T CELL RECEPTORS FROM THE HIV-SPECIFIC REPERTOIRE, MEANS FOR THEIR PRODUCTION AND THERAPEUTIC USES THEREOF
20190381099 ยท 2019-12-19
Inventors
- Lisa Amita CHAKRABARTI (Paris, FR)
- Daniela BENATI (Reggio Emilia, IT)
- Moran GALPERIN (Neuilly-Sur-Seine, FR)
Cpc classification
C07K14/161
CHEMISTRY; METALLURGY
C12N2740/15043
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
C07K2317/34
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
A61K35/17
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
Abstract
The present invention pertains to the field of T Cell receptors (TCR) identification and clonotyping, and especially concerns particular TCRs identified by clonotyping of a HIV-specific TCR repertoire, or fragments thereof. The invention relates especially to TCRs recognizing Gag peptide located between positions 293-312 in the GAG protein of HIV-1. The present invention further relates to nucleic acid constructs suitable as means for cloning or expressing nucleic acid molecules or TCRs of the invention, such as plasmids, vectors, especially lentiviraltransfer vectors. The invention is of particular interest in the context of therapeutic treatment of human beings seropositive for HIV.
Claims
1-24. (canceled)
25. A T-cell receptor (TCR) which is specific for the epitope located between positions 293-312 in the GAG protein of HIV-1 having the amino-acid sequence FRDYVDRF[Y/F]KTLRAEQA[S/T]QE (SEQ ID NO: 1), comprising an alpha chain and a beta chain whose variable domains each comprise three complementarity determining regions CDR1, CDR2 and CDR3, wherein a. the amino-acid sequence of the CDR1 and CDR2 on the alpha variable chain is encoded by the human TRAV24 gene, and b. the amino-acid sequence of the CDR1 and CDR2 on the beta variable chain is encoded by the human TRBV2 gene, and c. the TCR has a sensitivity for said epitope of the GAG protein of HIV-1 that is measured as the capability of CD4+ T cells which express the TCR, to proliferate and to differentiate into TNF-alpha and/or IFN-gamma secreting effectors upon stimulation with said epitope with half-maximal responses for TNF-alpha or IFN-gamma production (EC50) being achieved.
26. The TCR of claim 25, wherein d. the amino-acid sequence of the CDR3 on the alpha chain comprises a motif selected amongst: [A/S]X[K/R]AAGNKLT (SEQ ID NO: 2), AXYGGATNKLI (SEQ ID NO: 3), AX[R/N][R/N]AGNMLTF (SEQ ID NO: 4), AXD[N/D]RKLI (SEQ ID NO: 5) or AXE[S/G]X[G/A][A/S][Q/E]KLV (SEQ ID NO: 6), X being any amino-acid, and/or e. the amino-acid sequence of the CDR3 on the beta chain comprises a motif selected amongst: ASSX[R/G/L][T/A][S/G]GXX[E/D/T][Q/T][F/Y]) (SEQ ID NO: 7), ASSX[R/G/L][T/A][S/G/A]GXX[E/D/T/P][Q/T][F/Y/H] (SEQ ID NO: 8), ASSGXXNTEAF (SEQ ID NO: 9) or ASVLMRT[N/R]NEQF (SEQ ID NO: 10), X being any amino-acid.
27. The TCR of claim 25, which specifically recognizes a peptide from the GAG protein of HIV-1 having the amino-acid sequence FRDYVDRF[Y/F]KTLRAEQA[S/T]QE (SEQ ID NO: 1) when presented by a major histocompatibility complex (MHC) molecule.
28. The TCR of claim 25, which has at least one of the following properties: a. an affinity for the epitope located between positions 293-312 of the GAG protein of HIV-1 measured by a Kd value m that is equal or less than 20 M by SPR analysis and/or b. it is polyfunctional as measured by assaying induction of at least 3 cytokines.
29. The TCR of claim 25, which has sensitivity for the epitope located between positions 293-312 of the GAG protein of HIV-1 that is measured according to at least one or several of: i. the capability of CD4+ T cells which express the TCR, to proliferate and to differentiate into TNF-alpha and/or IFN-gamma secreting effectors upon stimulation with said epitope, defined through the epitope concentration required for achieving half-maximal responses (EC50) for TNF-alpha or IFN-gamma production, wherein the EC50 value is in the range of 10E-8 to 10E-7 M, and/or ii. monitoring the induction of the early activation marker CD69 by cells expressing the TCRs, upon stimulation with said epitope, as defined through the epitope concentration required for achieving half-maximal responses (EC50) for CD69 induction, wherein the EC50 is in the range of 10-5 M to 10-7 M, and/or iii. by MHC-class II tetramers binding/titration experiment, sensitivity being defined by half-maximal tetramer binding values (EC50) in cells transduced with the TCR, wherein the EC50 tetramer binding value is in the range of 10E-9 to 10E-7 M, and/or iv. by assessing with TCR-transduced cells, upon antigenic stimulation using the Gag293 peptide, whether markers production including at least one of the following markers is achieved: cytokines such as TNF-alpha, IL-2, IFN-gamma, chemokines such as MIP-1 beta/CCL4, degranulation marker such as CD107a, and/or v. by assessing the polyfunctionality of TCR-transduced cells such as CD4+ or CD8+ cells, upon antigenic stimulation using the Gag293 peptide, though assessment of the presence of a detectable induction of at least 3 cytokines, and/or vi. by assessing the cytotoxicity of TCR-transduced cells such as CD4+ or CD8+ cells, in the presence of HIV-infected cells, and evaluating the percentage of viral suppression, wherein the the viral suppression observed in HIV-infected cells, especially in the presence of CD4+ transduced cells, is in a range of 40%, to 100%, and/or viral suppression can be detected in HIV-infected cells in the presence of CD4+ transduced cells at a ratio below 2, and/or viral suppression is observed in CD8+ transduced cells and is in a range of 40% to 100%.
30. The TCR of claim 25, wherein: a. the amino-acid sequence of the CDR3 on the alpha chain is or comprises a sequence as disclosed in any one of SEQ ID NO: 11 to 27, and/or b. the amino-acid sequence of the CDR3 on the beta chain is or comprises a sequence as disclosed in any one of SEQ ID NO: 28 to 46, or c. the amino-acid sequence of the CDR3 on the alpha and/or beta chain comprises a variant having at least 80% amino-acids sequence identity with the sequences disclosed in a. and b. respectively, the length of the amino-acid sequence of the CDR3 on the alpha chain being from 9 and 16 amino-acid residues, the length of the amino-acid sequence of the CDR3 on the beta chain being from 11 and 18 amino-acid residues.
31. The TCR of claim 25, wherein: a. the amino-acid sequence of the CDR3 on the alpha chain is or comprises a sequence selected from: CAFKAAGNKLTF (SEQ ID NO: 47), CASKAAGNKLTF (SEQ ID NO: 48), and CSRRAAGNKLTF (SEQ ID NO: 49), and/or b. the amino-acid sequence of the CDR3 on the beta chain is or comprises a sequence selected from: CASSRLAGGMDEQF (SEQ ID NO: 50), CATTPGASGISEQF (SEQ ID NO: 51), CASSPGTSGVEQFF (SEQ ID NO: 52), and CASSRRTSGGTDTQYF (SEQ ID NO: 53), or c. the amino-acid sequence of the CDR3 on the alpha and/or beta chain comprises a variant having at least 80% amino-acids sequence identity with the sequences disclosed in a. and b. respectively, the length of the amino-acid sequence of the CDR3 on the alpha chain being from 9 and 16 amino-acid residues, the length of the amino-acid sequence of the CDR3 on the beta chain being from 11 and 18 amino-acid residues.
32. The TCR of claim 25, wherein: the amino-acid sequence of the CDR1 and CDR2 on the alpha variable chain encoded by the human TRAV24 gene has an amino-acid sequence for the CDR1alpha corresponding to the positions 49 to 54 in SEQ ID NO: 58 and has an amino-acid sequence for the CDR2alpha corresponding to the positions 72 to 77 in SEQ ID NO: 58 and the amino-acid sequence of the CDR1 and CDR2 on the beta variable chain encoded by the human TRBV2 gene has an amino-acid sequence for the CDR1beta corresponding to the positions 46 to 50 in SEQ ID NO: 59 and has an amino-acid sequence for the CDR2beta corresponding to the positions 68 to 73 in SEQ ID NO: 59 and the amino-acid sequence of the CDR3 on the alpha chain that is: CAFKAAGNKLTF (SEQ ID NO: 11), and the amino-acid sequence of the CDR3 on the beta chain that is: CASSRLAGGMDEQFF (SEQ ID NO: 512), or the amino-acid sequence of the CDR3 on the alpha and/or beta chain comprises a variant having at least 80% amino-acids sequence identity with the sequences disclosed above for the CDR3 found on the alpha and beta chains, respectively, the length of the amino-acid sequence of the CDR3 on the alpha chain being from 9 and 16 amino-acid residues, the length of the amino-acid sequence of the CDR3 on the beta chain being from 11 and 18 amino-acid residues.
33. The TCR of claim 25, wherein: the amino-acid sequence of its alpha chain is as disclosed in SEQ ID NO: 58 or SEQ ID NO: 60, and the amino-acid sequence of its beta chain is as disclosed in SEQ ID NO: 59 or SEQ ID NO: 61, or the amino-acid sequence of its alpha and/or beta chain is a variant having at least 80% amino-acids sequence identity with the sequences disclosed above.
34. The TCR of claim 25, which is an isolated, and/or recombinant TCR and/or a chimeric TCR such as a single chain TCR, a soluble TCR, a single chain TCR fragment.
35. A nucleic acid molecule encoding at least one chain of the TCR of claim 25, or a fragment thereof selected in the group of nucleic acid molecules encoding the alpha chain, the variable domain of the alpha chain, the CDR3 domain of the alpha chain, the beta chain, the variable domain of the beta chain, the CDR3 domain of the beta chain, the soluble form of the TCR.
36. A nucleic acid molecule encoding at least a part of the alpha chain of a human TCR and/or at least a part of the beta chain of a TCR, in which: a. the nucleic acid molecule encoding at least a part of the alpha chain of a TCR comprises at least the nucleotide sequence of the human TRAV24 gene coding the CDR1 and the CDR2 of a TCR and further comprises the junctional rearranged nucleotide sequence disclosed in any one of SEQ ID NO: 79 to SEQ ID NO: 120 or a variant thereof having at least 80% sequence identity with these sequences, and/or b. the nucleic acid molecule encoding at least a part of the beta chain of a TCR comprises at least the nucleotide sequence of the human TRBV2 gene coding the CDR1 and the CDR2 of a TCR and further comprises the junctional rearranged nucleotide sequence disclosed in any one of SEQ ID NO: 121 to SEQ ID NO: 161 or a variant thereof having at least 80% sequence identity with these sequences.
37. The nucleic acid molecule according to claim 36, which comprises or consists of the sequence disclosed in SEQ ID NO: 62, and/or comprises or consists of the sequence disclosed in SEQ ID NO: 63, or variant thereof having at least 80% nucleotide sequence identity with the sequences.
38. The nucleic acid molecule according to claim 36, which comprises a nucleic acid sequence coding for the alpha chain and/or the beta chain of a TCR.
39. A recombinant nucleic acid molecule which comprises the nucleic acid molecule coding for the alpha chain and the nucleic acid molecule of the beta chain of a TCR wherein both nucleic acid molecules are linked to form a single molecule, optionally are linked by a polynucleotide encoding a 2A peptide, and each of said nucleic acid molecule is as defined in claim 35.
40. A vector comprising at least one nucleic acid molecule according to claim 35.
41. A lentiviral transfer vector, comprising at least one nucleic acid molecule according to claim 35 and lentiviral cis-active elements including long terminal repeats (LTRs) or modified LTRs including partially deleted 3LTR, psi () packaging signal, optionally Rev responsive element (RRE), wherein the nucleic acid molecule is contained in a transcription unit and wherein said vector optionally further comprises a lentiviral DNA flap encompassing the fragment of the lentiviral genome framed by the regions of central polypurine tract (cPPT) and central termination sequence (CTS) and/or wherein the transcription unit optionally comprises a self-cleaving 2A sequence inserted between sequences encoding alpha and beta TCR chains.
42. The lentiviral transfer vector according to claim 41, wherein the lentiviral sequences are from the genomic sequence of a viral species selected from the group consisting of: human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), visna/maedi virus (VMV), caprine arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), and bovine immunodeficiency virus (BIV)
43. A method to produce recombinant lentiviral vector particles, comprising or consisting of: a) transfecting the recombinant lentiviral transfer vector according to claim 41, into a host cell, for example a HEK-293T cell line; b) co-transfecting the cell of step a) with (i) a plasmid vector encoding the envelope glycoprotein G of a VSV, and (ii) with a plasmid vector encoding the lentiviral GAG and POL protein or mutated non integrative POL protein of a lentivirus, as packaging construct; c) recovering the recombinant lentiviral particles expressing recombinant TCR.
44. Recombinant lentiviral vector particles the genome of which comprises the recombinant lentiviral transfer vector according to claim 41, which are pseudotyped with a vesicular stomatitis virus glycoprotein G (VSV-G) protein.
45. A method for obtaining a collection of recombinant cells expressing a TCR or a recombinant TCR, comprising the steps of: a. Transducing cells capable of expressing a TCR at their surface with recombinant lentiviral vector particles according to claim 44, and b. Culturing the transduced cells in conditions that permit the TCR to be expressed at their surface, and c. Obtaining and/or recovering a recombinant cell collection expressing said recombinant TCR and optionally further isolating said expressed recombinant TCR.
46. A collection of recombinant human T-cells presenting a TCR as claimed in claim 25, formulated for administration to a human host.
47. A method of providing an immunotherapeutic treatment of a human patient seropositive for HIV, comprising administering the recombinant lentiviral vector particles according to claim 44 to the human patient.
48. The method of claim 47, wherein the human patient is under antiretroviral therapy following a HIV infection.
Description
LEGEND OF THE FIGURES
[0348]
[0349] (A) Sorting of Gag293-specific CD4+ T cells with HLA-DR tetramers. Examples of primary CD4+ T cell lines labeled with DRB5 (top) and DR1 (bottom) tetramers. The percentage of tetramer positive cells (Tet+) in the total CD4+ T cell population (middle plots) and in the sorted Tet+ population (right plots) is reported in the top right corner of the graph. Samples labeled with tetramers loaded with an irrelevant peptide (CLIP or Annexin II) were used as negative controls (left plots).
[0350] (B, C) The percentages of Tet+ cells expressing the TRAV24 (B) or TRBV2 family (C) were analyzed by qPCR in the HIC and the HAART groups and compared by the Mann-Whitney test.
[0351] (D, E) CDR3 length profiles for the TRAV24 (D) and TRBV2 families (E) are shown for each patient analyzed. Healthy donor PBMC were used as control (bottom left). The percentage of the TRAV24 or TRBV2 family in the total TRAV or TRBV PCR product is reported above each profile.
[0352]
[0353] (A) The number of unique CDR3 amino acid sequences (clonotype AA) obtained per 100 TRAV24 (left) or TRBV2 (right) nucleotide sequences were compared in the HIC and HAART groups with the Mann-Whitney test.
[0354] (B) Simpson's diversity indexes computed for TRAV24 (left) and TRBV2 (right) clonotypes AA obtained in each patient were compared in the HIC and HAART groups with the Mann-Whitney test.
[0355] (C to E) Frequencies of TRAJ genes (D), TRBJ genes (E), and TRBD genes (F) in Gag293-specific TRA or TRB sequences. Frequencies were compared between the HIC (light grey bars) and HAART groups (dark bars).
[0356] (F): the distribution of CDR3 lengths were compared for TRAV24 between the sets of HIV Controller sequences (HIC, n=584) and treated patient sequences (HAART, n=496). CDR3 lengths are reported in number of a. a.
[0357] (G): the distribution of CDR3 lengths were compared for TRBV2 between the sets of HIV Controller sequences (HIC, n=716) and treated patient sequences (HAART, n=566).
[0358]
[0359] (A, B) The Meme motif discovery program was used to identify a.a. motifs enriched in Controller TRAV24 sequences (A) and TRBV2 sequences (B) compared to corresponding sequences in treated patients. The Meme program was used in discriminative mode, which highlights differences between sequence datasets. The relative size of each a.a. symbol is proportional to its frequency in the HIC dataset, while the total height of a.a. symbols indicates the information content of the position, in bits.
[0360] (C, D) Frequency of public clonotypes per 100 TRAV24 sequences (C) or per 100 TRBV2 sequences (D) for each of the 8 Controllers (HIC) and 8 treated patients (HAART) studied.
[0361] (E, F) Frequency of nucleotide sequences coding for a public clonotype per 100 TRAV24 sequences (E) and per 100 TRBV2 sequences (F). (C to F) Significant differences (P<0.05) obtained by the Mann-Whitney test are reported.
[0362] (G) Structure of the CDR3 junction for the most prevalent TRAV24 public clonotype AFKAAGNKLT. The number of N mutations (N), of trimmed nucleotides (trim), and the frequency (% AFKAAGNKLT) of the 4 nucleotide sequences coding for this clonotype are reported (SEQ ID NO: 172 to 174 on
[0363]
[0364] (A) Gating strategy for tetramer analysis in Controller PBMC. An example of PBMC staining with a control tetramer (AnnII; left plot) and a Gag293-loaded DRB5 tetramer (right plot) is shown.
[0365] (B) Frequency of TRAV24 and TRBV2 families in Gag293-Tet+ cells sorted ex vivo. The percentages of TRAV24 expression in total TRAV products (left) and TRBV2 expression in total TRBV products (right) are reported. Dotted lines indicate the mean percentage of TRAV24 and TRBV2 families in CD4+ T cell from 7 healthy donors.
[0366] (C) Representation of Gag293-specific clonotypes found ex vivo in the cell line obtained from the same patient. The percentage of sequences matching a TRAV24 (left) or TRBV2 ex vivo clonotype (right) in the corresponding cell line is reported, with medians indicated by horizontal lines.
[0367] (D, E) The percentages of public motifs are compared in sequences obtained ex vivo (left) and in the matched cell line (right) for TRAV24 (D) and TRBV2 (E), using the paired Student t test.
[0368]
[0369] (A) Expression of TCR(and CD3 in J76 cells transduced with the F24, F25, and F5 TCRs. Solid grey histograms correspond to mock-transduced J76 cells.
[0370] (B) Staining of F24-transduced J76 cells with CLIP-loaded tetramers (top) and Gag293-loaded tetramers (bottom). The percentage of Tet+ cells is reported on each plot.
