPR system and type II CRISPR-Cas system are used interchangeably herein and refer to a DNA cleavage system utilizing a Cas9 endonuclease in complex with at least one RNA component. For example, a Cas9 can be in complex with a CRISPR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA). In another example, a Cas9 can be in complex with a guide RNA. Thus, crRNA, tracrRNA, and guide RNA are non-limiting examples of RNA components herein.

(31) The term CRISPR-associated (Cas) endonuclease herein refers to a Cas protein encoded by a Cas gene. A Cas endonuclease, when in complex with a suitable RNA component, is capable of cleaving all or part of a specific DNA target sequence in certain embodiments. For example, it is can be capable of introducing a single- or double-strand break in a specific DNA target sequence; it can alternatively be characterized as being able to cleave one or both strands of a specific DNA target sequence. A Cas endonuclease unwinds the DNA duplex at the target sequence and cleaves at least one DNA strand, as mediated by recognition of the target sequence by a crRNA or guide RNA that is in complex with the Cas. Such recognition and cutting of a target sequence by a Cas endonuclease typically occurs if the correct protospacer-adjacent motif (PAM) is located at or adjacent to the 3 end of the DNA target sequence. Alternatively, a Cas protein herein may lack DNA cleavage or nicking activity, but can still specifically bind to a DNA target sequence when complexed with a suitable RNA component. A preferred Cas protein herein is Cas9.

(32) Cas9 (formerly referred to as Cas5, Csn1, or Csx12) herein refers to a Cas endonuclease of a type II CRISPR system that forms a complex with crRNA and tracrRNA, or with a guide RNA, for specifically recognizing and cleaving all or part of a DNA target sequence. Cas9 protein comprises an RuvC nuclease domain and an HNH (H-N-H) nuclease domain, each of which cleaves a single DNA strand at a target sequence (the concerted action of both domains leads to DNA double-strand cleavage, whereas activity of one domain leads to a nick). In general, the RuvC domain comprises subdomains I, II and III, where domain I is located near the N-terminus of Cas9 and subdomains II and Ill are located in the middle of the protein, flanking the HNH domain (Hsu et al, Cell 157:1262-1278). Apo-Cas9 refers to Cas9 that is not complexed with an RNA component. Apo-Cas9 can bind DNA, but does so in a non-specific manner, and cannot cleave DNA (Sternberg et al., Nature 507:62-67).

(33) In some embodiments, the Cas endonuclease can comprises a modified form of the Cas9 polypeptide. The modified form of the Cas9 polypeptide can include an amino acid change (e.g., deletion, insertion, or substitution) that reduces the naturally-occurring nuclease activity of the Cas9 protein. For example, in some instances, the modified form of the Cas9 protein has less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% of the nuclease activity of the corresponding wild-type Cas9 polypeptide (US patent application US20140068797 A1, published on Mar. 6, 2014). In some cases, the modified form of the Cas9 polypeptide has no substantial nuclease activity and is referred to as catalytically inactivated Cas9 or deactivated cas9 (dCas9). Catalytically inactivated Cas9 variants include Cas9 variants that contain mutations in the HNH and RuvC nuclease domains. These catalytically inactivated Cas9 variants are capable of interacting with sgRNA and binding to the target site in vivo but cannot cleave either strand of the target DNA. This mode of action, binding but not breaking the DNA can be used to transiently decrease the expression of specific loci in the chromosome without causing permanent genetic changes.

(34) A catalytically inactive Cas9 can be fused to a heterologous sequence (US patent application US20140068797 A1, published on Mar. 6, 2014). Suitable fusion partners include, but are not limited to, a polypeptide that provides an activity that indirectly increases transcription by acting directly on the target DNA or on a polypeptide (e.g., a histone or other DNA-binding protein) associated with the target DNA. Additional suitable fusion partners include, but are not limited to, a polypeptide that provides for methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitinating activity, adenylation activity, deadenylation activity, SUMOylating activity, deSUMOylating activity, ribosylation activity, deribosylation activity, myristoylation activity, or demyristoylation activity. Further suitable fusion partners include, but are not limited to, a polypeptide that directly provides for increased transcription of the target nucleic acid (e.g., a transcription activator or a fragment thereof, a protein or fragment thereof that recruits a transcription activator, a small molecule/drug-responsive transcription regulator, etc.). A catalytically inactive Cas9 can also be fused to a Fokl nuclease to generate double strand breaks (Guilinger et al. Nature biotechnology, volume 32, number 6, June 2014).

(35) The term RNA component herein refers to an RNA component of an RGEN containing a ribonucleic acid sequence that is complementary to a strand of a DNA target sequence. This complementary sequence is referred to herein as a guide sequence or variable targeting domain sequence. Examples of suitable RNA components herein include crRNA and guide RNA. Also, an RNA component herein does not have a 5-cap.

(36) The term CRISPR RNA (crRNA) herein refers to an RNA sequence that can form a complex with one or more Cas proteins (e.g., Cas9) and provides DNA binding specificity to the complex. A crRNA provides DNA binding specificity since it contains guide sequence (variable targeting domain [VT]) that is complementary to a strand of a DNA target sequence. A crRNA further comprises a repeat sequence (tracr RNA mate sequence) encoded by a repeat region of the CRISPR locus from which the crRNA was derived. A repeat sequence of a crRNA can anneal to sequence at the 5-end of a tracrRNA. crRNA in native CRISPR systems is derived from a pre-crRNA transcribed from a CRISPR locus. A pre-crRNA comprises spacer regions and repeat regions; spacer regions contain unique sequence complementary to a DNA target site sequence. Pre-crRNA in native systems is processed to multiple different crRNAs, each with a guide sequence along with a portion of repeat sequence. CRISPR systems utilize crRNA, for example, for DNA targeting specificity.

(37) The term trans-activating CRISPR RNA (tracrRNA) herein refers to a non-coding RNA used in type II CRISPR systems, and contains, in the 5-to-3 direction, (i) a sequence that anneals with the repeat region of CRISPR type II crRNA and (ii) a stem loop-containing portion (Deltcheva et al., Nature 471:602-607).

(38) The terms guide RNA (gRNA) and single guide RNA (sgRNA) are used interchangeably herein. A gRNA herein may refer to a chimeric sequence containing a crRNA operably linked to a tracrRNA. Alternatively, a gRNA can refer to a synthetic fusion of a crRNA and a tracrRNA, for example. Jinek et al. (Science 337:816-821) disclose some gRNA features. A gRNA can also be characterized in terms of having a guide sequence (variable targeting domain) followed by a Cas endonuclease recognition (CER) domain [WO2015026883, published on 02-26-2015, U.S. Patent Application US 2015-0082478 A1, published on Mar. 19, 2015 and US 2015-0059010 A1, published on Feb. 26, 2015, all are hereby incorporated in its entirety by reference]. A CER domain comprises a tracrRNA mate sequence followed by a tracrRNA sequence.

(39) The terms target site sequence, target site, target sequence, target DNA, DNA target sequence, target locus, genomic target site, genomic target sequence, genomic target locus, and protospacer are used interchangeably herein. A target site sequence refers to a polynucleotide sequence on a chromosome, episome, or any other DNA molecule in the genome of a non-conventional yeast to which an RGEN herein can recognize, bind to, and optionally nick or cleave. A target site can be (i) an endogenous/native site in the yeast, (ii) heterologous to the yeast and therefore not be naturally occurring in the genome, or (iii) found in a heterologous genomic location compared to where it natively occurs.

(40) A target site sequence herein is at least 13 nucleotides in length and has a strand with sufficient complementarity to a guide sequence (of a crRNA or gRNA) to be capable of hybridizing with the guide sequence and direct sequence-specific binding of a Cas protein or Cas protein complex to the target sequence (if a suitable PAM is adjacent to the target sequence in certain embodiments). A cleavage/nick site (applicable with a endonucleolytic or nicking Cas) can be within the target sequence (e.g., using a Cas9) or a cleavage/nick site could be outside of the target sequence (e.g., using a Cas9 fused to a heterologous endonuclease domain such as one derived from a Fokl enzyme).

(41) An artificial target site or artificial target sequence herein refers to a target sequence that has been introduced into the genome of a non-conventional yeast. An artificial target sequence in some embodiments can be identical in sequence to a native target sequence in the genome of the yeast, but be located at a different position (a heterologous position) in the genome or it can different from the native target sequence if located at the same position in the genome of the yeast.

(42) An episome herein refers to a DNA molecule that can exist in a yeast cell autonomously (can replicate and pass on to daughter cells) apart from the chromosomes of the yeast cell. Episomal DNA can be either native or heterologous to a yeast cell. Examples of native episomes herein include mitochondrial DNA (mtDNA). Examples of heterologous episomes herein include plasmids and yeast artificial chromosomes (YACs).

(43) A protospacer adjacent motif (PAM) herein refers to a short sequence that is recognized by an RGEN herein. The sequence and length of a PAM herein can differ depending on the Cas protein or Cas protein complex used, but are typically 2, 3, 4, 5, 6, 7, or 8 nucleotides long, for example.

(44) The terms 5-cap and 7-methylguanylate (m.sup.7G) cap are used interchangeably herein. A 7-methylguanylate residue is located on the 5 terminus of messenger RNA (mRNA) in eukaryotes. RNA polymerase II (Pol II) transcribes mRNA in eukaryotes. Messenger RNA capping occurs generally as follows: The most terminal 5 phosphate group of the mRNA transcript is removed by RNA terminal phosphatase, leaving two terminal phosphates. A guanosine monophosphate (GMP) is added to the terminal phosphate of the transcript by a guanylyl transferase, leaving a 5-5 triphosphate-linked guanine at the transcript terminus. Finally, the 7-nitrogen of this terminal guanine is methylated by a methyl transferase.

(45) The terminology not having a 5-cap herein is used to refer to RNA having, for example, a 5-hydroxyl group instead of a 5-cap. Such RNA can be referred to as uncapped RNA, for example. Uncapped RNA can better accumulate in the nucleus following transcription, since 5-capped RNA is subject to nuclear export. One or more RNA components herein are uncapped.

(46) The terms ribozyme and ribonucleic acid enzyme are used interchangeably herein. A ribozyme refers to one or more RNA sequences that form secondary, tertiary, and/or quaternary structure(s) that can cleave RNA at a specific site. A ribozyme includes a self-cleaving ribozyme that is capable of cleaving RNA at a cis-site relative to the ribozyme sequence (i.e., auto-catalytic, or self-cleaving). The general nature of ribozyme nucleolytic activity has been described (e.g., Lilley, Biochem. Soc. Trans. 39:641-646). A hammerhead ribozyme (HHR) herein may comprise a small catalytic RNA motif made up of three base-paired stems and a core of highly conserved, non-complementary nucleotides that are involved in catalysis. Pley et al. (Nature 372:68-74) and Hammann et al. (RNA 18:871-885), which are incorporated herein by reference, disclose hammerhead ribozyme structure and activity. A hammerhead ribozyme herein may comprise a minimal hammerhead sequence as disclosed by Scott et al. (Cell 81:991-1002, incorporated herein by reference), for example.

(47) In one embodiment of the disclosure, the method comprises a method of targeting an RNA-guided endonuclease (RGEN) to a target site sequence on a chromosome or episome in a non-conventional yeast, said method comprising providing to said yeast a first recombinant DNA construct comprising a DNA sequence encoding a Cas endonuclease, and at least a second recombinant DNA construct comprising a DNA sequence encoding a ribozyme upstream of an RNA component, wherein the RNA transcribed from the second recombinant DNA construct autocatalytically removes the ribozyme to yield said RNA component , wherein the RNA component and the Cas9 endonuclease can form an RGEN that can bind to all or part of the target site sequence.

(48) In one embodiment of the disclosure the non-conventional yeast comprises a polynucleotide sequence comprising a promoter operably linked to at least one nucleotide sequence, wherein said nucleotide sequence comprises a DNA sequence encoding a ribozyme upstream of a DNA sequence encoding an RNA component, wherein said RNA component comprises a variable targeting domain complementary to a target site sequence on a chromosome or episome in the yeast, wherein the RNA component can form a RNA-guided endonuclease (RGEN), wherein said RGEN can bind to all or part of the target site sequence, wherein the RNA transcribed from the nucleotide sequence autocatalytically removes the ribozyme to yield said RNA component, wherein said RNA component does not have a 5 cap.

(49) A ribozyme also includes a ribozyme that cleaves 5 of its own sequence removing any preceding transcript but leaving the ribozyme sequence intact.

(50) In one embodiment of the disclosure the non-conventional yeast comprises a polynucleotide sequence comprising a promoter operably linked to at least one nucleotide sequence, wherein said nucleotide sequence comprises a DNA sequence encoding a ribozyme upstream of a DNA sequence encoding an RNA component, wherein said RNA component comprises a variable targeting domain complementary to a target site sequence on a chromosome or episome in the yeast, wherein the RNA component can form a RNA-guided endonuclease (RGEN), wherein said RGEN can bind to all or part of the target site sequence, wherein the RNA transcribed from the nucleotide sequence autocatalytically removes the ribozyme to yield said RNA component, wherein the RNA transcribed from the nucleotide sequence does not autocatalytically removes the ribozyme to yield a ribozyme-RNA component fusion molecule without a 5 cap.

(51) The terms targeting, gene targeting, DNA targeting, editing, gene editing and DNA editing are used interchangeably herein. DNA targeting herein may be the specific introduction of an indel, knock-out, or knock-in at a particular DNA sequence, such as in a chromosome or episome of a non-conventional yeast. In general, DNA targeting can be performed herein by cleaving one or both strands at a specific DNA sequence in a non-conventional yeast with a Cas protein associated with a suitable RNA component. Such DNA cleavage, if a double-strand break (DSB), can prompt NHEJ processes which can lead to indel formation at the target site. Also, regardless of whether the cleavage is a single-strand break (SSB) or DSB, HR processes can be prompted if a suitable donor DNA polynucleotide is provided at the DNA nick or cleavage site. Such an HR process can be used to introduce a knock-out or knock-in at the target site, depending on the sequence of the donor DNA polynucleotide.

(52) Alternatively, DNA targeting herein can refer to specific association of a Cas/RNA component complex herein to a target DNA sequence, where the Cas protein does or does not cut a DNA strand (depending on the status of the Cas protein's endonucleolytic domains).

(53) The term indel herein refers to an insertion or deletion of nucleotide bases in a target DNA sequence in a chromosome or episome. Such an insertion or deletion may be of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more bases, for example. An indel in certain embodiments can be even larger, at least about 20, 30, 40, 50, 60, 70p, 80, 90, or 100 bases If an indel is introduced within an open reading frame (ORF) of a gene, oftentimes the indel disrupts wild type expression of protein encoded by the ORF by creating a frameshift mutation.

(54) The terms knock-out, gene knock-out and genetic knock-out are used interchangeably herein. A knock-out represents a DNA sequence of a non-conventional yeast herein that has been rendered partially or completely inoperative by targeting with a Cas protein; such a DNA sequence prior to knock-out could have encoded an amino acid sequence, or could have had a regulatory function (e.g., promoter), for example. A knock-out may be produced by an indel (by NHEJ), or by specific removal of sequence that reduces or completely destroys the function of sequence at or near the targeting site. A knocked out DNA polynucleotide sequence herein can alternatively be characterized as being partially or totally disrupted or downregulated, for example.

(55) In one embodiment, the disclosure concerns a non-conventional yeast comprising a Cas9 endonuclease and a polynucleotide sequence comprising a promoter operably linked to at least one nucleotide sequence, wherein said nucleotide sequence comprises a DNA sequence encoding a ribozyme upstream of a DNA sequence encoding an RNA component, wherein said RNA component comprises a variable targeting domain complementary to a target site sequence on a chromosome or episome in the yeast, wherein the RNA component can form a RNA-guided endonuclease (RGEN) with the Cas endonuclease, wherein said RGEN can bind to the target site sequence. The Cas9 endonuclease can be introduced in the yeast as a protein or can be introduced via a recombinant DNA construct. The Cas9 endonuclease can be expressed in a stable or transient manner by any method known in the art.

(56) The terms knock-in, gene knock-in and genetic knock-in are used interchangeably herein. A knock-in represents the replacement or insertion of a DNA sequence at a specific DNA sequence in a non-conventional yeast by targeting with a Cas protein. Examples of knock-ins are a specific insertion of a heterologous amino acid coding sequence in a coding region of a gene, or a specific insertion of a transcriptional regulatory element in a genetic locus.

(57) The terms donor polynucleotide, donor DNA, targeting polynucleotide and targeting DNA are used interchangeably herein. A donor polynucleotide refers to a DNA sequence that comprises at least one sequence that is homologous to a sequence at or near a DNA target site (e.g., a sequence specifically targeted by a Cas protein herein). A donor DNA polynucleotide that includes a polynucleotide that comprises at least one nucleotide modification when compared to the nucleotide sequence to be edited, is also referred to as a polynucleotide modification template, polynucleotide modification template DNA or template DNA. A nucleotide modification can be at least one nucleotide substitution, addition or deletion. Optionally, the polynucleotide modification template can further comprise homologous nucleotide sequences flanking the at least one nucleotide modification, wherein the flanking homologous nucleotide sequences provide sufficient homology to the desired nucleotide sequence to be edited.

(58) A homologous sequence within a donor polynucleotide herein can comprise or consist of a sequence of at least about 25 nucleotides that have 100% identity with a sequence at or near a target site, or at least about 95%, 96%, 97%, 98%, or 99% identity with a sequence at or near a target site.

(59) In certain embodiments, a donor DNA polynucleotide can have two homologous sequences separated by a sequence that is heterologous to sequence at a target site. These two homologous sequences of such a donor polynucleotide can be referred to as homology arms, which flank the heterologous sequence. HR between a target site and a donor polynucleotide with two homology arms typically results in the replacement of a sequence at the target site with the heterologous sequence of the donor polynucleotide (target site sequence located between DNA sequences homologous to the homology arms of the donor polynucleotide is replaced by the heterologous sequence of the donor polynucleotide). In a donor polynucleotide with two homology arms, the arms can be separated by 1 or more nucleotides (i.e., the heterologous sequence in the donor polynucleotide can be at least 1 nucleotide in length). Various HR procedures that can be performed in a non-conventional yeast herein are disclosed, for example, in DNA Recombination: Methods and Protocols: 1st Edition (H. Tsubouchi, Ed., Springer-Verlag, New York, 2011), which is incorporated herein by reference.

(60) In one embodiment, the donor DNA construct comprises a polynucleotide of Interest to be inserted into the target site of a Cas endonuclease, wherein the donor DNA construct further comprises a first and a second region of homology that flank the polynucleotide of Interest. The first and second regions of homology of the donor DNA share homology to a first and a second genomic region, respectively, present in or flanking the target site of the plant genome.

(61) The terms percent by volume, volume percent, vol % and v/v % are used interchangeably herein. The percent by volume of a solute in a solution can be determined using the formula: [(volume of solute)/(volume of solution)]100%.

(62) The terms percent by weight, weight percentage (wt %) and weight-weight percentage (% w/w) are used interchangeably herein. Percent by weight refers to the percentage of a material on a mass basis as it is comprised in a composition, mixture, or solution.

(63) The terms polynucleotide, polynucleotide sequence, and nucleic acid sequence are used interchangeably herein. These terms encompass nucleotide sequences and the like. A polynucleotide may be a polymer of DNA or RNA that is single- or double-stranded, that optionally contains synthetic, non-natural or altered nucleotide bases. A polynucleotide may be comprised of one or more segments of cDNA, genomic DNA, synthetic DNA, or mixtures thereof. Nucleotides (ribonucleotides or deoxyribonucleotides) can be referred to by a single letter designation as follows: A for adenylate or deoxyadenylate (for RNA or DNA, respectively), C for cytidylate or deoxycytidylate (for RNA or DNA, respectively), G for guanylate or deoxyguanylate (for RNA or DNA, respectively), U for uridylate (for RNA), T for deoxythymidylate (for DNA), R for purines (A or G), Y for pyrimidines (C or T), K for G or T, H for A or C or T, I for inosine, W for A or T, and N for any nucleotide (e.g., N can be A, C, T, or G, if referring to a DNA sequence; N can be A, C, U, or G, if referring to an RNA sequence). Any RNA sequence (e.g., crRNA, tracrRNA, gRNA) disclosed herein may be encoded by a suitable DNA sequence.

(64) The term isolated as used herein refers to a polynucleotide or polypeptide molecule that has been completely or partially purified from its native source. In some instances, the isolated polynucleotide or polypeptide molecule is part of a greater composition, buffer system or reagent mix. For example, the isolated polynucleotide or polypeptide molecule can be comprised within a cell or organism in a heterologous manner.

(65) The term gene as used herein refers to a DNA polynucleotide sequence that expresses an RNA (RNA is transcribed from the DNA polynucleotide sequence) from a coding region, which RNA can be a messenger RNA (encoding a protein) or a non-protein-coding RNA (e.g., a crRNA, tracrRNA, or gRNA herein). A gene may refer to the coding region alone, or may include regulatory sequences upstream and/or downstream to the coding region (e.g., promoters, 5-untranslated regions, 3-transcription terminator regions). A coding region encoding a protein can alternatively be referred to herein as an open reading frame [ORF]. A gene that is native or endogenous refers to a gene as found in nature with its own regulatory sequences; such a gene is located in its natural location in the genome of a host cell. A chimeric gene refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature (i.e., the regulatory and coding regions are heterologous with each other). Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. A foreign or heterologous gene refers to a gene that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, native genes introduced into a new location within the native host, or chimeric genes. The polynucleotide sequences in certain embodiments disclosed herein are heterologous. A transgene is a gene that has been introduced into the genome by a transformation procedure. A codon-optimized open reading frame has its frequency of codon usage designed to mimic the frequency of preferred codon usage of the host cell.

(66) A native amino acid sequence or polynucleotide sequence is naturally occurring, whereas a non-native amino acid sequence or polynucleotide sequence does not occur in nature.

(67) Regulatory sequences as used herein refer to nucleotide sequences located upstream of a gene's transcription start site (e.g., promoter), 5 untranslated regions, and 3 non-coding regions, and which may influence the transcription, processing or stability, or translation of an RNA transcribed from the gene. Regulatory sequences herein may include promoters, enhancers, silencers, 5 untranslated leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, stem-loop structures, and other elements involved in regulation of gene expression. One or more regulatory elements herein may be heterologous to a coding region herein.

(68) A promoter as used herein refers to a DNA sequence capable of controlling the transcription of RNA from a gene. In general, a promoter sequence is upstream of the transcription start site of a gene. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as constitutive promoters. One or more promoters herein may be heterologous to a coding region herein.

(69) A strong promoter as used herein refers to a promoter that can direct a relatively large number of productive initiations per unit time, and/or is a promoter driving a higher level of gene transcription than the average transcription level of the genes in the yeast.

(70) The terms 3 non-coding sequence, transcription terminator and terminator as used herein refer to DNA sequences located downstream of a coding sequence. This includes polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression.

(71) The term cassette as used herein refers to a promoter operably linked to a sequence encoding a protein or non-protein-coding RNA. A cassette may optionally be operably linked to a 3 non-coding sequence.

(72) The terms upstream and downstream as used herein with respect to polynucleotides refer to 5 of and 3 of, respectively.

(73) The term expression as used herein refers to (i) transcription of RNA (e.g., mRNA or a non-protein coding RNA such as crRNA, tracrRNA or gRNA) from a coding region, or (ii) translation of a polypeptide from mRNA.

(74) When used to describe the expression of a gene or polynucleotide sequence, the terms down-regulation, disruption, inhibition, inactivation, and silencing are used interchangeably herein to refer to instances when the transcription of the polynucleotide sequence is reduced or eliminated. This results in the reduction or elimination of RNA transcripts from the polynucleotide sequence, which results in a reduction or elimination of protein expression derived from the polynucleotide sequence (if the gene comprised an ORF). Alternatively, down-regulation can refer to instances where protein translation from transcripts produced by the polynucleotide sequence is reduced or eliminated. Alternatively still, down-regulation can refer to instances where a protein expressed by the polynucleotide sequence has reduced activity. The reduction in any of the above processes (transcription, translation, protein activity) in a cell can be by about 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% relative to the transcription, translation, or protein activity of a suitable control cell. Down-regulation can be the result of a targeting event as disclosed herein (e.g., indel, knock-out), for example.