[0371] (C) The percentage of Tet+ cells after transfer of F24 (black), F25 (medium grey), and F5 (light grey) is reported for each of the 4 tetramers tested after subtraction of CLIP-tetramer background (mean of 2 experiments).
[0372] (D) Example of SPR sensorgrams. The soluble F24 TCR (concentrations 0.3 to 100 M) was flown over immobilized DR11-Gag293 monomers to measure the SPR response. RU, response units.
[0373] (E) Affinity measurement of the F24, F25, and F5 TCRs for Gag293 complexed to DR11, DRB5, or DR1 monomers. Each soluble TCR was flown over Gag293-DR complexes at different concentrations (x axis) to measure binding RU (y axis).
[0374] (F) Summary of affinities (Kdeq) of the F24, F25 or F5 TCRs for Gag293-loaded HLA-DRB monomers. Each Kdeq value represent the meanSEM from at least two independent experiments performed in duplicate.
[0375] (G) Correlation between TCR affinity and tetramer binding. TCR affinities (log Kdeq) of the F24, F25 and F5 TCRs for the 3 Gag293-DR complexes are plotted in function of the percentage of Gag293-Tet+ cells (log % Tet+) for the corresponding TCR/HLA-DR combination (y axis). R: Spearman correlation coefficient.
[0376]
[0377] (A, B) Antigen sensitivity assay in TCR-transduced J76 cells. Percentages of CD69 expression in J76 cells transduced with TCRs F24, F25, F5 (A) or F4 and F13 (B), after coculture with L-cells expressing different HLA-DR alleles (DR11, DR15, DRB5, or DR11) and loaded with decreasing Gag293 concentrations. Experiments were conducted in triplicate, with curves corresponding to one experiment shown for clarity.
[0378] (C) Antigen sensitivity assay of TCRs HD5 and HY9 from HAART patients.
[0379] (D) Correlation between binding affinity (log Kdeq) for Gag293-loaded HLA-DR monomers (DR11, DRB5, and DR1) and antigen sensitivity (log EC50 for CD69 induction) of the F24, F25 and F5 TCRs.
[0380] (E) Correlation between the antigen sensitivity (log EC50) measured for 8 TCRs in the presence of DR11 APC and the number of HLA-DR alleles restricting these TCRs. (E, F). R: Spearman correlation coefficient.
[0381] (F) TCR reactivity to native HIV-1 capsid antigens. CD69 induction was quantified in TCR-transduced J76 cells cocultured with dendritic cells infected with the VSV-pseudotyped virus HIV-1 (+) or left uninfected (). One representative experiment out of three is shown.
[0382]
[0383] (A) Cytokine production in primary CD4+ T cells mock-transduced (1st row) or transduced with the F24, F25, or F5 TCR (rows 2-4) and stimulated with 10-5M Gag293. CD4+ T cells were analyzed by ICS for expression of TNF-, MIP-1, IL-2, IFN-, and CD107a. One representative experiment out of three is shown.
[0384] (B) ICS analysis of CD4+ T cells transduced with F24 and stimulated with decreasing Gag293 doses. Expression of the analyzed markers (% marker+) is reported in function of peptide dose, after subtraction of background measured in unstimulated cells.
[0385] (C) Summary of EC50 values measured by ICS in CD4+ T cells after TCR transduction. For each TCR, the Gag293 concentration required to achieve half-maximal expression of the 5 markers studied is reported. Mean+SEM of EC50 values obtained for 3 independent experiments are reported.
[0386] (D) Cytokine production in CD8+ T cells that were mock-transduced (1st row) or transduced with the F24 TCR (2nd row) and analyzed as in A.
[0387] (E) ICS analysis of CD8+ T cells transduced with F24 and stimulated with decreasing Gag293 doses.
[0388] (F) Polyfunctionality of CD4+ T cells transduced with the F24, F25, and F5 TCRs and stimulated with decreasing Gag293 doses. The number of co-expressed markers out of the 5 studied (TNF-, MIP-1, IL-2, IFN-, CD107a) defines the number of functions reported in legend. Stimulation with PMA/ionomycin is used as a positive control.
[0389]
[0390] (A) The number of mutations (P+N) inserted in Gag293-specific clonotypes compared to TRAV24-containing (left) or TRBV2-containing (right) germline sequences is reported.
[0391] (B) The number of germline nucleotides trimmed during V(D)J recombination to generate the observed Gag293-specific TRAV24-containing (left) and TRBV2-containing (right) clonotypes is reported.
[0392] (A and B): The numbers of mutations and trimmed nucleotides were computed in the IMGT/HighV-QUEST program, using the IMGT database of human germline TRAV and TRBV alleles as a reference (www.imgt.org). Significant differences between means (P<0.05) obtained by the unpaired student t-test are reported.
[0393]
[0394] The Meme motif discovery program (meme-suite.org) was used to identify the most prevalent a.a. motifs in HIV Controller (HIC) and treated patients (HAART) clonotypes. The Meme program was used in normal mode with the one occurrence per sequence option, to take all clonotypes into account. The relative sizes of the letters in the logo are proportional to their frequencies, while the total height of the letters indicates the information content of the position, in bits.
[0395] (A) Most prevalent motif in TRAV24 clonotypes from the HIC (top; n=584) and HAART (bottom; n=496) groups.
[0396] (B) Most prevalent motif in TRBV2 clonotypes from the HIC (top; n=716) and HAART (bottom; n=566) groups.
[0397]
[0398] (A) Gag293-DR11 tetramer titration: J76 cells transduced with the TCRs F24, F25, or F5 were incubated with decreasing concentrations of HLA-DR11 tetramer loaded with the Gag293 peptide. The percentage of Gag293-specific tetramer+ (Tet+) cells minus the percentage of cells labeled with a control CLIP-loaded tetramer is reported. (B and C)
[0399] Gag293-DRB5 tetramer (B) and Gag293-DR1 tetramer (C) titration on F24-transduced cells. The dip in binding curves at high tetramer concentrations likely reflects competition effects between multivalent ligands. EC50 computation was based on the sigmoidal part of the response curve. (D) Linear correlation between the maximum % of tetramer+ cells and TCR affinity determined by SPR. (E) The half-maximal tetramer binding values (EC50) are reported. ND: not detectable, i.e. tetramer binding was too low to evaluate the EC50 value.
[0400]
[0401] (A) Comparison of antigen sensitivity in HIV Controllers (HIC) and treated patients (HAART) carrying at least one DR11 allele. Antigen sensitivity was measured by the last Gag293 peptide dilution (in M) that yielded a specific CD4+ T cell line.
[0402] (B) Comparison of the maximal ELIPOT response to Gag293 in DR11 patients. CD4+ T cell lines generated with a 10-5 M Gag293 peptide dose were restimulated with the same high peptide dose and analyzed by IFN- ELISpot assay. The number of spot forming cells (SFC) per 106 cells is reported. Values>104 SFC/106 cells reached saturation and are reported as equal to 104 SFC/106 cells.
[0403] (A and B) P values obtained by the Mann-Whitney U test are reported.
[0404] (C and D) Comparison of TRAV24 (C) and TRBV2 (D) expression in Gag293-specific cells of DR11 patients.
[0405] The percentage of TRAV24 or TRBV2 expression among tetramer-positive (Tet+) cells is reported.
[0406]
[0407] (A) Example of TCR transduction in primary CD4+ T cells from a healthy donor. PBMCs were mock transduced, or transduced to express the F24, F25, or F5 TCRs, and stained with anti-TRBV2 mAb.
[0408] (B) MHC II tetramer staining in CD4+ T cells transduced with the F24 TCR (second row), or mock transduced (first row). The percentage of CD4+ T cells stained with Gag293-loaded HLA-DR tetramers (DR11, DR15, DRB5, and DR1) is reported in the top right corner. For these experiments, the DR15 tetramer used corresponded to the HLA DRB1*1502 rather than the HLA DRB1*1501 allele.
[0409] (C) Quantification of MHC II tetramer staining in TCR-transduced primary CD4+ T cells. For each tetramer, the mean percentage of tetramer-positive (Tet+) CD4+ T cells obtained from 4 independent experiments is shown. The percentage of Gag293-specific Tet+ cells was computed by subtracting the percentage of CLIP-Tet+ cells from that of Gag293-Tet+ cells. Light grey bars: mock-transduced; black bars: F24-transduced; grey bars: F25-transduced; light grey bars: F5-transduced.
[0410]
[0411] (A) Blocking of the cytokine response in CD8+ T cells with anti-HLA antibodies.
[0412] Cytokine induction was measured in CD8+ T cells transduced with the F24 TCR after stimulation with 10-5 M Gag293 peptide or in non-stimulated cells (NS). Cells were pretreated with an isotypic IgG2a control antibody (black bars), an HLA-DR blocking antibody (grey bars) or a pan-MHC I blocking antibody (light grey bars) at 10 g/ml prior to peptide stimulation. >75% of the response was blocked by HLA-DR antibody treatment for each cytokine tested, indicating that F24-expressing CD8+ T cells were predominantly restricted by MHC II.
[0413] (B) Analysis of the polyfunctionality of CD8+ T cells transduced with the Gag293-specific TCR F24. Polyfunctionality was defined as the capacity for specific cells to co-express at least 3 markers among the 5 studied (TNF-, MIP-1, IL-2, IFN-, and CD107a) after Gag293 peptide stimulation. The number of markers co-expressed defines the number of functions reported in legend. Polyfunctionality is visualized with pie charts in which each slice represents a functional category: white, 5 functions; light grey, 4 functions; middle grey, 3 functions; dark grey, 2 functions; andblack, 1 function. Polyfunctionality was assessed after stimulation at different peptide doses ranging from 10-5 M to 10-8 M. Stimulation with PMA and ionomycin was used as a positive control to induce a highly polyfunctional response (right pie).
[0414]
[0415] (A) Scheme of the viral suppression assay: immature monocyte-derived dendritic cells (iDC) were infected with a single-cycle pseudotyped HIV-1-GFP virus (HIV-1 NL4-3 GFP) in the presence of Vpx containing virus-like particles (Vpx-VLP), and then cocultivated with TCR-transduced T cells. HIV suppression was quantified by the decrease in GFP+DC in the presence of TCR-transduced T cells at different effector:target (E:T) ratios.
[0416] (B) Representative example illustrating the decrease of GFP+ infected DC in the presence of F24-transduced CD4+ T cells.
[0417] (C) Quantification of the decrease in GFP+ infected DC in function of the TCR transduced (F24, F25, or F5) and of the E:T ratio.
[0418] (D) Comparison of F24 suppressive effect on infection in DC expressing different HLA-DR alleles.
[0419] (E) Suppressive effect of the 3 TCRs when transduced in CD8+ T cells.
[0420]
[0421]
[0422] As a summary of the experiments carried out, it has been observed that the rare patients who spontaneously control HIV replication in the absence of therapy show signs of a particularly efficient cellular immune response. To identify the molecular determinants underlying this response, the inventors characterized the TCR repertoire directed at the most immunoprevalent CD4 epitope in HIV-1 capsid, Gag293. HIV Controllers from the ANRS CODEX cohort showed a highly skewed TCR repertoire characterized by a predominance of TRAV24 and TRBV2 variable genes, shared CDR3 motifs, and a high frequency of public clonotypes. The most prevalent public clonotypes generated TCRs with affinities at the higher end of values reported for naturally occurring TCRs. These high-affinity Gag293-specific TCRs were cross-restricted by up to 5 distinct HLA-DR alleles, accounting for their expression in HIV Controllers of diverse genetic backgrounds. Transfer of these TCRs to healthy donor CD4+ T cells conferred high antigen sensitivity and polyfunctionality, thus recapitulating key features of the Controller CD4 response. Transfer of a high-affinity Gag293-specific TCR could also redirect CD8+ T cells to target HIV-1 capsid via nonconventional MHC II restriction. These findings indicate that TCR clonotypes with superior functions are associated with HIV control. Amplifying or transferring such clonotypes may contribute to immunotherapeutic approaches that aim at a functional HIV cure.
Results
[0423] We set to compare Gag293-specific CD4 responses in HIV Controllers and efficiently treated patients, two groups characterized by long-term viral control. The clinical and immunological characteristics of the studied patients are reported in Table 1. A stringent definition of HIV control was applied, based on an undetectable viral load in standard assays (<50 copies HIV-1 RNA/ml) for over 5 years. The duration of control was actually longer, as patients included in the Controller group (HIC group, n=14) had been infected for a median duration of 19 years. They were compared to HIV-1 infected patients (HAART group, n=15) who had received long-term antiretroviral therapy, with an undetectable viral load for at least 5 years, and a median duration of treatment of 11 years. Thus, both groups were characterized by long-term viral suppression, which ensured that potential differences in CD4 responses were not primarily determined by levels of residual HIV viremia.
TABLE-US-00030 TABLE 1 Clinical and immunological characteristics of patients HIV controllers Treated patients Clinical parameters.sup.a (HIC, n = 14) (HAART, n = 15) P value.sup.b Age, years 50 [34-61] 48 [39-56] N.S. Duration of HIV-1 infection, years 19.6 [9.8-26.0] 11.9 [6.8-25.3] 0.015 Duration of antiretroviral treatment, N/A 11.1 [5.6-19.3] years Virus load, HIV-1 RNA copies/ml <50 <50 N.S. plasma CD4+ T cells/mm3 875 [648-1400] 570 [266-1534] 0.008 Nadir of CD4+ T cells/mm3 N/A 216 [21-589] Frequency of Gag293-specific CD4+ T cell lines generated at different peptide HIV controllers Treated patients doses.sup.c (HIC, n = 14) (HAART, n = 15) P value.sup.d Gag293 dose: 10.sup.5 M 14/14 15/15 N.S. Gag293 dose: 10.sup.7 M 14/14 8/15 0.006 Gag293 dose: 10.sup.9 M 8/14 1/15 0.005 Gag293 dose: 10.sup.11 M 2/14 0/15 N.S. .sup.aMedian values and ranges are reported. .sup.bP values were estimated with the Mann-Whitney test. .sup.cFrequency of viable cell lines that achieved doubling of input cells and gave a specific response by IFN-g ELISPOT assay. .sup.dDifferences in frequencies were evaluated with Fisher's exact test. N.S.: not significant (P 0.05); N/A: not applicable.
[0424] High Antigen Sensitivity of Gag293-Specific CD4 Responses in HIV Controllers
[0425] TCR repertoire studies of specific CD4+ T cells have remained scarce in humans due to the limited clonal amplification of CD4+ T cells as compared to CD8+ T cells, and to the generally lower affinity of TCR expressed by CD4+ T cells, which limits MHC II tetramer detection (31). In the case of HIV infection, these factors are compounded by the general decrease of the CD4+ T cell population, the preferential depletion of HIV-specific CD4+ T cells, and their incomplete restoration under antiretroviral therapy (5, 6). To address these issues and analyze the TCR repertoire of CD4+ T cells from treated patients as well as Controllers, we devised a system of short-term primary CD4+ T cell line cultures that allowed the amplification of MHC II tetramer-positive cells prior to sorting. Using this system, we previously reported the presence Gag293-specific CD4+ T cells with high antigen sensitivity and high MHC II tetramer binding capacity in Controllers, while such cells were absent from treated patients (27). To extend these results, we generated primary CD4+ T cells lines by stimulation with decreasing doses of Gag293 peptide. The specificity of CD4+ T cell lines was evaluated at equivalent growth stages (doubling time), by restimulation with Gag293 and analysis by IFN- ELISPOT assay. As reported in Table 1, viable Gag293-specific cell lines were obtained for all patients of the HIC and HAART groups when initially stimulated with the highest peptide dose of 10.sup.5 M. However, a marked difference was observed for cell lines generated at 10.sup.7 M peptide, with only 8 out of 15 treated patients responding, versus all of the 14 Controllers (P=0.006). The difference was also marked at the 10.sup.9 M peptide dose (P=0.005). Moreover, 2 of the Controllers, but none of the treated patients responded at the 10.sup.11 M peptide dose. These experiments established that Gag293-specific CD4+ T cells had a higher antigen sensitivity in the Controller group, as indicated by the capacity to proliferate and differentiate into IFN--secreting effectors upon stimulation with minimal peptide doses.
[0426] Biased TRAV and TRBV Gene Usage in Gag293-Specific CD4+ T Cells
[0427] To characterize the Gag93-specific TCR repertoire, we first genotyped patients for the HLA-DRB1 gene. Eight Controllers and eight treated patients who shared at least one of four HLA-DR alleles (DR1, DR11, DR15, or DRB5) were included in the TCR study (Table 5). The frequencies of these four alleles did not differ significantly between the HIC and the HAART groups (P0.05 by Fisher's exact test). CD4+ T cell lines from these patients were labeled with HLA-DR matched Gag293-loaded tetramers, and evaluated for the proportion of Tet+ cells in the CD4+CD8-T cell population (
[0428] Analysis of TRBV distribution also revealed a major bias in Gag293-specific cells, with a marked predominance of the TRBV2 family, expressed at a median value of 82% in the Controller group (
[0429] High Clonotypic Diversity of Gag293-Specific Cells in Controllers
[0430] Clonotypic repertoire analysis was carried out for the two variable gene families amplified in Gag293-specific cells, TRAV24 and TRBV2. PCR products corresponding to these two families were cloned, sequenced, and analyzed with IMGT tools (34). A minimum of 50 productive CDR3 sequences were analyzed for each sample, with the full list of CDR3 sequences provided in Tables 6 and 7. Productive TRAV24 sequences (n=584 for the HIC group; n=496 for the HAART group HAART group results not shown) were evaluated for diversity by counting the number of distinct clonotypes, i.e. the number of unique CDR3 aa sequences, present in each patient sample. The normalized number of clonotypes proved significantly higher in the HIC than the HAART group (P=0.0011;
[0431] Biased J and D Gene Usage in Gag293-Specific TCRs from Controllers
[0432] The Gag293-specific CDR3 sequence dataset was analyzed for the distribution of Junction (J) and Diversity (D) gene segments. TRAJ gene usage was restricted, with 15 and 11 distinct TRAJ genes detected in TRAV24 sequences for the HIC and HAART groups, respectively, out of 61 TRAJ genes reported in the IMGT database (
[0433] High Prevalence of Public Motifs in Gag293-Specific TCRs from Controllers
[0434] Given the observed biases in V(D)J gene usage, we next evaluated whether Gag293-specific CDR3 sequences shared common aa motifs. The Meme motif discovery software was used in discriminative mode to identify motifs enriched in HIC as compared to HAART TRAV24 sequences. This approach revealed a highly prevalent but complex motif shared by 81% of HIC CDR3 sequences (
TABLE-US-00031 TABLE2 PrevalenceofpublicmotifsinGag293-specificclonotypes Public CDR3 HIC HAART Pvalue clono- TRAV24Motif length group group HICvs types Sequence (AA) (%seq.) (%seq.) HAART (%seq.) MotifAV24-1 [A/S]x[K/R]AAGNKLT 10 37.16 22.38 <0.0001 33.33 MotifAV24-2 AxYGGATNKLI 11 11.64 6.65 0.0062 27.78 Motifs 48.80 29.03 <0.0001 61.11 AV24-1+ AV24-2 TRBV2Motif Public Sequence CDR3 HIC HAART Pvalue clono- SEQIDNO: length group group HICvs types 196and197 (AA) (%seq.) (%seq.) HAART (%seq.) MotifBV2-1 ASSx[R/G/L][T/A][S/G] 13 38.55 6.36 <0.0001 50.00 Gxx[E/T]Q[F/Y] MotifBV2-2 ASSx[R/G/L][T/A]SGGxx 14 11.87 3.89 <0.0001 33.33 [E/T]Q[F/Y] Motifs 50.42 10.25 <0.0001 83.33 BV2-1+ BV2-2 The percentage of motif occurrence is reported in total sequences from HIC and HAART patients as well as in the set of public clonotypes. P values for differences between the HIC and HAART groups were computed with Fishers exact test. x = any amino acid. Seq. = Sequences.