(75) The terms control cell and suitable control cell are used interchangeably herein and may be referenced with respect to a cell in which a particular modification (e.g., over-expression of a polynucleotide, down-regulation of a polynucleotide) has been made (i.e., an experimental cell). A control cell may be any cell that does not have or does not express the particular modification of the experimental cell. Thus, a control cell may be an untransformed wild type cell or may be genetically transformed but does not express the genetic transformation. For example, a control cell may be a direct parent of the experimental cell, which direct parent cell does not have the particular modification that is in the experimental cell. Alternatively, a control cell may be a parent of the experimental cell that is removed by one or more generations. Alternatively still, a control cell may be a sibling of the experimental cell, which sibling does not comprise the particular modification that is present in the experimental cell.

(76) The term increased as used herein may refer to a quantity or activity that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20% more than the quantity or activity for which the increased quantity or activity is being compared. The terms increased, greater than, and improved are used interchangeably herein. The term increased can be used to characterize the expression of a polynucleotide encoding a protein, for example, where increased expression can also mean over-expression.

(77) The term operably linked as used herein refers to the association of two or more nucleic acid sequences such that that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence. That is, the coding sequence is under the transcriptional control of the promoter. Coding sequences can be operably linked to regulatory sequences, for example. Also, for example, a crRNA can be operably linked (fused to) a tracrRNA herein such that the tracrRNA mate sequence of the crRNA anneals with 5 sequence of the tracrRNA. Such operable linkage may comprise a suitable loop-forming sequence such as GAAA (SEQ ID NO:43), CAAA (SEQ ID NO:44), or AAAG (SEQ ID NO:45).

(78) The term recombinant as used herein refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques. The terms recombinant, transgenic, transformed, engineered or modified for exogenous gene expression are used interchangeably herein.

(79) Methods for preparing recombinant constructs/vectors herein (e.g., a DNA polynucleotide encoding a ribozyme-RNA component cassette herein, or a DNA polynucleotide encoding a Cas protein herein) can follow standard recombinant DNA and molecular cloning techniques as described by J. Sambrook and D. Russell (Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001); T. J. Silhavy et al. (Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1984); and F. M. Ausubel et al. (Short Protocols in Molecular Biology, 5th Ed. Current Protocols, John Wiley and Sons, Inc., NY, 2002).

(80) The term transformation as used herein refers to the transfer of a nucleic acid molecule into a host organism or host cell. For example, the nucleic acid molecule may be one that replicates autonomously in a cell, or that integrates into the genome of the host organism/cell, or that exists transiently in a cell without replicating or integrating. Non-limiting examples of nucleic acid molecules suitable for transformation are disclosed herein, such as plasmids and linear DNA molecules. Host organisms/cells (e.g., non-conventional yeast herein) containing the transformed nucleic acid fragments can be referred to as transgenic, recombinant, transformed, or as transformants.

(81) The terms sequence identity or identity as used herein with respect to polynucleotide or polypeptide sequences refer to the nucleic acid residues or amino acid residues in two sequences that are the same when aligned for maximum correspondence over a specified comparison window. Thus, percentage of sequence identity or percent identity refers to the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the results by 100 to yield the percentage of sequence identity. It would be understood that, when calculating sequence identity between a DNA sequence and an RNA sequence, T residues of the DNA sequence align with, and can be considered identical with, U residues of the RNA sequence. For purposes of determining percent complementarity of first and second polynucleotides, one can obtain this by determining (i) the percent identity between the first polynucleotide and the complement sequence of the second polynucleotide (or vice versa), for example, and/or (ii) the percentage of bases between the first and second polynucleotides that would create canonical Watson and Crick base pairs.

(82) The Basic Local Alignment Search Tool (BLAST) algorithm, which is available online at the National Center for Biotechnology Information (NCBI) website, may be used, for example, to measure percent identity between or among two or more of the polynucleotide sequences (BLASTN algorithm) or polypeptide sequences (BLASTP algorithm) disclosed herein. Alternatively, percent identity between sequences may be performed using a Clustal algorithm (e.g., ClustalW or ClustalV). For multiple alignments using a Clustal method of alignment, the default values may correspond to GAP PENALTY=10 and GAP LENGTH PENALTY=10. Default parameters for pairwise alignments and calculation of percent identity of protein sequences using a Clustal method may be KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids, these parameters may be KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. Alternatively still, percent identity between sequences may be performed using an EMBOSS algorithm (e.g., needle) with parameters such as GAP OPEN=10, GAP EXTEND=0.5, END GAP PENALTY=false, END GAP OPEN=10, END GAP EXTEND=0.5 using a BLOSUM matrix (e.g., BLOSUM62).

(83) Herein, a first sequence that is complementary to a second sequence can alternatively be referred to as being in the antisense orientation with the second sequence.

(84) Various polypeptide amino acid sequences and polynucleotide sequences are disclosed herein as features of certain embodiments of the disclosed invention. Variants of these sequences that are at least about 70-85%, 85-90%, or 90%-95% identical to the sequences disclosed herein can be used. Alternatively, a variant amino acid sequence or polynucleotide sequence can have at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with a sequence disclosed herein. The variant amino acid sequence or polynucleotide sequence has the same function/activity of the disclosed sequence, or at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the function/activity of the disclosed sequence.

(85) All the amino acid residues disclosed herein at each amino acid position of Cas9 proteins herein are examples. Given that certain amino acids share similar structural and/or charge features with each other (i.e., conserved), the amino acid at each position in a Cas9 can be as provided in the disclosed sequences or substituted with a conserved amino acid residue (conservative amino acid substitution) as follows: 1. The following small aliphatic, nonpolar or slightly polar residues can substitute for each other: Ala (A), Ser (S), Thr (T), Pro (P), Gly (G); 2. The following polar, negatively charged residues and their amides can substitute for each other: Asp (D), Asn (N), Glu (E), Gln (Q); 3. The following polar, positively charged residues can substitute for each other: His (H), Arg (R), Lys (K); 4. The following aliphatic, nonpolar residues can substitute for each other: Ala (A), Leu (L), Ile (I), Val (V), Cys (C), Met (M); and 5. The following large aromatic residues can substitute for each other: Phe (F), Tyr (Y), Trp (W).

(86) As shown below in Example 1, performing Cas9-mediated DNA targeting in non-conventional yeast such as Yarrowia lipolytica using Pol III promoter-transcribed gRNA has proven to be difficult. Other means for producing RNA components for Cas9 are therefore of interest for providing Cas9-mediated DNA targeting in non-conventional yeast.

(87) Embodiments of the disclosed invention concern a non-conventional yeast comprising at least one RNA-guided endonuclease (RGEN) comprising at least one RNA component that does not have a 5-cap. This uncapped RNA component comprises a sequence complementary to a target site sequence in a chromosome or episome in the yeast. The RGEN can bind to, and optionally cleave, all or part of a target site sequence.

(88) Significantly, RGEN-mediated DNA targeting occur in these non-conventional yeast, as manifested by indel formation or increased levels of homologous recombination (HR) between the RGEN target site sequence and exogenously supplied donor DNA sequence. Prior to the instant disclosure, non-conventional yeast were generally intractable to gene targeting by HR, typically relying on random, infrequent DNA breaks at a target site to prompt its HR with a donor DNA. This is due to non-conventional yeast having low HR activity and instead favoring non-homologous end-joining (NHEJ) activity. Thus, genetic targeting by HR in non-conventional yeast may now be just as feasible as it has been in conventional yeasts such as S. cerevisiae that favor HR over NHEJ processes. While not wishing to be bound to any theory, it is believed that providing at least one RNA component without a 5-cap in a non-conventional yeast cell leads to better accumulation of the RNA component in the nucleus, where it can participate in RGEN-mediated DNA targeting.

(89) RNA processing tools, such as a Csy4 (Cas6)-based RNA processing tool have been described (Nissim et al. 2014 .Molecular Cell 54:698-710). Csy4 binds pre-crRNA stem-loop repeats and specifically cleaves its cognate substrate to produce mature crRNA's that contain a spacer sequence flanked by fragments of the repeat (Sternberg et al. 2012. RNA,18(4):661-72). Disclosed herein (Example 12) is the use of a Csy4 to process a guide RNA such that it results in an RNA component (guide RNA) that does not have a 5cap, wherein the RNA component can form an RGEN that is can bind to and cleave a target site in the genome of a non-conventional yeast.

(90) A non-conventional yeast herein is not a conventional (model) yeast such as a Saccharomyces (e.g., S. cerevisiae, which is also known as budding yeast, baker's yeast, and/or brewer's yeast) or Schizosaccharomyces (e.g., S. pombe, which is also known as fission yeast) species. Conventional yeasts in certain embodiments are yeast that favor HR DNA repair processes over repair processes mediated by NHEJ.

(91) Non-conventional yeast in certain embodiments can be yeast that favor NHEJ DNA repair processes over repair processes mediated by HR. Conventional yeasts such as Saccharomyces cerevisiae and Schizosaccharomyces pombe typically exhibit specific integration of donor DNA with short flanking homology arms (30-50 bp) with efficiencies routinely over 70%, whereas non-conventional yeasts such as Pichia pastoris, Hansenula polymorpha, Yarrowia lipolytica, Pichia stipitis and Kluyveromyces lactis usually show specific integration with similarly structured donor DNA at efficiencies of less than 1% (Chen et al., PLoS ONE 8:e57952). Thus, a preference for HR processes can be gauged, for example, by transforming yeast with a suitable donor DNA and determining the degree to which it is specifically recombined with a genomic site predicted to be targeted by the donor DNA. A preference for NHEJ (or low preference for HR), for example, would be manifest if such an assay yielded a high degree of random integration of the donor DNA in the yeast genome. Assays for determining the rate of specific (HR-mediated) and/or random (NHEJ-mediated) integration of DNA in yeast are known in the art (e.g., Ferreira and Cooper, Genes Dev. 18:2249-2254; Corrigan et al., PLoS ONE 8:e69628; Weaver et al., Proc. Natl. Acad. Sci. U.S.A. 78:6354-6358; Keeney and Boeke, Genetics 136:849-856).

(92) Given their low level of HR activity, non-conventional yeast herein can (i) exhibit a rate of specific targeting by a suitable donor DNA having 30-50 bp flanking homology arms of less than about 1%, 2%, 3%, 4%, 5%, 6%, 7%, or 8%, for example, and/or (ii) exhibit a rate of random integration of the foregoing donor DNA of more than about 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75%, for example. These rates of (i) specific targeting and/or (ii) random integration of a suitable donor DNA can characterize a non-conventional yeast as it exists before being provided an RGEN as disclosed herein. An aim for providing an RGEN to a non-conventional yeast in certain embodiments is to create site-specific DNA single-strand breaks (SSB) or double-strand breaks (DSB) for biasing the yeast toward HR at the specific site. Thus, a non-conventional yeast comprising a suitable RGEN herein typically should exhibit an increased rate of HR with a particular donor DNA. Such an increased rate can be at least about 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, or 10-fold higher than the rate of HR in a suitable control (e.g., same non-conventional yeast transformed with the same donor DNA, but lacking a suitable RGEN).

(93) A non-conventional yeast in certain aspects herein can be one that reproduces asexually (anamorphic) or sexually (teleomorphic). While non-conventional yeast herein typically exist in unicellular form, certain types of these yeast may optionally be able to form pseudohyphae (strings of connected budding cells). In still further aspects, a non-conventional yeast may be haploid or diploid, and/or may have the ability to exist in either of these ploidy forms.

(94) A non-conventional yeast herein can be cultivated following any means known in the art, such as described in Non-Conventional Yeasts in Genetics, Biochemistry and Biotechnology: Practical Protocols (K. Wolf, K. D. Breunig, G. Barth, Eds., Springer-Verlag, Berlin, Germany, 2003), Yeasts in Natural and Artificial Habitats (J. F. T. Spencer, D. M. Spencer, Eds., Springer-Verlag, Berlin, Germany, 1997), and/or Yeast Biotechnology: Diversity and Applications (T. Satyanarayana, G. Kunze, Eds., Springer, 2009), all of which are incorporated herein by reference.

(95) Non-limiting examples of non-conventional yeast herein include yeasts of the following genera: Yarrowia, Pichia, Schwanniomyces, Kluyveromyces, Arxula, Trichosporon, Candida, Ustilago, Torulopsis, Zygosaccharomyces, Trigonopsis, Cryptococcus, Rhodotorula, Phaffia, Sporobolomyces, and Pachysolen. A suitable example of a Yarrowia species is Y. lipolytica. Suitable examples of Pichia species include P. pastoris, P. methanolica, P. stipitis, P. anomala and P. angusta. Suitable examples of Schwanniomyces species include S. castellii, S. alluvius, S. hominis, S. occidentalis, S. capriottii, S. etchellsii, S. polymorphus, S. pseudopolymorphus, S. vanrijiae and S. yamadae. Suitable examples of Kluyveromyces species include K. lactis, K. marxianus, K. fragilis, K. drosophilarum, K. thermotolerans, K. phaseolosporus, K. vanudenii, K. waltii, K. africanus and K. polysporus. Suitable examples of Arxula species include A. adeninivorans and A. terrestre. Suitable examples of Trichosporon species include T. cutaneum, T. capitatum, T. inkin and T. beemeri. Suitable examples of Candida species include C. albicans, C. ascalaphidarum, C. amphixiae, C. antarctica, C. argentea, C. atlantica, C. atmosphaerica, C. blattae, C. bromeliacearum, C. carpophila, C. carvajalis, C. cerambycidarum, C. chauliodes, C. corydali, C. dosseyi, C. dubliniensis, C. ergatensis, C. fructus, C. glabrata, C. fermentati, C. guiffiermondii, C. haemulonii, C. insectamens, C. insectorum, C. intermedia, C. jeffresii, C. kefyr, C. keroseneae, C. krusei, C. lusitaniae, C. lyxosophila, C. maltosa, C. marina, C. membranifaciens, C. milleri, C. mogii, C. oleophila, C. oregonensis, C. parapsilosis, C. quercitrusa, C. rugosa, C. sake, C. shehatea, C. temnochilae, C. tenuis, C. theae, C. tolerans, C. tropicalis, C. tsuchiyae, C. sinolaborantium, C. sojae, C. subhashii, C. viswanathii, C. utilis, C. ubatubensis and C. zemplinina. Suitable examples of Ustilago species include U. avenae, U. esculenta, U. hordei, U. maydis, U. nuda and U. tritici. Suitable examples of Torulopsis species include T. geochares, T. azyma, T. glabrata and T. candida. Suitable examples of Zygosaccharomyces species include Z. bailii, Z. bisporus, Z. cidri, Z. fermentati, Z. florentinus, Z. kombuchaensis, Z. lentus, Z. mellis, Z. microellipsoides, Z. mrakii, Z. pseudorouxii and Z. rouxii. Suitable examples of Trigonopsis species include T. variabilis. Suitable examples of Cryptococcus species include C. laurentii, C. albidus, C. neoformans, C. gattii, C. uniguttulatus, C. adeliensis, C. aerius, C. albidosimilis, C. antarcticus, C. aquaticus, C. ater, C. bhutanensis, C. consortionis, C. curvatus, C. phenolicus, C. skinneri, C. terreus and C. vishniacci. Suitable examples of Rhodotorula species include R. acheniorum, R. tula, R. acuta, R. americana, R. araucariae, R. arctica, R. armeniaca, R. aurantiaca, R. auriculariae, R. bacarum, R. benthica, R. biourgei, R. bogoriensis, R. bronchialis, R. buffonii, R. calyptogenae, R. chungnamensis, R. cladiensis, R. coraffina, R. cresolica, R. crocea, R. cycloclastica, R. dairenensis, R. diffluens, R. evergladiensis, R. ferulica, R. foliorum, R. fragaria, R. fujisanensis, R. futronensis, R. gelatinosa, R. glacialis, R. glutinis, R. gracilis, R. graminis, R. grinbergsii, R. himalayensis, R. hinnulea, R. histolytica, R. hylophila, R. incarnata, R. ingeniosa, R. javanica, R. koishikawensis, R. lactosa, R. lameffibrachiae, R. laryngis, R. lignophila, R. lini, R. longissima, R. ludwigii, R. lysinophila, R. marina, R. martyniae-fragantis, R. matritensis, R. meli, R. minuta, R. mucilaginosa, R. nitens, R. nothofagi, R. oryzae, R. pacifica, R. pallida, R. peneaus, R. philyla, R. phylloplana, R. pilatii, R. pilimanae, R. pinicola, R. plicata, R. polymorpha, R. psychrophenolica, R. psychrophila, R. pustula, R. retinophila, R. rosacea, R. rosulata, R. rubefaciens, R. rubella, R. rubescens, R. rubra, R. rubrorugosa, R. rufula, R. rutila, R. sanguines, R. sanniei, R. sartoryi, R. silvestris, R. simplex, R. sinensis, R. slooffiae, R. sonckii, R. straminea, R. subericola, R. suganii, R. taiwanensis, R. taiwaniana, R. terpenoidalis, R. terrea, R. texensis, R. tokyoensis, R. ulzamae, R. vanillica, R. vuilleminii, R. yarrowii, R. yunnanensis and R. zsoltii. Suitable examples of Phaffia species include P. rhodozyma. Suitable examples of Sporobolomyces species include S. alborubescens, S. bannaensis, S. beijingensis, S. bischofiae, S. clavatus, S. coprosmae, S. coprosmicola, S. corallinus, S. dimmenae, S. dracophylli, S. elongatus, S. gracilis, S. inositophilus, S. johnsonii, S. koalae, S. magnisporus, S. novozealandicus, S. odorus, S. patagonicus, S. productus, S. roseus, S. sasicola, S. shibatanus, S. singularis, S. subbrunneus, S. symmetricus, S. syzygii, S. taupoensis, S. tsugae, S. xanthus and S. yunnanensis. Suitable examples of Pachysolen species include P. tannophilus.

(96) Yarrowia lipolytica is preferred in certain embodiments disclosed herein. Examples of suitable Y. lipolytica include the following isolates available from the American Type Culture Collection (ATCC, Manassas, Va.): strain designations ATCC #20362, #8862, #8661, #8662, #9773, #15586, #16617, #16618, #18942, #18943, #18944, #18945, #20114, #20177, #20182, #20225, #20226, #20228, #20327, #20255, #20287, #20297, #20315, #20320, #20324, #20336, #20341, #20346, #20348, #20363, #20364, #20372, #20373, #20383, #20390, #20400, #20460, #20461, #20462, #20496, #20510, #20628, #20688, #20774, #20775, #20776, #20777, #20778, #20779, #20780, #20781, #20794, #20795, #20875, #20241, #20422, #20423, #32338, #32339, #32340, #32341, #34342, #32343, #32935, #34017, #34018, #34088, #34922, #34922, #38295, #42281, #44601, #46025, #46026, #46027, #46028, #46067, #46068, #46069, #46070, #46330, #46482, #46483, #46484, #46436, #60594, #62385, #64042, #74234, #76598, #76861, #76862, #76982, #90716, #90811, #90812, #90813, #90814, #90903, #90904, #90905, #96028, #201241, #201242, #201243, #201244, #201245, #201246, #201247, #201249, and/or #201847.

(97) A Y. lipolytica, as well as any other non-conventional yeast herein, may be oleaginous (e.g., produce at least 25% of its dry cell weight as oil) and/or produce one or more polyunsaturated fatty acids (e.g., omega-6 or omega-3). Such oleaginy may be a result of the yeast being genetically engineered to produce an elevated amount of lipids compared to its wild type form. Examples of oleaginous Y. lipolytica strains are disclosed in U.S. Pat. Appl. Publ. Nos. 2009/0093543, 2010/0317072, 2012/0052537 and 2014/0186906, which are herein incorporated by reference.

(98) Embodiments disclosed herein for non-conventional yeast can also be applied to other microorgansims such as fungi. Fungi in certain embodiments can be fungi that favor NHEJ DNA repair processes over repair processes mediated by HR. A fungus herein can be a Basidiomycetes, Zygomycetes, Chytridiomycetes, or Ascomycetes fungus. Examples of filamentous fungi herein include those of the genera Trichoderma, Chrysosporium, Thielavia, Neurospora (e.g., N. crassa, N. sitophila), Cryphonectria (e.g., C. parasitica), Aureobasidium (e.g., A. pullulans), Filibasidium, Piromyces, Cryplococcus, Acremonium, Tolypocladium, Scytalidium, Schizophyllum, Sporotrichum, Penicillium (e.g., P. bilaiae, P. camemberti, P. candidum, P. chrysogenum, P. expansum, P. funiculosum, P. glaucum, P. mameffei, P. roqueforti, P. verrucosum, P. viridicatum), Gibberella (e.g., G. acuminata, G. avenacea, G. baccata, G. circinata, G. cyanogena, G. fujikuroi, G. intricans, G. pulicaris, G. stilboides, G. tricincta, G. zeae), Myceliophthora, Mucor (e.g., M. rouxii, M. circinelloides), Aspergillus (e.g., A. niger, A. oryzae, A. nidulans, A. flavus, A. lentulus, A. terreus, A. clavatus, A. fumigatus), Fusarium (e.g., F. graminearum, F. oxysporum, F. bubigenum, F. solani, F. oxysporum, F. verticillioides, F. proliferatum, F. venenatum), and Humicola, and anamorphs and teleomorphs thereof. The genus and species of fungi herein can be defined, if desired, by morphology as disclosed in Barnett and Hunter (Illustrated Genera of Imperfect Fungi, 3rd Edition, Burgess Publishing Company, 1972). A fungus can optionally be characterized as a pest/pathogen, such as a pest/pathogen of an animal (e.g., human).

(99) Trichoderma species in certain aspects herein include T. aggressivum, T. amazonicum, T. asperellum, T. atroviride, T. aureoviride, T. austrokoningii, T. brevicompactum, T. candidum, T. caribbaeum, T. catoptron, T. cremeum, T. ceramicum, T. cerinum, T. chlorosporum, T. chromospermum, T. cinnamomeum, T. citrinoviride, T. crassum, T. cremeum, T. dingleyeae, T. dorotheae, T. effusum, T. erinaceum, T. estonicum, T. fertile, T. gelatinosus, T. ghanense, T. hamatum, T. harzianurn, T. helicum, T. intricatum, T. konilangbra, T. koningii, T. koningiopsis, T. longibrachiatum, T. longipile, T. minutisporum, T. oblongisporum, T. ovalisporum, T. petersenii, T. phyllostahydis, T. piluliferum, T. pleuroticola, T. pleurotum, T. polysporum, T. pseudokoningii, T. pubescens, T. reesei, T. rogersonii, T. rossicum, T. satumisporum, T. sinensis, T. sinuosum, T. spirale, T. stramineum, T. strigosum, T. stromaticum, T. surrotundum, T. taiwanense, T. thailandicum, T. thelephoricolum, T. theobromicola, T. tomentosum, T. velutinum, T. virens, T. viride and T. viridescens. A Trichoderma species herein can be cultivated and/or manipulated as described in Trichoderma: Biology and Applications (P.K. Mukherjee et al., Eds., CABI, Oxfordshire, UK, 2013), for example, which is incorporated herein by reference.

(100) A microbial cell in certain embodiments is an algal cell. For example, an algal cell can be from any of the following: Chlorophyta (green algae), Rhodophyta (red algae), Phaeophyceae (brown algae), Bacillariophycaeae (diatoms), and Dinoflagellata (dinoflagellates). An algal cell can be of a microalgae (e.g., phytoplankton, microphytes, or planktonic algae) or macroalgae (kelp, seaweed) in other aspects. As further examples, an algal cell herein can be a Porphyra (purple laver), Palmaria species such as P. palmata (dulse), Arthrospira species such as A. platensis (spirulina), Chlorella (e.g., C. protothecoides), a Chondrus species such as C. crispus (Irish moss), Aphanizomenon, Sargassum, Cochayuyo, Botryococcus (e.g., B. braunii), Dunaliella (e.g., D. tertiolecta), Gracilaria, Pleurochrysis (e.g., P. carterae), Ankistrodesmus, Cyclotella, Hantzschia, Nannochloris, Nannochloropsis, Nitzschia, Phaeodactylum (e.g., P. tricornutum), Scenedesmus, Stichococcus, Tetraselmis (e.g., T. suecica), Thalassiosira (e.g., T. pseudonana), Crypthecodinium (e.g., C. cohnii), Neochloris (e.g., N. oleoabundans), or Schiochytrium. An algal species herein can be cultivated and/or manipulated as described in Thompson (Algal Cell Culture. Encyclopedia of Life Support System (EOLSS), Biotechnology Vol 1, available at eolss.net/sample-chapters internet site), for example, which is incorporated herein by reference.

(101) A non-conventional yeast herein comprising at least one RGEN comprising at least one RNA component that does not have a 5-cap does not occur in nature. Without wishing to be held to any particular theory, it is believed that such yeast do not occur naturally since RGENs herein have only been found to occur in prokaryotes, for example. Also, it is believed that certain embodiments of yeast do not naturally occur by virtue of comprising an RGEN with an RNA component comprising a gRNA, which represents a heterologous linkage of a crRNA with a tracrRNA.

(102) An RGEN herein refers to a complex comprising at least one Cas protein and at least one RNA component. Examples of suitable Cas proteins include one or more Cas endonucleases of type I, II, or III CRISPR systems (Bhaya et al., Annu. Rev. Genet. 45:273-297, incorporated herein by reference). A type I CRISPR Cas protein can be a Cas3 or Cas4 protein, for example. A type II CRISPR Cas protein can be a Cas9 protein, for example. A type III CRISPR Cas protein can be a Cas10 protein, for example. A Cas9 protein is used in preferred embodiments. A Cas protein in certain embodiments may be a bacterial or archaeal protein. Type I-III CRISPR Cas proteins herein are typically prokaryotic in origin; type I and III Cas proteins can be derived from bacterial or archaeal species, whereas type II Cas proteins (i.e., a Cas9) can be derived from bacterial species, for example. In other embodiments, suitable Cas proteins include one or more of Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof.

(103) In other aspects of the disclosed invention, a Cas protein herein can be from any of the following genera: Aeropyrum, Pyrobaculum, Sulfolobus, Archaeoglobus, Haloarcula, Methanobacteriumn, Methanococcus, Methanosarcina, Methanopyrus, Pyrococcus, Picrophilus, Thernioplasnia, Corynebacterium, Mycobacterium, Streptomyces, Aquifrx, Porphvromonas, Chlorobium, Thermus, Bacillus, Listeria, Staphylococcus, Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacterium, Azarcus, Chromobacterium, Neisseria, Nitrosomonas, Desulfovibrio, Geobacter, Myrococcus, Campylobacter, Wolinella, Acinetobacter, Erwinia, Escherichia, Legionella, Methylococcus, Pasteurella, Photobacterium, Salmonella, Xanthomonas, Yersinia, Streptococcus, Treponema, Francisella, or Thermotoga. Alternatively, a Cas protein herein can be encoded, for example, by any of SEQ ID NOs:462-465, 467-472, 474-477, 479-487, 489-492, 494-497, 499-503, 505-508, 510-516, or 517-521 as disclosed in U.S. Appl. Publ. No. 2010/0093617, which is incorporated herein by reference.

(104) An RGEN in certain embodiments comprises a Cas9 amino acid sequence. The amino acid sequence of a Cas9 protein herein, as well as certain other Cas proteins herein, may be derived from a Streptococcus (e.g., S. pyogenes, S. pneumoniae, S. thermophilus, S. agalactiae, S. parasanguinis, S. oralis, S. salivarius, S. macacae, S. dysgalactiae, S. anginosus, S. constellatus, S. pseudoporcinus, S. mutans), Listeria (e.g., L. innocua), Spiroplasma (e.g., S. apis, S. syrphidicola), Peptostreptococcaceae, Atopobium, Porphyromonas (e.g., P. catoniae), Prevotella (e.g., P. intermedia), Veillonella, Treponema (e.g., T. socranskii, T. denticola), Capnocytophaga, Finegoldia (e.g., F. magna), Coriobacteriaceae (e.g., C. bacterium), Olsenella (e.g., O. profusa), Haemophilus (e.g., H. sputorum, H. pittmaniae), Pasteurella (e.g., P. bettyae), Olivibacter (e.g., O. sitiensis), Epilithonimonas (e.g., E. tenax), Mesonia (e.g., M. mobilis), Lactobacillus (e.g., L. plantarum), Bacillus (e.g., B. cereus), Aquimarina (e.g., A. muelleri), Chryseobacterium (e.g., C. palustre), Bacteroides (e.g., B. graminisolvens), Neisseria (e.g., N. meningitidis), Francisella (e.g., F. novicida), or Flavobacterium (e.g., F. frigidarium, F. soli) species, for example. An S. pyogenes Cas9 is preferred in certain aspects herein. As another example, a Cas9 protein can be any of the Cas9 proteins disclosed in Chylinski et al. (RNA Biology 10:726-737), which is incorporated herein by reference.

(105) Accordingly, the sequence of a Cas9 protein herein can comprise, for example, any of the Cas9 amino acid sequences disclosed in GenBank Accession Nos. G3ECR1 (S. thermophilus), WP_026709422, WP_027202655, WP_027318179, WP_027347504, WP_027376815, WP_027414302, WP_027821588, WP_027886314, WP_027963583, WP_028123848, WP_028298935, Q03JI6 (S. thermophilus), EGP66723, EGS38969, EGV05092, EHI65578 (S. pseudoporcinus), EIC75614 (S. oralis), EID22027 (S. constellatus), EIJ69711, EJP22331 (S. oralis), EJP26004 (S. anginosus), EJP30321, EPZ44001 (S. pyogenes), EPZ46028 (S. pyogenes), EQL78043 (S. pyogenes), EQL78548 (S. pyogenes), ERL10511, ERL12345, ERL19088 (S. pyogenes), ESA57807 (S. pyogenes), ESA59254 (S. pyogenes), ESU85303 (S. pyogenes), ETS96804, UC75522, EGR87316 (S. dysgalactiae), EGS33732, EGV01468 (S. oralis), EHJ52063 (S. macacae), EID26207 (S. oralis), EID33364, EIG27013 (S. parasanguinis), EJF37476, EJ019166 (Streptococcus sp. BS35b), EJU16049, EJU32481, YP_006298249, ERF61304, ERK04546, ETJ95568 (S. agalactiae), TS89875, ETS90967 (Streptococcus sp. SR4), ETS92439, EUB27844 (Streptococcus sp. BS21), AFJ08616, EUC82735 (Streptococcus sp. CM6), EWC92088, EWC94390, EJP25691, YP_008027038, YP_008868573, AGM26527, AHK22391, AHB36273, Q927P4, G3ECR1, or Q99ZW2 (S. pyogenes), which are incorporated by reference. A variant of any of these Cas9 protein sequences may be used, but should have specific binding activity, and optionally endonucleolytic activity, toward DNA when associated with an RNA component herein. Such a variant may comprise an amino acid sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of the reference Cas9.

(106) Alternatively, a Cas9 protein herein can be encoded by any of SEQ ID NOs:462 (S. thermophilus), 474 (S. thermophilus), 489 (S. agalactiae), 494 (S. agalactiae), 499 (S. mutans), 505 (S. pyogenes), or 518 (S. pyogenes) as disclosed in U.S. Appl. Publ. No. 2010/0093617 (incorporated herein by reference), for example. Alternatively still, a Cas9 protein herein can comprise the amino acid sequence of SEQ ID NO:11, or residues 1-1368 of SEQ ID NO:11, for example. Alternatively still, a Cas9 protein may comprise an amino acid sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any of the foregoing amino acid sequences, for example. Such a variant Cas9 protein should have specific binding activity, and optionally cleavage or nicking activity, toward DNA when associated with an RNA component herein.

(107) The origin of a Cas protein used herein (e.g., Cas9) may be from the same species from which the RNA component(s) is derived, or it can be from a different species. For example, an RGEN comprising a Cas9 protein derived from a Streptococcus species (e.g., S. pyogenes or S. thermophilus) may be complexed with at least one RNA component having a sequence (e.g., crRNA repeat sequence, tracrRNA sequence) derived from the same Streptococcus species. Alternatively, the origin of a Cas protein used herein (e.g., Cas9) may be from a different species from which the RNA component(s) is derived (the Cas protein and RNA component(s) may be heterologous to each other); such heterologous Cas/RNA component RGENs should have DNA targeting activity.

(108) Determining binding activity and/or endonucleolytic activity of a Cas protein herein toward a specific target DNA sequence may be assessed by any suitable assay known in the art, such as disclosed in U.S. Pat. No. 8,697,359, which is disclosed herein by reference. A determination can be made, for example, by expressing a Cas protein and suitable RNA component in a non-conventional yeast, and then examining the predicted DNA target site for the presence of an indel (a Cas protein in this particular assay would have complete endonucleolytic activity [double-strand cleaving activity]). Examining for the presence of an indel at the predicted target site could be done via a DNA sequencing method or by inferring indel formation by assaying for loss of function of the target sequence, for example. In another example, Cas protein activity can be determined by expressing a Cas protein and suitable RNA component in a non-conventional yeast that has been provided a donor DNA comprising a sequence homologous to a sequence in at or near the target site. The presence of donor DNA sequence at the target site (such as would be predicted by successful HR between the donor and target sequences) would indicate that targeting occurred.

(109) A Cas protein herein such as a Cas9 typically further comprises a heterologous nuclear localization sequence (NLS). A heterologous NIL amino acid sequence herein may be of sufficient strength to drive accumulation of a Cas protein in a detectable amount in the nucleus of a yeast cell herein, for example. An NIL may comprise one (monopartite) or more (e.g., bipartite) short sequences (e.g., 2 to 20 residues) of basic, positively charged residues (e.g., lysine and/or arginine), and can be located anywhere in a Cas amino acid sequence but such that it is exposed on the protein surface. An NIL may be operably linked to the N-terminus or C-terminus of a Cas protein herein, for example. Two or more NIL sequences can be linked to a Cas protein, for example, such as on both the N- and C-termini of a Cas protein. Non-limiting examples of suitable NIL sequences herein include those disclosed in U.S. Pat. Nos. 6,660,830 and 7,309,576 (e.g., Table 1 therein), which are both incorporated herein by reference. Another example of an NIL useful herein includes amino acid residues 1373-1379 of SEQ ID NO:11.

(110) In certain embodiments, a Cas protein and its respective RNA component (e.g., crRNA) that directs DNA-specific targeting by the Cas protein are heterologous to the disclosed non-conventional yeast. The heterologous nature of these RGEN components is due to the fact that Cas proteins and their respective RNA components are only known to exist in prokaryotes (bacteria and archaea).

(111) A Cas protein herein can optionally be expressed in a non-conventional yeast cell using an open reading frame (ORF) that is codon-optimized for expression in the yeast cell. A codon-optimized sequence herein is an ORF having its frequency of codon usage designed to mimic the frequency of preferred codon usage of the host cell. In aspects in which Y. lipolytica is the non-conventional yeast cell, codon optimization of an ORF can be performed following the Y. lipolytica codon usage profile as provided in U.S. Pat. No. 7,125,672, which is incorporated herein by reference.

(112) In some embodiments, a Cas protein is part of a fusion protein comprising one or more heterologous protein domains (e.g., 1, 2, 3, or more domains in addition to the Cas protein). Such a fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains, such as between Cas and a first heterologous domain. Examples of protein domains that may be fused to a Cas protein herein include, without limitation, epitope tags (e.g., histidine [His], V5, FLAG, influenza hemagglutinin [HA], myc, VSV-G, thioredoxin [Trx]), reporters (e.g., glutathione-5-transferase [GST], horseradish peroxidase [HRP], chloramphenicol acetyltransferase [CAT], beta-galactosidase, beta-glucuronidase [GUS], luciferase, green fluorescent protein [GFP], HcRed, DsRed, cyan fluorescent protein [CFP], yellow fluorescent protein [YFP], blue fluorescent protein [BFP]), and domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity (e.g., VP16 or VP64), transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity. A Cas protein in other embodiments may be in fusion with a protein that binds DNA molecules or other molecules, such as maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD), GAL4A DNA binding domain, and herpes simplex virus (HSV) VP16. Additional domains that may be part of a fusion protein comprising a Cas protein herein are disclosed in U.S. Patent Appl. Publ. No. 2011/0059502, which is incorporated herein by reference. In certain embodiments in which a Cas protein is fused to a heterologous protein (e.g., a transcription factor), the Cas protein has DNA recognition and binding activity (when in complex with a suitable RNA component herein), but no DNA nicking or cleavage activity.

(113) An RGEN herein can bind to, and optionally cleave, a DNA strand at a DNA target sequence. In certain embodiments, an RGEN can cleave one or both strands of a DNA target sequence. An RGEN can cleave both strands of a DNA target sequence, for example.

(114) An RGEN herein that can cleave both strands of a DNA target sequence typically comprises a Cas protein that has all of its endonuclease domains in a functional state (e.g., wild type endonuclease domains or variants thereof retaining some or all activity in each endonuclease domain). Thus, a wild type Cas protein (e.g., a Cas9 protein disclosed herein), or a variant thereof retaining some or all activity in each endonuclease domain of the Cas protein, is a suitable example of an RGEN that can cleave both strands of a DNA target sequence. A Cas9 protein comprising functional RuvC and HNH nuclease domains is an example of a Cas protein that can cleave both strands of a DNA target sequence. An RGEN herein that can cleave both strands of a DNA target sequence typically cuts both strands at the same position such that blunt-ends (i.e., no nucleotide overhangs) are formed at the cut site.

(115) An RGEN herein that can cleave one strand of a DNA target sequence can be characterized herein as having nickase activity (e.g., partial cleaving capability). A Cas nickase (e.g., Cas9 nickase) herein typically comprises one functional endonuclease domain that allows the Cas to cleave only one strand (i.e., make a nick) of a DNA target sequence. For example, a Cas9 nickase may comprise (i) a mutant, dysfunctional RuvC domain and (ii) a functional HNH domain (e.g., wild type HNH domain). As another example, a Cas9 nickase may comprise (i) a functional RuvC domain (e.g., wild type RuvC domain) and (ii) a mutant, dysfunctional HNH domain.

(116) Non-limiting examples of Cas9 nickases suitable for use herein are disclosed by Gasiunas et al. (Proc. Natl. Acad. Sci. U.S.A. 109:E2579-E2586), Jinek et al. (Science 337:816-821), Sapranauskas et al. (Nucleic Acids Res. 39:9275-9282) and in U.S. Patent Appl. Publ. No. 2014/0189896, which are incorporated herein by reference. For example, a Cas9 nickase herein can comprise an S. thermophilus Cas9 having an Asp-31 substitution (e.g., Asp-31-Ala) (an example of a mutant RuvC domain), or a His-865 substitution (e.g., His-865-Ala), Asn-882 substitution (e.g., Asn-882-Ala), or Asn-891 substitution (e.g., Asn-891-Ala) (examples of mutant HNH domains). Also for example, a Cas9 nickase herein can comprise an S. pyogenes Cas9 having an Asp-10 substitution (e.g., Asp-10-Ala), Glu-762 substitution (e.g., Glu-762-Ala), or Asp-986 substitution (e.g., Asp-986-Ala) (examples of mutant RuvC domains), or a His-840 substitution (e.g., His-840-Ala), Asn-854 substitution (e.g., Asn-854-Ala), or Asn-863 substitution (e.g., Asn-863-Ala) (examples of mutant HNH domains). Regarding S. pyogenes Cas9, the three RuvC subdomains are generally located at amino acid residues 1-59, 718-769 and 909-1098, respectively, and the HNH domain is located at amino acid residues 775-908 (Nishimasu et al., Cell 156:935-949).

(117) A Cas9 nickase herein can be used for various purposes in non-conventional yeast of the disclosed invention. For example, a Cas9 nickase can be used to stimulate HR at or near a DNA target site sequence with a suitable donor polynucleotide. Since nicked DNA is not a substrate for NHEJ processes, but is recognized by HR processes, nicking DNA at a specific target site should render the site more receptive to HR with a suitable donor polynucleotide.

(118) As another example, a pair of Cas9 nickases can be used to increase the specificity of DNA targeting. In general, this can be done by providing two Cas9 nickases that, by virtue of being associated with RNA components with different guide sequences, target and nick nearby DNA sequences on opposite strands in the region for desired targeting. Such nearby cleavage of each DNA strand creates a DSB (i.e., a DSB with single-stranded overhangs), which is then recognized as a substrate for NHEJ (leading to indel formation) or HR (leading to recombination with a suitable donor polynucleotide, if provided). Each nick in these embodiments can be at least about 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 (or any integer between 5 and 100) bases apart from each other, for example. One or two Cas9 nickase proteins herein can be used in a Cas9 nickase pair as described above. For example, a Cas9 nickase with a mutant RuvC domain, but functioning HNH domain (i.e., Cas9 HNH.sup.+/RuvC.sup.), could be used (e.g., S. pyogenes Cas9 HNH.sup.+/RuvC.sup.). Each Cas9 nickase (e.g., Cas9 HNH.sup.+/RuvC.sup.) would be directed to specific DNA sites nearby each other (up to 100 base pairs apart) by using suitable RNA components herein with guide RNA sequences targeting each nickase to each specific DNA site.

(119) An RGEN in certain embodiments can bind to a DNA target site sequence, but does not cleave any strand at the target site sequence. Such an RGEN may comprise a Cas protein in which all of its nuclease domains are mutant, dysfunctional. For example, a Cas9 protein herein that can bind to a DNA target site sequence, but does not cleave any strand at the target site sequence, may comprise both a mutant, dysfunctional RuvC domain and a mutant, dysfunctional HNH domain. Non-limiting examples of such a Cas9 protein comprise any of the RuvC and HNH nuclease domain mutations disclosed above (e.g., an S. pyogenes Cas9 with an Asp-10 substitution such as Asp-10-Ala and a His-840 substitution such as His-840-Ala). A Cas protein herein that binds, but does not cleave, a target DNA sequence can be used to modulate gene expression, for example, in which case the Cas protein could be fused with a transcription factor (or portion thereof) (e.g., a repressor or activator, such as any of those disclosed herein). For example, a Cas9 comprising an S. pyogenes Cas9 with an Asp-10 substitution (e.g., Asp-10-Ala) and a His-840 substitution (e.g., His-840-Ala) can be fused to a VP16 or VP64 transcriptional activator domain. The guide sequence used in the RNA component of such an RGEN would be complementary to a DNA sequence in a gene promoter or other regulatory element (e.g., intron), for example.

(120) A yeast in certain aspects may comprise (i) an RGEN that can cleave one or both DNA strands of a DNA target sequence and (ii) a donor polynucleotide comprising at least one sequence homologous to a sequence at or near a DNA target site sequence (a sequence specifically targeted by a Cas protein herein). A suitable donor polynucleotide is able to undergo HR with a sequence at or near a DNA target site if the target site contains a SSB or DSB (such as can be introduced using a Cas protein herein). A homologous sequence within a donor polynucleotide herein can comprise or consist of a sequence of at least about 25, 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10000 nucleotides, or about 50-500, 50-550, 50-600, 50-650, or 50-700 nucleotides, that have 100% identity with a sequence at or near the target site sequence, or at least about 95%, 96%, 97%, 98%, or 99% identity with a sequence at or near the target site sequence, for example.

(121) A donor polynucleotide herein can have two homologous sequences (homology arms), for example, separated by a sequence that is heterologous to sequence at or near a target site sequence. HR between such a donor polynucleotide and a target site sequence typically results in the replacement of a sequence at the target site with the heterologous sequence of the donor polynucleotide (target site sequence located between target site sequences homologous to the homology arms of the donor polynucleotide is replaced by the heterologous sequence of the donor polynucleotide). In a donor polynucleotide with two homology arms, the arms can be separated by at least about 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 75, 100, 250, 500, 1000, 2500, 5000, 10000, 15000, 20000, 25000, or 30000 nucleotides (i.e., the heterologous sequence in the donor polynucleotide is at least about 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 75, 100, 250, 500, 1000, 2500, 5000, 10000, 15000, 20000, 25000, or 30000 nucleotides in length), for example. The length (e.g., any of the lengths disclosed above for a homologous sequence) of each homology arm may be the same or different. The percent identity (e.g., any of the % identities disclosed above for a homologous sequence) of each arm with respective homologous sequences at or near the target site can be the same or different.

(122) A DNA sequence at or near (alternatively, in the locality or proximity of) the target site sequence that is homologous to a corresponding homologous sequence in a donor polynucleotide can be within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 450, 500, 750, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, or 60000 (or any integer between 1 and 60000) nucleotides (e.g., about 1-1000, 100-1000, 500-1000, 1-500, or 100-500 nucleotides), for example, from the predicted Cas protein cut site (DSB or nick) in the target sequence. These nucleotide distances can be marked from the cut site to the first nucleotide of the homologous sequence, going either in the upstream or downstream direction from the cut site. For example, a sequence near a target sequence that is homologous to a corresponding sequence in a donor polynucleotide can start at 500 nucleotide base pairs downstream the predicted Cas protein cut site in a target sequence. In embodiments herein employing a donor polynucleotide with two homology arms (e.g., first and second homology arms separated by a heterologous sequence), a homologous sequence (corresponding in homology with the first homology arm of a donor) can be upstream the predicted Cas cut site, and a homologous sequence (corresponding in homology with the second homology arm of a donor) can be downstream the predicted Cas cut site, for example. The nucleotide distances of each of these upstream and downstream homologous sequences from the predicted cut site can be the same or different, and can be any of the nucleotide distances disclosed above, for example. For instance, the 3 end of a homologous sequence (corresponding in homology with the first homology arm of a donor) may be located 600 nucleotide base pairs upstream a predicted Cas cut site, and the 5 end of a homologous sequence (corresponding in homology with the second homology arm of a donor) may be located 400 nucleotide base pairs downstream the predicted Cas cut site.

(123) An RGEN herein can bind to, and optionally cleave a DNA strand at a target site sequence in a chromosome, episome, or any other DNA molecule in the genome of a non-conventional yeast. This recognition and binding of a target sequence is specific, given that an RNA component of the RGEN comprises a sequence (guide sequence) that is complementary to a strand of the target sequence. A target site in certain embodiments can be unique (i.e., there is a single occurrence of the target site sequence in the subject genome).

(124) The length of a target sequence herein can be at least 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides; between 13-30 nucleotides; between 17-25 nucleotides; or between 17-20 nucleotides, for example. This length can include or exclude a PAM sequence. Also, a strand of a target sequence herein has sufficient complementarity with a guide sequence (of a crRNA or gRNA) to hybridize with the guide sequence and direct sequence-specific binding of a Cas protein or Cas protein complex to the target sequence (if a suitable PAM is adjacent to the target sequence, see below). The degree of complementarity between a guide sequence and a strand of its corresponding DNA target sequence is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, for example. A target site herein may be located in a sequence encoding a gene product (e.g., a protein or an RNA) or a non-coding sequence (e.g., a regulatory sequence or a junk sequence), for example.

(125) A PAM (protospacer-adjacent motif) sequence may be adjacent to the target site sequence. A PAM sequence is a short DNA sequence recognized by an RGEN herein. The associated PAM and first 11 nucleotides of a DNA target sequence are likely important to Cas9/gRNA targeting and cleavage (Jiang et al., Nat. Biotech. 31:233-239). The length of a PAM sequence herein can vary depending on the Cas protein or Cas protein complex used, but is typically 2, 3, 4, 5, 6, 7, or 8 nucleotides long, for example. A PAM sequence is immediately downstream from, or within 2, or 3 nucleotides downstream of, a target site sequence that is complementary to the strand in the target site that is in turn complementary to an RNA component guide sequence, for example. In embodiments herein in which the RGEN is an endonucleolytically active Cas9 protein complexed with an RNA component, the Cas9 binds to the target sequence as directed by the RNA component and cleaves both strands immediately 5 of the third nucleotide position upstream of the PAM sequence. Consider the following example of a target site:PAM sequence:

(126) 5-NNNNNNNNNNNNNNNNNNNNXGG-3 (SEQ ID NO:46).