[0435] Meme analysis of TRBV2 sequences in discriminative mode identified a complex motif with interspersed highly conserved positions in 79% of HIC sequences (
[0436] High Frequency of TCR Sharing in HIV Controllers
[0437] Public clonotypes were defined as identical CDR3 aa sequences found in at least two individuals, without any mismatch tolerated. A total of 18 public clonotypes were identified in the TRAV24 sequence dataset obtained from the 16 patients studied (Table 3A). The most prevalent public clonotype, AFKAAGNKLT (called TRAV24-F), was found in 6 Controllers and 2 treated patients (75% and 25%, respectively), which are remarkably high frequencies in humans with diverse HLA II backgrounds. Groups of highly related public clonotypes were apparent, with a first group sharing the TRAJ17 chain and motif AxKAAGNKLT (AV24-1), and a second group sharing the TRAJ32 chain and motif AxYGGATNKLI (AV24-2). The 18 public clonotypes showed a high degree of motif sharing (61% positive for motifs AV24-1 or AV24-2, Table 2), confirming their similarity. Of note, public clonotypes were more frequent in the HIC than in the HAART group (P=0.03;
[0438] Interestingly, a majority of TRAV24 public clonotypes (67%) were encoded by multiple nucleotide sequences. The mean number of unique nucleotide sequences encoding a TRAV24 public clonotype was 2.33, versus 1.05 for private (i.e. non-public) TRAV24 clonotypes. Detailed analysis of the 4 sequences coding for the most prevalent TRAV24 public clonotype, AFKAAGNKLT, showed that P and N mutations inserted between the TRAV24 and the TRAJ17 genes were few, ranging from 0 to 4 nucleotides (
TABLE-US-00032 TABLE3 DistributionofGag293-specificpublicclonotypes Nb HIC1 HIC2 HIC3 HIC4 HIC6 HIC7 HAA1 HAA2 HAA4 HAA8 of Nbof DR15 DRB5 DR11 DR15 HIC5DR1 DR11 DRB5 HIC8DR1 DRB5 DRB5 HAA3DR1 DR11 HAA5DR1 HAA6DR1 HAA7DR11 DRB5 HIC HAART A-TRAV24PublicClonotypes TRAJ17 CAFKAAGNKLTF tgtgcctttaaagct 2 35 8 11 59 37 6 2 gcaggcaacaagcta actttt tgtgcctttaaggct 1 1 1 gcaggcaacaagcta actttt tgtgccttcaaagct 2 64 2 10 gcaggcaacaagcta actttt tgtgcatttaaagct 1 gcaggcaacaag ctaactttt CAFRAAGNKLTF tgtgccttcagggct 2 4 1 gcaggcaacaagcta actttt tgtgcctttagagct 1 gcaggcaacaagcta actttt tgtgcctttcgagct 2 3 gcaggcaacaagcta actttt tgtgcctttagggct 1 gcaggcaacaagcta actttt CAHKAAGNKLTF tgtgcccacaaagct 2 3 2 0 gcaggcaacaagcta actttt tgtgcccataaagct 1 gcaggcaacaagcta actttt CALKAAGNKLTF tgtgccttgaaagct 1 2 1 gcaggcaacaagcta actttt tgtgccttaaaagct 1 gcaggcaacaagcta actttt tgtgctctaaaagct 6 gcaggcaacaagcta actttt CASKAAGNKLTF tgtgcctctaaagct 13 2 0 gcaggcaacaagcta actttt tgtgcctccaaagct 4 gcaggcaacaagcta actttt CSRRAAGNKLTF tgtagtcggagggct 18 10 1 1 gcaggcaacaagcta actttt TRAJ32 CAEYGGATNKLIF tgtgccgaatatggt 2 1 3 3 0 ggtgctacaaacaag ctcatcttt CANYGGATNKLIF tgtgccaactatggc 2 5 2 0 ggtgctacaaacaag ctcatcttt CAPYGGATNKLIF tgtgccccttatggt 2 1 2 1 ggtgctacaaacaag ctcatcttt tgtgctccttatggc 1 ggtgctacaaacaag ctcatcttt tgtgccccgtatggt 1 ggtgctacaaacaag ctcatcttt CARYGGATNKLIF tgtgcccgttatggt 10 1 1 ggtgctacaaacaag ctcatcttt tgtgctcgttatggt 1 ggtgctacaaacaag ctcatcttt tgtgctcggtatggt 26 ggtgctacaaacaag ctcatcttt CASYGGATNKLIF tgtgcctcttatggt 8 1 1 3 0 ggtgctacaaacaag ctcatcttt tgtgcctcctatggt 25 1 ggtgctacaaacaag ctcatcttt tgtgcctcgtatggt 2 ggtgctacaaacaag ctcatcttt tgtgcctcctatggc 2 ggtgctacaaacaag ctcatcttt TRAJ38 CAFDNRKLIW tgtgccttcgacaac 31 37 1 1 cgtaagctgatttgg tgtgcctttgacaac 2 cgtaagctgatttgg TRAJ39 CAFRNAGNMLTF tgtgcctttcgtaat 1 2 2 gcaggcaacatgctc accttt tgtgcctttcggaat 1 gcaggcaacatgctc accttt tgtgcctttaggaat 4 gcaggcaacatgctc accttt tgtgcctttagaaat 10 gcaggcaacatgctc accttt CALNNAGNMLTF tgtgccctcaataat 1 1 1 gcaggcaacatgctc accttt tgtgccttaaataat 24 gcaggcaacatgctc accttt CALRNAGNMLTF tgtgccctgcggaat 3 1 1 gcaggcaacatgctc accttt tgtgccttaagaaat 1 gcaggcaacatgctc accttt tgtgccttacgaaat 12 gcaggcaacatgctc accttt CATRRAGNMLTF tgtgcgacgcgccgt 6 5 2 0 gcaggcaacatgctc accttt TRAJ54 CASESTGAQKLVF tgtgcctccgagtcc 3 1 2 0 acgggagcccagaag ctggtattt TRAJ57 CAYEGASEKLVF tgtgcctacgagggg 3 1 2 0 gcatctgaaaagctg gtcttt B-TRBV2PublicClonotypes TRBJ1-1 CASSGQTNTEAFF tgtgccagctcagga 10 2 1 1 cagacgaacactgaa gctttcttt TRBJ1-5 CASSEGAAGNQPQHF tgtgccagcagtgaa 1 1 1 ggggcggctggcaat cagccccagcatttt tgtgccagcagcgag 1 ggggcggcgggcaat cagccccagcatttt TRBJ2-1 CASSELTSGGDEQFF tgtgccagcagtgag 1 63 2 0 ttgactagcgggggg gatgagcagttcttc CASSPGTSGVGEQFF tgtgcaagcagcccc 15 2 0 gggactagcggagtt ggtgagcagttcttc tgtgcaagcagcccc 1 gggactagcggagtt ggtgagcagtttttc tgtgccagcagtccc 2 gggactagcggggtt ggtgagcagttcttc CASVLMRTNNEQFF tgtgccagtgtatta 9 4 atgaggacgaacaat 2 0 gagcagttcttc TRBJ2-3 CASSALASGTDTQYF tgtgccagcagtgcg 1 2 1 ttagctagcggtaca gatacgcagtatttt tgtgccagcagtgct 1 ttggctagcggcaca gatacgcagtatttt tgtgccagcagtgcc 2 ctggctagtggcaca gatacgcagtatttt CASSARTSGGADTQYF tgtgccagcagtgca 1 2 0 aggactagcgggggg gccgatacgcagtat ttt tgtgccagcagtgcc 1 aggactagcgggggg gcagatacgcagtat ttt tgtgccagcagtgct 1 aggactagcgggggg gcagatacgcagtat ttt CASSARTSGGSDTQYF tgtgccagcagtgcc 1 3 0 aggactagcgggggc tcggatacgcagtat ttt tgtgccagcagtgct 3 cggactagcgggggg tcagatacgcagtat ttt tgtgccagcagcgcc 1 cggactagcgggggg tcagatacgcagtat ttt tgtgccagcagtgcc 2 aggactagcgggggg tcagatacgcagtat ttt CASSARTSGGTDTQYF tgtgccagcagtgcc 2 1 2 0 aggactagcggaggc acagatacgcagtat ttt tgtgccagcagtgct 1 aggactagcgggggc acagatacgcagtat ttt CASSHRASGGDTQYF tgtgccagcagtcac 31 1 2 0 agggcctcaggcggg gatacgcagtatttt CASSLRTSGGSDTQYF tgtgccagcagccta 1 1 1 aggactagcgggggt tcagatacgcagtat ttt tgtgccagcagcctt 1 aggactagcgggggt tcagatacgcagtat ttt CASSLRTSGGTDTQYF tgtgccagcagtctt 1 1 1 aggactagcgggggc acagatacgcagtat ttt tgtgccagcagtctc 2 cggactagcgggggc acagatacgcagtat ttt tgtgccagcagtctt 1 cggactagcggggga acagatacgcagtat ttt CASSPLTSGTDTQYF tgtgccagcagtccg 1 1 1 ttgactagcggaaca gatacgcagtatttt tgtgccagcagtcca 1 ttgactagcggcaca gatacgcagtatttt tgtgccagcagtcgt aggactagcgggggc 6 acagatacgcagtat ttt CASSRRTSGGTDTQYF tgtgccagcagtcga 1 4 0 cggactagcgggggc acagatacgcagtat ttt tgtgccagctcacga 1 cggactagcgggggc acagatacgcagtat ttt tgtgccagcagccgc 12 cggactagcgggggc acagatacgcagtat ttt tgtgccagcagtcgg 1 aggactagcgggggc acagatacgcagtat ttt TRBJ2-7 CASSKLASGADEQYF tgtgccagctcaaaa 6 1 2 0 ctggctagcggggcc gacgagcagtacttc tgtgccagctcaaaa 1 ctggctagcggggcc gacgagcagtatttc CASSPRTSGGDEQYF tgtgccagcagtccc 1 1 1 cggactagcgggggc gacgagcagtacttc tgtgccagcagcccc 1 cggactagcgggggg gacgagcagtacttc CASSPRTSGTYEQYF tgtgccagcagtccc 1 1 1 cggactagcggtacc tacgagcagtacttc tgtgccagcagtcct 1 aggactagcggaacc tacgagcagtacttc CASSRRTSGTYEQYF tgtgccagcagccgt 1 2 0 aggactagcgggact tacgagcagtacttc tgtgccagcagtaga 1 cggactagcgggacc tacgagcagtacttc The number of nucleotide sequences coding for a TRAV24 (A) or TRBV2 (B) public clonotype is reported for each patient studied. The number of HIC and HAART patients sharing a given public clonotype is reported in the last two columns. HIC: HIV Controller; HAART or HAA: patient receiving highly active antiretroviral therapy. The tetramer used for sorting (DR1, DR11, DR15, or DRB5) is reported below each patient code.
[0439] Public clonotypes were also abundant in Gag293-specific TCR(I chains, with a total of 18 found in the TRBV2 sequence dataset (Table 3B). Public clonotype sequences derived predominantly from the TRBJ2-3, TRBJ2-1, and TRBJ2-7 genes, which were all more represented in HIC than HAART sequences. TRBV2 public clonotypes showed a remarkably high degree of motif sharing (83%, Table 2), emphasizing the presence of conserved features in spite of relatively high sequence diversity. Again, TRBV2 public clonotypes were clearly more frequent in the HIC than the HAART group, in terms of aa sequences (P=0.006;
[0440] It was noteworthy that the majority of public clonotypes were restricted by multiple HLA DR alleles. Specifically, 83% of TRAV24 public clonotypes and 56% of TRBV2 public clonotypes were identified in samples sorted with at least 2 different HLA DR tetramers (Table 3, A and B). The most prevalent TRAV24 public clonotype, TRAV24-F, was restricted by the 4 HLA DR alleles tested (DR1, DR11, DR15, DRB5), while the most prevalent TRBV2 public clonotype, TRBV2-13, was restricted by 3 of these alleles (DR1, DR15, and DRB5). Thus, highly prevalent public clonotypes showed a high level of HLA cross-restriction, which could help explain their prevalence in patients of diverse genetic backgrounds.
[0441] We next evaluated the degree of overlap of the Gag293-specific clonotypic repertoires restricted by two distinct HLA DR alleles in a same patient. This intrapatient comparison was done for 3 HIV Controllers, for whom two cell lines sorted with different tetramers (DR15/DRB5, or DR11/DRB5) were analyzed in parallel (
[0442]
The Gag293-specific repertoire was compared in two cell lines obtained from the same patient but sorted with two distinct MHC II tetramers.
The TRAV24 clonotypes
Comparisons are shown for 3 HIV Controllers. Public clonotypes are in bold type. Clonotypes tested functionally are marked by an asterisk.
TABLE-US-00033 TABLE 9 Intrapatient comparisons of Gag293-specific clonotypic repertoires obtained with different MHC II tetramers - Summary % shared % public in TRAV24 % shared shared Tetramers clonotypes TRAV24 TRAV24 Patient used AA sequences clonotypes AA HIC1 DRB1*1501/ 22.22 83.51 50 DRB5*0101 HIC3 DRB1*1101/ 7.69 16.98 100 DRB5*0101 HIC7 DRB5*0101/ 6.25 30.92 100 DRB1*1502 Mean 12.05 43.80 83.33 % shared % public in TRBV2 % shared shared Tetramers clonotypes TRBV2 TRBV2 Patient used AA sequences clonotypes AA HIC1 DRB1*1501/ 11.63 12.5 40 DRB5*0101 HIC3 DRB1*1101/ 14.81 40.22 50 DRB5*0101 HIC7 DRB5*0101/ 6.45 28.57 50 DRB1*1502 Mean 10.96 27.10 46.67
[0443] The Gag293-specific repertoire was compared in cell lines obtained from the same patient but sorted with two distinct MHC II tetramers. Comparisons were made for 3 HIV Controllers (HIC1, HIC3, HIC7). Clonotype AA: unique CDR3 sequence, in amino acids.
[0444] The % of shared clonotypes AA is obtained from the number of shared clonotypes AA divided by the total number of clonotypes AA obtained for the two tetramer+ samples.
[0445] The % of shared sequences is obtained from the number of nt sequences corresponding to shared clonotypes AA divided by the total number of sequences obtained for the two tetramer+ samples.
[0446] The % of public clonotypes is computed among the shared clonotypes AA.
[0447] Ex Vivo Detection of Gag293-Specific Public Clonotypes in HIV Controllers
[0448] The Gag293-specific TCR repertoire was initially analyzed in primary CD4+ T cell lines, as the preferential depletion of specific CD4+ T cells in HIV-infected patients did not allow a direct ex vivo analysis of Tet+ cells. However, the exceptional immunological status of HIV Controllers made the ex vivo analysis feasible for a subset of these patients. Four samples sorted from Controller PBMC containing >2,000 Tet+ cells were analyzed by Immunoscope and sequencing. The DRB5 tetramer was used in these experiments, as it yielded the best signal/noise ratio (example in
[0449] The frequency of each TRAV24 clonotype found ex vivo was computed relative to total TRAV24 sequences found in the same patient (Table 4, 3rd column) and in the matched cell line (4th column). Ex vivo clonotypes represented in median 66% of sequences found in matched cell lines, indicating a large overlap between the ex vivo and in vitro repertoires (
[0450] Detailed analysis of TRAV24 sequences obtained ex vivo revealed the presence of previously identified public clonotypes in each of the patient tested (highlighted in color, Table 4). Public clonotypes were present at median frequencies of 44% and 25% in ex vivo TRAV24 and TRBV2 sequences, respectively, which did not differ significantly from frequencies observed in matched cell lines (not shown). Overall, the ex vivo analysis confirmed the high degree of TCR sharing among HIV Controllers. It was striking that some of the most prevalent public clonotypes, such as AFKAAGNKLT, could represent more than half of TRAV24 sequences in the Gag293-specific repertoire (54.7% in HIC7). This suggested that public clonotypes could shape the properties of the Gag-specific response in controlled HIV infection.
TABLE-US-00034 TABLE4 ListingofTRAV24clonotypesfoundin Gag293-specificCD4+ Tcellssortedexvivo. %incell J-GENE JUNCTION(AA) %exvivo line HIC1DRB5+ exvivo(n= 119seq.) TRAJ38*01 CARDDRKLIW 4.20 TRAJ17*01 CAFTAAGNKLTF 8.40 TRAJ39*01 CALGNAGNMLTF 27.73 4.65 TRAJ6*01 CAFIPGGSYIPTF 3.36 2.33 TRAJ32*02 CASYGGATNKLIF 21.85 62.79 TRAJ45*01 CALDSGGGADGLTF 34.45 HIC2DRB5+ exvivo(n= 56seq.) TRAJ17*01 CAFKAAGNKLTF 17.86 56.06 TRAJ39*01 CARRNAGNMLTF 12.50 TRAJ17*01 CASKAAGNKLTF 69.64 19.70 HIC3DRB5+ exvivo(n= 76seq.) TRAJ17*01 CALKAAGNKLTF 6.58 1.79 TRAJ39*01 CALRQAGNMLTF 93.42 62.50 HIC7DRB5+ exvivo(n= 106seq) TRAJ13*02 CAPGGYQKVTF 4.72 TRAJ22*01 CAWGSARQLTF 4.72 TRAJ17*01 CAFKAAGNKLTF 54.72 18.18 TRAJ17*01 CAFNAAGNKLTF 5.66 5.45 TRAJ26*01 CAFVAAGQNFVF 4.72 TRAJ32*02 CAEYGGATNKLIF 3.77 5.45 TRAJ32*01 CANYGGATNKLIF 6.60 3.64 TRAJ32*02 CASYGGATNKLIF 0.94 7.27 TRAJ24*02 CALMTTDSWGKLQF 14.15 The representation of each clonotype in the TRAV24 sequence set obtained ex vivo (3rd column) and in the corresponding cell line (4th column) is reported (SEQ ID NO: 176 to 195).
[0451] TCR Transfer Confers Gag293 Recognition in the Context of Multiple HLA-DR Alleles
[0452] We set to functionally characterize the most prevalent TRAV24 public clonotype AFKAAGNKLT (clonotype TRAV24-F) by pairing it with different TRBV2 chains and testing the activity of reconstituted TCRs. The chosen TRBV2 clonotypes no. 24 (CASSRLAGGMDEQFF) and 25 (CATTPGASGISEQFF) were the most abundant in cell line of patient HIC2 (10.38% and 33.96% of TRBV2 chains, respectively; Table 7), and were co-expressed at high levels with clonotype TRAV24-F, resulting in a high probability of functional TCR chain pairing. The third TRBV2 clonotype, no. 5 (CASSGLAGGMDEQFF), was derived from patient HIC3, who also expressed TRAV24-F at high level. Clonotype 5 differed by a single residue (R to G) from clonotype 24, and thus provided information on the contribution of the CDR3 arginine to TCR function. TRBV2 clonotypes 24 and 5 carried the public motif BV2-1, while TRBV2 clonotype 25 was private (see Table 10 for a list of all TCR constructs). Full-length TRA and TRB genes were cloned into a T2A lentiviral vector, ensuring equimolar expression of the two chains. The resulting TCRs, F24, F25, and F5, were transduced in J76, a mutant Jurkat cell line defective for endogenous TCR expression, which provides a favorable cellular context for TCR transfer assays. After transduction, J76 cells expressed equivalent levels of the 3 TCRs at the cell surface (60% TCR+ cells), and recovered a high level of CD3 surface expression (
To test the specificity of the transferred TCRs, transduced J76 were labeled with a panel of Gag293-loaded HLA-DR tetramers. The F24 TCR was found to bind 3 out of the 4 tetramer tested, with an efficiency that was higher for DR11 as compared to DRB5 and DR1 (
[0453] Tetramer titration experiments showed the expected hierarchy between the 3 TCRs (F24>F25>F5) but did not prove sensitive enough to determine TCR avidity for F25 and F5 (
[0454] Transfer of TCRs Containing Public TRAV24 and TRBV2 Clonotypes Confers High Antigen Sensitivity to J76 Cells
[0455] TCR function was tested by monitoring the induction of the early activation marker CD69 in transduced J76 cells. Murine fibroblastic L cells engineered to express a single human HLA-DR allele were used as APC, allowing a precise control of the restricting HLA molecule. L cells expressing DR1, DR3, DR4, DR7, DR11, DR15, or DRB5 were pulsed with decreasing doses of Gag293 peptide and cocultured with J76 cells transduced with the F24, F25, and F5 TCRs (
[0456] Two other TRAV24 public clonotypes, TRAV24-S(ASKAAGNKLT) and TRAV24-RR (SRRAAGNKLT) conferred cross-restriction by 4 HLA-DR alleles when paired to TRBV2 chains no. 24 and 5, respectively (Table 10), emphasizing that broad HLA cross-restriction was a frequent property of public clonotypes. We then tested the pairing of TRAV24-F with two TRBV2 public clonotypes: TRBV2-4 (ASSPGTSGVGEQF), shared by 2 Controllers, and TRBV2-13 (ASSRRTSGGTDTQY), the most prevalent TRBV2 clonotype, shared by 4 Controllers. The resulting TCRs, F4 and F13, were cross-restricted by 3 HLA-DR alleles (DR11, DR15 and DRB5) (
[0457] We next verified that the recombinant TCRs could recognize native HIV capsid antigens naturally processed by APC, in addition to peptide-pulsed APC. To this goal, we used infected monocyte-derived dendritic cells (MDDC) as alternative APC. MDDC from DR11+ healthy donors were infected with an HIV-1 pseudotyped virus and incubated with J76 cells expressing the F24, F25, or F5 TCR. The TCR-transduced cells showed robust CD69 induction in the presence of infected MDDC, while CD69 expression remained moderate in the absence of infection (
[0458] As the public clonotypes consistently generated TCRs with optimal antigen sensitivity in a DR11 context, it was important to verify that differences in antigen sensitivity between the HIC and the HAART group did not depend on a bias in DR11 expression. Among the 29 patients included in the study, 3 Controllers and 4 treated patients expressed a DR11 allele, including HLA DRB1*1101, DRB1*1122, and DRB1*1165 (Table 5). Comparison of the last Gag293 peptide dilution that induced a specific cell line showed that, among DR11 patients, 3 out of 3 Controllers and 1 in 4 treated patient responded at a dilution <10-5 M (
TABLE-US-00035 TABLE 5 MHC typing and clinical characteristics of patients included in the study Duration of VL Tetramer Patient Age Infection CD4/ copies/ MHC Class II used for ID yrs yrs mm3 mL DRB1 alleles sort HIC 1 56.4 25.0 850 <50 DRB1*1501/1507/1510 (DRB5) DRB1*1501 HIC 2 50.8 24.2 1020 <50 DRB1*1122 DRB1*1501/ DRB5*0101 1507/1510 (DRB5) HIC 3 54.7 22.0 1050 <50 DRB1*0102 DRB1*1101 DRB1*1101 HIC 4 61.4 26.0 852 <50 DRB1*1501 (DRB5) DRB1*1501 HIC 5 53.6 11.0 742 <50 DRB1*0101 DRB1*1607 DRB1*0101 HIC 6 34.6 13.1 1048 <50 DRB1*1101 DRB1*1204/ DRB1*1101 1201/1202/ 1307 HIC 7 41.7 11.7 744 <50 DRB1*0701/ DRB1*1501/ DRB5*0101 0703/0704/ 1502 0705/0706 (DRB5) HIC 8 48.5 21.0 799 <50 DRB1*0102 DRB1*1301 DRB1*0101 HIC 9 49.7 14.6 754 <50 DRB1*0101 DRB1*0701 HIC 11 45.0 26.0 1042 <50 DRB1*0101 DRB1*1501 (DRB5) HIC 12 50.9 25.5 648 <50 DRB1*0301 DRB1*1359 HIC 13 34.0 9.8 899 <50 DRB1*1360/ DRB1*1401/ 1402 1602 (DRB5) HIC 14 56.6 18.3 1400 <50 DRB1*1301/ DRB1*0703 1302 HIC 15 43.6 14.7 1063 <50 DRB1*0101 DRB1*0703 Median 50.3 19.6 875 <50 HIC HAAR 41.4 7.1 516 <50 DRB1*0101/ DRB1*1502/ DRB5*0101 T 1 0107 1504/1506/ 1514 (DRB5) HAAR 44.5 10.2 432 <50 DRB1*1502 DRB1*1608 DRB5*0101 T 2 (DRB5) HAAR 52.5 25.3 682 <50 DRB1*0101/ DRB1*0703 DRB1*0101 T 3 0107 HAAR 53.0 14.5 570 <50 DRB1*0703 DRB1*1122 DRB1*1101 T 4 HAAR 48.6 9.0 948 <50 DRB1*0102 DRB1*1410 DRB1*0101 T 5 HAAR 54.5 6.8 266 <50 DRB1*0101/01 DRB1*0322 DRB1*0101 T 6 07 HAAR 55.9 18.1 846 <50 DRB1*0701 DRB1*1122 DRB1*1101 T 7 HAAR 39.5 20.1 847 <50 DRB1*1501 (DRB5) DRB5*0101 T 8 HAAR 47.7 19.7 534 <50 N.A. N.A. T 9 HAAR 54.0 11.2 422 <50 DRB1*0301 DRB1*1501 T 10 (DRB5) HAAR 52.1 12.9 937 <50 DRB1*0701 DRB1*1001 T 11 HAAR 43.0 12.1 558 <50 DRB1*1165 DRB1*1301 T 12 HAAR 45.0 11.9 1534 <50 DRB1*0401 DRB1*1101 T 13 HAAR 47.5 11.9 557 <50 DRB1*0901 DRB1*1301 T 14 HAAR 41.4 7.1 785 <50 DRB1*0101 DRB1*0301 T 15 Median 47.7 11.9 570 <50 HAAR T Primary CD4+ T cell lines were generated from 14 HIV Controllers (HIC) and 15 treated patients (HAART) genotyped for HLA-DRB1. For a subgroup of 8 HIC and 8 HAART patients, CD4+ T cell lines were sorted with HLA-matched tetramers loaded with the Gag293 peptide. The tetramer used for the sort is reported in the rightmost column. VL: viral load; N.A. not available.
[0459] Transfer of the F24 TCR confers polyfunctionality to primary CD4+ and CD8+ T cells
[0460] We next evaluated the properties of the F24, F25, and F5 TCRs when transferred directly into primary T cells, a system physiologically more relevant to potential TCR transfer applications. Healthy donor PBMC were transduced with concentrated TCR lentivector stocks, and analyzed for exogenous TCR expression with a TRBV2-specific mAb. Mock-transduced CD4+ T cells expressed endogenous TRBV2 at levels below 5%, while TCR-transduced CD4+ T cells showed TRBV2 expression rates in the 25%-35% range (
[0461] To evaluate TCR function, PMBC from DR11, DR15, DR1, or DRB5 donors were TCR-transduced and cocultured with autologous MDDC pulsed with Gag293. A panel of 5 markers, including the cytokines TNF-, IL-2, and IFN-, the chemokine MIP-1/CCL4, and the degranulation marker CD107a, was assayed by intracellular cytokine staining (ICS). CD4+ T cells transduced with the F24, F25, and F5 TCRs showed abundant cytokine production and degranulation capacity after high dose Gag293 peptide stimulation (
[0462] Polyfunctionality, or the capacity to express multiple cytokines simultaneously, is a hallmark of Controller T cells, and is thought to provide superior effector functions (17, 23, 39). Quantification of the number of functions (or markers) co-expressed by TCR transduced cells revealed a high degree of polyfunctionality (
[0463] Interestingly, CD8+ T cells transduced with the F24 TCR also showed a Gag293-specific cytokine response, with detectable induction of the 5 markers tested (
[0464] Expression of the High-Affinity F24 TCR Induces the Formation of Mature Immunological Synapses at High Frequency
[0465] We set up a system to measure the formation of conjugates between TCR-transduced J76 T cells and antigen presenting cells (APC) pulsed with the Gag293 peptide. EBV-transformed B lymphoblastoid cell lines (B-EBV) of known HLA DR haplotypes were used APC. Conjugate formation was measured by the percentage of B-EBV/TCR-J76 doublets counted by flow cytometry. The high affinity TCR F24 proved markedly more efficient at inducing conjugate formation with B-EBV, compared to the lower affinity TCRs F25 and F5 (not shown). Analysis by imaging flow cytometry showed that the intensity of CD3 relocalization at the T cell/APC interface also strongly depended on TCR affinity (not shown). Therefore, the high affinity TCR F24 proved more efficient at triggering the formation and the maturation of immunological synapses, a key step required for T cell activation and proliferation.
[0466] The F24 TCR Confers Cytotoxic Responses to Both CD4+ and CD8+ T Cells
[0467] Interestingly, transduction of the F24 TCR resulted in Gag293-specific cytokine responses in CD8+ T cells. Though responses were less sensitive than in CD4+ T cells, polyfunctionality persisted until the 10-7 M peptide dose. The use of blocking HLA antibodies showed that the CD8+ T cells recognized Gag293 through HLA-DR molecules. Thus, transfer of the F24 TCR could redirect CD8+ T cells to target HIV-1 capsid via nonconventional MHC II restriction. This suggests that the F24 TCR is of sufficiently high affinity to function in absence of the CD4 coreceptor and of the CD4-associated Ick molecules.
[0468] We developed a primary cell assay to evaluate the capacity of TCR-transduced T cells to kill HIV-infected autologous dendritic cells (DC) (see
[0469] These findings have important immunotherapeutic implications, as they open the possibility to target the capsid major homology region with both CD4+ and CD8+ T cells, which should reinforce the immune response and limit the risks of escape mutations. Accordingly, the inventors' findings disclosed herein indicate that transfer of public TCRs encompassed within the present disclosure would enable both CD4+ and CD8+ T cells to lyze HIV-infected target cells with high efficiency. Given the unique set of properties disclosed herein, controller-derived and especially suitably selected public TCRs as disclosed herein represent promising tools for immunotherapy against HIV, especially for HIV control and/or functional cure.
Discussion
[0470] Exploration of the TCR repertoire specific for the most immunoprevalent CD4 epitope in HIV-1 Gag revealed a markedly biased repertoire focused on the TRAV24 and TRBV2 gene families. Highly prevalent public motifs and public clonotypes were preferentially shared by HIV Controllers, suggesting that particular TCR determinants contributed to the efficiency of the antiviral CD4 response in these patients. This notion was reinforced by functional analysis of the most prevalent public clonotypes, as these were able to confer HLA cross-restricted, highly sensitive, polyfunctional responses against Gag antigens, indicative of superior function. These findings, which to our knowledge provide the first assessment of the HIV-specific CD4+ T cell repertoire at the clonotypic level, emphasize that intrinsic TCR determinants, rather than low antigenemia, determine the remarkable properties of the cellular response in controlled HIV infection.
[0471] It was noteworthy that both the TRAV24 and TRBV2 repertoires specific for Gag293 showed a high degree of motif and clonotype sharing. In fact, when the inventors characterized the repertoire of TCRs specific for Gag293, they uncovered an unexpected level of TCR sharing among HIV Controllers, which in turn enabled to envision that the features of particular TCR sequences can be associated with HIV control. So far, most studies of the human TCR repertoire have focused on TRB genes, but recent analyses suggest that the human TRA repertoire is even more diverse (40). Our findings provide evidence for a dual bias in controlled HIV infection, with both TCR chains showing a significant degree of conservation. The most prevalent TRAV24 clonotype (AFKAAGNKLT) was present in 6/8 Controllers (75%) studied. In comparison, CD8 TRB public clonotypes reported in previous studies of the HIV-specific repertoire were shared between 2 to 4 patients (14, 15, 41, 42). When the analysis was extended to less stringent definitions of TCR biases, close to half of Controller TRAV24 and TRBV2 clonotypes fitted defined public motifs, while the corresponding frequencies were of 29% and 10% respectively for clonotypes of treated patients. Such strong bias in the Gag293-specific TCR repertoire of Controllers could not be attributed to amplification of a few clonotypes during culture as the repertoire of Controllers remained highly diverse, with a median of 36 distinct TRBV2 clonotypes per 100 CDR3 sequences. In addition, similar frequencies of public motifs were detected in vitro and ex vivo when the TCR repertoire of Controllers could be analyzed in both conditions. Rather, these findings suggest that strong selective pressures shaped the Gag293-specific repertoire during the establishment of viral control.
[0472] Public clonotype occurrence should statistically be an extremely rare event, given the huge number of TCRs that can be generated by V(D)J recombination (>10.sup.15) and the extensive genetic diversity observed in human TCR repertoires, with an estimated >10.sup.7 distinct clonotypes per individual (43). However, public clonotypes have been described in several chronic viral infections of humans, especially those caused by members of the herpesviridae family (32, 35, 37, 43). CD8 public clonotypes specific for conserved regions of Gag have also been identified in the context of Controlled HIV-1 infection, particularly in patients expressing the protective alleles HLA-B57 and B27 (11, 15, 41), though they can also be detected in patients carrying non-protective HLA-B alleles (42). Recent findings indicate that the frequency of HIV-specific public clonotypes correlates with the magnitude of the CD8 response, suggesting an important contribution to antiviral efficacy (42). Whether CD8 public clonotypes are generally more abundant in controlled rather than progressive HIV infection remains debated (44, 45), but it has become clear that the particular set of CD8 public clonotypes present in Controllers is more efficient at suppressing viral replication and at recognizing viral escape mutants than that of progressor patients (11, 12). A high frequency of Gag-specific CD8 public clonotypes has also been associated with a favorable outcome in the SIVmac model, in primary infection as well as post-vaccination (46). The finding that the Gag-specific CD4 repertoire of Controllers is more biased than the corresponding CD8 repertoire and is enriched in highly efficient public clonotypes supports the notion that public clonotypes contribute to HIV/SIV control. A reason for the advantage conferred by public clonotypes in the antiviral response may lie in their intrinsically high frequency. Analyses of the naive TCR repertoire have shown that public clonotypes, which are by definition shared by several individuals, are also present at significantly higher frequencies than private clonotypes in the naive repertoire of each individual (47). The presence of a larger pool of naive T cells ready to respond to a given pathogen is thought to trigger a more rapid initiation of the immune response, which can provide a key advantage to limit viral dissemination at an early stage. This advantage may be particularly critical in the cases of viruses such as HIV and SIV, which can induce a massive CD4+ T cell depletion and ensuing immunosuppression during the first week of infection (48). In effect, abundant public clonotypes endowed with efficient functions may act as a rapid antiviral response force, similar to populations of innate cells expressing conserved TCRs, such as iNKT or MAIT cells (38, 49).