(127) N can be A, C, T, or G, and X can be A, C, T, or G in this example sequence (X can also be referred to as N.sub.PAM). The PAM sequence in this example is XGG (underlined). A suitable Cas9/RNA component complex would cleave this target immediately 5 of the double-underlined N. The string of N's in SEQ ID NO:46 represents target sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical, for example, with a guide sequence in an RNA component herein (where any T's of the DNA target sequence would align with any U's of the RNA guide sequence). A guide sequence of an RNA component of a Cas9 complex, in recognizing and binding at this target sequence (which is representive of target sites herein), would anneal with the complement sequence of the string of N's; the percent complementarity between a guide sequence and the target site complement is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, for example. If a Cas9 nickase is used to target SEQ ID NO:46 in a genome, the nickase would nick immediately 5 of the double-underlined N or at the same position of the complementary strand, depending on which endonuclease domain in the nickase is dysfunctional. If a Cas9 having no nucleolytic activity (both RuvC and HNH domains dysfuntional) is used to target SEQ ID NO:46 in a genome, it would recognize and bind the target sequence, but not make any cuts to the sequence.

(128) A PAM herein is typically selected in view of the type of RGEN being employed. A PAM sequence herein may be one recognized by an RGEN comprising a Cas, such as Cas9, derived from any of the species disclosed herein from which a Cas can be derived, for example. In certain embodiments, the PAM sequence may be one recognized by an RGEN comprising a Cas9 derived from S. pyogenes, S. thermophilus, S. agalactiae, N. meningitidis, T. denticola, or F. novicida. For example, a suitable Cas9 derived from S. pyogenes could be used to target genomic sequences having a PAM sequence of NGG (SEQ ID NO:47; N can be A, C, T, or G). As other examples, a suitable Cas9 could be derived from any of the following species when targeting DNA sequences having the following PAM sequences: S. thermophilus (NNAGAA [SEQ ID NO:48]), S. agalactiae (NGG [SEQ ID NO:47]), NNAGAAW [SEQ ID NO:49, W is A or T], NGGNG [SEQ ID NO:50]), N. meningitidis (NNNNGATT [SEQ ID NO:51]), T. denticola (NAAAAC [SEQ ID NO:52]), or F. novicida (NG [SEQ ID NO:53]) (where N's in all these particular PAM sequences are A, C, T, or G). Other examples of Cas9/PAMs useful herein include those disclosed in Shah et al. (RNA Biology 10:891-899) and Esvelt et al. (Nature Methods 10:1116-1121), which are incorporated herein by reference. Examples of target sequences herein follow SEQ ID NO:46, but with the XGG PAM replaced by any one of the foregoing PAMs.

(129) At least one RNA component that does not have a 5-cap is comprised in an RGEN in embodiments herein. This uncapped RNA component comprises a sequence complementary to a target site sequence in a chromosome or episome in a non-conventional yeast. An RGEN specifically binds to, and optionally cleaves, a DNA strand at the target site based on this sequence complementary. Thus, the complementary sequence of an RNA component in embodiments of the disclosed invention can also be referred to as a guide sequence or variable targeting domain.

(130) The guide sequence of an RNA component (e.g., crRNA or gRNA) herein can be at least 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 ribonucleotides in length; between 13-30 ribonucleotides in length; between 17-25 ribonucleotides in length; or between 17-20 ribonucleotides in length, for example. In general, a guide sequence herein has sufficient complementarity with a strand of a target DNA sequence to hybridize with the target sequence and direct sequence-specific binding of a Cas protein or Cas protein complex to the target sequence (if a suitable PAM is adjacent to the target sequence). The degree of complementarity between a guide sequence and its corresponding DNA target sequence is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, for example. The guide sequence can be engineered accordingly to target an RGEN to a DNA target sequence in a yeast cell.

(131) An RNA component herein can comprise a crRNA, for example, which comprises a guide sequence and a repeat (tracrRNA mate) sequence. The guide sequence is typically located at or near (within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more bases) the 5 end of the crRNA. Downstream the guide sequence of a crRNA is a repeat or tracrRNA mate sequence that is complementary to, and can hybridize with, sequence at the 5 end of a tracrRNA. Guide and tracrRNA mate sequences can be immediately adjacent, or separated by 1, 2, 3, 4 or more bases, for example. A tracrRNA mate sequence has, for example, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence complementarity to the 5 end of a tracrRNA. In general, degree of complementarity can be with reference to the optimal alignment of the tracrRNA mate sequence and tracrRNA sequence, along the length of the shorter of the two sequences. The length of a tracrRNA mate sequence herein can be at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 ribonucleotides in length, for example, and hybridizes with sequence of the same or similar length (e.g., plus or minus 1, 2, 3, 4, or 5 bases) at the 5 end of a tracrRNA. Suitable examples of tracrRNA mate sequences herein comprise SEQ ID NO:54 (guuuuuguacucucaagauuua), SEQ ID NO:55 (guuuuuguacucuca), SEQ ID NO:56 (guuuuagagcua, see Examples), or SEQ ID NO:57 (guuuuagagcuag), or variants thereof that (i) have at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity and (ii) can anneal with the 5-end sequence of a tracrRNA. The length of a crRNA herein can be at least about 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, or 48 ribonucleotides; or about 18-48 ribonucleotides; or about 25-50 ribonucleotides, for example.

(132) A tracrRNA should be included along with a crRNA in embodiments in which a Cas9 protein of a type II CRISPR system is comprised in the RGEN. A tracrRNA herein comprises in 5-to-3 direction (i) a sequence that anneals with the repeat region (tracrRNA mate sequence) of crRNA and (ii) a stem loop-containing portion. The length of a sequence of (i) can be the same as, or similar with (e.g., plus or minus 1, 2, 3, 4, or 5 bases), any of the tracrRNA mate sequence lengths disclosed above, for example. The total length of a tracrRNA herein (i.e., sequence components [i] and [ii]) can be at least about 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90 (or any integer between 30 and 90) ribonucleotides, for example. A tracrRNA may further include 1, 2, 3, 4, 5, or more uracil residues at the 3-end, which may be present by virtue of expressing the tracrRNA with a transcription terminator sequence.

(133) A tracrRNA herein can be derived from any of the bacterial species listed above from which a Cas9 sequence can be derived, for example. Examples of suitable tracrRNA sequences include those disclosed in U.S. Pat. No. 8,697,359 and Chylinski et al. (RNA Biology 10:726-737), which are incorporated herein by reference. A preferred tracrRNA herein can be derived from a Streptococcus species tracrRNA (e.g., S. pyogenes, S. thermophilus).

(134) TABLE-US-00002 OthersuitableexamplesoftracrRNAshereinmay comprise: SEQIDNO:58: uagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcacc gagucggugc(seeExamples), SEQIDNO:59: uagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaagug, or SEQIDNO:60: uagcaaguuaaaauaaggcuaguccguuauca, whicharederivedfromS.pyogenestracrRNA. OthersuitableexamplesoftracrRNAshereinmay comprise: SEQIDNO:61: uaaaucuugcagaagcuacaaagauaaggcuucaugccgaaaucaacacc cugucauuuuauggcaggguguuuucguuauuuaa, SEQIDNO:62: ugcagaagcuacaaagauaaggcuucaugccgaaaucaacacccugucau uuuauggcaggguguuuucguuauuua, or SEQIDNO:63: ugcagaagcuacaaagauaaggcuucaugccgaaaucaacacccugucau uuuauggcagggugu, whicharederivedfromS.thermophilustracrRNA.
Still other examples of tracrRNAs herein are variants of these tracrRNA SEQ ID NOs that (i) have at least about 80%, 85%, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity therewith and (ii) can function as a tracrRNA (e.g., 5-end sequence can anneal to tracrRNA mate sequence of a crRNA, sequence downstream from the 5-end sequence can form one or more hairpins, variant tracrRNA can form complex with a Cas9 protein).

(135) An RNA component of an RGEN disclosed herein can comprise, for example, a guide RNA (gRNA) comprising a crRNA operably linked to, or fused to, a tracrRNA. The crRNA component of a gRNA in certain preferred embodiments is upstream of the tracrRNA component (i.e., such a gRNA comprises, in 5-to-3 direction, a crRNA operably linked to a tracrRNA). Any crRNA and/or tracrRNA (and/or portion thereof, such as a crRNA repeat sequence, tracrRNA mate sequence, or tracrRNA 5-end sequence) as disclosed herein (e.g., above embodiments) can be comprised in a gRNA, for example.

(136) The tracrRNA mate sequence of the crRNA component of a gRNA herein should be able to anneal with the 5-end of the tracrRNA component, thereby forming a hairpin structure. Any of the above disclosures regarding lengths of, and percent complementarity between, tracrRNA mate sequences (of crRNA component) and 5-end sequences (of tracrRNA component) can characterize the crRNA and tracrRNA components of a gRNA, for example. To facilitate this annealing, the operable linkage or fusion of the crRNA and tracrRNA components preferably comprises a suitable loop-forming ribonucleotide sequence (i.e., a loop-forming sequence may link the crRNA and tracrRNA components together, forming the gRNA). Suitable examples of RNA loop-forming sequences include GAAA (SEQ ID NO:43, see Examples), CAAA (SEQ ID NO:44) and AAAG (SEQ ID NO:45). However, longer or shorter loop sequences may be used, as may alternative loop sequences. A loop sequence preferably comprises a ribonucleotide triplet (e.g., AAA) and an additional ribonucleotide (e.g., C or G) at either end of the triplet.

(137) A gRNA herein forms a hairpin (first hairpin) with annealing of its tracrRNA mate sequence (of the crRNA component) and tracrRNA 5-end sequence portions. One or more (e.g., 1, 2, 3, or 4) additional hairpin structures can form downstream from this first hairpin, depending on the sequence of the tracrRNA component of the gRNA. A gRNA may therefore have up to five hairpin structures, for example. A gRNA may further include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more residues following the end of the gRNA sequence, which may be present by virtue of expressing the gRNA with a transcription terminator sequence, for example. These additional residues can be all U residues, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% U residues, for example, depending on the choice of terminator sequence.

(138) Non-limiting examples of suitable gRNAs useful in the disclosed invention may comprise:

(139) TABLE-US-00003 SEQIDNO:64: NNNNNNNNNNNNNNNNNNNNguuuuuguacucucaagauuuaGAAAuaaa ucuugcagaagcuacaaagauaaggcuucaugccgaaaucaacacccugu cauuuuauggcaggguguuuucguuauuuaa, SEQIDNO:65: NNNNNNNNNNNNNNNNNNNNguuuuuguacucucaGAAAugcagaagcua caaagauaaggcuucaugccgaaaucaacacccugucauuuuauggcagg guguuuucguuauuuaa, SEQIDNO:66: NNNNNNNNNNNNNNNNNNNNguuuuuguacucucaGAAAugcagaagcua caaagauaaggcuucaugccgaaaucaacacccugucauuuuauggcagg gugu, SEQIDNO:67: NNNNNNNNNNNNNNNNNNNNguuuuuguacucucaGAAAuagcaaguuaa aauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc, SEQIDNO:68: NNNNNNNNNNNNNNNNNNNNguuuuagagcuaGAAAuagcaaguuaaaau aaggcuaguccguuaucaacuugaaaaagug, SEQIDNO:69: NNNNNNNNNNNNNNNNNNNNguuuuagagcuaGAAAuagcaaguuaaaau aaggcuaguccguuauca, or SEQIDNO:70: NNNNNNNNNNNNNNNNNNNNguuuuagagcuaGAAAuagcaaguuaaaau aaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu (seeExamples).
In each of SEQ ID NOs:64-70, the single-underlined sequence represents a crRNA portion of the gRNA. Each N represents a ribonucleotide base (A, U, G, or C) of a suitable guide sequence. The first block of lower case letters represents tracrRNA mate sequence. The second block of lower case letters represents a tracrRNA portion of the gRNA. The double-underlined sequence approximates that portion of tracrRNA sequence that anneals with the tracrRNA mate sequence to form a first hairpin. A loop sequence (GAAA, SEQ ID NO:43) is shown in capital letters, which operably links the crRNA and tracrRNA portions of each gRNA. Other examples of gRNAs herein include variants of the foregoing gRNAs that (i) have at least about 80%, 85%, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity (excluding guide sequence in this calculation) with these sequences, and (ii) can function as a gRNA that specifically targets a Cas9 protein to bind with, and optionally nick or cleave, a target DNA sequence.

(140) A gRNA herein can also be characterized in terms of having a guide sequence (VT domain) followed by a Cas endonuclease recognition (CER) domain. A CER domain comprises a tracrRNA mate sequence followed by a tracrRNA sequence. Examples of CER domains useful herein include those comprised in SEQ ID NOs:64-70 above (the CER domain in each is the sequence following the N's of the VT domain). Another suitable example of a CER domain is SEQ ID NO:1 (see Examples), which comprises in 5-to-3 direction the tracrRNA mate sequence of SEQ ID NO:56, the loop-forming sequence of SEQ ID NO:43 (GAAA), and the tracrRNA sequence of SEQ ID NO:58.

(141) An RNA component of an RGEN of the disclosed invention does not have a 5-cap (7-methylguanylate [m.sup.7G] cap). Thus, an RNA component herein does not have a 7-methylguanylate (m.sup.7G) cap at its 5-terminus. An RNA component herein can have, for example, a 5-hydroxyl group instead of a 5-cap. Alternatively, an RNA component herein can have, for example, a 5 phosphate instead of a 5-cap. It is believed that the RNA component can better accumulate in the nucleus following transcription, since 5-capped RNA (i.e., RNA having 5 m.sup.7G cap) is subject to nuclear export. Preferred examples of uncapped RNA components herein include suitable gRNAs, crRNAs, and/or tracrRNAs. In certain embodiments, an RNA component herein lacks a 5-cap, and optionally has a 5-hydroxyl group instead, by virtue of RNA autoprocessing by a ribozyme sequence at the 5-end of a precursor of the RNA component (i.e., a precursor RNA comprising a ribozyme sequence upstream of an RNA component such as a gRNA undergoes ribozyme-mediated autoprocessing to remove the ribozyme sequence, thereby leaving the downstream RNA component without a 5-cap). In certain other embodiments, an RNA component herein is not produced by transcription from an RNA polymerase III (Pol III) promoter.

(142) A yeast in certain embodiments further comprises a DNA polynucleotide sequence comprising (i) a promoter operably linked to (ii) a nucleotide sequence encoding an RNA component. This polynucleotide sequence is used by the yeast to express an RNA component that complexes with an Cas protein to form an RGEN. Such a polynucleotide sequence can be in the form of a plasmid, yeast artificial chromosome (YAC), cosmid, phagemid, bacterial artificial chromosome (BAC), virus, or linear DNA (e.g., linear PCR product), for example, or any other type of vector or construct useful for transferring a polynucleotide sequence into a non-conventional yeast cell. This polynucleotide sequence can exist transiently (i.e., not integrated into the genome) or stably (i.e., integrated into the genome) in a yeast cell herein. Also, this polynucleotide sequence can comprise, or lack, one or more suitable marker sequences (e.g., selection or phenotype marker).

(143) A suitable promoter comprised in a polynucleotide sequence for expressing an RNA component herein is operable in a non-conventional yeast cell, and can be constitutive or inducible, for example. A promoter in certain aspects can comprise a strong promoter, which is a promoter that can direct a relatively large number of productive initiations per unit time, and/or is a promoter driving a higher transcription level than the average transcription level of the genes in the yeast comprising the yeast.

(144) Examples of strong promoters useful herein include those disclosed in U.S. Patent Appl. Publ. Nos. 2012/0252079 (DGAT2), 2012/0252093 (EL1), 2013/0089910 (ALK2), 2013/0089911 (SPS19), 2006/0019297 (GPD and GPM), 2011/0059496 (GPD and GPM), 2005/0130280 (FBA, FBAIN, FBAINm), 2006/0057690 (GPAT) and 2010/0068789 (YAT1), which are incorporated herein by reference. Other examples of suitable strong promoters include those listed in Table 2.

(145) TABLE-US-00004 TABLE 2 Strong Promoters Promoter Name Native Gene Reference.sup.a XPR2 alkaline extracellular protease U.S. Pat. No. 4,937,189; EP220864 TEF translation elongation factor U.S. Pat. No. EF1- (tef) 6,265,185 GPD, GPM glyceraldehyde-3-phosphate- U.S. Pat. Nos. dehydrogenase (gpd), 7,259,255 phosphoglycerate mutase and 7,459,546 (gpm) GPDIN glyceraldehyde-3-phosphate- U.S. Pat. No. dehydrogenase (gpd) 7,459,546 GPM/FBAIN chimeric phosphoglycerate U.S. Pat. No. mutase (gpm)/fructose- 7,202,356 bisphosphate aldolase (fba1) FBA, FBAIN, fructose-bisphosphate aldolase U.S. Pat. No. FBAINm (fba1) 7,202,356 GPAT glycerol-3-phosphate U.S. Pat. No. O-acyltransferase (gpat) 7,264,949 YAT1 ammonium transporter enzyme U.S. Pat. Appl. Publ. (yat1) No. 2006/0094102 EXP1 export protein U.S. Pat. No. 7,932,077 .sup.aEach reference in this table is incorporated herein by reference.
Though the above-listed strong promoters are from Yarrowia lipolytica, it is believed that corresponding promoters (e.g., homologs) thereof from any of the non-conventional yeast disclosed herein, for example, could serve as a strong promoter. Thus, a strong promoter may comprise an XPR2, TEF, GPD, GPM, GPDIN, FBA, FBAIN, FBAINm, GPAT, YAT1, EXP1, DGAT2, EL1, ALK2, or SPS19 promoter, for example. Alternatively, a strong promoter such as any corresponding to any of the foregoing can be from other types of yeast (e.g., S. cerevisiae, S. pombe) (e.g., any of the strong promoters disclosed in U.S. Patent Appl. Publ. No. 2010/0150871, which is incorporated herein by reference). Other examples of strong promoters useful herein include PGK1, ADH1, TDH3, TEF1, PHO5, LEU2, and GAL1 promoters, as well as strong yeast promoters disclosed in Velculescu et al. (Cell 88:243-251), which is incorporated herein by reference. Still another example of a strong promoter useful herein can comprise SEQ ID NO:12 (a Yarrowia FBA1 promoter sequence).

(146) A promoter herein can comprise an RNA polymerase II (Pol II) promoter in certain embodiments. It is believed that all the above-listed strong promoters are examples of suitable Pol II promoters. Transcription from a Pol II promoter may involve formation of an RNA polymerase II complex of at least about 12 proteins (e.g., RPB1-RPN12 proteins), for example. RNA transcribed from a Pol II promoter herein typically is 5-capped (e.g., contains an m.sup.7G group at the 5-end). Since an RNA component herein does not have a 5-cap, a means for removing the 5-cap from an RNA component should be employed if it is expressed from a Pol II promoter herein. Suitable means for effectively removing a 5-cap from a Pol II-transcribed RNA component herein include appropriate use of one or more ribozymes (see below), group 1 self-splicing introns, and group 2 self-splicing introns, for example.

(147) A nucleotide sequence herein encoding an RNA component may further encode a ribozyme that is upstream of the sequence encoding the RNA component, for example. Thus, a yeast in certain embodiments further comprises a DNA polynucleotide sequence comprising (i) a promoter operably linked to (ii) a nucleotide sequence encoding, in 5-to-3 direction, a ribozyme and an RNA component. Transcripts expressed from such a polynucleotide sequence autocatalytically remove the ribozyme sequence to yield an RNA that does not have a 5-cap but which comprises the RNA component sequence. This autoprocessed RNA can comprise a crRNA or gRNA, for example, and can complex with a Cas protein such as a Cas9, thereby forming an RGEN.

(148) A ribozyme herein can be a hammerhead (HH) ribozyme, hepatitis delta virus (HDV) ribozyme, group I intron ribozyme, RnaseP ribozyme, or hairpin ribozyme, for example. Other non-limiting examples of ribozymes herein include Varkud satellite (VS) ribozymes, glucosamine-6-phosphate activated ribozymes (glmS), and CPEB3 ribozymes. Lilley (Biochem. Soc. Trans. 39:641-646) discloses information pertaining to ribozyme structure and activity. Examples of ribozymes that should be suitable for use herein include ribozymes disclosed in EP0707638 and U.S. Pat. Nos. 6,063,566, 5,580,967, 5,616,459, and 5,688,670, which are incorporated herein by reference.

(149) A hammerhead ribozyme is used in certain preferred embodiments. This type of ribozyme may be a type I, type II, or type III hammerhead ribozyme, for example, as disclosed in Hammann et al. (RNA 18:871-885), which is incorporated herein by reference. Multiple means for identifying DNA encoding a hammerhead ribozyme are disclosed in Hammann et al., which can be utilized accordingly herein. A hammerhead ribozyme herein may be derived from a virus, viroid, plant virus satellite RNA, prokaryote (e.g., Archaea, cyanobacteria, acidobacteria), or eukaryote such as a plant (e.g., Arabidopsis thaliana, carnation), protist (e.g., amoeba, euglenoid), fungus (e.g., Aspergillus, Y. lipolytica), amphibian (e.g., newt, frog), schistosome, insect (e.g., cricket), mollusc, mammal (e.g., mouse, human), or nematode, for example.

(150) A hammerhead ribozyme herein typically comprises three base-paired helices, each respectively referred to as helix I, H and III, separated by short linkers of conserved sequences. The three types of hammerhead ribozymes (I-III) are generally based on which helix the 5 and 3 ends of the ribozyme are comprised in. For example, if the 5 and 3 ends of a hammerhead ribozyme sequence contribute to stem I, then it can be referred to as a type I hammerhead ribozyme. Of the three possible topological types, type I can be found in the genomes of prokaryotes, eukaryotes and RNA plant pathogens, whereas type II hammerhead ribozymes have only been described in prokaryotes, and type III hammerhead ribozymes are mostly found in plants, plant pathogens and prokaryotes. A hammerhead ribozyme in certain embodiments is a type I hammerhead ribozyme.

(151) In certain embodiments, the sequence encoding a hammerhead ribozyme can comprise at least about 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 (or any integer between 40 and 150) nucleotides, 40-100 nucleotides, or 40-60 nucleotides.

(152) The sequence encoding a hammerhead ribozyme is upstream of the sequence encoding an RNA component. The sequence encoding a hammerhead ribozyme herein may be, for example, immediately 5 of, or at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides 5 of, sequence encoding a guide sequence of an RNA component (e.g., the guide sequence may be that of a crRNA or gRNA). The first 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 ribonucleotides of the hammerhead ribozyme typically should be complementary to the first same number, respectively, of ribonucleotides of the sequence immediately downstream the hammerhead ribozyme sequence. For example, if a polynucleotide sequence herein encodes an RNA comprising a hammerhead ribozyme sequence that is immediately upstream of the guide sequence of an RNA component, the first 6 ribonucleotides, for instance, of the ribozyme could be complementary to the first 6 ribonucleotides of the guide sequence. In this example, the hammerhead ribozyme would cleave the RNA transcript immediately upstream of the first position of the guide sequence (or stated another way, the hammerhead ribozyme would cleave the RNA transcript immediately downstream the ribozyme sequence). This logic similarly applies to the other foregoing example embodiments. For example, if a polynucleotide sequence herein encodes an RNA comprising a hammerhead ribozyme sequence that is 8 residues upstream of the guide sequence of an RNA component (e.g., there is an 8-residue spacer sequence), the first 6 ribonucleotides, for instance, of the ribozyme could be complementary to the 6 ribonucleotides immediately 3 of the ribozyme sequence. In this example, the hammerhead ribozyme would cleave the RNA transcript immediately downstream the ribozyme sequence. As yet another example, if a polynucleotide sequence herein encodes an RNA comprising a hammerhead ribozyme sequence that is immediately upstream of the guide sequence of an RNA component, the first 10 ribonucleotides, for instance, of the ribozyme could be complementary to the first 10 ribonucleotides of the guide sequence. In this example, the hammerhead ribozyme would cleave the RNA transcript immediately upstream of the first position of the guide sequence (or stated another way, the hammerhead ribozyme would cleave the RNA transcript immediately downstream the ribozyme sequence).