[0473] The high prevalence of Gag293 public clonotypes may result from a high probability of being generated during V(D)J recombination. The most prevalent TRAV24 public clonotype, AFKAAGNKLTF, could be simply generated from germline sequences by limited nucleotide trimming, without requiring N/P mutations. In addition, 72% the 36 Gag293 specific public clonotypes were encoded by more than one nucleotide CDR3 sequence, compatible with the notion of convergent recombination (36). Interestingly, a study of the preimmune CD4+ T cell repertoire in healthy individuals identified several clones reactive with HIV antigens, including one that responded to Gag293 with high antigen sensitivity (50), supporting the idea that high-avidity Gag293-specific precursors may be comparatively abundant in the naive repertoire. Another reason for the high prevalence of Gag293-specific public clonotypes may lie in their extensive HLA cross-restriction. The Gag293 peptide shows promiscuous binding to at least 14 HLA-DR and DQ allomorphs, enabling multiple possibilities for cross-restriction (30, 51, 52). Functional analyses indicated that the F24 TCR bound at least 5 distinct Gag293-MHC II complexes, with an efficient recognition of DR1, DR11, DR15, DRB5, and a limited but consistent recognition of DR7. The correlation between the degree of cross-restriction and the antigen sensitivity of the 8 TCRs tested suggests that broad HLA cross-restriction is a characteristic of high-affinity TCRs, which may better tolerate punctual MHC polymorphisms. This notion is supported by a study of human CD4 responses to JC virus, where HLA II cross-restricted clones showed higher antigen sensitivity and greater in vivo expansion than clones with a more narrow restriction (53). Widespread cross-restriction may help explain why HLA II allele frequencies are not strongly biased in carriers of chronic viral infections. HIV Controllers show a highly significant enrichment for protective HLA I alleles, while biases in HLA II allele distribution have been reported but appear less prominent (23, 52, 54). Considering the evidence for broad HLA II cross-restriction of HIV-specific public TCRs, the limited HLA II biases in the Controller population does not rule out a significant contribution of CD4+ T cells to HIV control.
[0474] The co-expression of TRAV24 and TRBV2 public clonotypes generated functional TCRs that, for some combinations, displayed a remarkably high affinity for Gag293-MHC II complexes. Human TCRs generally show affinities in the 1 to 100 M range by SPR analysis (38). MHC II restricted TCRs show a trend for a lower affinity as compared to MHC I restricted TCRs, with average Kd values of 70 versus 35 M, respectively. With a Kd of 0.86 M for the Gag293-DR11 complex, F24 demonstrated one of the highest affinities reported so far for an MHC II restricted TCR, ranking second in a list of 22 human and mouse TCRs for which structural data is available (38). The molecular determinants of a high avidity interaction for the Gag293-MHC complex appear to depend on both the TRAV24 and TRBV2 chains, and on the restricting HLA allele. The most conserved CDR3 residues in public motifs represent likely candidates for contact residues with Gag293. However, conserved CDR1/CDR2 residues may also contact the Gag293 peptide, considering the predominance of the TRAV24 and TRBV2 families. Future structural studies should help determine the respective roles of the CDR3 versus the CDR1/2 regions in shaping high-avidity interactions for Gag293-MHC complexes. The expression of high-affinity TCRs for Gag293 in Controllers resulted in high antigen sensitivity as measured by CD69 induction, with a good correlation between the two parameters (R=0.85). Thus, TCR biophysical properties largely accounted for TCR function, consistent with multiple studies in animal models (55, 56). It should be noted, however, that in some studies TCRs with very high or supraphysiological affinities were found to have reduced functions (57). A proposed explanation is that a pMHC that interacts too tightly with a very high affinity TCR cannot disengage to contact additional TCRs, and thus does not achieve serial TCR triggering and T cell response amplification (58). We did not observe decreased functions for the TCR/pMHC II combinations showing the highest affinities by SPR, suggesting that TCR affinities in the order of 1 M are still in the physiological range for optimal TCR function in human CD4+ T cells.
[0475] The reasons for the preferential amplification of high-affinity Gag293-specific TCRs in Controllers compared to treated patients remain to be elucidated. A particular genetic background or a limited duration of acute infection may have promoted the amplification of such TCRs in Controllers (59). Conversely, patients who initially progressed to disease may have lost the high avidity CD4+ T cell population due to preferential infection and depletion, a notion supported by the restricted CD4 TCR repertoire observed in treated patients, and by rapid loss of certain CD4 specificities after the acute infection stage (6). It will be informative to determine whether other immunoprevalent HIV epitopes elicit a response pattern similar to that observed for Gag293, with the induction of a highly biased, high affinity TCR repertoire in controlled infection. The preferential detection of Gag-specific CD4 responses in HIV Controllers (22) suggests that several regions of Gag may be targeted by high affinity TCRs, though this remains to be investigated. High-affinity CD4 TCRs are endowed with strong proliferative capacity (55), which helps explain how they could reach such a dominance in controlled HIV infection. The high affinity of Controller TCRs also translated into efficient cytokine secretion upon Gag293 peptide stimulation. Primary CD4+ T cells transduced with the F24 TCR showed EC50 ranging between 10.sup.8 M and 10.sup.9 M peptide for the different cytokines studied, indicative of a remarkably high antigen sensitivity for the CD4+ T cell subset. Polyfunctionality, a property which has been associated with HIV control (39), showed a clear dependence on TCR affinity. Comparison of the F24, F25, and F5 TCRs showed that a difference of 1.1 log in affinity resulted in a 2 log difference in the peptide concentration at which half the specific cells retained 3 functions. Thus, TCR affinity appears critical in determining the range of cytokine produced, particularly at low antigen dose. Of interest, not all cytokines were equally dependent on the strength of the TCR signal, with TNF- showing the lowest requirements, and IFN- the most stringent. The notion of a hierarchy in cytokine production is consistent with a report showing that the affinity of Gag-specific T cell clones dictated their cytokine expression profile (10). It is relevant that for CD4+ T cells, in contrast to CD8+ T cells, IFN- is the most demanding cytokine, as it can be produced only by high avidity cells upon limiting antigenic stimulation. IFN- plays a key role in CD4+T cell helper function, through its capacity to upregulate MHC II in APC and prime them for efficient antigen presentation. In addition, IFN- production by tissue CD4+ T cells plays an underappreciated role in the recruitment of immune effectors, through the triggering of chemokine cascades (60). In controlled HIV infection, high avidity Gag-specific CD4+ T cells may play a similar role, by keeping the immune system in constant alert, and rapidly recruiting CD8+ T cells and NK cells to sites of HIV replication upon the occurrence of viral replication blips. In addition, IFN- secretion may play a direct antiviral role, through the induction of interferon stimulated genes (ISG) that inhibit HIV replication (61). For instance, Th1 cells are thought to be less infectable than Th2 cells due to a higher expression of the HIV restriction factor APOBEC3G (62). Highly differentiated Th1 effectors that re-express CD45RA appear particularly resistant to HIV infection (63). Gag-specific CD4+ T cells in Controllers maintain a Th1 differentiation status with persistent IFN- production (24), raising the possibility that such cells possess a degree of resistance to HIV infection. Thus, high TCR affinity, with the associated capacity for IFN- expression at low antigen dose, may contribute to HIV control at several levels, through sensitive immune surveillance, rapid triggering of helper functions, and direct antiviral effector mechanisms.
[0476] As a proof of concept, the functionality of the most prevalent public clonotype identified by the inventors was tested by TCR transfer in vitro. The most prevalent TRAV24 clonotype, found in 6/8 Controllers and 2/8 treated patients, was paired with a public TRVB2 chain in a bicistronic lentiviral vector, and the resulting TCR (F24) was transferred to heterologous T cells by lentiviral transduction. Interestingly, the F24 TCR was able to recognize the Gag293 peptide presented in the context of multiple MHC II alleles. This broad MHC II cross-restriction helped explain how TRAV24 and TRBV2 public clonotypes could be shared by Controllers expressing diverse MHC II genotypes. The transfer of the F24 TCR was sufficient to confer high antigen sensitivity to primary CD4+ T cells, as indicated an EC50<10-8 M peptide for cytokine induction (
[0477] Of interest, the F24 TCR was also able to confer polyfunctional cytokine responses when transferred into CD8+ T cells. The responses were MHC II restricted, indicating that the F24 TCR could interact with the Gag293-MHC II complex in the absence of the CD4 coreceptor. The CD4 molecule is not thought to contribute significantly to the affinity of the pMHC/TCR/CD4 complex, but plays an important role in relocating the kinase Lck close to TCR/CD3 signaling complex (64). The comparatively lower cytokine responses in CD8+ than in CD4+ T cells may thus result from a lower number of Lck molecules available for triggering intracellular signals. The transfer of the F24 TCR to CD8+ T cells still conferred the 5 functions tested at the 10.sup.5 M to 10.sup.7 M antigen dose, suggesting that transduced CD8+ T cells could become efficient effectors in foci of productive HIV replication. These findings open the possibility of reprogramming CD8+ T cells to target the highly conserved MHR region of capsid, which could be advantageous given the high fitness cost associated with mutations in this region (65). The report that a CMV-based protective SIV vaccine elicited a high frequency of unconventional MHC II-restricted CD8 responses highlights the potential benefits of CD8 T cell reprogramming (66). Studies of TCR transfer for cancer immunotherapy have shown the interest of transferring the same TCR in both CD4+ and CD8+ T cells to enhance tumoricidal activity (67). Similarly, the transfer of a high-avidity Gag-specific TCR in both CD4+ and CD8+ T cell populations may be of interest for adoptive T cell therapies targeting HIV, in order to trigger a full set of antiviral functions.
[0478] In conclusion, study of TCRs specific for the immunoprevalent CD4 epitope in capsid revealed that particular clonotypes are associated with HIV control. The TCR repertoire of Controllers was characterized by a high prevalence of public TRAV24 and TRBV2 chains. Reconstituted TCRs showed affinities that reached the micromolar range, at the high end of values obtained for naturally expressed TCRs. Public clonotypes conferred MHC II cross-restriction, high antigen sensitivity and polyfunctionality to CD4+ T cells, suggesting a key role in shaping the properties of an efficient CD4 response. The most prevalent public clonotype also proved functional in CD8+ T cells, suggesting that it could be used to target the highly conserved capsid MHR region in patients of diverse HLA types. Inducing or transferring such clonotypes may contribute to the development of immunotherapeutic approaches that aim at a functional cure of HIV infection.
TABLE-US-00036 TABLE6 ListofTRAV24clonotypesspecificforGag293(SEQIDNO:198to314forJunction(AA) sequencesandSEQIDNO:315to454forJunction(nt)sequences %nt %AA JUNCTION V-GENE J-GENE JUNCTION JUNCTION(AA) frequency seq seq ntnumber HIC1DR15+ TRAV24*01,or TRAJ38*01 tgtgcccgtgacgaccgtaagctgatttgg CARDDRKLIW 1 1.89 1.89 30 TRAV24*02 TRAV24*01 TRAJ34*01 tgtgcctctggtaacaccgacaagctcatcttt CASGNTDKLIF 1 1.89 1.89 33 TRAV24*01 TRAJ39*01 tgtgccttttgtaatgcaggcaacatgctcaccttt CAFCNAGNMLTF 1 1.89 1.89 36 TRAV24*01 TRAJ17*01 tgtgcctttaaagctgcaggcaacaagctaactttt CAFKAAGNKLTF* 2 3.77 5.66 TRAV24*01 TRAJ17*01 tgtgcctttaaggctgcaggcaacaagctaactttt 1 1.89 TRAV24*01 TRAJ17*01 tgtgcctttacggctgcaggcaacaagctaactttt CAFTAAGNKLTF 1 1.89 1.89 TRAV24*01 TRAJ17*01 tgtgccctagaaaatgcaggcaacaagctaactttt CALENAGNKLTF 1 1.89 1.89 TRAV24*01 TRAJ39*01 tgtgccctcggtaatgcaggcaacatgctcaccttt CALGNAGNMLTF 33 62.26 64.15 TRAV24*01 TRAJ39*01 tgtgccctcggtaatgcaggcaacatgctcacgttt 1 1.89 TRAV24*01 TRAJ57*01 tgctcgcctcagggcggatctgaaaagctggtcttt CSPQGGSEKLVF 1 1.89 1.89 TRAV24*01 TRAJ6*01 tgtgcctttatcccaggaggaagctacatacctacattt CAFIPGGSYIPTF 1 1.89 1.89 39 TRAV24*01 TRAJ42*01 tgtgcctctgatggaggaagccaaggcaatctcatcttt CASDGGSQGNLIF 1 1.89 1.89 TRAV24*01 TRAJ32*02 tgtgcctcttatggtggtgctacaaacaagctcatcttt CASYGGATNKLIF 8 15.09 15.09 Total 11 53 100.00 100.00 HIC2DRB5+ TRAV24*01 TRAJ17*01 tgtgccttcaaagctgcaggcaacaagctaactttt CAFKAAGNKLTF* 2 3.03 56.06 36 TRAV24*01 TRAJ17*01 tgtgcctttaaagctgcaggcaacaagctaactttt 35 53.03 TRAV24*01 TRAJ17*01 tgtgcctttaaggttgcaggcaacaagctaactttt CAFKVAGNKLTF 1 1.52 1.52 TRAV24*01 TRAJ39*01 tgtgcctttaggatggcaggcaacatgctcaccttt CAFRMAGNMLTF 1 1.52 1.52 TRAV24*01 TRAJ39*01 tgtgcctttcgtaatgcaggcaacatgctcaccttt CAFRNAGNMLTF 1 1.52 1.52 TRAV24*01 TRAJ17*01 tgtgcccacaaagctgcaggcaacaagctaactttt CAHKAAGNKLTF 2 3.03 4.55 TRAV24*01 TRAJ17*01 tgtgcccataaagctgcaggcaacaagctaactttt 1 1.52 TRAV24*01 TRAJ39*01 tgtgcccctataaatgcaggcaacatgctcaccttt CAPINAGNMLTF 6 9.09 9.09 TRAV24*01 TRAJ17*01 tgtgcccgcaaagctgcaggcaacaagctaactttt CARKAAGNKLTF 1 1.52 1.52 TRAV24*01 TRAJ17*01 tgtgcctctaaagctgcaggcaacaagctaactttt CASKAAGNKLTF* 13 19.70 19.70 TRAV24*01 TRAJ17*01 tgtgcctcacgaactgcaggcaacaagctaactttt CASRTAGNKLTF 3 4.55 4.55 Total 9 66 100.00 100.00 HIC3DR11+ TRAV24*01 TRAJ17*01 tgtgctccaaagagcaggcaacaagctaacttt CAPKSRQQANF 1 0.64 0.64 33 TRAV24*01 TRAJ17*01 tgtgccttcaaagctgcaggcaacaagctaactttt CAFKAAGNKLTF* 64 41.03 46.15 36 TRAV24*01,or TRAJ17*01 tgtgcctttaaagctgcaggcaacaagctaactttt 8 5.13 TRAV24*02 TRAV24*01,or TRAJ17*01 tgtgccttcagggctgcaggcaacaagctaactttt CAFRAAGNKLTF 2 1.28 1.28 TRAV24*02 TRAV24*01,or TRAJ17*01 tgtgccttgaaagctgcaggcaacaagctaactttt CALKAAGNKLTF 1 0.64 0.64 TRAV24*02 TRAV24*01 TRAJ39*01 tgtgccttgaaacaagcaggcaacaagctcactttt CALKQAGNKLTF 1 0.64 0.64 TRAV24*01 TRAJ39*01 tgtgccttgaggcaagcaggcaacatgctcaccttt CALRQAGNMLTF 6 3.85 3.85 TRAV24*01,or TRAJ17*01 tgtgccatgaaagctgcaggcaacaagctaactttt CAMKAAGNKLTF 1 0.64 1.28 TRAV24*02 TRAV24*01,or TRAJ17*01 tgtgcgatgaaagctgcaggcaacaagctaactttt 1 0.64 TRAV24*02 TRAV24*01,or TRAJ17*01 tgtgccaacagagctgcaggcaacaagctaactttt CANRAAGNKLTF 1 0.64 0.64 TRAV24*02 TRAV24*01,or TRAJ17*01 tgtgcctccaaagctgcaggcaacaagctaactttt CASKAAGNKLTF* 4 2.56 2.56 TRAV24*02 TRAV24*01,or TRAJ17*01 tgtgcctacaaagctgcaggcaacaagctaactttt CAYKAAGNKLTF 1 0.64 0.64 TRAV24*02 TRAV24*01,or TRAJ17*01 tgtggtttcaaagctgcaggcaacaagctaactttt CGFKAAGNKLTF 1 0.64 0.64 TRAV24*02 TRAV24*01,or TRAJ17*01 tgtggttggaaagctgcaggcaacaagctaactttt CGWKAAGNKLTF 1 0.64 0.64 TRAV24*02 TRAV24*01,or TRAJ17*01 tgtagtttgaaagctgcaggcaacaagctaactttt CSLKAAGNKLTF 2 1.28 1.28 TRAV24*02 TRAV24*01,or TRAJ17*01 tgtagtttgagagctgcaggcaacaagctaactttt CSLRAAGNKLTF 1 0.64 0.64 TRAV24*02 TRAV24*01 TRAJ17*01 tgtagtcggagggctgcaggcaacaagctaactttt CSRRAAGNKLTF* 18 11.54 11.54 TRAV24*01,or TRAJ17*01 tgtagttggaaagctgcaggcaacaagctaactttt CSWKAAGNKLTF 4 2.56 2.56 TRAV24*02 TRAV24*01,or TRAJ17*01 tgtagttggagagctgcaggcaacaagctaactttt CSWRAAGNKLTF 1 0.64 1.28 TRAV24*02 TRAV24*01,or TRAJ17*01 tgtagttggagggctgcaggcaacaagctaactttt 1 0.64 TRAV24*02 TRAV24*01,or TRAJ17*01 tgtaccaagaaagctgcaggcaacaagctaactttt CTKKAAGNKLTF 1 0.64 21.15 TRAV24*02 TRAV24*01 TRAJ17*01 tgtacgaagaaagctgcaggcaacaagctaactttt 32 20.51 TRAV24*01,or TRAJ17*01 tgtaccttgaaagctgcaggcaacaagctaactttt CTLKAAGNKLTF 1 0.64 0.64 TRAV24*02 TRAV24*01,or TRAJ17*01 tgtacgaacaaagctgcaggcaacaagctaactttt CTNKAAGNKLTF 1 0.64 0.64 TRAV24*02 TRAV24*01,or TRAJ17*01 tgtactaggaaagctgcaggcaacaagctaactttt CTRKAAGNKLTF 1 0.64 0.64 TRAV24*02 Total 22 156 100.00 100.00 HIC4DR15+ TRAV24*01 TRAJ39*01 tgtgccttccaaaatgcaggcaacatgctcaccttt CAFQNAGNMLTF 6 9.23 9.23 36 TRAV24*01 TRAJ17*01 tgtgcctttagagctgcaggcaacaagctaactttt CAFRAAGNKLTF 1 1.54 1.54 TRAV24*01 TRAJ39*01 tgtgcgacgcgccgtgcaggcaacatgctcaccttt CATRRAGNMLTF 6 9.23 9.23 TRAV24*01 TRAJ57*01 tgtgcctacgagggggcatctgaaaagctggtcttt CAYEGASEKLVF 3 4.62 4.62 TRAV24*01 TRAJ32*02 tgtgccgaatatggtggtgctacaaacaagctcatcttt CAEYGGATNKLIF 2 3.08 3.08 39 TRAV24*01 TRAJ32*02 tgtgccccttatggtggtgctacaaacaagctcatcttt CAPYGGATNKLIF 2 3.08 3.08 TRAV24*01 TRAJ32*02 tgtgcccgttatggtggtgctgcaaacaagctcatcttt CARYGGAANKLIF 1 1.54 1.54 TRAV24*01 TRAJ32*02 tgtgcccgttatggtggtgctacaaacaagctcatcttt CARYGGATNKLIF 10 15.38 16.92 TRAV24*01 TRAJ32*02 tgtgctcgttatggtggtgctacaaacaagctcatcttt 1 1.54 TRAV24*01,or TRAJ32*02 tgtgcccgctatggtggtggtacaaacaagctcattttt CARYGGGTNKLIF 1 1.54 1.54 TRAV24*02 TRAV24*01 TRAJ54*01 tgtgcctccgagtccacgggagcccagaagctggtattt CASESTGAQKLVF 3 4.62 4.62 TRAV24*01 TRAJ32*02 tgtgcctcctatggtggtgctacaaacaagctcatcttt CASYGGATNKLIF 25 38.46 43.08 TRAV24*01 TRAJ32*02 tgtgcctcgtatggtggtgctacaaacaagctcatcttt 2 3.08 TRAV24*01 TRAJ32*02 tgtgcctcttatggtggtgctacaaacaagctcatcttt 1 1.54 TRAV24*01 TRAJ32*02 tgtgcctcctatgttggtgctacaaacaagctcatcttt CASYVGATNKLIF 1 1.54 1.54 Total 12 65 100.00 100.00 HIC5DR1+ TRAV24*02 TRAJ38*01 tgtgccttcgacaaccgtaagctgatttgg CAFDNRKLIW 31 51.67 55.00 30 TRAV24*01 TRAJ38*01 tgtgcctttgacaaccgtaagctgatttgg 2 3.33 TRAV24*01 TRAJ17*01 tgtgcctttaaggctgcaggcaacaagctaactttt CAFKAAGNKLTF* 1 1.67 1.67 36 TRAV24*01 TRAJ17*01 tgtgcctttcgagctgcaggcaacaagctaactttt CAFRAAGNKLTF 2 3.33 3.33 TRAV24*01 TRAJ36*01 tgtgcctcagaaactggggcaaacaacctcttcttt CASETGANNLFF 2 3.33 3.33 TRAV24*02 TRAJ39*01 tgtgcgacgcgccgtgcaggcaacatgctcaccttt CATRRAGNMLTF 5 8.33 8.33 TRAV24*01 TRAJ57*01 tgtgcctacgagggggcatctgaaaagctggtcttt CAYEGASEKLVF 1 1.67 1.67 TRAV24*01 TRAJ32*02 tgtgccgaatatggtggtgctacaaacaagctcatcttt CAEYGGATNKLIF 1 1.67 1.67 39 TRAV24*01 TRAJ22*01 tgtgccttcgcttctggttctgcaaggcaactgaccttt CAFASGSARQLTF 13 21.67 21.67 TRAV24*01 TRAJ54*01 tgtgcctccgagtccacgggagcccagaagctggtattt CASESTGAQKLVF 1 1.67 1.67 TRAV24*02 TRAJ38*01 tgtgccttttacccccctggcaacaaccgtaagctgatttgg CAFYPPGNNRKLIW 1 1.67 1.67 42 Total 10 60 100.00 100.00 HIC6DR11+ TRAV24*01 TRAJ17*01 tgtgcatttaaagctgcaggcaacaagctaactttt CAFKAAGNKLTF* 1 1.69 23.73 36 TRAV24*01 TRAJ17*01 tgtgccttcaaagctgcaggcaacaagctaactttt 2 3.39 TRAV24*01 TRAJ17*01 tgtgcctttaaagctgcaggcaacaagctaactttt 11 18.64 TRAV24*01 TRAJ17*01 tgtgcctttaaagatgcaggcaacaagctaactttt CAFKDAGNKLTF 1 1.69 1.69 TRAV24*01 TRAJ39*01 tgtgcctttcctaatgcaggcaacatgctcaccttt CAFPNAGNMLTF 5 8.47 8.47 TRAV24*01 TRAJ17*01 tgtgcctttagggctgcaggcaacaagctaactttt CAFRAAGNKLTF 1 1.69 1.69 TRAV24*01 TRAJ39*01 tgtgcctttcggaatgcaggcaacatgctcaccttt CAFRNAGNMLTF 1 1.69 1.69 TRAV24*01 TRAJ17*01 tgtgctctaaaagctgcaggcaacaagctaactttt CALKAAGNKLTF 6 10.17 10.17 TRAV24*01 TRAJ17*01 tgtgctctaaaagatgcaggcaacaagctaactttt CALKDAGNKLTF 1 1.69 1.69 TRAV24*01 TRAJ39*01 tgtgccttaaaaaatgcaggcaacatgctcaccttt CALKNAGNMLTF 4 6.78 6.78 TRAV24*01 TRAJ39*01 tgtgccctcaataatgcaggcaacatgctcaccttt CALNNAGNMLTF 1 1.69 1.69 TRAV24*01 TRAJ39*01 tgtgccctgcggaatgcaggcaacatgctcaccttt CALRNAGNMLTF 3 5.08 5.08 TRAV24*01 TRAJ17*01 tgtgcccccaaagctgcaggcaacaagctaactttt CAPKAAGNKLTF 12 20.34 20.34 TRAV24*01 TRAJ17*01 tgtgcccccaaagatgcaggcaacaagctaactttt CAPKDAGNKLTF 1 1.69 1.69 TRAV24*01 TRAJ39*01 tgtgcctccaagaatgcaggcaacatgctcaccttt CASKNAGNMLTF 1 1.69 1.69 TRAV24*01 TRAJ39*01 tgtgcctccatgaatgcaggcaacatgctcaccttt CASMNAGNMLTF 7 11.86 11.86 TRAV24*01 TRAJ53*01 tgtgcctttaagggaggtggaggtagcaactataaactgacattt CAFKGGGGSNYKLTF 1 1.69 1.69 45 Total 15 59 100.00 100.00 HIC7DRB5+ TRAV24*01 TRAJ20*01 tgtgcctttggcgactacaagctcagcttt CAFGDYKLSF 2 3.64 3.64 30 TRAV24*01 TRAJ17*01 tgtgcctttcacgctgcaggcaacaagctaactttt CAFHAAGNKLTF 1 1.82 1.82 36 TRAV24*01 TRAJ17*01 tgtgccttcaaagctgcaggcaacaagctaactttt CAFKAAGNKLTF* 10 18.18 18.18 TRAV24*01 TRAJ10*01 tgtgcctttaagggaggaggaaacaaactcaccttt CAFKGGGNKLTF 1 1.82 1.82 TRAV24*01 TRAJ17*01 tgtgcctttaacgctgcaggcaacaagctaactttt CAFNAAGNKLTF 3 5.45 5.45 TRAV24*01 TRAJ17*01 tgtgccttccaggctgcaggcaacaagctaactttt CAFQAAGNKLTF 9 16.36 16.36 TRAV24*01 TRAJ10*01 tgtgcctttaggggaggaggaaacaaactcaccttt CAFRGGGNKLTF 11 20.00 20.00 TRAV24*01 TRAJ39*01 tgtgcctttcgaagagcaggcaacatgctcaccttt CAFRRAGNMLTF 1 1.82 1.82 TRAV24*01 TRAJ17*01 tgtgcccacaaagctgcaggcaacaagctaactttt CAHKAAGNKLTF 3 5.45 5.45 TRAV24*01 TRAJ17*01 tgtgcccacaaaggagcaggcaacaagctaactttt CAHKGAGNKLTF 1 1.82 1.82 TRAV24*01 TRAJ32*02 tgtgccgaatatggtggtgctacaaacaagctcatcttt CAEYGGATNKLIF 3 5.45 5.45 39 TRAV24*01 TRAJ32*01 tgtgccaactatggcggtgctacaaacaagctcatcttt CANYGGATNKLIF 2 3.64 3.64 TRAV24*01 TRAJ57*01 tgtgcccccggggggggcggatctgaaaagctggtcttt CAPGGGGSEKLVF 2 3.64 3.64 TRAV24*01 TRAJ32*02 tgtgccccttatggtggtgctacaaacaagctcatcttt CAPYGGATNKLIF 1 1.82 3.64 TRAV24*01 TRAJ32*01 tgtgctccttatggcggtgctacaaacaagctcatcttt 1 1.82 TRAV24*01 TRAJ32*01 tgtgcctcctatggcggtgctacaaacaagctcatcttt CASYGGATNKLIF 2 3.64 7.27 TRAV24*01 TRAJ32*02 tgtgcctcctatggtggtgctacaaacaagctcatcttt 1 1.82 TRAV24*01 TRAJ32*02 tgtgcctcttatggtggtgctacaaacaagctcatcttt 1 1.82 Total 15 55 100.00 100.00 HIC8DR1+ TRAV24*01 TRAJ31*01 tgtgggggggataacaatgccagactcatgttt CGGDNNARLMF 54 77.14 77.14 33 TRAV24*01 TRAJ31*01 tgtgggggggataacaatgccagactcacgttt CGGDNNARLTF 1 1.43 1.43 TRAV24*01 TRAJ34*01 tgtgcctctctctataacaccgacaagctcatcttt CASLYNTDKLIF 10 14.29 14.29 36 TRAV24*01 TRAJ32*01 tgtgccaactatggcggtgctacaaacaagctcatcttt CANYGGATNKLIF 5 7.14 7.14 39 Total 4 70 100.00 100.00 TRAV24 clonotypes obtained from 8 Controller cell lines, 8 treated patient cell lines, and 4 ex vivo Controller samples are listed. The V(D)J gene nomenclature is that of the IMGT database (www.imgt.org). Public clonotypes are in bold type. Clonotypes tested functionally are marked by an asterisk.
TABLE-US-00037 TABLE7 ListofTRBV2clonotypesspecificforGag293(SEQIDNO:455to749forJunction(AA) sequencesandSEQIDNO:750to1059forJunction(nt)sequences TRBV2clonotypesobtainedfrom8Controllercelllines,8treatedpatientcelllines, and4exvivoControllersamplesarelisted.TheV(D)Jgenenomenclatureisthatofthe IMGTdatabase(www.imgt.org).Publicclonotypesareinboldtype.Clonotypestested functionallyaremarkedbyanasterisk. fre- %nt %AA nt V-GENE J-GENE D-GENE JUNCTION JUNCTION(AA) quency seq seq number HIC1DR15+ TRBV2*01 TRBJ2-7*01 TRBD1*01 tgtgccagcttagggcccctacggcacgagcagtacttc CASLGPLRHEQYF 2 3.33 3.33 39 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcaaaccactagttagcacagatacgcagtatttt CASKPLVSTDTQYF 1 1.67 1.67 42 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagccttgaaaggactagcgggggtgagcagttcttc CASLERTSGGEQFF 1 1.67 1.67 TRBV2*02or TRBV2*03 TRBV2*01 TRBJ2-1*01 TRBD1*01 tgtgccagcacccgggacaggacaaagaatgagcagttcttc CASTRDRTKNEQFF 1 1.67 1.67 45 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagcagtgcgttggctagcgggggagatgagcagttcttc CASSALASGGDEQFF 1 1.67 1.67 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagtgcgttagctagcggtacagatacgcagtatttt CASSALASGTDTQYF 1 1.67 1.67 TRBV2*01 TRBJ2-7*01 TRBD2*01 tgtgccagcagtgaactgacctctagaacctacgagcagtacttc CASSELTSRTYEQYF 1 1.67 1.67 TRBV2*01,or TRBJ1-5*01 TRBD2*01 tgtgccagcagtgaacgggtttcgggcaatcagccccagcatttt CASSERVSGNQPQHF 2 3.33 3.33 TRBV2*02or TRBV2*03 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagcagccctatggctagcgggggggatgagcagttcttc CASSPMASGGDEQFF 1 1.67 1.67 TRBV2*01,or TRBJ2-7*01 TRBD2*02 tgtgccagcagccgtaggactagcgggacttacgagcagtacttc CASSRRTSGTYEQYF 1 1.67 1.67 TRBV2*02or TRBV2*03 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagcagtgtgatggctagccgtgggaatgagcagttcttc CASSVMASRGNEQFF 1 1.67 1.67 TRBV2*01 TRBJ1-5*01 TRBD2*01 tgtgccagccaaaggggggctcgggggggcaatcagccccagcatttt CASQRGARGGNQPQHF 1 1.67 1.67 48 TRBV2*01,or TRBJ1-4*01 TRBD1*01 tgtgccagcagggctcgaacaggggcaactaatgaaaaactgtttttt CASRARTGATNEKLFF 1 1.67 1.67 TRBV2*02or TRBV2*03 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagtgccaagactagcgggggctcagatacgcagtatttt CASSAKTSGGSDTQYF 1 1.67 1.67 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagcgccctggctagcgggggccgggatacgcagtatttt CASSALASGGRDTQYF 1 1.67 1.67 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagcagtgcccggactagcgggggactcgatgagcagttcttc CASSARTSGGLDEQFF 1 1.67 1.67 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagtgccaggactagcgggggctcggatacgcagtatttt CASSARTSGGSDTQYF 1 1.67 1.67 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtaagagggctagcgggggcacagatacgcagtatttt CASSKRASGGTDTQYF 2 3.33 3.33 TRBV2*02 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagcctaaggactagcgggggttcagatacgcagtatttt CASSLRTSGGSDTQYF 1 1.67 1.67 TRBV2*02or TRBV2*03 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagcagccgcttgacgagcggggggcggaatgagcagttcttc CASSRLTSGGRNEQFF 2 3.33 3.33 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagttctaagactagcgggggcacagatacgcagtatttt CASSSKTSGGTDTQYF 1 1.67 1.67 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagcagttcaaggactagcgggggccaagatgagcagttcttc CASSSRTSGGQDEQFF 1 1.67 1.67 TRBV2*01 TRBJ1-5*01 TRBD2*01 tgtgccacctccagaggagcgcggggaagcaatcagccccagcatttt CATSRGARGSNQPQHF 34 56.67 56.67 Total 23 60 100.00 100.00 HIC2DRB5+ TRBV2*01,or TRBJ1-2*01 TRBD1*01 tgtgccagcgccaggacagggggcgttggctacaccttc CASARTGGVGYTF 1 0.94 0.94 39 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*02 tgtgccagcaggactagcgggacctacgagcagtacttc CASRTSGTYEQYF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD1*01 tgtgccagcaaagcaaaaacggtaacctacaagcagtacttc CASKAKTVTYKQYF 1 0.94 0.94 42 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcaaaccaaaagcggtaacctacgagcagtacttc CASKPKAVTYEQYF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-3*01 TRBD1*01 tgtgccagcagagggacagcgactggaaacaccatatatttt CASRGTATGNTIYF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-4*01 TRBD1*01 tgtgccagcagaccgacagcaactaatgaaaaactgtttttt CASRPTATNEKLFF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgaatatgcgactagcaatgagcagttcttc CASSEYATSNEQFF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-1*01 TRBD1*01 tgtgccagcagtcgtggacagcggcacagatacgcagtattt CASSRGQRHRYAVF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*02 tgtgccatctcgcgtctagcgggaggcatggacgagcagtacttc CAISRLAGGMDEQYF 1 0.94 0.94 45 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcggccgactagcatcgggcacagatacgcagtatttt CASGRLASGTDTQYF 2 1.89 1.89 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-2*01 TRBD2*01 tgtgccagcaggagggggactagcggcaccggggagctgtttttt CASRRGTSGTGELFF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagtgatggggctagcggggtgggagagcagtacttc CASSDGASGVGEQYF 2 1.89 1.89 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-6*02 TRBD1*01 tgtgccagcagtgaagctgccaggggtaattcacccctccacttt CASSEAARGNSPLHF 2 1.89 1.89 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagtgaaggggctagcgggctcggggagcagtacttc CASSEGASGLGEQYF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*02 tgtgccagcagtgaactggctagcgggataagtgagcagttcttc CASSELASGISEQFF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgaacttgctagcgggctcgcagagcagttcttc CASSELASGLAEQFF 2 1.89 1.89 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*02 tgtgccagcagtgaactggctagcgggacgggtgagcagttcttc CASSELASGTGEQFF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*02 tgtgccagcagtgaacgggctagcgggaccgacgagcagtacttc CASSERASGTDEQYF 2 1.89 1.89 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-2*01 TRBD2*01 tgtgccagcagtgaaagggctagcggggtcggggagctgtttttt CASSERASGVGELFF 2 1.89 1.89 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagcggactggctagcggcacagatacgcagtatttt CASSGLASGTDTQYF 2 1.89 1.89 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-2*01 TRBD2*01 tgtgccagttcgggactagcgtcgggcaccggggagctgtttttt CASSGLASGTGELFF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagcgggatgactagccgatcctacgagcagtacttc CASSGMTSRSYEQYF 3 2.83 2.83 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-2*01 TRBD2*01 tgtgccagcagcccgggactagccggcaccggggagctgtttttt CASSPGLAGTGELFF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtccgttgactagcggaacagatacgcagtatttt CASSPLTSGTDTQYF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-5*01 TRBD1*01 tgtgccagcagtcctcgggccagggggaatcagccccagcatttt CASSPRARGNQPQHF 2 1.89 1.89 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagccctcggactagcggtccctacgagcagtacttc CASSPRTSGPYEQYF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*02 tgtgccagcagtcctcggactagcgggagttacgagcagtacttc CASSPRTSGSYEQYF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-2*01 TRBD2*01 tgtgccagcagccaagggctagcgggcaccggggagctgtttttt CASSQGLAGTGELFF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD1*01 tgtgccagcagtcaattagctaggggcacagatacgcagtatttt CASSQLARGTDTQYF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD1*01 tgtgccagcagtcaacttgtatcgctgaggggggagcagtacttc CASSQLVSLRGEQYF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*02 tgtgccagcagtcaacggactagcgggagcgacgagcagtacttc CASSQRTSGSDEQYF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagccaagttgcggggggtacagctacgcagtatttt CASSQVAGGTATQYF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-5*01 TRBD2*01 tgtgccagctcccggggggctcggggcaatcagccccagcatttt CASSRGARGNQPQHF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*02 