(153) An example of a hammerhead ribozyme sequence can be presented as follows:

(154) NNNNNNcugaugaguccgugaggacgaaacgaguaagcucguc (SEQ ID NO:15, N can be A, U, C, or G; see Examples). The first 6 residues of SEQ ID NO:15 can be designed to complement (anneal to) the first 6 residues (e.g., of a guide sequence of a crRNA or gRNA disclosed herein) immediately following SEQ ID NO:15 in an RNA transcript expressed from a DNA polynucleotide herein. The ribozyme would cleave the transcript immediately following SEQ ID NO:15. Although SEQ ID NO:15 is shown with 6 residues (N) for annealing with sequence residues immediately following SEQ ID NO:15, there can be 5 to 15 N residues at the beginning of this ribozyme for this purpose. It is noted that, with an RNA transcript comprising SEQ ID NO:15, (i) helix I of the hammerhead ribozyme would be formed by the annealing of the N residues with the first 6 residues immediately following SEQ ID NO:15 in a transcript, (ii) helix II would be formed by the annealing of the complementary sequences indicated with single-underlining, and (iii) helix III would be formed by the annealing of the complementary sequences indicated with double-underlining. Thus, a hammerhead ribozyme in certain embodiments can be a variant of SEQ ID NO:15 having (i) at least about 80%, 85%, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity (excluding N sequence in this calculation) with SEQ ID NO:15, and (ii) regions aligning with the single-underlined and double-underlined regions of SEQ ID NO:15 that anneal to each other to form helices II and III (helix I is formed be appropriate selection of the N residues).

(155) Examples of sequences that can be linked to SEQ ID NO:15 and various embodiments thereof (above) include gRNAs comprising one of SEQ ID NOs:64-70.

(156) A DNA polynucleotide herein encoding an RNA sequence comprising a 5 hammerhead ribozyme linked to an RNA component (a ribozyme-RNA component cassette herein) may be designed to drive transcription of a transcript with a 5-end beginning immediately with the hammerhead ribozyme sequence (i.e., ribozyme sequence starts at transcription start site). Alternatively, a DNA polynucleotide may be designed to drive transcription of a transcript having non-ribozyme sequence upstream from the ribozyme-RNA component cassette. Such 5 non-ribozyme transcript sequence can be as short as a few nucleotides (1-10) long, up to as long as 5000-20000 nucleotides, for example (this sequence 5 of the ribozyme is removed from the RNA component when the ribozyme cleaves itself from the RNA component).

(157) In certain embodiments, a DNA polynucleotide comprising a ribozyme-RNA component cassette could comprise a suitable transcription termination sequence downstream of the RNA component sequence. Examples of transcription termination sequences useful herein are disclosed in U.S. Pat. Appl. Publ. No. 2014/0186906, which is herein incorporated by reference. For example, an S. cerevisiae Sup4 gene transcription terminator sequence (e.g., SEQ ID NO:8) can be used. Such embodiments typically do not comprise a ribozyme sequence located downstream from a ribozyme-RNA component cassette. Also, such embodiments typically comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more residues following the end of the RNA component sequence, depending on the choice of terminator sequence. These additional residues can be all U residues, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% U residues, for example, depending on the choice of terminator sequence. Alternatively, a ribozyme sequence (e.g., hammerhead or HDV ribozyme) can be 3 of (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides) the RNA component sequence; the RNA component sequence in such embodiments is flanked by upstream and downstream ribozymes. A 3 ribozyme sequence can be positioned accordingly such that it cleaves itself from the RNA component sequence; such cleavage would render a transcript ending exactly at the end of the RNA component sequence, or with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more residues following the end of the RNA component sequence, for example.

(158) In certain embodiments, a DNA polynucleotide can comprise (i) a promoter operably linked to (ii) a sequence comprising more than one ribozyme-RNA component cassettes (i.e., tandem cassettes). A transcript expressed from such a DNA polynucleotide can have, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more ribozyme-RNA component cassettes. A 3 ribozyme sequence can optionally be included (e.g., as above) following each RNA component sequence to allow cleavage and separation of the RNA component from downstream transcript sequence. Each RNA component in such embodiments typically is designed to guide an RGEN herein to a unique DNA target site. Thus, such a DNA polynucleotide can be used in a non-conventional yeast accordingly to target multiple different target sites at the same time, for example; such use can optionally be characterized as a multiplexing method. A 5 hammerhead ribozyme that is linked to an RNA component that is linked to a 3 ribozyme can be referred to as a ribozyme-RNA component-ribozyme cassette herein. A DNA polynucleotide herein for expressing a transcript comprising tandem ribozyme-RNA component-ribozyme cassettes can be designed such that there are about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more nucleotides between each cassette (e.g., non-coding spacer sequence). The distances between each cassette may be the same or different.

(159) Though certain of the above embodiments have been described in terms of hammerhead ribozyme sequences, such embodiments can also be characterized in terms of any other ribozyme sequence herein (e.g., HDV ribozyme), accordingly, instead of a hammerhead ribozyme sequence. One of ordinary skill in the art would understand how to position such other ribozyme sequence to cleave at a particular site.

(160) A yeast in certain embodiments further comprises a DNA polynucleotide sequence comprising (i) a promoter operably linked to (ii) a nucleotide sequence encoding a Cas protein (e.g., Cas9). This polynucleotide sequence is used by the yeast to express a Cas protein that complexes with an RNA component to form an RGEN. Such a polynucleotide sequence can be in the form of a plasmid, YAC, cosmid, phagemid, BAC, virus, or linear DNA (e.g., linear PCR product), for example, or any other type of vector or construct useful for transferring a polynucleotide sequence into a non-conventional yeast cell. Any Pol II promoter disclosed herein may be used, for example. Any of the features disclosed above regarding a DNA polynucleotide sequence for expressing an RNA component may be applied, accordingly, to a DNA polynucleotide sequence for expressing a Cas protein. This polynucleotide sequence can exist transiently (i.e., not integrated into the genome) or stably (i.e., integrated into the genome) in a yeast cell herein. A yeast in other aspects can have, in addition to a DNA polynucleotide for expressing a Cas protein, a DNA polynucleotide for expressing an RNA component (e.g., as described above). Both these DNA polynucleotides may be stable or transient to the yeast; alternatively, a DNA polynucleotide for expressing a Cas protein can be stable and the DNA polynucleotide for expressing an RNA component can be transient (or vice versa).

(161) A DNA polynucleotide sequence can alternatively be one for expressing both a Cas protein and a suitable RNA component for providing an RGEN in a yeast cell. Such a DNA polynucleotide can comprise, for example, (i) a promoter operably linked to a nucleotide sequence encoding an RNA component (of an RGEN) (an RNA component cassette), and (ii) a promoter operably linked to a nucleotide sequence encoding a Cas protein (e.g., Cas9) (a Cas cassette). Any of the above-described features regarding DNA polynucleotides for expressing a Cas protein or an RNA component can be applied, for example, to a DNA polynucleotide sequence for expressing both a Cas protein and a suitable RNA component in a non-conventional yeast cell. Also, any of the Cas proteins and RNA components (e.g., crRNA or gRNA) disclosed herein may be expressed from this DNA polynucleotide sequence. One or more RNA components and/or Cas cassettes may be comprised within a DNA polynucleotide sequence in certain embodiments. In other aspects, one or more RNA components may be expressed in tandem as described above. Promoters used in a Cas cassette and an RNA cassette may be the same or different. It is contemplated that such a DNA polynucleotide sequence would be useful for expressing an RGEN in both non-conventional yeast and conventional yeast.

(162) The disclosed invention also concerns a method of targeting an RNA-guided endonuclease (RGEN) to a target site sequence in a chromosome or episome in a non-conventional yeast. This method comprises providing to the nucleus of the yeast an RGEN comprising at least one RNA component that does not have a 5-cap, wherein the RNA component comprises a sequence complementary to the target site sequence, and wherein the RGEN binds to, and optionally cleaves, all or part of the target site sequence.

(163) This targeting method can be practiced using any of the above-disclosed embodiments or below Examples regarding each of the method features (e.g., yeast type, RGEN, RNA component, etc.), for example. Thus, any of the features disclosed above or in the Examples, or any combination of these features, can be used appropriately to characterize embodiments of a targeting method herein. The following targeting method features are examples.

(164) A non-conventional yeast in certain embodiments of a targeting method herein can be a member of any of the following genera: Yarrowia, Pichia, Schwanniomyces, Kluyveromyces, Arxula, Trichosporon, Candida, Ustilago, Torulopsis, Zygosaccharomyces, Trigonopsis, Cryptococcus, Rhodotorula, Phaffia, Sporobolomyces, and Pachysolen. Y. lipolytica is a suitable Yarrowia yeast herein. Other non-limiting examples of non-conventional yeast useful in a targeting method are disclosed herein.

(165) An RGEN suitable for use in a targeting method herein can comprise a Cas protein of a type I, II, or III CRISPR system. A Cas9 protein can be used in certain embodiments, such as a Streptococcus Cas9. Examples of Streptococcus Cas9 proteins suitable for use in a targeting method include Cas9 proteins comprising amino acid sequences derived from an S. pyogenes, S. thermophilus, S. pneumoniae, S. agalactiae, S. parasanguinis, S. oralis, S. salivarius, S. macacae, S. dysgalactiae, S. anginosus, S. constellatus, S. pseudoporcinus, or S. mutans Cas9 protein. Other non-limiting examples of RGENs and Cas9 proteins useful in a targeting method herein are disclosed herein. For example, an RGEN that can cleave one or both strands at a DNA target sequence may be used.

(166) An RNA component of an RGEN for use in a targeting method herein can comprise, for example, a gRNA comprising a crRNA operably linked to, or fused to, a tracrRNA. Any crRNA and/or tracrRNA (and/or portion thereof, such as a tracrRNA mate sequence, or tracrRNA 5-end sequence) as disclosed herein can be comprised in a gRNA, for example. Also, any gRNA disclosed herein can be used in the targeting method, for example.

(167) A PAM (protospacer-adjacent motif) sequence may be adjacent to the target site sequence, for example. In certain embodiments of a targeting method herein, a PAM sequence is immediately downstream from, or within 2, or 3 nucleotides downstream of, a target site sequence that is complementary to the strand in the target site that is in turn complementary to an RNA component guide sequence. In embodiments herein in which the RGEN is an endonucleolytically active Cas9 protein complexed with an RNA component, the Cas9 binds to the target sequence as directed by the RNA component and cleaves both strands immediately 5 of the third nucleotide position upstream of the PAM sequence. Examples of suitable PAM sequences include S. pyogenes (NGG [SEQ ID NO:47]) and S. thermophilus (NNAGAA [SEQ ID NO:48]) PAM sequences, which can be used for targeting with Cas9 proteins derived from each species, respectively. Also, any PAM sequence as disclosed herein can be used in the targeting method, for example.

(168) A yeast in certain embodiments of a targeting method herein further comprises a DNA polynucleotide sequence comprising (i) a promoter operably linked to (ii) a nucleotide sequence encoding an RNA component. It is with such a DNA polynucleotide that an RNA component of an RGEN can be provided to the nucleus of a yeast, since the RNA component is transcribed from the DNA polynucleotide. Examples of suitable DNA polynucleotide sequences for expressing an RNA component (of an RGEN) in a yeast nucleus are disclosed herein. Any of the promoters as disclosed herein can be used in such a DNA polynucleotide sequence, for example, such as a strong promoter and/or one that comprises a Pol II promoter sequence. In certain embodiments, a DNA polynucleotide encoding an RNA component can be used to provide an RNA component in a yeast that has already been engineered to express a Cas protein (e.g., stable Cas expression).

(169) A nucleotide sequence herein encoding an RNA component may further encode a ribozyme that is upstream of the sequence encoding the RNA component, for example. Thus, a yeast in certain embodiments of a targeting method herein may comprise a DNA polynucleotide sequence comprising (i) a promoter operably linked to (ii) a nucleotide sequence encoding, in 5-to-3 direction, a ribozyme and an RNA component. It is with such a DNA polynucleotide that an RNA component of an RGEN can be provided to the nucleus of a yeast, since the RNA component is transcribed from the DNA polynucleotide. A ribozyme herein can be a hammerhead ribozyme, hepatitis delta virus (HDV) ribozyme, group I intron ribozyme, RnaseP ribozyme, or hairpin ribozyme, for example. Any ribozyme as disclosed herein, as well as any polynucleotide sequence as disclosed herein encoding a ribozyme linked to an RNA component, can be used in the targeting method, for example.

(170) A yeast in certain embodiments of a targeting method herein may further comprise a DNA polynucleotide sequence comprising (i) a promoter operably linked to (ii) a nucleotide sequence encoding a Cas protein (e.g., Cas9). It is with such a DNA polynucleotide that a Cas protein component of an RGEN can be provided in the yeast. Examples of suitable DNA polynucleotide sequences for expressing a Cas protein component (of an RGEN) in a yeast are disclosed herein. Any of the promoters as disclosed herein can be used in such a DNA polynucleotide sequence, for example, such as a strong promoter.

(171) A donor polynucleotide comprising at least one sequence homologous to a sequence at or near a DNA target site sequence can also be provided to the yeast in certain embodiments of a targeting method (along with providing an RGEN that nicks or cuts at the target site sequence). Suitable examples include donor polynucleotides with homology arms. Any donor polynucleotide as disclosed herein can be used in a targeting method, for example. Such embodiments of this method typically involve HR between the donor polynucleotide and the target sequence (after RGEN-mediated nicking or cleavage of the target sequence); thus, these this method can optionally also be referred to as a method of performing HR in a non-conventional yeast. Examples of HR strategies that can be performed by this method are disclosed herein. A suitable amount of a donor DNA polynucleotide for targeting in a yeast cell can be at least about 300, 400, 500, 600, 700, or 800 molecules of the donor DNA per yeast cell.

(172) Any constructs or vectors comprising a DNA polynucleotide described herein for expressing RGEN components may be introduced into a non-conventional yeast cell by any standard technique. These techniques include transformation (e.g., lithium acetate transformation (Methods in Enzymology, 194:186-187), biolistic impact, electroporation, and microinjection, for example. As examples, U.S. Pat. Nos. 4,880,741 and 5,071,764, and Chen et al. (Appl. Microbiol. Biotechnol. 48:232-235), which are incorporated herein by reference, describe DNA transfer techniques for Y. lipolytica.

(173) A targeting method herein can be performed for the purpose of creating an indel in a non-conventional yeast. Such a method can be performed as disclosed above, but without further providing a donor DNA polynucleotide that could undergo HR at or near the target DNA site (i.e., NHEJ is induced in this method). Examples of indels that can be created are disclosed herein. The size of an indel may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more bases, for example. An indel in certain embodiments can be even larger such as at least about 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 bases. In still other embodiments, insertions or deletions can be at least about 500, 750, 1000, or 1500 bases. When attempting to create an indel in certain embodiments, a single base substitution may instead be formed in a target site sequence. Thus, a targeting method herein can be performed for the purpose of creating single base substitution, for example.

(174) In certain embodiments of a targeting method herein aimed at indel formation, the frequency of indel formation in a non-conventional yeast (e.g., Y. lipolytica) is significantly higher than what would be observed using the same or similar targeting strategy in a conventional yeast such as S. cerevisiae. For example, while the frequency of indel formation in a conventional yeast may be about 0.0001 to 0.001 (DiCarlo et al., Nucleic Acids Res. 41:4336-4343), the frequency in a non-conventional yeast herein may be at least about 0.05, 0.10, 0.15, 0.20, 0.25, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, 0.60, 0.65, 0.70, 0.75, or 0.80. Thus, the frequency of indel formation in a non-conventional yeast herein may be at least about 50, 100, 250, 500, 750, 1000, 2000, 4000, or 8000 times higher, for example, than what would be observed using the same or similar Cas-mediated targeting strategy in a conventional yeast. Certain aspects of these embodiments can be with regard to a targeting method that does not include a donor DNA, and/or in which RGEN components (a Cas and a suitable RNA component) are expressed from the same vector/construct.

(175) A targeting method herein can be performed in such a way that 2 or more DNA target sites are targeted in the method, for example. Such a method can comprise providing to a yeast a DNA polynucleotide that expresses a transcript comprising tandem ribozyme-RNA component cassettes (e.g., tandem ribozyme-RNA component-ribozyme cassettes) as disclosed herein. This method can target DNA sites very close to the same sequence (e.g., a promoter or open reading frame, and/or sites that are distant from each other (e.g., in different genes and/or chromosomes). Such a method can be performed with (for HR) or without (for NHEJ leading to indel and/or base substitution) suitable donor DNA polynucleotides, depending on the desired outcome of the targeting.

(176) A targeting method in certain embodiments can be performed to disrupt one or more DNA polynucleotide sequences encoding a protein or a non-coding RNA. An example of such a sequence that can be targeted for disruption is one encoding a marker (i.e., a marker gene). Non-limiting examples of markers herein include screenable markers and selectable markers. A screenable marker herein can be one that renders a yeast visually different under appropriate conditions. Examples of screenable markers include polynucleotides encoding beta-glucuronidase (GUS), beta-galactosidase (lacZ), and fluorescent proteins (e.g., GFP, RFP, YFP, BFP). A selectable marker herein can be one that renders a yeast resistant to a selective agent or selective environment. Examples of selectable markers are auxotrophic markers such as HIS3, LEU2, TRP1, MET15, or URA3, which allow a yeast to survive in the absence of exogenously provided histidine, leucine, tryptophan, methionine, or uracil, respectively. Other examples of selectable markers are antibiotic (antifungal)-resistance markers such as those rendering a yeast resistance to hygromycin B, nourseothricin, phleomycin, puromycin, or neomycin (e.g., G418).

(177) At least one purpose for disrupting a marker in certain embodiments can be for marker recycling. Marker recycling is a process, for example, comprising (i) transforming a yeast with a marker and heterologous DNA sequence, (ii) selecting a transformed yeast comprising the marker and the heterologous DNA sequence (where marker-selectable yeast typically have a higher chance of containing the heterologous DNA sequence), (iii) disrupting the marker, and then repeating steps (i)-(iii) as many times as necessary (using the same marker, but each cycle using a different heterologous DNA sequence) to transform the yeast with multiple heterologous DNA sequences. One or more heterologous sequences in this process may comprise the marker itself in the form of a donor polynucleotide(e.g., marker flanked by homology arms for targeting a particular locus). Examples of marker recycling processes herein include those using URA3 as a marker in non-conventional yeast such as Y. lipolytica.

(178) Non-limiting examples of compositions and methods disclosed herein are as follows:

(179) 1. A non-conventional yeast comprising at least one RNA-guided endonuclease (RGEN) comprising at least one RNA component that does not have a 5-cap, wherein the RNA component comprises a sequence complementary to a target site sequence on a chromosome or episome in the yeast, wherein the RGEN can bind to all or part of the target site sequence. 2. The non-conventional yeast of embodiment 1, wherein the RGEN can bind to and cleave all or part of the target site sequence. 3. The yeast of embodiment 1, wherein said yeast is a member of a genus selected from the group consisting of Yarrowia, Pichia, Schwanniomyces, Kluyveromyces, Arxula, Trichosporon, Candida, Ustilago, Torulopsis, Zygosaccharomyces, Trigonopsis, Cryptococcus, Rhodotorula, Phaffia, Sporobolomyces, and Pachysolen. 4. The yeast of embodiment 1, wherein the RGEN comprises a CRISPR (clustered regularly interspaced short palindromic repeats)-associated (Cas) protein-9 (Cas9) amino acid sequence. 5. The yeast of embodiment 4, wherein the Cas9 protein is a Streptococcus Cas9 protein. 6. The yeast of embodiment 4, wherein the RNA component comprises a guide RNA (gRNA) comprising a CRISPR RNA (crRNA) operably linked to a trans-activating CRISPR RNA (tracrRNA). 7. The yeast of embodiment 4, wherein a PAM (protospacer-adjacent motif) sequence is adjacent to the target site sequence. 8. A non-conventional yeast comprising a polynucleotide sequence comprising a promoter operably linked to at least one nucleotide sequence, wherein said nucleotide sequence comprises a DNA sequence encoding a ribozyme upstream of a DNA sequence encoding an RNA component, wherein said RNA component comprises a variable targeting domain complementary to a target site sequence on a chromosome or episome in the yeast, wherein the RNA component can form a RNA-guided endonuclease (RGEN), wherein said RGEN can bind to all or part of the target site sequence. 9. The non-conventional yeast of embodiment 8, wherein the RGEN can bind to and cleave all or part of the target site sequence. 10. The non-conventional yeast of embodiment 8, wherein the RNA transcribed from the nucleotide sequence autocatalytically removes the ribozyme to yield said RNA component, wherein said RNA component does not have a 5 cap. 11. The non-conventional yeast of embodiment 10, wherein the ribozyme is a hammerhead ribozyme, hepatitis delta virus ribozyme, group I intron ribozyme, RnaseP ribozyme, or hairpin ribozyme. 12. The non-conventional yeast of embodiment 8, wherein the RNA transcribed from the nucleotide sequence does not autocatalytically removes the ribozyme to yield a ribozyme-RNA component fusion molecule without a 5 cap. 13. The non-conventional yeast of embodiment 12, wherein the ribozyme is a HDV ribozyme. 14. The non-conventional yeast of embodiment 8, wherein the promoter is a strong promoter. 15. The non-conventional yeast of embodiment 8, wherein the promoter comprises a Pol II promoter sequence. 16. A method of targeting an RNA-guided endonuclease (RGEN) to a target site sequence on a chromosome or episome in a non-conventional yeast, said method comprising providing to said yeast an RGEN comprising at least one RNA component that does not have a 5-cap, wherein the RNA component comprises a sequence complementary to the target site sequence, wherein the RGEN binds to all or part of the target site sequence. 17. The method of embodiment 16, wherein the RGEN can bind to and cleave all or part of the target site sequence. 18. A method of targeting an RNA-guided endonuclease (RGEN) to a target site sequence on a chromosome or episome in a non-conventional yeast, said method comprising providing to said yeast an RGEN comprising at least one ribozyme-RNA component fusion molecule, wherein the RNA component comprises a sequence complementary to the target site sequence, wherein the RGEN binds to all or part of the target site sequence. 19. The method of embodiment 18, wherein the RGEN can bind to and cleave all or part of the target site sequence. 20. A method of targeting an RNA-guided endonuclease (RGEN) to a target site sequence on a chromosome or episome in a non-conventional yeast, said method comprising providing to said yeast a first recombinant DNA construct comprising a DNA sequence encoding a Cas endonuclease, and at least a second recombinant DNA construct comprising a DNA sequence encoding a ribozyme upstream of an RNA component, wherein the RNA transcribed from the second recombinant DNA construct autocatalytically removes the ribozyme to yield said RNA component , wherein the RNA component and the Cas9 endonuclease can form an RGEN that can bind to all or part of the target site sequence. 21. The method of embodiment 20, wherein the RGEN can bind to and cleave all or part of the target site sequence. 22. A method of targeting an RNA-guided endonuclease (RGEN) to a target site sequence on a chromosome or episome in a non-conventional yeast, said method comprising providing to said yeast a first recombinant DNA construct comprising a DNA sequence encoding a Cas endonuclease, and at least a second recombinant DNA construct comprising a DNA sequence encoding a ribozyme-RNA component fusion molecule, wherein said ribozyme-RNA component fusion molecule and the Cas9 endonuclease can form an RGEN that can bind to, and optionally cleave, all or part of the target site sequence. 23. The method of embodiment 22, wherein the RGEN can bind to and cleave all or part of the target site sequence. 24. A method for modifying a target site on a chromosome or episome in a non-conventional yeast, the method comprising providing to a non-conventional yeast a first recombinant DNA construct comprising a DNA sequence encoding a Cas endonuclease, and a second recombinant DNA construct comprising a DNA sequence encoding a ribozyme upstream of an RNA component, wherein the RNA transcribed from the second recombinant DNA construct autocatalytically removes the ribozyme to yield said RNA component that does not have a 5 cap, wherein the Cas9 endonuclease introduces a single or double-strand break at said target site. 25. A method for modifying a target site on a chromosome or episome in a non-conventional yeast, the method comprising providing to a non-conventional yeast a first recombinant DNA construct comprising a DNA sequence encoding a Cas endonuclease, and a second recombinant DNA construct comprising a DNA sequence encoding a ribozyme-RNA component fusion molecule that does not have a 5cap, wherein said ribozyme-RNA component fusion molecule and the Cas9 endonuclease can form a RGEN that introduces a single or double-strand break at said target site. 26. A method for modifying multiple target sites on a chromosome or episome in a non-conventional yeast, the method comprising providing to a non-conventional yeast at least a first recombinant DNA construct comprising a DNA sequence encoding a Cas endonuclease, and at least a second recombinant DNA construct comprising a promoter operably linked to at least one polynucleotide, wherein said at least one polynucleotide encodes an RNA molecule comprising a ribozyme upstream of an RNA component, wherein said RNA molecule autocatalytically removes the ribozyme to yield said RNA component , wherein the Cas9 endonuclease introduces a single or double-strand break at said target site. 27. A method for modifying multiple target sites on a chromosome or episome in a non-conventional yeast, the method comprising providing to a non-conventional yeast at least a first recombinant DNA construct comprising a DNA sequence encoding a Cas endonuclease, and at least a second recombinant DNA construct comprising a promoter operably linked to at least one polynucleotide, wherein said at least one polynucleotide encodes a ribozyme-RNA component fusion molecule, wherein said ribozyme-RNA component fusion molecule and the Cas9 endonuclease can form a RGEN that introduces a single or double-strand break at said target site. 28. The method of any of embodiments 22-25, further comprising identifying at least one non-conventional yeast cell that has a modification at said target, wherein the modification includes at least one deletion, addition or substitution of one or more nucleotides in said target site. 29. The method of any of embodiments 24-28, further comprising providing a donor DNA to said yeast, wherein said donor DNA comprises a polynucleotide of interest. 30. The method of embodiment 29, further comprising identifying at least one yeast cell comprising in its chromosome or episome the polynucleotide of interest integrated at said target site. 31. A method for editing a nucleotide sequence on a chromosome or episome in a non-conventional yeast, the method comprising providing to a non-conventional yeast a polynucleotide modification template DNA, a first recombinant DNA construct comprising a DNA sequence encoding a Cas endonuclease, and a second recombinant DNA construct comprising a DNA sequence encoding a ribozyme upstream of an RNA component, wherein the RNA transcribed from the second recombinant DNA construct autocatalytically removes the ribozyme to yield said RNA component that does not have a 5cap, wherein the Cas9 endonuclease introduces a single or double-strand break at a target site in the chromosome or episome of said yeast, wherein said a polynucleotide modification template DNA comprises at least one nucleotide modification of said nucleotide sequence. 32. A method for editing a nucleotide sequence on a chromosome or episome in a non-conventional yeast, the method comprising providing to a non-conventional yeast a polynucleotide modification template DNA, a first recombinant DNA construct comprising a DNA sequence encoding a Cas endonuclease, and a second recombinant DNA construct comprising a DNA sequence encoding a ribozyme-RNA component fusion molecule that does not have a 5cap, wherein said ribozyme-RNA component fusion molecule and the Cas9 endonuclease can form a RGEN that introduces a single or double-strand break at a target site in the chromosome or episome of said yeast, wherein said a polynucleotide modification template DNA comprises at least one nucleotide modification of said nucleotide sequence. 33. A method for editing a nucleotide sequences on a chromosome or episome in a non-conventional yeast, the method comprising providing to a non-conventional yeast at least one a polynucleotide modification template DNA, at least a first recombinant DNA construct comprising a DNA sequence encoding a Cas endonuclease, and at least a second recombinant DNA construct comprising a promoter operably linked to at least one polynucleotide, wherein said at least one polynucleotide encodes an RNA molecule comprising a ribozyme upstream of an RNA component, wherein said RNA molecule autocatalytically removes the ribozyme to yield said RNA component that does not have a 5cap , wherein the Cas9 endonuclease introduces a single or double-strand break at a target site in the chromosome or episome of said yeast, wherein said polynucleotide modification template DNA comprises at least one nucleotide modification of said nucleotide sequence. 34. A method for editing a nucleotide sequence on a chromosome or episome in a non-conventional yeast, the method comprising providing to a non-conventional yeast at least one a polynucleotide modification template DNA, at least a first recombinant DNA construct comprising a DNA sequence encoding a Cas endonuclease, and at least a second recombinant DNA construct comprising a promoter operably linked to at least one polynucleotide, wherein said at least one polynucleotide encodes a ribozyme-RNA component fusion molecule that does not have a 5cap, wherein said ribozyme-RNA component fusion molecule and the Cas9 endonuclease can form a RGEN that introduces a single or double-strand break at a target site in the chromosome or episome of said yeast, wherein said a polynucleotide modification template DNA comprises at least one nucleotide modification of said nucleotide sequence. 35. The method of any of embodiments 24-34 wherein the first recombinant DNA and the second recombinant DNA are located on the same plasmid. 36. The method of any of embodiments 24-34 wherein the first recombinant DNA and the second recombinant DNA are located on separate plasmid. 37. A method for silencing a nucleotide sequence on a chromosome or episome in a non-conventional yeast, the method comprising providing to a non-conventional yeast, at least a first recombinant DNA construct comprising a DNA sequence encoding an inactivated Cas9 endonuclease, and at least a second recombinant DNA construct comprising a promoter operably linked to at least one polynucleotide, wherein said at least one polynucleotide encodes a ribozyme-RNA component fusion molecule that does not have 5cap, wherein said ribozyme-RNA component fusion molecule and the inactivated Cas9 endonuclease can form a RGEN that binds to said nucleotide sequence in the chromosome or episome of said yeast, thereby blocking transcription of said nucleotide sequence. 38. A high throughput method for the production of multiple guide RNAs for gene modification in non-conventional yeast, the method comprising:

(180) a) providing a recombinant DNA construct comprising a promoter operably linked to, in 5 to 3 order, a first DNA sequence encoding a ribozyme, a second DNA sequence encoding a counterselection agent, a third DNA sequence encoding a CER domain of a guide RNA, and a terminator sequence;

(181) b) providing at least one oligonucleotide duplex to the recombinant DNA construct of (a), wherein said oligonucleotide duplex is originated from combining a first single stranded oligonucleotide comprising a DNA sequence capable of encoding a variable targeting domain (VT) of a guide RNA target sequence with a second single stranded oligonucleotide comprising the complementary sequence to the DNA sequence encoding the variable targeting domain;

(182) c) exchanging the counterselection agent of (a) with the at least one oligoduplex of (b), thereby creating a library of recombinant DNA constructs each comprising a DNA sequence capable of encoding a variable targeting domain of a guide RNA; and,

(183) d) transcribing the library of recombinant DNA constructs of (c), thereby creating a library of ribozyme-guideRNA molecules. 39. The method of embodiment 38, further comprising inducing the library of ribozyme-guide RNA molecules such that said molecules autocatalitically remove the ribozyme and aany RNA sequence upstream of the ribozyme to yield a library of guide RNA molecules that do not contain 5 cap. 40. The method of embodiment 38, further comprising inducing the library of ribozyme-guide RNA molecules such that said molecules cleaves any RNA sequence upstream of the ribozyme TO yield a ribozyme-gRNA fusion molecules that do not contain 5 cap. 41. A recombinant DNA sequence comprising (i) a polymerase-II promoter operably linked to (ii) a nucleotide sequence encoding a ribozyme and a guide RNA, wherein said ribozyme is upstream of said guide RNA, wherein RNA transcribed from the nucleotide sequence of (ii) autocatalically removes the ribozyme to yield said guide RNA, and wherein said guide RNA can form a RGEN that can recognize, bind to, and optionally cleave a target site in the genome of a non-conventional yeast. 42. A recombinant RNA sequence comprising a ribozyme and a guide RNA, wherein said ribozyme is upstream of said guide RNA, wherein said ribozyme can be autocatalically removed to yield said guide RNA, and wherein said guide RNA can form a RGEN that can recognize, bind to, and optionally cleave a target site in the genome of a non-conventional yeast. 43. A recombinant DNA sequence comprising (i) a polymerase-II promoter operably linked to (ii) a nucleotide sequence encoding a ribozyme and a guide RNA, wherein said ribozyme is upstream of said guide RNA, wherein RNA transcribed from the nucleotide sequence of (ii) yields a ribozyme-guide RNA fusion molecule, and wherein said ribozyme-guide fusion molecule can form a RGEN that can recognize, bind to, and optionally cleave a target site in the genome of a non-conventional yeast. 44. A recombinant RNA sequence comprising a ribozyme -guide RNA fusion molecule, wherein said ribozyme-guide RNA fusion molecule can form a RGEN that can recognize, bind to, and optionally cleave a target site in the genome of a non-conventional yeast.

EXAMPLES

(184) The disclosed invention is further defined in the following Examples. It should be understood that these Examples, while indicating certain preferred aspects of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various uses and conditions.

Example 1

sgRNA Expressed from a Pol III Promoter in Yarrowia Does Not Guide Cas9 to Target Sites and Mediate DNA Cleavage

(185) This example discloses vectors and cassettes designed to express sgRNAs and Cas9 protein in Yarrowia lipolytica targeting the Leu2 locus. If sgRNAs and Cas9 produced in this yeast can interact, find and cleave target sites, mutations should be generated via error-prone non-homologous end-joining (NHEJ) at the target sites.

(186) FIG. 1 illustrates a sgRNA molecule, which is a single RNA molecule containing two regions, a variable targeting domain (VT) (guide sequence) and Cas endonuclease recognition domain (CER). The VT region can be a 20 mer of RNA polynucleotide that has identity to a targeted nucleic acid molecule. The VT domain specifies a target site for cleavage in the target site that lies 5 of a PAM motif (e.g., NGG, SEQ ID NO:47). The CER domain interacts with Cas9 protein and allows the VT domain to interact and direct the Cas9 protein cleavage (Jinek et al., Science 337:816-821). Both VT and CER domains are required for the function of an sgRNA.

(187) DNA sequences encoding VT domains that target Cas9 to three individual target sites (Leu2-1, Leu2-2, Leu2-3) in the coding region of the LEU2 locus of Yarrowia are listed in Table 3. Table 3 also lists a DNA sequence encoding a VT domain targeting the coding region of the Yarrowia CAN1 locus.

(188) TABLE-US-00005 TABLE 3 DNA Sequences Encoding sgRNA VT domains for Targeting the LEU2 or CAN1 Locus in Yarrowia with Cas9 Leu2-1.sup.a (SEQ ID NO: 2) TCCAAGAAGATTGTTCTTCT Leu2-2.sup.a (SEQ ID NO: 3) CTCCGTCATCCCCGGTTCTC Leu2-3.sup.a (SEQ ID NO: 4) CGGCGACTTCTGTGGCCCCG Can1-1.sup.b (SEQ ID NO: 17) TCAAACGATTACCCACCCTC .sup.aThe LEU2 gene sites targeted by Leu2-1, Leu2-2, and Leu2-3 have a CGG, TGG, or AGG, respectively, as a PAM site. .sup.bThe CAN1 gene site targeted by Can1-1 has a CGG as a PAM site.
Each of the LEU2-targeting DNA sequences in Table 3 was individually fused to a DNA sequence encoding a CER domain (SEQ ID NO:1) that interacts with Streptococcus pyogenes Cas9 protein, thereby creating DNA sequences encoding complete sgRNAs having both a CER domain and VT domain (note that SEQ ID NO:1 comprises in the 5-to-3 direction the tracrRNA mate sequence of SEQ ID NO:56, the loop-forming sequence of SEQ ID NO:43 (GAAA), and the tracrRNA sequence of SEQ ID NO:58. In order to express these sgRNAs in the nucleus of the cell and evade nuclear export and 5 modification systems, DNA sequences encoding the sgRNAs were put under control of RNA Pol III promoters from Saccharomyces cerevisiae (Snr52 [SEQ ID NO:5] or Rpr1 [SEQ ID NO:6]) or Yarrowia lipolytica (Snr52 [SEQ ID NO:7]). Specifically, Sc Snr52 was fused to Leu2-1, Sc Rpr1 was fused to Leu2-2, and YI Snr52 was fused to Leu2-3. The 3 end of the DNA sequence encoding each sgRNA was fused to a strong terminator from the Sup4 gene of Saccharomyces cerevisiae (SEQ ID NO:8). Thus, three different Pol III-driven sgRNA cassettes were prepared.

(189) The open reading frame of the Cas9 gene from Streptococcus pyogenes M1 GAS (SF370) was codon-optimized for expression in Yarrowia per standard techniques, yielding SEQ ID NO:9. DNA sequence encoding a simian virus 40 (SV40) monopartite nuclear localization signal (NIL) plus a short linker (4 amino acids) was incorporated after the last sense codon of SEQ ID NO:9 to render SEQ ID NO:10. SEQ ID NO:10 encodes the amino acid sequence shown in SEQ ID NO:11. The last seven amino acids of SEQ ID NO:11 encode the added NIL, whereas residues at positions 1369-1372 of SEQ ID NO:11 encode the added linker. The Yarrowia codon-optimized Cas9-NIL sequence (SEQ ID NO:10) was fused to a Yarrowia constitutive promoter, FBA1 (SEQ ID NO:12), by standard molecular biology techniques. An example of a Yarrowia codon-optimized Cas9 expression cassette (SEQ ID NO:13) is illustrated in FIG. 2A containing the constitutive FBA1 promoter, Yarrowia codon-optimized Cas9, and the SV40 NIL. This Cas9 expression cassette (SEQ ID NO:13) was cloned into the plasmid pZUF rendering construct pZUFCas9 (FIG. 3A, SEQ ID NO:14).

(190) Each of the sgRNA expression cassettes (above) were individually cloned into the Pacl/Clal site of pZUFCas9 (SEQ ID NO:14) to render a pZUFCas9/sgRNA construct that could be used to co-transform yeast cells with the Yarrowia codon-optimized Cas9 expression cassette and a Pol III-driven sgRNA expression cassette. An example of such a construct is pZUFCas9/PolIII-sgRNA (FIG. 3B), which contains the Yl Snr52 -sgRNA expression cassette for targeting Leu2-3 in Yarrowia.

(191) Uracil auxotrophic Y. lipolytica cells were transformed with 200 ng of plasmids pZUFCas9 (SEQ ID NO:14) or a particular pZUFCas9/sgRNA (e.g., pZUFCas9/PolIII-sgRNA, FIG. 3B) and selected for uracil prototrophy on complete minimal plates lacking uracil (CM-ura). Colonies arising on the CM-ura plates were screened for leucine auxotrophy on complete minimal plates lacking leucine (CM-leu). None of the uracil prototroph transformants displayed leucine auxotrophy. These results suggest that the Yarrowia codon-optimized Cas9 and Pol III promoter-driven sgRNA were not expressed, were not produced, did not interact, did not target DNA, and/or did not cleave DNA. If this experiment had produced leucine auxotrophs, such results would likely have indicated that a Cas9/sgRNA complex targeted and cleaved the Leu2 coding region leading to error-prone NHEJ and consequent indel formation, creating frameshift mutations.

(192) Thus, it appears that Pol III-driven expression of sgRNA might not be useful for providing a functional Cas9-sgRNA complex in Yarrowia.

Example 2

Yarrowia-Optimized sgRNA Expression Cassettes Comprising 5- and 3-Ribozymes Driven by DNA Polymerase II Promoters

(193) This example discloses sgRNAs optimized for expression and Cas9-mediated targeting in Yarrowia. Each cassette used for such expression comprised a Pol II promoter for driving transcription of an sgRNA fused to a 5-ribozyme and 3-ribozyme (ribozyme-sgRNA-ribozyme, or RGR). The 5 and 3 ribozymes were provided to remove Pol II promoter-related transcript modifications from the sgRNA such as 5 cap structures, leaving just the sgRNA sequence. These expression cassettes allow a broader promoter choice for sgRNA expression. Also, sgRNAs transcribed from these cassettes are not subject to nuclear export since they lack a 5-cap structure. These features allow robust expression of sgRNA in Yarrowia cells so they might guide Cas9 endonuclease to targeted regions of the genome in vivo.

(194) The addition of 5 HammerHead (HH) and 3 Hepatitis Delta Virus (HDV) ribozymes to a sgRNA sequence allows expression of the sgRNA from any promoter without consideration for post-transcriptional modifications that occur at promoters transcribed by some RNA polymerases (e.g. Pol II) and circumvents the current limited selection of promoters for sgRNA expression. When such sgRNA is expressed, the ribozymes present in the pre-sgRNA transcript autocleave, thereby separating from the transcript leaving an unmodified sgRNA.

(195) For each sgRNA tested, DNA sequence encoding the sgRNA was fused (i) at its 5-end to a sequence encoding a 5 HH ribozyme (SEQ ID NO:15) and (ii) at its 3-end to a sequence encoding a 3 HDV ribozyme (SEQ ID NO:16). The 5-linkage of the HH ribozyme was such that the first 6 nucleotides of the HH ribozyme were the reverse compliment of the first 6 nucleotides of the VT region (guide sequence) of the sgRNA. Each ribozyme-flanked pre-sgRNA (RGR) was fused to the FBA1 promoter (SEQ ID NO:12) using standard molecular biology techniques to yield a Yarrowia-optimized sgRNA expression cassette (final cassette depicted in FIG. 2B). An example sequence of such a cassette is shown in SEQ ID NO:18, which comprises an FBA1 promoter (SEQ ID NO:12) operably linked to a sequence encoding an RGR (HH-sgRNA-HDV) in which the sgRNA comprises a VT domain encoded by SEQ ID NO:17 (Can1-1) and SEQ ID NO:1 as its CER domain (note that each of the CER domain-coding regions of SEQ ID NO:18, pRF38 (SEQ ID NO:19) and pRF84 (SEQ ID NO:41) have an added TGG, where such TGG is between residue positions corresponding to positions 73-74 of SEQ ID NO:1 (CER domain)). This VT domain targets a site in the coding region of the Yarrowia CAN1 gene open reading frame (GenBank Accession No. NC_006068, YALIOB19338g, bp 2557513-2559231 of chromosome B). The first 6 residues of the encoded HH ribozyme are complementary to the first 6 residues of the sgRNA (i.e., first 6 residues of the VT domain). Note that there are three residues (ATG) immediately following SEQ ID NO:12 (FBA1 promoter) in SEQ ID NO:18 which are not believed to affect expression and ribozyme-mediated autocatalysis of the pre-sgRNA. SEQ ID NO:18 was cloned into a construct termed pRF38 (FIG. 3C, SEQ ID NO:19).

(196) Thus, DNA cassettes for expressing sgRNA without 5 and 3 pol II promoter-related transcript modifications were prepared. These type of cassettes were used in Example 3 for Cas9 gene targeting in Yarrowia.

EXAMPLE 3

Yarrowia-Optimized sgRNA Can be Used in an sgRNA/Cas9 Endonuclease System to Cleave Chromosomal DNA

(197) This example discloses using Yarrowia-optimized sgRNA expression cassettes as described in Example 2 to express sgRNA that can function with Cas9 to recognize and cleave chromosomal DNA in Yarrowia. Such cleavage was manifested by the occurrence of mutations in the region of the predicted DNA cleavage site due to error-prone NHEJ DNA repair at the cleavage site.

(198) The CAN1 gene of Y. lipolytica was targeted for cleavage. Successful targeting of CAN1 in Yarrowia transformants was examined by phenotype (canavanine resistance) and sequencing for mutation frequency and spectra, respectively.

(199) Ura.sup. Y. lipolytica cells (strain Y2224, a uracil auxotroph derived directly from strain ATCC 20362, is disclosed in U.S. Patent Appl. Publ. No. 2010/0062502, which is incorporated herein by reference) were co-transformed by lithium ion-mediated transformation (Ito et al., J. Bacteriology 153:163-168) with pZUFCas9 (FIG. 3A, SEQ ID NO:14) and a linear PCR product amplified from pRF38 (FIG. 3C, SEQ ID NO:19) containing the Yarrowia-optimized RGR pre-sgRNA cassette (comprised in SEQ ID NO:18) for targeting the CAN1 locus. The primers used for this PCR amplification were SEQ ID NO:20 (Forward) and SEQ ID NO:21 (Reverse). Ura.sup. Y. lipolytica cells (Y2224) cells transformed with pZUFCas9 (SEQ ID NO:14) alone served as a negative control. Cells transformed with pZUFCas9 (SEQ ID NO:14) and the RGR pre-sgRNA expression cassettes were selected on CM-ura medium as uracil prototrophs. Cells containing loss-of-function mutations in the CAN1 gene were screened by replica-plating the CM-ura plates onto complete minimal medium lacking uracil, lacking arginine, and supplemented with 60 g/ml of the toxic arginine analog, canavanine (CM+can). Cells with a functional CAN1 gene can transport canavanine into the cells causing cell death. Cells with a loss-of-function allele in the CAN1 gene do not transport canavanine and are able to grow on the CM+can plates.

(200) The frequency of loss-of-function mutants recovered by the phenotypic screen of canavanine resistance was zero for cells transformed with Cas9 alone (FIG. 4). However, when Cas9 was co-transformed with the RGR pre-sgRNA expression cassette, the frequency of canavanine-resistant transformants was increased to ten percent (FIG. 4).

(201) The CAN1 locus of canavanine-resistant colonies was amplified using forward (SEQ ID NO:22) and reverse (SEQ ID NO:23) PCR primers. PCR products were purified using Zymoclean and concentrator columns (Zymo Research, Irvine, Calif.). The PCR products were sequenced (Sanger method) using sequencing primer SEQ ID NO:24. Sequences were aligned with wild-type (WT) Yarrowia CAN1 coding sequence containing the target site (FIG. 5). The primary loss-of-function mutation (73% of sequenced isolates) at the CAN1 locus in cells expressing both Cas9 and the sgRNA was a -1 frameshift mutation at the Cas9 cleavage site (FIG. 5). A smaller number of other deletions and insertions made up the remainder of the mutations at the CAN1 locus. In all, 90% of the mutations were small deletions or insertions (FIG. 5). Rarely, other events occurred such as the insertion of small amounts of sequence from another chromosome (4%), insertion of the Yarrowia-optimized sgRNA expression cassette at the cleavage site (1.5%), or larger deletions (1%). 3.5% of the canavanine-resistant colonies screened had complex rearrangements at the CAN1 locus which were not determined by sequencing. Altogether, the mutations observed at the CAN1 target site indicate that error-prone NHEJ was used in the cells to repair the cleavage made by the Cas9/sgRNA complex.

(202) Both (i) the increased frequency of canavanine-resistant colonies in cells transformed to express a CAN1-specific Cas9 endonuclease, and (ii) the sequencing data indicating that the canavanine-resistance mutations were due to error-prone NHEJ events at the predicted Cas9 cleavage site, confirm that the Yarrowia-optimized Cas9 and RGR pre-sgRNA expression cassettes described in Example 2 cleave Yarrowia chromosomal DNA and generate mutations.

(203) Thus, expressing an RNA component (e.g., sgRNA) of an RGEN (e.g., Cas9) not having a 5-cap, where the 5 cap of the RNA component is autocatalytically removed by a ribozyme, allows RGEN-mediated targeting of DNA sequences in a non-conventional yeast.

Example 4

Yarrowia-Optimized sgRNA Expressed with a 5-Ribozyme, But without a 3 Ribozyme), Is Useful in an sgRNA/Cas9 Endonuclease System for Cleaving Chromosomal DNA

(204) In this example, the functionality of sgRNA produced from a Yarrowia-optimized cassette containing only a 5 HH ribozyme, but no 3 ribozyme, was evaluated to determine if the sgRNA could interact with Cas9, recognize a DNA target sequence, induce DNA cleavage by Cas9, and lead to mutation by error-prone NHEJ.

(205) RNAs transcribed from Pol II promoters are heavily processed and modified at both their 5 and 3 ends, suggesting that, to produce a functional sgRNA from a Pol II promoter, the 5 and 3 ends must be cleaved off. It has previously been shown that sgRNAs produced in vitro with flanking regions are (i) non-functional if a 5-flanking region exists, and (ii) significantly functionally impaired if a 3 flanking region exists (Gao et al., J. Integr. Plant Biol. 56:343-349). If pre-sgRNA containing a 5 ribozyme and also a 3 flanking region was expressed Saccharomyces cerevisiae along with Cas9, the sgRNA did not function to direct Cas9 to a target site for cleavage (Gao et al., ibid).

(206) To test if a 5 ribozyme-flanked sgRNA (lacking a 3-located ribozyme) could function in non-conventional yeast, a Yarrowia-optimized sgRNA expression cassette (SEQ ID NO:25) was constructed containing, in a 5-to-3 direction, an FBA1 promoter (SEQ ID NO:12) fused to a HH ribozyme (SEQ ID NO:15) fused to a sequence encoding an sgRNA (an example of SEQ ID NO:70) targeting the Can1-1 target site (SEQ ID NO:17) fused to a strong transcriptional terminator from the S. cerevisiae Sup4 gene (SEQ ID NO:8) (this cassette can be characterized as expressing an RG [ribozyme-sgRNA] RNA). The sgRNA encoded in the RG expression cassette comprises a VT domain corresponding to SEQ ID NO:17, linked to a CER domain (SEQ ID NO:1). The first 6 residues of the encoded HH ribozyme are complementary to the first 6 residues of the sgRNA (i.e., first 6 residues of the VT domain). Note that there are three residues (ATG) immediately following SEQ ID NO:12 (FBA1 promoter) in SEQ ID NO:25 which are not believed to affect expression and ribozyme-mediated autocatalysis of the pre-sgRNA. This Yarrowia-optimized RG expression cassette (SEQ ID NO:25) is illustrated in FIG. 2C.

(207) To test the ability of the Yarrowia-optimized RG cassette to express an sgRNA that can interact with Cas9, direct Cas9 to a DNA target sequence for cleavage by Cas9, PCR product containing either the RG construct (SEQ ID NO:25) or the RGR construct (SEQ ID NO:18, Example 2) was co-transformed with pZUFCas9 (SEQ ID NO:14) into Ura.sup. Y. lipolytica cells (Y2224) by lithium ion-mediated transformation (Ito et al., ibid). Ura.sup.+ transformants were replica-plated onto CM+can plates to screen for canavanine-resistant cells (as in Example 3) in which the sgRNA produced from the RG or RGR pre-sgRNA functioned in guiding Cas9 to cleave the CAN1 target sequence resulting in error-prone repair via NHEJ. The frequencies at which the Yarrowia-optimized RG or RGR cassettes directed Cas9 mediated cleavage to the target site were the same (FIG. 6), indicating that contrary to results of Gao et al. (J. Integr. Plant Biol. 56:343-349) using S. cerevisiae, a 3 ribozyme was not necessary for efficient Cas9/sgRNA target cleavage and mutation in Yarrowia.

(208) This example demonstrates that, in non-conventional yeast such as Yarrowia, only a 5-flanking ribozyme appears to be necessary to produce a functional sgRNA from Pol II promoters when using a ribozyme strategy. This result contrasts with what has been observed in S. cerevisiae, a conventional yeast, in which both 5 and 3 ribozymes were required for efficient cleavage and mutation of a target sequence by Cas9 (Gao et al., ibid).

(209) Thus, this example further demonstrates that expressing an RNA component (e.g., sgRNA) of an RGEN (e.g., Cas9) not having a 5-cap, where the 5 cap of the RNA component is autocatalytically removed by a ribozyme, allows RGEN-mediated targeting of DNA sequences in a non-conventional yeast.

Example 5

Use of Linear Polynucleotide Modification Templates to Facilitate Homologous Recombination (HR) Repair of Cas9/sqRNA-induced DNA Double-Strand Breaks

(210) This example discloses testing for the ability of the HR machinery in Yarrowia to use linear polynucleotide modification template DNA sequences to repair double-strand breaks (DSBs) generated by expressing Yarrowia-optimized Cas9 and pre-sgRNA expression cassettes. Three different linear template sequences were produced, each having 5- and 3-arm sequences that were homologous to regions outside a Cas9/sgRNA targeting site in chromosomal DNA.

(211) The first two types of polynucleotide modification template sequences were generated from synthesized oligonucleotides that were complimentary. The complimentary oligonucleotides were annealed and then purified by ethanol precipitation.

(212) The first polynucleotide modification template was generated using complementary oligonucleotides (SEQ ID NOs:28 and 29) and was designed to delete the 20-nucleotide Can1-1 target site (SEQ ID NO:17), the 3-nucleotide PAM domain and the two nucleotides immediately upstream of the Can1-1 target site, thereby deleting 8 codons and 1 base pair resulting in a -1 by frameshift in the CAN1 gene. The first polynucleotide modification template was assembled by annealing SEQ ID NO:28 and its reverse compliment, SEQ ID NO:29. The homology arms (each about 50-bp) of the first donor DNA are directly next to each other; there is no heterologous sequence between them.

(213) The second polynucleotide modification template generated using complementary oligonucleotides (SEQ ID NOs:30 and 31) and was designed to generate two in-frame translational stop codons (i.e., nonsense mutations) in the CAN1 open reading frame. It was also designed to disrupt the PAM sequence downstream the Can1-1 target site (replacing CGG with ATG) and the first nucleotide of the seed sequence (i.e., last residue of the Can1-1 target sequence of SEQ ID NO:17) (replacing C with G). This polynucleotide modification template was created by annealing SEQ ID NO:30 and its reverse compliment, SEQ ID NO:31. As can be gleaned from above, the homology arms (each about 50-bp) of the second donor DNA are separated by a few base pairs of heterologous sequence.

(214) A third polynucleotide modification template was generated in part by producing two PCR products. In one of the PCR products (SEQ ID NO:32, amplified from Y. lipolytica ATCC 20362 genomic DNA using primers SEQ ID NO:33 [forward] and SEQ ID NO:34 [reverse]), position 638 of SEQ ID NO:32 corresponds to the nucleotide 3 bp upstream of the CAN1 open reading frame start codon. The reverse primer (SEQ ID NO:34) adds 17 nucleotides complementary to sequence lying 37 bp downstream the CAN1 open reading frame. The second PCR product (SEQ ID NO:35, amplified from Y. lipolytica ATCC 20362 genomic DNA using primers SEQ ID NO:36 [forward] and SEQ ID NO:37 [reverse]), comprises 637 base pairs starting 14 base pairs downstream the stop codon of the CAN1 open reading frame. The forward primer (SEQ ID NO:36) adds 20 nucleotides complementary to the region ending 2 base pairs upstream the CAN1 open reading frame. Both the upstream (SEQ ID NO:32) and downstream PCR products (SEQ ID NO:35) were purified using Zymoclean and concentrator columns. These PCR products (10 ng each) were mixed in a new PCR reaction. The 3-most 37 nucleotides of the upstream product are identical to the 5-most 37 nucleotides of the downstream product. The upstream and downstream fragments were used to prime each other creating a single product (SEQ ID NO:38) by synthesis from overlapping ends containing both the upstream and downstream sequences (technique described by Horton et al., Biotechniques 54:129-133). The homology arms (each over 600-bp) of the SEQ ID NO:38 donor DNA are directly next to each other; there is no heterologous sequence between them. This polynucleotide modification template can enable a large deletion encompassing the entire CAN1 open reading frame in the region of a Cas9/sgRNA-mediated double-strand break in the Can1-1 target site.

(215) Ura.sup. Y. lipolytica cells (Y2224) were transformed using the above lithium ion transformation method with (i) pZUFCas9 (SEQ ID NO:14), (ii) 1 g of the Yarrowia-optimized RGR pre-sgRNA expression cassette (SEQ ID NO:18), and (iii) 1 nmol of the frameshift template DNA (SEQ ID NO:28), 1 nmol of the point mutation template DNA (SEQ ID NO:30), or 1 g of the large deletion template DNA (SEQ ID NO:38). Transformed cells were recovered as prototrophs for uracil on CM-ura plates. The prototrophic colonies were screened by replica-plating to CM+can to identify canavanine-resistant cells, which have CAN1 mutations. The CAN1 locus of Can.sup.R colonies from each transformation were screened via PCR amplification using forward (SEQ ID NO:22) and reverse primers (SEQ ID NO:23). Each PCR product was purified using ExoSAP-IT (Affymetrix, Santa Clara, Calif.) and sequenced (Sanger method) using sequencing primer SEQ ID NO:24. The frequency of colonies exhibiting the predicted homologous recombination event out (in view of which particular template DNA was used in the transformation) of the total number of Can.sup.R colonies was about 15% (FIG. 7).

(216) The three different polynucleotide modification template DNA sequences had slightly different efficiencies of HR repair (FIG. 8). Specifically, HR frequencies with each of these templates was roughly between 11% (large deletion and frameshift donors) and 22% (point mutation template) (FIG. 8), indicating that some of the Cas9/sgRNA-generated cleavage events at the Can1-1 target site were repaired using the HR pathway in a high-fidelity manner when polynucleotide modification template DNA was provided.

(217) Use of the two major pathways of DNA repair, NHEJ or HR, demonstrates a clear bias for NHEJ in Yarrowia (FIG. 7), which is different from what has been observed in studies of repair at Cas9/sgRNA-mediated cleavage events in conventional yeast. For example, DiCarlo et al. (Nucleic Acids Res. 41:4336-4343) showed that almost all S. cerevisiae mutants obtained when a donor DNA was provided for repair of a Cas9/sgRNA-mediated DNA cleavage were generated via HR, while the frequency fell by 4 to 5 orders of magnitude when donor DNA was not provided, indicating a clear bias toward HR. In contrast, the total mutation frequency in Yarrowia at a Cas9/sgRNA (sgRNA expressed from the RGR cassette) cleavage site did not vary between transformants that received or did not receive polynucleotide modification template DNA (FIG. 9, showing 15% mutation rates for both types of transformants), and HR only accounts for about 15 percent of the mutant transformants generated when donor DNA is provided (FIG. 7). Thus, the frequency of HR with a polynucleotide modification template DNA sequence in Yarrowia as observed above was only about 2.25%, which is in stark contrast to the near 100% HR-mediated mutation rate observed with donor DNA in a conventional yeast (DiCarlo et al., ibid).

(218) Thus, this example further demonstrates that expressing an RNA component (e.g., sgRNA) of an RGEN (e.g., Cas9) not having a 5-cap, where the 5 cap of the RNA component is autocatalytically removed by a ribozyme, allows RGEN-mediated targeting of DNA sequences in a non-conventional yeast. This example also demonstrates that RGEN-mediated cleavages in a non-conventional yeast can be repaired by HR at a certain rate if a suitable donor DNA (polynucleotide modification template) is provided.

Example 6

Expression of Cas9 and Yarrowia-Optimized RGR or RG Pre-sgRNA from a Single Stable Vector Provides Cas9/sgRNA-Mediated Target DNA Cleavage

(219) In this example, Yarrowia-optimized RGR or RG pre-sgRNA expression cassettes were each individually moved into the same stable expression plasmid as a Yarrowia-optimized Cas9 expression cassette. Specifically, SEQ ID NO:18 (for RGR expression) or SEQ ID NO:25 (for RG expression) were each individually cloned into pZUFCas9 (FIG. 3A, SEQ ID NO:14). This allowed for single-component transformation to express both Cas9 endonuclease and the RG or RGR pre-sgRNA in cells, thereby providing Cas9/sgRNA-mediated target site cleavage followed by error prone NHEJ repair.

(220) Yarrowia-optimized RGR (SEQ ID NO:18) or RG (SEQ ID NO:25) sgRNA expression cassettes were amplified by PCR using forward (SEQ ID NO:39) and reverse (SEQ ID NO:40) primers. Each product was individually cloned into plasmid pZUFCas9 (SEQ ID NO:14) at Pacl/Clal restriction sites to generate two new plasmids each carrying respective cassettes for Cas9 expression and expression of either the optimized RGR pre-sgRNA (pRF84, SEQ ID NO:41, FIG. 10A) or the optimized RG pre-sgRNA (pRF85, SEQ ID NO:42, FIG. 10B).

(221) To test the ability of the pRF84 (SEQ ID NO:41) and pRF85 (SEQ ID NO:42) plasmid constructs to each effectively express Cas9 and sgRNA to provide Cas9/sgRNA-mediated target site (Can1-1) cleavage, Ura.sup. Y. lipolytica cells (Y2224) were transformed using the above lithium ion transformation method with 200 ng of pRF84 (SEQ ID NO:41), pRF85 (SEQ ID NO:42), or pZUFCas9 (SEQ ID NO:14). Cells transformed with each plasmid were selected as uracil prototrophs on CM-ura medium. Uracil prototrophs from each transformation were screened for CAN1 mutants by replica-plating on CM+can. The number of colonies that grew on the CM+can plates were used to generate a CAN1 mutation frequency (FIG. 11) for the cells transformed with pZUFCas9 (expressing Cas9 alone), pRF84 (expressing Cas9 and RGR pre-sgRNA), or pRF85 (expressing Cas9 and RG pre-sgRNA). Yarrowia cells transformed with pZUFCas9 (SEQ ID NO:14) had a 0 frequency of Cas9/sgRNA-mediated mutation at the CAN1 locus, whereas cells expressing (i) Cas9 and (ii) RGR pre-sgRNA (pRF84) or RG sgRNA (pRF85) had similar CAN1 mutation frequencies (69%) as indicated by canavanine-resistance (FIG. 11).

(222) These results indicate that expressing Cas9 and pre-sgRNA from the same vector lead to significantly higher rates of Cas9/sgRNA-mediated cleavage and consequently NHEJ-mediated mutation at the predicted cleavage site. While Yarrowia cells transformed with separate sequences encoding Cas9 and pre-sgRNA (RGR or RG pre-sgRNA) exhibited a targeted mutation frequency of about 5% (Example 4, FIG. 6), placing both Cas9 and sgRNA coding sequences on the same vector used for transformation resulted in a targeted mutation frequency of about 69% (FIG. 11).

(223) Thus, expressing a Cas protein and its corresponding RNA component from the same construct used to transform a non-conventional yeast results in a higher rate of Cas-mediated DNA targeting in the yeast compared to using separate constructs to express the RGEN protein and RNA components.

Example 7

High-efficiency Gene Targeting Using a HDV Ribozyme-sgRNA Fusion in Yarrowia Lipolytica

(224) This example discusses the use of single guide RNAs (sgRNAs that are flanked on the 5 end by a HDV ribozyme (Ribozyme-single guide RNA fusion). When expressed, the HDV ribozyme cleaves 5 of its own sequence removing any preceding transcript but leaving the HDV sequence fused to the 5 end of the sgRNA.

(225) Plasmid pZuf-Cas9 (SEQ ID NO: 14) was mutagenized using Agilent QuickChange and the following primers Aarl-removal-1 (AGAAGTATCCTACCATCTACcatctccGAAAGAAACTCGTCGATTCC, SEQ ID NO: 90) and Aarl-removal-2 (GGAATCGACGAGTTTCTTTCggagatgGTAGATGGTAGGATACTTCT, SEQ ID NO:91) to remove the endogenous Aarl site present in the Cas9 gene (SEQ ID NO: 10) on pZuf-Cas9 (SEQ ID NO: 14) and generate pRF109 (SEQ ID NO: 92). The modified Aar1-Cas9 gene (SEQ ID NO: 93) was cloned as a Ncol/Notl fragment from pRF109 into the Ncol/Notl site of pZufCas9 replacing the existing Cas9 gene (SEQ ID NO: 10) with the Aar1-Cas9 gene to generate pRF141 (SEQ ID NO: 94).

(226) The high throughput cloning cassette (FIG. 12A, SEQ ID NO: 95) is composed of the yl52 promoter (SEQ ID NO: 96), the HDV ribozyme (SEQ ID NO: 16), the Escherichia coli counterselection cassette rpsL (SEQ ID NO: 97), the DNA encoding the guide RNA CER domain (SEQ ID NO: 1) and the S. cerevisiae Sup4 terminator (SEQ ID NO: 8). Flanking the ends of the high-throughput cloning cassette (SEQ ID NO: 95) are Pacl and Clal restriction enzyme recognition sites. The high-throughput cloning cassette was cloned into the Pacl/Clal sites of pRF141 (SEQ ID NO: 94) to generate pRF291 (SEQ ID NO: 98). The rpsL counterselection cassette (SEQ ID NO: 97) contains a WT copy of the E. coli gene rpsL encoding the S12 ribosomal protein subunit (Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology, 1987, First ed. American Society of Microbiology, Washington, D.C.). Some mutations in the S12 subunit cause resistance to the antibiotic streptomycin (Ozaki M, Mizushima S, Nomura M. 1969. Identification and functional characterization of the protein controlled by the streptomycin-resistant locus in E. coli. Nature 222:333-339) in a recessive manner (Lederberg J. 1951. Streptomycin resistance; a genetically recessive mutation. Journal of bacteriology 61:549-550) such that if a wild-type copy of the rpsL gene is present the strain is phenotypically sensitive to streptomycin . Common cloning strains such as Top10 (Life technologies) have a mutated copy of rpsL on their chromosome such that the cells are resistant to streptomycin.

(227) Cloning a DNA fragment encoding a variable targeting domain of a guide RNA into a plasmid (such as pRF291) requires two partially complimentary oligonucleotides that when annealed they contain the DNA fragment encoding the variable targeting domain, as well as the correct overhangs for cloning into the two Aarl sites present in the high-throughput cloning cassette. Two oligonucleotides Can1-1F (AATGGGACtcaaacgattacccaccctcGTTT, SEQ ID NO: 99) and Can1-1R (TCTAAAACgagggtgggtaatcgtttgaGTCC , SEQ ID NO: 100) were resuspended in duplex buffer (30mM HEPES pH 7.5, 100mM Sodium Acetate) at 100pM. Can1-1F (SEQ ID NO: 99) and Can1-1R (SEQ ID NO: 100) were mixed at a final concentration of 50 M each in a single tube, heated to 95 C. for 5 minutes and cooled to 25 C. at 0.1 C./min to anneal the two oligonucleotides to form a small duplex DNA molecule (FIG. 12B) containing the DNA fragment encoding the variable targeting domain of a guide RNA capable of targeting the Can1-1 target site (shown as SEQ ID NO: 101 which include the PAM sequence CGG) . A single tube digestion/ligation reaction was created containing 50 ng of pRF291, 2.5 M of the small duplex DNA composed of Can1-1F and Can1-1R 1T4 ligase buffer (50mM Tris-HCI, 10 mM MgCl.sub.2, 1 mM ATP, 10 mM DTT pH 7.5), 0.5 M Aarl oligonucleotide, 2 units Aarl, 40 units T4 DNA ligase in a 20 l final volume. A second control reaction lacking the duplexed Can1-1F and Can1-1R duplex was also assembled. The reactions were incubated at 37 C. for 30 minutes. 10 l of each reaction was transformed into Top10 E. coli cells as previously described (Green MR, Sambrook J. 2012. Molecular Cloning: A Laboratory Manual, Fourth Edition ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). In order to select for the presence of pRF291 where the duplex of Can1-1F and Can1-1R had replaced the rpsL counterselection marker flanked by Aarl restriction sites (FIG. 12A) cells were plated on lysogeny Broth solidified with 1.5% (w/v) Bacto agar containing 100 g/ml Ampicillin and 50 g/ml Streptomycin. The presence of pRF291 containing the high-throughput cloning cassette yielded colonies phenotypically resistant to the antibiotic ampicillin but sensitive to the antibiotic streptomycin due to the presence of the counterselection cassette on the plasmid. However, in cases where the counterselection cassette was removed via the Aarl enzyme and the Can1-1 duplex DNA was ligated into the site (removing the recognition sequences for Aarl) the cells transformed with the plasmid had an ampicillin resistant, streptomycin resistant phenotype (FIG. 12A). pRF291 containing the DNA fragment encoding the Can1-1 variable targeting domain targeting (replacing the counterselection cassette) created a recombinant HDV-sgRNA expression cassette (SEQ ID NO: 102) containing the yl52 promoter fused to the DNA encoding the HDV ribozyme (SEQ ID NO: 16) fused to the DNA encoding the Can1-1 variable targeting domain (SEQ ID NO: 17) fused to the DNA encoding the guide CER domain (SEQ ID NO: 1) fused to the sup4 terminator (SEQ ID NO: 8). The plasmid containing this construct, pRF303 (SEQ ID NO: 103) was used to encode a HDV ribozyme-guide RNA (SEQ ID NO: 104) that was capable (when in complex with a Cas9 endonuclease) to target the Can1 gene (SEQ ID NO: 21) of Yarrowia lipolytica for mutagenesis.

(228) Yarrowia lipolytica was transformed (as described in Richard M, Quijano RR, Bezzate S, Bordon-Pallier F, Gaillardin C. 2001. Journal of bacteriology 183:3098-3107) with either no plasmid or 100 ng of plasmid carrying no sgRNA expression cassette (pRF291, SEQ ID NO: 98), pRF84 plasmid carrying an RGR expression cassette (SEQ ID NO: 41), pRF85 plasmid carrying the RG cassette where the 5 ribozyme removed itself from the sgRNA (SEQ ID NO: 42), or pRF303 (SEQ ID NO: 103) carrying the HDV-sgRNA fusion expression cassette (SEQ ID NO: 102) targeting the Can1-1 target site in Yarrowia. Transformants were selected for uracil prototrophy and scored for mutations in the Can1 gene by phenotypic resistance to the arginine analog canavanine. The plasmid expressing the HDV-sgRNA fusion caused loss of function mutations in the Can1 gene at the same frequency of the plasmid that expressed either of the sgRNAs that were liberated from the ribozyme suggesting that a 5 fusion of the HDV ribozyme to the sgRNA targeting Can1-1 did not affect sgRNA function (Table 4).

(229) TABLE-US-00006 TABLE 4 Mutation frequency of Can1-1 target sequence via different sgRNA variants. Plasmid sgRNA variant Can.sup.R Frequency SD pRF291 No sgRNA 0 0 pRF84 RGR that yields sgRNA 0.70 0.04 pRF85 RG that yields sgRNA 0.73 0.11 pRF303 FIDV-sgRNA fusion 0.81 0.15

(230) A number of additional DNA fragments encoding variable targeting domains targeting a number of additional target sites (Table 5) were cloned into the pRF291 (SEQ ID NO: 98) plasmid using the same strategy as described above and illustrated in FIG. 12A. Including a DNA fragment encoding a variable targeting domain targeting a second target site targeting within the Can1 gene (SEQ ID NO: 105), the can1-2 target site (SEQ ID NO: 106) and other target sites such as sou2-1 (SEQ ID NO: 107), Sou2-2 (SEQ ID NO: 108), Tgl1-1 (SEQ ID NO: 112), Acos10-1 (SEQ ID NO: 113), Fat1-1 (SEQ ID NO: 114) and Ura3-1 (SEQ ID NO: 116).

(231) TABLE-US-00007 TABLE5 DNASequencesEncodingsgRNAVTdomainsfor TargetingdifferentLociinYarrowiawithCas9 DNAencoding Yarrowiatarget VariableTargeting sites+ PAM domainofsgRNA sequence(bold) Can1-2 Base1-20ofSEQ GGCCCACTCGGATGACTCAGAGG IDNO:106 (SEQIDNO:106) Sou2-1 Base1-24ofSEQ GTCTGGACCTTCCACCCTCGCCA IDNO:107 CGGG (SEQIDNO:107) Sou2-2 Base1-22ofSEQ GCAGTCCCGTGGCGAGGGTGGA IDNO:108 AGG (SEQIDNO:108) TGL1-1 Base1-20ofSEQ CAGCTCGAGACGTCCTAGAACGG IDNO:112 (SEQIDNO:112) Acos10-1 Base1-20ofSEQ TTCCTCTGTCACAGACGTTTCGG IDNO:113 (SEQIDNO:113) Fat1-1 Base1-20ofSEQ GAAAAGTGCGTTTTGATTCTCGG IDNO:114 (SEQIDNO:114) ura3-1 Base1-20ofSEQ GCCGCTCGAGTGCTCAAGCTCG IDNO:116 (SEQIDNO:116)

(232) The mutation frequency of the target sites indicated that all HDV-sgRNA fusions were capable of making a complex with the Cas9 endonuclease which in turn generated cleavage at the respective target site that led to mutations via NHEJ (Table 6).

(233) TABLE-US-00008 TABLE 6 Mutation frequency at various target sites in Yarrowia lipolytica using HDV-sgRNA fusions. Target site Mutation frequency SD Can1-2 0.76 0.15 Sou2-1 0.19 Sou2-2 0.30 TGL1-1 0.88 Acos10-1 0.36 Fat1-1 0.50 ura3-1 0.92

Example 8

Gene Silencing Using Inactivated-Cas9 and HDV-sgRNA Fusions.