tgtgccagcagccgactagcgggaggtttaggtgagcagttcttc CASSRLAGGLGEQFF 2 1.89 1.89 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*02 tgtgccagcagccgactagcgggagggatggatgagcagttcttc CASSRLAGGMDEQFF* 11 10.38 10.38 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*02 tgtgccagcagccgactagcgggagggacggatgagcagttcttc CASSRLAGGTDEQFF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtcgtctgactagcggcacagatacgcagtatttt CASSRLTSGTDTQYF 2 1.89 1.89 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*02 tgtgccagcagccgagtgacgggagggatggatgagcagttcttc CASSRVTGGMDEQFF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcaccaaactagcggggggtacatctgagcagttcttc CASTKLAGGTSEQFF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcaccaaactagcgtggggcacatatacgcagtatttt CASTKLAWGTYTQYF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*02 tgtgccaccacccccggggctagcgggataagtgagcagttcttc CATTPGASGISEQFF* 35 33.02 33.96 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD1*01 tgtgccaccacccccggggctagtgggataagtgagcagttcttc 1 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD1*01 tgtgccagcagtgaaaggggacagggggcgcggtacgagcagtacttc CASSERGQGARYEQYF 1 0.94 0.94 48 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtcgtatgactggcgggggcacagatacgcagtatttt CASSRMTGGGTDTQYF 1 0.94 0.94 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtcgtaggactagcgggggcacagatacgcagtatttt CASSRRTSGGTDTQYF* 6 5.66 5.66 TRBV2*02or TRBV2*03 Total 44 106 100.00 100.00 HIC3DR11+ TRBV2*01,or TRBJ2-3*01 TRBD1*01 tgtgccagtcaccggacatacacagatacgcagtatttt CASHRTYTDTQYF 2 1.60 1.60 39 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-1*01 TRBD1*01 tgtgccagctcaggacagacgaacactgaagctttcttt CASSGQTNTEAFF 10 8.00 8.00 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-2*01 TRBD1*01 tgtgccagcagatggacagcaacctcttatggctacaccttc CASRWTATSYGYTF 15 12.00 12.00 42 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-2*01 TRBD1*01 tgtgccagcagtcccacaacgacagggtatggctacaccttc CASSPTTTGYGYTF 1 0.80 0.80 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-2*01 TRBD1*01 tgtgcctcccacgaaggggccgggggcttcggggagctgtttttt CASHEGAGGFGELFF 1 0.80 0.80 45 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-2*01 TRBD1*01 tgtgcctcccacgaaggggccgggggctacggggagctgtttttt CASHEGAGGYGELFF 2 1.60 1.60 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD1*01 tgtgccagcagtgccggaactagaggggtgggggagcagttcttc CASSAGTRGVGEQFF 1 0.80 0.80 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgctttggctagcggcacagatacgcagtatttt CASSALASGTDTQYF 1 0.80 0.80 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagtgacgcggctagcggtgtgggcgagcagtacttc CASSDAASGVGEQYF 6 4.80 4.80 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*02 tgtgccagcagtgatctggctagcgggacgaatgagcagttcttc CASSDLASGTNEQFF 1 0.80 0.80 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgaccgggctagcggggtcggggagcagttcttc CASSDRASGVGEQFF 1 0.80 0.80 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgacaggactagcggtccccatgagcagttcttc CASSDRTSGPHEQFF 6 4.80 4.80 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*02 tgtgccagcagcggactagcgggaggaatggatgagcagttcttc CASSGLAGGMDEQFF* 7 5.60 5.60 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD1*01 tgtgccagcagccccggggcgagaggaattgatgagcagttcttc CASSPGARGIDEQFF 1 0.80 0.80 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgcaagcagccccgggactagcggagttggtgagcagttcttc CASSPGTSGVGEQFF* 15 12.00 12.80 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgcaagcagccccgggactagcggagttggtgagcagtttttc 1 0.80 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD1*01 tgtgcaagcagccccgggacgagcggagttggtaagcagtttttc CASSPGTSGVGKQFF 1 0.80 0.80 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagccccaggactagcgggggaggcgagcagtacttc CASSPRTSGGGEQYF 1 0.80 0.80 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-5*01 TRBD1*01 tgtgccagcagtcccagtgctcgcggcaatcagccccagcatttt CASSPSARGNQPQHF 2 1.60 1.60 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*02 tgtgccagcagcccgacgactagcgggagaggcgagcagtacttc CASSPTTSGRGEQYF 2 1.60 1.60 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagttccgggactagcggggccggggagcagttcttc CASSSGTSGAGEQFF 1 0.80 0.80 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagttccgggactagcggagttggtgagcagttcttc CASSSGTSGVGEQFF 1 0.80 27.20 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagttccgggactagcggggtcggggagcagttcttc CASSSGTSGVGEQFF 33 26.40 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagtgtcgggactagcggggtgggcgagcagtacttc CASSVGTSGVGEQYF 11 8.80 8.80 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagttacggggctagcggggtgggggagcagttcttc CASSYGASGVGEQFF 1 0.80 0.80 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagttacaggactagcgggccccgggagcagttcttc CASSYRTSGPREQFF 1 0.80 0.80 TRBV2*02or TRBV2*03 Total 24 125 100.00 100.00 HIC4DR15+ TRBV2*01,or TRBJ1-2*01 TRBD2*01 tgtgccagcaggaaagaaggatctaggctacacctc CASRKEGSRLHL 1 0.66 0.66 36 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-2*01 TRBD1*01 tgtgccagcagtgacagaacgacatgtggctacaccttc CASSDRTTCGYTF 1 0.66 0.66 39 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-2*01 TRBD1*01 tgtgccagcagtgaaagaaggatctatggctacaccttc CASSERRIYGYTF 5 3.29 3.29 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagagccctagcgtcggggggtgagcagttcttc CASRALASGGEQFF 5 3.29 3.29 42 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgctttagctagcggagataagcagtatttt CASSALASGDKQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgctttggctagcggagatacgcagtatttt CASSALASGDTQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD1*01 tgtgccagcagtgacgacagggtcggcgatgagcagttcttc CASSDDRVGDEQFF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagcaaactagcgtctggagatgagcagttcttc CASSKLASGDEQFF 4 2.63 2.63 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*02 tgtgccagcagtgttttacctggaggcaatgatccgctcttc CASSVLPGGNDPLF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgttttacctggtcgcaatgagccgttcttc CASSVLPGRNEPFF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD1*01 tgcgccagcagtgttttacgtggtggcaatgagcagtttttc CASSVLRGGNEQFF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgttttacgtggtcgcaatgagccgttcttc CASSVLRGRNEPFF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 tgtgccagcagtgttttacgtggtcgcaatgagcagttcttc CASSVLRGRNEQFF 8 5.26 5.26 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*02 tgtgccagcagtgtttcacgaggtggcaataagcagtttttc CASSVSRGGNKQFF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD1*01 tgtgccagtgtattaatgaggacgaacaatgagcagttcttc CASVLMRTNNEQFF 9 5.92 5.92 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgctccagcagagctagagggtgcgcgggtaagcagtatttc CSSRARGCAGKQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgccctgactagcgggggcgatgagcagttcttc CASSALTSGGDEQFF 1 0.66 0.66 45 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgcaaggactagcgggggatccgagcagttcttc CASSARTSGGSEQFF 2 1.32 1.32 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*02 tgtgccagcagtgctaggactagcgggagtgacgagcagtacttc CASSARTSGSDEQYF 2 1.32 1.32 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD1*01 tgtgccagcagtgacagggcctcaggcggggatacgcagtatttt CASSDRASGGDTQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgatcgggctagcgggggggatacgcagtatttt CASSDRASGGDTQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD1*01 tgtgccagcagtgatcgggctacagggggggatacgcagtatttt CASSDRATGGDTQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgaaaaggctagcgggggggatacgcagtatttt CASSEKASGGDTQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgaattggctagcgggggggatgagcagttcttc CASSELASGGDEQFF 2 1.32 1.32 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD1*01 tgtgccagcagtcacaaggcttcagggggggataagcagtatttt CASSHKASGGDKQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD1*01 tgtgccagctctcacatggcctcaggcggcgatacgcagtatttt CASSHMASGGDTQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD1*01 tgtgccagcagtcacagggcctcaggcggggctactccgtatttt CASSHRASGGATPYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD1*01 tgtgccagcagtcaccgggcctcaggtggggatactccgcatttt CASSHRASGGDTPHF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD1*01 tgtgccagcagtcacagggcctcaggcggggatacgcagtatttt CASSHRASGGDTQYF 31 20.39 20.39 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagctcaaaactggctagcggggccgacgagcagtacttc CASSKLASGADEQYF 6 3.95 4.61 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagctcaaaactggctagcggggccgacgagcagtatttc 1 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBD1*01 tgtgccagctcaaaacttactaggggcgcagataagcagtatttc CASSKLTRGADKQYF 1 0.66 0.66 TRBJ2-7*01 TRBV2*02 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagtaagaggactagcggtacctacgagcagtacttc CASSKRTSGTYEQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagcctccggactagcggctcctacgagcagtacttc CASSLRTSGSYEQYF 2 1.32 1.32 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagtccccggactagcggtacctacgagcagtacttc CASSPRTSGTYEQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-2*01 TRBD2*01 tgtgccagctcgccgcgagtcttctctgtcggggagctgtttttt CASSPRVFSVGELFF 4 2.63 2.63 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagccaaagggctagcgggggggacgagcagttcttc CASSQRASGGDEQFF 2 1.32 1.32 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*02 tgtgccagcagtagacggactagcgggacctacgagcagtacttc CASSRRTSGTYEQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagcgtccggactagcgggtcctacgagcagtacttc CASSVRTSGSYEQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*02 tgcaccagcagtggtaggactagcgggagggataagcagtatttc CTSSGRTSGRDKQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD1*01 tgtaccagcagtcacagggcctcaggcggggatacgcagtatttt CTSSHRASGGDTQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagtgccaggattagcggggggctcaacgagcagtacttc CASSARISGGLNEQYF 1 0.66 0.66 48 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgcaaggactagcgggggggccgatacgcagtatttt CASSARTSGGADTQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagtgccaggactagcggggggcttgacgagcagtacttc CASSARTSGGLDEQYF 19 12.50 12.50 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgctcggactagcggggggtcagatacgcagtatttt CASSARTSGGSDTQYF 3 1.97 1.97 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtaaaaggactagcgggggggccgatacgcagtatttt CASSKRTSGGADTQYF 2 1.32 1.32 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtcttaggactagcgggggcacagatacgcagtatttt CASSLRTSGGTDTQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagccccaggactagcgggggcacagatacgcagtatttt CASSPRTSGGTDTQYF 5 3.29 3.29 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD1*01 tgtgccagctcacgacgggcttccgggggcactactccgcattatttt CASSRRASGGTTPHYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtcgacggactagcgggggcacagatacgcagtatttt CASSRRTSGGTDTQYF* 1 0.66 1.32 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagctcacgacggactagcgggggcacagatacgcagtatttt 1 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*02 tgtgccagcagtcgtcggactagcgggagggcggatacgcagtatttt CASSRRTSGRADTQYF 4 2.63 2.63 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*02 tgtgccagcagtcgtaggactagcgggagtctagatacgcagtatttt CASSRRTSGSLDTQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD1*01 tgtgccagcagcaccaggattagagggggcacagataagcagtatttt CASSTRIRGGTDKQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgttaggactagcgggggcacagatacgcagtatttt CASSVRTSGGTDTQYF 1 0.66 0.66 TRBV2*02or TRBV2*03 Total 52 152 100.00 100.00 HIC5DR1+ TRBV2*01 TRBJ1-2*01 TRBD1*01 tgtgccagcagagacagtaactatggctacaccttc CASRDSNYGYTF 1 1.61 1.61 36 TRBV2*02 TRBJ2-5*01 TRBD1*01 tgtgccagcagtcgacggacggagacccagtacttc CASSRRTETQYF 3 4.84 4.84 TRBV2*02 TRBJ2-4*01 TRBD1*01 tgtgccagcagtgaaaccagggccaacattcagtacttc CASSETRANIQYF 1 1.61 1.61 39 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagcagcggactagcggcgaatgagcagttcttc CASSGLAANEQFF 1 1.61 1.61 TRBV2*01,or TRBD1*01 tgtgcctcaagggcagggtcggtggccactgaagctttcttt CASRAGSVATEAFF 1 1.61 1.61 42 TRBV2*02 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagcagtgggaggactagcggcaatgagcagttcttc CASSGRTSGNEQFF 2 3.23 3.23 TRBV2*02 TRBJ2-1*01 TRBD1*01 tgtgccagcagtgtcgtgggcagttacaatgagcagttcttc CASSVVGSYNEQFF 34 54.84 54.84 TRBV2*01 TRBJ2-1*01 TRBD1*01 tgtgccagtgtattaatgaggacgaacaatgagcagttcttc CASVLMRTNNEQFF 4 6.45 6.45 TRBV2*02 TRBJ2-2*01 TRBD1*01 tgtgccagcagggccgggacctcgggcaccggggagctgtttttt CASRAGTSGTGELFF 1 1.61 1.61 45 TRBV2*01,or TRBJ2-7*01 TRBD2*02 tgtgccagcaggaaggggactagcgggagtggcaagcagtacttc CASRKGTSGSGKQYF 2 3.23 3.23 TRBV2*02 TRBV2*02 TRBJ2-1*01 TRBD2*01 tgtgccagcagtgaaaaggctagcggggtggatgagcagttcttc CASSEKASGVDEQFF 1 1.61 1.61 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagtgaaagggctagcgggcacgatacgcagtatttt CASSERASGHDTQYF 1 1.61 1.61 TRBV2*01 TRBJ2-3*01 TRBD1*01 tgtgccagcagtcacagggcctcaggcggggatacgcagtatttt CASSHRASGGDTQYF 1 1.61 1.61 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagctcaaaactggctagcggggccgacgagcagtacttc CASSKLASGADEQYF 1 1.61 1.61 TRBV2*02 TRBV2*01 TRBJ2-7*01 TRBD2*01 tgtgccagcagtaaacaggctagcgggggggacgagcagtacttc CASSKQASGGDEQYF 8 12.90 12.90 Total 15 62 100.00 100.00 HIC6DR11+ TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagagaatacgcgactagcaacgagcagtacttc CASREYATSNEQYF 1 1.52 1.52 42 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-2*01 TRBD2*01 tgtgccagcagtgaaatggcgaccgggttgcgctacaccttc CASSEMATGLRYTF 1 1.52 1.52 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-2*01 TRBD1*01 tgtgccagcagtgaaacggcgacagggttgcgctacaccttc CASSETATGLRYTF 4 6.06 6.06 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-6*02 TRBD2*01 tgtgccagcacgctaacacgggttaattcacccctccacttt CASTLTRVNSPLHF 2 3.03 3.03 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcaatcaacggactagcgggccttacgagcagtacttc CASNQRTSGPYEQYF 1 1.52 1.52 45 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgatttggctagcggcacaggggagcagttcttc CASSDLASGTGEQFF 2 3.03 3.03 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD1*01 tgtgccagcagtgaagctgcagggggctacggtgagcagttcttc CASSEAAGGYGEQFF 1 1.52 1.52 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-5*01 TRBD1*01 tgtgccagcagtgaatttgccaggggcaatcagccccagcatttt CASSEFARGNQPQHF 1 1.52 1.52 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-5*01 TRBD1*01 tgtgccagcagtgaattcgtaagggacaatcagccccagcatttt CASSEFVRDNQPQHF 1 1.52 1.52 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-5*01 TRBD1*01 tgtgccagcagtgaattcgtaaggggcaatcagccccagcatttt CASSEFVRGNQPQHF 4 6.06 6.06 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-5*01 TRBD1*01 tgtgccagcagtgaaggggcggctggcaatcagccccagcatttt CASSEGAAGNQPQHF 1 1.52 1.52 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD1*01 tgtgccagcagtgaaggagctaggggcgtgggggagcagttcttc CASSEGARGVGEQFF 1 1.52 1.52 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-5*01 TRBD2*01 tgtgccagcagtgaaggggctagcggtacgggggcccagtacttc CASSEGASGTGAQYF 1 1.52 1.52 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD1*01 tgtgccagcagtgaaggcgctagtggcgtaggggagcagttcttc CASSEGASGVGEQFF 1 1.52 1.52 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgagggtactagcacctttcgtgagcagttcttc CASSEGTSTFREQFF 2 3.03 3.03 