(234) Catalytically inactivated Cas9 variants containing mutations in the HNH and RuvC nuclease domains (SEQ ID NO: 117) are capable of interacting with sgRNA and binding to the target site in vivo but cannot cleave either strand of the target DNA. This mode of action, binding but not breaking the DNA can be used to transiently decrease the expression of specific loci in the chromosome without causing permanent genetic changes.

(235) In order to generate catalytically inactivated Cas9 expression cassettes for Yarrowia lipolytica the D10A mutation was introduced to the plasmid pZufCas9 (SEQ ID NO: 14) using quickchange site-directed mutagenesis (Stratagene) as described with the primers D10AF (GAAATACTCCATCGGCCTGGCCATTGGAACCAACTCTGTCG, SEQ ID NO: 118) and D10AR (CGACAGAGTTGGTTCCAATGGCCAGGCCGATGGAGTATTTC, SEQ ID NO: 119). This generated a Yarrowia codon optimized Cas9 gene with the D10A mutation inactivating the RuvC nuclease (SEQ ID NO: 120) and the corresponding plasmid containing the construct, pRF111 (SEQ ID NO: 121). In order to inactivate the second nuclease domain (HNH) an additional round of quickchange mutagenesis (Stratagene) was performed using primer H840A1 (TCAGCGACTACGATGTGGACGCCATTGTCCCTCAATCCTTTCT, SEQ ID NO: 122) and H840A2 (AGAAAGGATTGAGGGACAATGGCGTCCACATCGTAGTCGCTGA, SEQ ID NO: 123) introducing the H840A mutation into the Yarrowia codon optimized D10A gene creating a Yarrowia codon optimized Cas9 inactivated gene (SEQ ID NO: 124) and the plasmid carrying the gene for expression in Yarrowia, pRF143 (SEQ ID NO: 125).

(236) In order to assess gene silencing in Yarrowia lipolytica a Yarrowia codon optimized dsREDexpress open reading frame (SEQ ID NO: 126) was generated as a cloning fragment with a 5 Ncol restriction site and a 3 Notl restriction site (SEQ ID NO: 127). The cloning fragment (SEQ ID NO: 127) was cloned into the Ncol/Notl sites of pZufCas9 to create an FBA1 promoter (SEQ ID NO: 12) fused to a Yarrowia optimized dsREDexpress cloning fragment (SEQ ID NO: 127) creating a FAB1-dsRED fusion cassette (SEQ ID NO: 128) which was contained on plasmid pRF165 (SEQ ID NO: 129). In order to integrate the FBA1-dsREDexpress cassette (SEQ ID NO: 128) into the chromosome, the Pmel-Notl fragment containing the cassette (SEQ ID NO: 130) was ligated into the Pmel/Notl sites of integration plasmid p2P069 (SEQ ID NO: 131) to generate an integration vector carrying the FBA1-dsREDexpressexpression cassette, pRF201 (SEQ ID NO: 132). A Sphl/Ascl fragment of pRF201 carrying the FBA1-dsREDexpress fusion and a copy of the Leu2 gene (SEQ ID NO: 133) was integrated into the chromosome of Yarrowia by selecting for Leucine prototrophy using standard techniques (Richard M, Quijano RR, Bezzate S, Bordon-Pallier F, Gaillardin C. 2001. Tagging morphogenetic genes by insertional mutagenesis in the yeast Yarrowia lipolytica. Journal of bacteriology 183:3098-3107). The presence of the FBA1-dsREDexpress expression cassette was confirmed in the Yarrowia genome using standard PCR techniques and primers HY026 (GCGCGTTTAAACCATCATCTAAGGGCCTCAAAACTACC, SEQ ID NO: 134) and HY027 (GAGAGCGGCCGCTTAAAGAAACAGATGGTGTCTTCCCT, SEQ ID NO: 135). Two independent strains containing the FBA1-dsREDexpress cassette (SEQ ID NO: 128) were chosen for further use, YRF41 and YRF42.

(237) To create sgRNAs for targeting the Yarrowia optimized dsREDexpress expression cassette (SEQ ID NO: 128) a strategy similar to Example 12 was used. A plasmid construct, pRF169 (SEQ ID NO: 136) contained the GPD promoter from Yarrowia (SEQ ID NO: 137) counterselectable marker , the DNA encoding the guide RNA CER domain (SEQ ID NO: 1) and a Sup4 terminator (SEQ ID NO: 8) cassette (SEQ ID NO: 138), as illustrated in FIG. 13A. DNA encoding the variable targeting domain of a sgRNA, targeting target sites in Yarrowia, linked to a DNA fragment encoding the HH ribozyme were cloned into pRF169 (SEQ ID NO: 136) as described in Example 12 except that the DNA fragments encoding the HH ribozyme were such that the first 6 nucleotides of the hammerhead ribozyme were the reverse compliment of the first 6 nucleotides of the variable targeting domain, as shown in FIG. 13B. When the duplexed oligonucleotides with the correct overhangs replace the counterselection cassettes between the Aarl sites a ribozyme-guideRNA (RG) expression cassette was created (FIG. 13-A). When transcribed, the HH ribozyme removes the 5 transcript and itself from the ribozyme-guide RNA molecule, leaving an intact sgRNA in the cell. Three guide RNA's targeting the dsREDexpress open reading frame (SEQ ID NO: 126) were generated; two targeting the template strand, ds-temp-1 (SEQ ID NO: 139), ds-temp-2 (SEQ ID NO: 140), and one targeting the non-template strand ds-nontemp-1 (SEQ ID NO: 141).

(238) For each target site two oligonucleotides were designed containing the DNA sequence encoding the target specific hammerhead ribozyme, the variable targeting domain (VTD) and the correct overlapping ends for cloning into the Aarl sites of pRF169. The oligonucleotides for each site; ds-temp-1F (SEQ ID NO: 144) ds-temp-1R (SEQ ID NO: 145), ds-temp-2F (SEQ ID NO: 146), ds-temp-2R (SEQ ID NO: 147), ds-nontemp-1F (SEQ ID NO: 148), and ds-nontemp-1R (SEQ ID NO: 149) were duplexed to form double stranded DNA molecules with the correct overhangs for cloning into the Aarl overhangs left in the high throughput cassette (FIG. 13A and 13B) of pRF169 and was performed as described in Example 12 for cloning into pRF291. Insertion of the DNA fragment encoding the variable targeting domain of the sgRNA, replacing the counterselection cassette, generated a new plasmid for each target site carrying a GPD promoter fused to the hammerhead ribozyme-target site duplex DNA fused to DNA encoding the guide RNA CER domain fused to the Sup4 terminator FIG. 13A. The plasmids containing these duplexes are pRF296 (ds-temp-1, SEQ ID NO: 150), pRF298 (ds-temp-2, SEQ ID NO: 151), pRF300 (ds-nontemp-1, SEQ ID NO: 152).

(239) In order to create constructs for gene silencing, the inactivated Cas9 from pRF143 (SEQ ID NO: 125) was cloned into pRF296, pRF298 and pRF300 as a Ncol/Notl fragment using standard techniques and replacing the functional Cas9 (SEQ ID NO: 93) that resided in the Ncol/Notl sites of those plasmids to create plasmids pRF339 (SEQ ID NO: 153), pRF341 (SEQ ID NO: 154), and pRF342 (SEQ ID NO: 155) respectively.

(240) Strains YRF41 and YRF42 were transformed with pRF339, pRF341, and pRF343 using standard techniques to uracil prototrophy (Richard M, Quijano RR, Bezzate S, Bordon-Pallier F, Gaillardin C. 2001. Tagging morphogenetic genes by insertional mutagenesis in the yeast Yarrowia lipolytica. Journal of bacteriology 183:3098-3107)). For each transformation 12 transformants were streak purified on plates lacking uracil to maintain the plasmid. Each isolate was used to inoculate 2 ml of CM-ura broth (Teknova) and was grown at 30 C., 250 RPM overnight. 2-5 l of each overnight was diluted into 200 l of ddH.sub.2O and analyzed in the dsREDexpress channel of an Accuri flow cytometer to assess the amount of dsREDexpress protein within each cell. Between 7,151 and 10,000 cells were analyzed from each culture. The mean fluorescence of Yarrowia cells without a dsREDexpress expression cassette were subtracted from the mean fluorescence of each of the cultures analyzed to obtain a corrected mean fluorescence within each strain/plasmid combination these were averaged and the standard deviation was determined (Table 7). Inactivated Cas9 combined with a ribozyme-sgRBA (RG) expressed via an expression vector, targeting a gene of interest, silenced the expression of the gene between 2 and 10 fold. The fold silencing varied depended on the location and strandedness of the target site and/or the ability of a ribozyme flanked sgRNA to be expressed from a DNA polymerase promoter in a functional form in a Yarrowia cell (Table 7).

(241) TABLE-US-00009 TABLE 7 Gene silencing by three target sites in two FBA-dsREDexpress integrated strains. Mean Fold of No Strain Plasmid Target Site fluorescence SD Target YRF41 None None 540.6 2.9 1 YRF41 pRF339 ds-temp-1 299.2 138.7 0.55 0.26 (SEQ ID NO: 69) YRF41 pRF341 ds-temp-2 257.9 139.3 0.48 0.26 (SEQ ID NO: 70) YRF41 pRF343 ds-nontemp-1 169.4 45.3 0.31 0.08 (SEQ ID NO: 71) YRF42 None None 871.2 36.9 1 YRF42 pRF339 ds-temp-1 194.3 121.1 0.22 0.14 (SEQ ID NO: 69) YRF42 pRF341 ds-temp-2 168.7 191.6 0.19 0.22 (SEQ ID NO: 70) YRF42 pRF343 ds-nontemp-1 94.9 109.6 0.11 0.13 (SEQ ID NO: 71)

Example 9

Precise Gene Editing Using Cas9 and a HDV Ribozyme-sgRNA Fusion (RG) Expressed from a Single Plasmid.

(242) In this example we demonstrate that the stable expression of Cas9 and an HDV-sgRNA fusion expressed from the same stable vector can create DNA double-strand breaks in target sites of Yarrowia that can be substrate for precise gene editing via homologous recombination.

(243) The Can1 deletion polynucleotide modification template DNA described in Example 4 (SEQ ID NO: 38) was digested with HinDIII and cloned into the HinDIII site of pUC18 using standard techniques to create pRF80 (SEQ ID NO: 156). A shorter Can1 deletion editing template (SEQ ID NO: 157) was amplified from pRF80 using standard PCR techniques and primers 80F (AGCTTGCTACGTTAGGAGAA, SEQ ID NO: 158) and 80R (TATGAGCTTATCCTGTATCG, SEQ ID NO: 159) to create large quantities of the editing template.

(244) Ura auxotrophic Yarrowia cells were transformed using standard techniques (Richard M, Quijano R R, Bezzate S, Bordon-Pallier F, Gaillardin C. 2001. Tagging morphogenetic genes by insertional mutagenesis in the yeast Yarrowia lipolytica. Journal of bacteriology 183:3098-3107) with 100ng of plasmid pRF291 carrying a copy of the Cas9 gene but no sgRNA and pRF303 carrying a copy of the Cas9 gene and the Can1-1 target site HDV-sgRNA expression cassette along with either no editing template DNA or 1000 ng of the short Can1 deletion editing template (SEQ ID NO: 157). Transformants were selected on CM-ura medium (Teknova). For each transformation 20 individual colonies were streak purified on CM-ura medium (Teknova). From each of the streak purified colonies 4 individual colonies (80 total per transformation) were patched onto CM-arg plates containing 60 g/ml of L-canavanine to screen for colonies containing a loss of function allele in the Can1 gene. Patches that demonstrated resistance to Canavanine were scored and frequencies of gene inactivation were scored (Table 8). In order to determine which colonies had lost Can1 function due to homologous recombination and which had lost Can1 function due to NHEJ the Can1 locus (SEQ ID NO: 160) was amplified using Can1-PCRF (GGAAGGCACATATGGCAAGG, SEQ ID NO: 22) and Can1-PCRR (GTAAGAGTGGTTTGCTCCAGG, SEQ ID NO: 23). In cells with small indels as described in previous examples the PCR product should be very similar to the WT Can1 loci (SEQ ID NO: 160) in size (2125 bp) in the strains containing a deletion by homologous recombination with the Can1 deletion editing template the PCR fragment (SEQ ID NO: 161) with Can1-PCRF (SEQ ID NO: 22) and Can1-PCRR (SEQ ID NO: 23) will be smaller (392 bp). 2 l of the PCR product were resolved via electrophoresis and imaged using standard techniques (FIG. 14). The percentage of the original 20 streaked colonies that yielded 1 or more colonies upon streak purification that had the short band corresponding to recombination with the editing template (SEQ ID NO: 161) were used to determine the frequency of HR (Table 8). In cells that received pRF303 (SEQ ID NO: 103) the frequency of Canavanine resistant colonies was similar whether the cells received an editing template (Table 8). In cells receiving both pRF303 (SEQ ID NO: 103) and Can1 short editing template (SEQ ID NO: 157) in the total population of transformed cells about 1/10.sup.th contained precise editing (Table 8) of the Can1 locus from the editing template (SEQ ID NO: 157).

(245) TABLE-US-00010 TABLE 8 Canavanine resistance frequency and frequency of precise editing. Editing Can.sup.R Fre- HR Fre- Plasmid sgRNA Template quency SD quency SD pRF291 None None 0 0 Not Determined (SEQ ID NO: 98) pRF291 None Can1 short 0 0 Not Determined (SEQ ID (SEQ ID NO: 98) NO: 157) pRF303 HDV-Can1- None 0.80 0.10 Not Determined (SEQ ID 1 sgRNA NO: 103) pRF303 HDV-Can1- Can1 short 0.72 0.12 0.09 0.05 (SEQ ID 1 sgRNA (SEQ ID NO: 103) NO: 157)

Example 10

URA3 Gene Inactivation in Yarrowia

(246) The present Example describes the construction and use of the plasmids expressing single guide RNA (sgRNA) and Cas9 endonuclease separately or together for URA3 gene inactivation in Yarrowia. pYRH235 and pYRH236 expressed a ribozyme flanked pre-sgRNA (RGR-URA3.1; SEQ ID NO: 164) targeting the URA3.1 target sequence (5-ctgttcagagacagtttcct-3; SEQ ID NO:165) and a ribozyme flanked pre-sgRNA (RGR-URA3.2; SEQ ID NO: 166) targeting the URA3.2 target sequence (5-taacatccagagaagcacac-3; SEQ ID NO:167) respectively. A Ncol-Notl restriction digest fragment of the DNA fragment encoding the RGR-URA3.1 and a BspHI-Notl restriction digest fragment encoding the RGR-URA3.2 were fused to the FBA1L promoter (SEQ ID NO: 168) to yield pYRH235 and pYRH236, respectively. The pYRH235 and pYRH236 plasmids contained a marker gene of a native acetohydroxyacid synthase (AHAS or acetolactate synthase; E. C. 4.1.3.18; SEQ ID NO:169) that had a single amino acid change (W497L) that confers sulfonyl urea resistance.

(247) A Ura-minus derivative (Y2224) of Yarrowia strain ATCC20362 was first transformed with linearized pZufCas9 (SEQ ID NO: 14) by Sphl-BsiWI restriction digest, and transformants were selected on complete minimal (CM) plates lacking uracil. The linearized Cas9 expression cassette was randomly integrated into Yarrowia genome, and therefore the transformants contained at least two copies of URA3 gene. Subsequently, pYRH235 or pYRH236 expressing sgRNA was transformed into the Cas9 expressing Yarrowia strains, and the transformants were selected on CM plates containing 600 mg/L sulfonylurea. 50 transformants were patched on CM-ura plates and SC plates with 5-FOA to find the frequency of URA3 gene inactivation by Cas9 and sgRNA for URA3. 94% and 100% of the pYRH235 and pYRH236 transformants, respectively, became uracil auxotrophs.

(248) Sequencing confirmation of mutation at target sites URA3.1 or URA3.2 was performed. 20 transformants of pZufCas9 and pYRH235 were randomly chosen for sequencing analysis, and each colony was analyzed for mutation of the URA3 gene of plasmid pZufCas9 and from native genomic URA3. To sequence the URA3 gene from plasmid pZufCas9, primers RHO705 (SEQ ID NO: 170) for URA3 and RHO719 (SEQ ID NO: 171) for FBA1 promoter sequences were used for PCR amplification of the region, and primers RHO733 (SEQ ID NO: 172) or RHO734 (SEQ ID NO: 173) were used for sequencing with the PCR amplification product as template. To sequence the URA3 gene of native genomic origin, primers RH0705 (SEQ ID NO: 170) and RHO707 (SEQ ID NO: 174) were used for PCR amplification, and primers RHO733 (SEQ ID NO: 172) and RHO734 (SEQ ID NO: 173) were used for sequencing with the PCR amplification product as template. All 20 colonies contained mutation at both plasmid and genomic originated URA3 genes (FIG. 15). A fragment alignment of the sequencing results for both plasmid and genomic originated URA3 genes of 5 representative colonies (Colony 1, 2, 3, 5 and 6; SEQ ID NOs: 176, 177, 178, 179 and 180 and SEQ ID NOs: 181, 182, 183,184 and 185, respectively) and wild type URA3.1 (SEQ ID NO: 175) are shown in FIG. 15. These results show that multiple copies of a gene in the same cell were targeted and mutated by sgRNA/Cas9 endonuclease systems in Yarrowia.

Example 11

URA3 Gene Mutation or Deletion in Yarrowia.

(249) The present Example describes the construction and use of the plasmids expressing two sgRNAs and Cas9 endonuclease on the same vector system for URA3 gene mutation or deletion in Yarrowia for use in marker recycling.

(250) pYRH222 expresses a Cas9 endonuclease (SEQ ID NO: 10) under a FBA1 promoter (SEQ ID NO: 12) and a FBA1L promoter driven DNA fragment encoding the ribozyme flanked pre-sgRNA (RGR-URA3.2; SEQ ID NO: 166) targeting the URA3.2 target sequence (SEQ ID NO:167), illustrated in FIG. 16A. The pYRH222 vector contained a hygromycin antibiotic resistant selection marker (SEQ ID NO:186) expressed under TDH1 (also referred as GPD) promoter (SEQ ID NO:187), as well as autonomously replicating sequence (ARS18; SEQ ID NO:208) which accomodates extrachromosomal replication of a plasmid (PNAS, Fournier, P. et al., 1993, 90:4912-4916). The presence of ARS18 rendered cells to lose plasmid when there was no selection pressure.

(251) pYRH282 was derived from pYRH222. The FBA1L promoter (SEQ ID NO: 168) fused to a DNA fragment encoding the RGR-URA3.1 (SEQ ID NO: 164) from pYRH235 was PCR amplified using primers RH0804 (SEQ ID NO: 188) and RHO805 (SEQ ID NO: 189). The PCR product was then digested with BsiWI and cloned into pYRH222. Orientation and sequence identity of the cloned gene was confirmed by sequencing, and the construct was named pYRH282.

(252) pYRH283 was derived from pYRH222. A synthetic DNA fragment flanked by BsiWI sites (SEQ ID NO: 190) composed of the TDH1 promoter (SEQ ID NO: 187) fusion to the DNA encoding the RGR-URA3.3 (SEQ ID NO: 191) was synthesized by IDT (Coralville, Iowa) and cloned into pYRH222 at BsiWI site. Orientation and sequence identity of the cloned gene was confirmed by sequencing, and the construct was named pYRH283.

(253) A progeny of Yarrowia strain ATCC20362 was transformed with pYRH222, pYRH282, and pYRH283, and the transformants were selected on YPD plates containing 300 mg/L hygromycin. Relatively high background growth was observed on no DNA control plate (Table 9). 30 transformants of each construct were randomly selected, and streaked onto SC plates with 5-FOA to counter-select for uracil auxotriophs. No growth was observed with colonies from no DNA control plate. 4 to 11 patches showed growth with pYRH222, pYRH282, and pYRH283 transformants. Colony PCR was performed with primers RHO610 (SEQ ID NO: 192) and RHO611 (SEQ ID NO: 193) to amplify the DNA region containing the sgRNA targeting sites, and PCR amplified products showed different migration on a agarose gel (FIG. 17). Sequencing was performed with the PCR products as template and a sequencing primer RHO704 (SEQ ID NO: 194).

(254) In case of pYRH222 transformants, 6 out of 11 sequencing worked successfully and all of them were mutated at the URA3.2 target site (FIG. 16B; SEQ ID NOs: 195-201). In case of pYRH282, all of the successfully sequencing showed mutations at target site(s), and 2 out of them showed deletion between the two target sites (FIG. 16C; SEQ ID NOs: 202-204). For pYRH283, 7 out of 8 successful sequencing showed mutations at target site(s), and 2 out of them showed deletion between the two target sites (FIG. 16D; SEQ ID NOs: 205-207), creating almost complete deletion of the URA3 gene.

(255) This example shows that two guide RNAs were expressed on the same plasmids to make a targeted deletion between two target sites using a sgRNA/Cas9 endonuclease system in Yarrowia, wherein the identification was performed by running a gel or by sequencing. The presence of ARS18 (SEQ ID NO:208) on these plasmids rendered cells to lose plasmid when there was no selection pressure, so that the plasmids could be used repeatedly for URA3 marker recycling.

(256) TABLE-US-00011 TABLE 9 Analysis of pYRH222, pYRH282, and pYRH283 transformants. Number of transformants was recorded for each transformation plate including no DNA control. Targeted Colonies on Patched Growth mutation/ Hyg plate on 5-FOA on 5-FOA sequenced No DNA control 131 30 0 pYRH222 352 30 11 6/6 (URA3.2) pYRH282 244 30 4 4/4 (URA3.2 + (2 deletions) URA3.1) pYRH283 178 30 10 7/8 (URA3.2 + (2 deletions) 3.3)

Example 12

Use of Csy4 (Cas6) in Yarrowia for Gene Inactivation

(257) The present Example describes the use of Csy4 (also referred to as Cas6) to create a guide RNA with no 5 cap that is capable of forming a RGEN complex that can target DNA sequences (such as, but not limiting to, CAN1) in non-conventional yeast.

(258) The gene encoding Csy4 (also known as Cas6) was introduced on a Cas9 expression plasmid together with DNA encoding the CAN1 targeting sgRNA flanked by 28 bp Csy4 recognition sites, for CAN1 gene inactivation in Yarrowia.

(259) pYRH290 expressed a Cas9 endonuclease (SEQ ID NO: 10) under a FBA1 promoter (SEQ ID NO: 12) and a Yarrowia lipolytica codon-optimized gene for Csy4 expression (SEQ ID NO: 209) under FBA1 promoter (SEQ ID NO: 210). pYRH290 also contained a DNA fragment (TDH1:28 bp-gCAN1-28bp; SEQ ID NO: 211) encoding the 28 bp Csy4 endonuclease recognition sequences (SEQ ID:212) flanked pre-sgRNA (SEQ ID NO:213) targeting a CAN1 target sequence (SEQ ID NO:214). After processing by Csy4, the resulting sgRNA (SEQ ID NO: 222) contained an 8-nucleotide 5-flanking sequence (SEQ ID NO: 223) and a 20-nucleotide 3-flanking sequence (SEQ ID NO: 224).

(260) A Ura-minus derivative (Y2224) of Yarrowia strain ATCC20362 was transformed with pYRH290, and transformants were selected on CM plates lacking uracil. 86 transformants were replica-plated to CM plates containing canavanine to select for cant mutants. 40 out of 86 transformants conferred growth on CM plates containing canavanine. 16 out of 40 canavanine resistant colonies were sequenced to confirm mutations at CAN1 target sites (SEQ ID NO: 214), and 14 colonies were confirmed to have mutations at CAN1 target site. FIG. 18 shows an alignment of a fragment of the wild type CAN1 gene comprising the CAN1 target site (SEQ ID NO: 215) and mutations at the CAN1 target sequence in colonies 14, 16, 18, 19, 24 and 25 , SEQ IDS NOs: 216-221, respectively).