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-2*01 TRBD2*01 tgtgccagcagtgaattagcgagcggcaccggggagctgtttttt CASSELASGTGELFF 1 1.52 1.52 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-5*01 TRBD2*02 tgtgccagcagtggggcagcgaggggcaatcagccccagcatttt CASSGAARGNQPQHF 5 7.58 7.58 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagcaaactgactagcgggggatacgagcagtacttc CASSKLTSGGYEQYF 2 3.03 3.03 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtcccgggactagcggggttggtgagcagttcttc CASSPGTSGVGEQFF* 2 3.03 3.03 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtcgtctagcggggggtttcgatgagcagttcttc CASSRLAGGFDEQFF 2 3.03 3.03 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtcgactagcggggggcacagatacgcagtatttt CASSRLAGGTDTQYF 2 3.03 3.03 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtagactagcgtctggcacagatacgcagtatttt CASSRLASGTDTQYF 5 7.58 7.58 TRBV2*02or TRBV2*03 TRBV2*01,or TRBV2*02or TRBJ2-7*01 TRBD2*01 tgtgccagcagtgtattggctagcgggctgggtgagcagtacttc CASSVLASGLGEQYF 1 1.52 1.52 48 TRBV2*03 TRBV2*01,or TRBJ1-5*01 TRBD1*01 tgtgccagcagacagggggcgaggggaggcaatcagccccagcatttt CASRQGARGGNQPQHF 6 9.09 9.09 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-5*01 TRBD1*01 tgtgccagctcacagggggcgcgggggggaaatcagccccagcatttt CASSQGARGGNQPQHF 1 1.52 1.52 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagtcgattagcgggggggagctcctacgagcagtacttc CASSRLAGGSSYEQYF 2 3.03 3.03 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagccgcctgactagcgggggggcagatacgcagtatttt CASSRLTSGGADTQYF 1 1.52 1.52 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagccgccggactagcgggggcacagatacgcagtatttt CASSRRTSGGTDTQYF* 12 18.18 18.18 TRBV2*02or TRBV2*03 Total 28 66 100.00 100.00 HIC7DRB5+ TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagtcctcgggcctcggggggagagcagtacttc CASSPRASGGEQYF 3 3.85 3.85 42 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-4*01 TRBD2*01 tgtgccagcagtgtgcggcggaataatgaaaaactgtttttt CASSVRRNNEKLFF 3 3.85 3.85 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcaaccgaaggactagcggaacctacgagcagtacttc CASNRRTSGTYEQYF 1 1.28 1.28 45 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagcgcactagcgtccgggggagatacgcagtatttt CASSALASGGDTQYF 3 3.85 3.85 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgcacgggctagcgggggggatgagcagttcttc CASSARASGGDEQFF 3 3.85 5.13 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgcacgggctagcgggggggatgagcagtttttc 1 1.28 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-5*01 TRBD1*01 tgtgccagcagtgcccggacgagtgggggtcagccccagcatttt CASSARTSGGQPQHF 4 5.13 5.13 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-5*01 TRBD1*01 tgtgccagcagcgcccggacatcgggcaatcagccccagcatttt CASSARTSGNQPQHF 11 14.10 14.10 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*02 tgtgccagcagtgaactggctagcgggatcaatgagcagttcttc CASSELASGINEQFF 5 6.41 6.41 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgagttgactagcgggggggatgagcagttcttc CASSELTSGGDEQFF 1 1.28 1.28 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*02 tgtgccagcagtaagaggacctctggaggagatacgcagtatttt CASSKRTSGGDTQYF 1 1.28 1.28 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagcctaaggactagcgggggggatgagcagtacttc CASSLRTSGGDEQYF 3 3.85 3.85 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagccccctgactagcgccacagatacgcagtatttt CASSPLTSATDTQYF 1 1.28 1.28 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtcctcgggctagcgggggcgatgagcagttcttc CASSPRASGGDEQFF 5 6.41 6.41 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-7*01 TRBD2*01 tgtgccagcagtccccggactagcgggggcgacgagcagtacttc CASSPRTSGGDEQYF 1 1.28 1.28 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcaggctccggactagcgggggtacagatacgcagtatttt CASRLRTSGGTDTQYF 2 2.56 2.56 48 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagacgactagcggggtttatggcagatacgcagtatttt CASRRLAGFMADTQYF 1 1.28 1.28 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgcacggactagcgcgggcacagatacgcagtatttt CASSARTSAGTDTQYF 1 1.28 7.69 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgcacggactagcgctggcacagatacgcagtatttt 5 6.41 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgccaggactagcgggggggcagatacgcattatttt CASSARTSGGADTHYF 1 1.28 1.28 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgccaggactagcgggggggcagatacgcagtatttt CASSARTSGGADTQYF 1 1.28 2.56 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgctaggactagcgggggggcagatacgcagtatttt 1 1.28 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagcgcccggactagcggggggtcagatacgcagtatttt CASSARTSGGSDTQYF 1 1.28 3.85 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgccaggactagcggggggtcagatacgcagtatttt 2 2.56 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgccaggactagcggaggcacagatacgcagtatttt CASSARTSGGTDTQYF 2 2.56 3.85 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgctaggactagogggggcacagatacgcagtatttt 1 1.28 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgaacggactagcgggggacgcgatacgcagtatttt CASSERTSGGRDTQYF 1 1.28 1.28 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagcggtaggactagcgggggatcggatacgcagtatttt CASSGRTSGGSDTQYF 3 3.85 3.85 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtcttagggctagcggggggtcagatacgcagtatttt CASSLRASGGSDTQYF 1 1.28 1.28 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtctgaggactagcgggggggcagatacgcagtatttt CASSLRTSGGADTQYF 1 1.28 1.28 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagccaacggactagcgggggggcagatacgcagtatttt CASSQRTSGGADTQYF 1 1.28 1.28 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagccgactgactagcgggggatcagatacgcagtatttt CASSRLTSGGSDTQYF 4 5.13 5.13 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtcgccggactagcgggggtctagatacgcagtatttt CASSRRTSGGLDTQYF 1 1.28 1.28 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtcggcggactagcggggggcccaatgagcagttcttc CASSRRTSGGPNEQFF 1 1.28 1.28 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtcggaggactagcgggggcacagatacgcagtatttt CASSRRTSGGTDTQYF* 1 1.28 1.28 TRBV2*02or TRBV2*03 Total 30 78 100.00 100.00 HIC8DR1+ TRBV2*01,or TRBJ2-7*01 TRBD1*01 tgtgccagcagtgaagggtgggaaccctacgagcagtacttc CASSEGWEPYEQYF 1 1.49 1.49 42 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgagttgactagcgggggggatgagcagttcttc CASSELTSGGDEQFF 63 94.03 94.03 45 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-1*01 TRBD2*01 tgtgccagcagtgagttgactagcgggggggatgagcagttgttc CASSELTSGGDEQLF 1 1.49 1.49 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ2-3*01 TRBD2*01 tgtgccagcagtgccaggactagcggaggcacagatacgcagtatttt CASSARTSGGTDTQYF 1 1.49 1.49 48 TRBV2*02or TRBV2*03 TRBV2*01,or TRBJ1-2*01 TRBD1*01 tgtgccaccaccgccgccgggacaggggtagacggaaactatggctacacc CATTAAGTGVDGNYGYTF 1 1.49 1.49 54 TRBV2*02or ttc TRBV2*03 Total 5 67 100 100 HIC1DRB5+ exvivo TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagccagcggggaaattcctacaatgagcagttcttc CASQRGNSYNEQFF 2 4.17 4.17 42 TRBV2*01 TRBJ2-7*01 TRBD2*01 tgtgccagcagaatccggactagcgggggggagcagtacttc CASRIRTSGGEQYF 11 22.92 22.92 TRBV2*01 TRBJ2-1*01 TRBD1*01 tgtgccagcacccgggacaggacaaagaatgagcagttcttc CASTRDRTKNEQFF 1 2.08 2.08 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagcagtgcgttggctagcgggggagatgagcagttcttc CASSALASGGDEQFF 1 2.08 2.08 45 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagcagtctccggactagcgggggagatgagcagttcttc CASSLRTSGGDEQFF 2 4.17 4.17 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagcagccctatggctagcgggggggatgagcagttcttc CASSPMASGGDEQFF 2 4.17 4.17 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagcccccggactagcggcacagatacgcagtatttt CASSPRTSGTDTQYF 2 4.17 4.17 TRBV2*01 TRBJ2-7*01 TRBD2*02 tgtgccagcagccgtaggactagcgggacttacgagcagtacttc CASSRRTSGTYEQYF 1 2.08 2.08 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagcagtgtgatggctagccgtgggaatgagcagttcttc CASSVMASRGNEQFF 1 2.08 2.08 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgtcagcagtgcgttggctagcgggggagatgagcagttcttc CVSSALASGGDEQFF 1 2.08 2.08 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcaataaattgactagcgggggccgggatacgcagtatttt CASNKLTSGGRDTQYF 4 8.33 8.33 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagtgccaggactagcgggggctcggatacgcagtatttt CASSARTSGGSDTQYF 4 8.33 8.33 48 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagcagcaaaaggactagcggggcgactgatgagcagttcttc CASSKRTSGATDEQFF 2 4.17 4.17 TRBV2*01 TRBJ2-5*01 TRBD2*01 tgtgccagcagtttgttgactagcgggggacgggagacccagtacttc CASSLLTSGGRETQYF 6 12.50 12.50 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagcagccgcttgacgagcggggggcggaatgagcagttcttc CASSRLTSGGRNEQFF 2 4.17 4.17 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagctccaggactagcgggggcacagatacgcagtatttt CASSSRTSGGTDTQYF 3 6.25 6.25 TRBV2*01 TRBJ1-5*01 TRBD2*01 tgtgccacctccagaggagcgcggggaagcaatcagccccagcatttt CATSRGARGSNQPQHF 3 6.25 6.25 Total 17 48 100.00 100.00 HIC2DRB5+ exvivo TRBV2*01, TRBJ2-2*01 TRBD1*01 tgtgccagcagagacggcctcggggagctgtttttt CASRDGLGELFF 1 2.00 2.00 36 orTRBV2*02 orTRBV2*03 TRBV2*01, TRBJ1-1*01 TRBD1*01 tgtgccagctcaggacagacgaacactgaagctttcttt CASSGQTNTEAFF 3 6.00 6.00 39 orTRBV2*02 orTRBV2*03 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagtgcactggctagcggaacagatacgcagtatttt CASSALASGTDTQYF 1 2.00 2.00 45 TRBV2*01 TRBJ2-5*01 TRBD2*01 tgtgccagcagtgaattggctagcgggcagggatcccagtacttc CASSELASGQGSQYF 5 10.00 10.00 TRBV2*01 TRBJ2-7*01 TRBD2*02 tgtgccagcagtgaactggctagcgggagctacgagcagtacttc CASSELASGSYEQYF 3 6.00 6.00 TRBV2*01, TRBJ2-1*01 TRBD2*02 tgtgccagcagtgaactggctagcgggacgggtgagcagttcttc CASSELASGTGEQFF 1 2.00 2.00 orTRBV2*02 orTRBV2*03 TRBV2*01, TRBJ2-7*01 TRBD2*01 tgtgccagcagccctcggactagcggtccctacgagcagtacttc CASSPRTSGPYEQYF 3 6.00 6.00 orTRBV2*02 orTRBV2*03 TRBV2*01, TRBJ2-3*01 TRBD2*01 tgtgccagcagccaattgactagcggcacagatacgcagtatttt CASSQLTSGTDTQYF 2 4.00 4.00 orTRBV2*02 orTRBV2*03 TRBV2*01, TRBJ2-1*01 TRBD2*02 tgtgccagcagtcgactagcgggaggatttgatgagcagttcttc CASSRLAGGFDEQFF 1 2.00 2.00 orTRBV2*02 orTRBV2*03 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagtcggttggctagcggcacagatacgcagtatttt CASSRLASGTDTQYF 4 8.00 8.00 TRBV2*01, TRBJ1-5*01 TRBD1*01 tgtgccagcagtcggacagtctcgggcaatcagccccagcatttt CASSRTVSGNQPQHF 1 2.00 2.00 orTRBV2*02 orTRBV2*03 TRBV2*01, TRBJ2-7*01 TRBD2*01 tgtgccagcagttcgttggctagcagaccctacgagcagtacttc CASSSLASRPYEQYF 1 2.00 2.00 orTRBV2*02 orTRBV2*03 TRBV2*01, TRBJ2-1*01 TRBD2*01 tgtgccagcacgaagggcgctagcgggtcgggtgagcagttcttc CASTKGASGSGEQFF 2 4.00 4.00 orTRBV2*02 orTRBV2*03 TRBV2*01 TRBJ2-1*01 TRBD2*02 tgtgccaccacccccggggctagcgggataagtgagcagttcttc CATTPGASGISEQFF* 14 28.00 28.00 TRBV2*01 TRBJ2-7*01 TRBD1*01 tgtgccagcagtgaaaggggacagggggcgcggtacgagcagtacttc CASSERGQGARYEQYF 5 10.00 10.00 48 TRBV2*01, TRBJ2-3*01 TRBD2*01 tgtgccagcagccgaaggactagcggaggcacagatacgcagtatttt CASSRRTSGGTDTQYF* 2 4.00 6.00 orTRBV2*02 orTRBV2*03 TRBV2*01, TRBJ2-3*01 TRBD2*01 tgtgccagcagccgaaggactagcggaggtacagatacgcagtatttt 1 2.00 orTRBV2*02 orTRBV2*03 Total 16 50 100.00 100.00 HIC3DRB5+ exvivo TRBV2*01 TRBJ2-1*01 TRBD2*02 tgtgccagcgcccgactagcgggaggtaccgatgagcagttcttc CASARLAGGTDEQFF 1 4.00 4.00 45 TRBV2*01 TRBJ1-5*01 TRBD2*01 tgtgccagcagcgcgaaggcccgcgggaatcagccccagcatttt CASSAKARGNQPQHF 2 8.00 8.00 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagcgcactagcggggggaacagatacgcagtatttt CASSALAGGTDTQYF 3 12.00 12.00 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagtgctttggctagcggcacagatacgcagtatttt CASSALASGTDTQYF 5 20.00 20.00 TRBV2*01 TRBJ2-7*01 TRBD2*01 tgtgccagcagtgacgcggctagcggtgtgggcgagcagtacttc CASSDAASGVGEQYF 4 16.00 16.00 TRBV2*01 TRBJ1-5*01 TRBD1*01 tgtgccagcagcggacaggcgaggggcaatcagccccagcatttt CASSGQARGNQPQHF 4 16.00 16.00 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgcaagcagccccgggactagcggagttggtgagcagttcttc CASSPGTSGVGEQFF* 4 16.00 16.00 TRBV2*01 TRBJ1-5*01 TRBD1*01 tgtgccagcagtcccagtgctcgcggcaatcagccccagcatttt CASSPSARGNQPQHF 1 4.00 4.00 TRBV2*01 TRBJ2-7*01 TRBD2*01 tgtgccagcagtgtcgggactagcggggtgggcgagcagtacttc CASSVGTSGVGEQYF 1 4.00 4.00 Total 9 25 100.00 100.00 HIC7DRB5+ exvivo TRBV2*01, TRBJ2-7*01 TRBD2*01 tgtgccagccaggcaagcggccgatcctacgagcagtacttc CASQASGRSYEQYF 4 3.67 3.67 42 orTRBV2*02 orTRBV2*03 TRBV2*01 TRBJ2-5*01 TRBD1*01 tgtgccagcagtgaattttgggggcaagagacccagtacttc CASSEFWGQETQYF 1 0.92 0.92 TRBV2*01 TRBJ2-1*01 TRBD2*01 tgtgccagcagtgagctggctagcggggatgagcagttcttc CASSELASGDEQFF 9 8.26 8.26 TRBV2*01 TRBJ2-7*01 TRBD1*01 tgtgccagcagtgtatcgcaggggagcgacgagcagtacttc CASSVSQGSDEQYF 1 0.92 0.92 TRBV2*01, TRBJ2-7*01 TRBD2*01 tgtgccagctgtcccatggctagccgatcctacgagcagtacttc CASCPMASRSYEQYF 1 0.92 0.92 orTRBV2*02 orTRBV2*03 TRBV2*01 TRBJ1-2*01 TRBD1*01 tgtgccagcattatcggttcccaaggggcctatggctacaccttc CASIIGSQGAYGYTF 1 0.92 0.92 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagcgcactagcgtccgggggagatacgcagtatttt CASSALASGGDTQYF 6 5.50 5.50 TRBV2*01, TRBJ2-1*01 TRBD2*01 tgtgccagcagtgcacgggctagcgggggggatgagcagttcttc CASSARASGGDEQFF 4 3.67 3.67 orTRBV2*02 orTRBV2*03 TRBV2*01, TRBJ1-5*01 TRBD1*01 tgtgccagcagcgcccggacatcgggcaatcagccccagcatttt CASSARTSGNQPQHF 5 4.59 4.59 orTRBV2*02 orTRBV2*03 TRBV2*01, TRBJ1-1*01 TRBD1*01 tgtgccagcagtgaacgcgggacagccaacactgaagctttcttt CASSERGTANTEAFF 1 0.92 0.92 45 orTRBV2*02 TRBV2*01, TRBJ2-3*01 TRBD2*01 tgtgccagcagcttcaggactagcgggggtgatacgcagtatttt CASSFRTSGGDTQYF 2 1.83 1.83 orTRBV2*02 orTRBV2*03 TRBV2*01, TRBJ2-3*01 TRBD2*01 tgtgccagcagtaagcgggctagcgggggagatacgcagtatttt CASSKRASGGDTQYF 2 1.83 1.83 orTRBV2*02 TRBV2*01, orTRBV2*02 TRBJ2-1*01 TRBD2*01 tgtgccagcagtcctcgggctagcgggggcgatgagcagttcttc CASSPRASGGDEQFF 3 2.75 2.75 orTRBV2*03 TRBV2*01 TRBJ2-7*01 TRBD2*01 tgtgccagcagtccccggactagcgggggcgacgagcagtacttc CASSPRTSGGDEQYF 7 6.42 6.42 TRBV2*01, TRBJ2-7*01 TRBD2*02 tgtgccagcagccccaggactagcgggacctacgagcagtacttc CASSPRTSGTYEQYF 1 0.92 15.60 orTRBV2*02 TRBV2*01 TRBJ2-7*01 TRBD2*02 tgtgccagcagtcctcggactagcgggacctacgagcagtacttc 16 14.68 TRBV2*01 TRBJ2-7*01 TRBD1*01 tgtgccagcagccccgtggccagggggccttacgagcagtacttc CASSPVARGPYEQYF 1 0.92 0.92 TRBV2*01 TRBJ2-7*01 TRBD2*01 tgtgccagcagtcaactgactagcagaacctacgagcagtacttc CASSQLTSRTYEQYF 1 0.92 0.92 TRBV2*01, TRBJ2-3*01 TRBD2*01 tgtgccagcagtgccaggactagcggggggtcagatacgcagtatttt CASSARTSGGSDTQYF 6 5.50 5.50 48 orTRBV2*02 TRBV2*01, TRBJ2-3*01 TRBD2*01 tgtgccagcagcgcccggactagcgggggcacagatacgcagtatttt CASSARTSGGTDTQYF 1 0.92 11.01 orTRBV2*02 orTRBV2*03 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagtgccaggactagcggaggcacagatacgcagtatttt 11 10.09 TRBV2*01, TRBJ2-3*01 TRBD2*01 tgtgccagcagcggtaggactagcgggggatcggatacgcagtatttt CASSGRTSGGSDTQYF 4 3.67 3.67 orTRBV2*02 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagtctgaggactagcgggggggcagatacgcagtatttt CASSLRTSGGADTQYF 1 0.92 0.92 TRBV2*01, TRBJ2-3*01 TRBD2*01 tgtgccagcagtctcaggactagcgggggttcagatacgcagtatttt CASSLRTSGGSDTQYF 2 1.83 1.83 orTRBV2*02 orTRBV2*03 TRBV2*01, TRBJ2-3*01 TRBD2*01 tgtgccagcagtcctctgactagcgggggcacagatacgcagtatttt CASSPLTSGGTDTQYF 1 0.92 0.92 orTRBV2*02 orTRBV2*03 TRBV2*01, TRBJ2-3*01 TRBD2*01 tgtgccagcagtcggaggactagcggggcctcagatacgcagtatttt CASSRRTSGASDTQYF 1 0.92 0.92 orTRBV2*02 TRBV2*01, TRBJ2-1*01 TRBD2*01 tgtgccagcagtcgacgtactagcgggggggccgatgagcagttcttc CASSRRTSGGADEQFF 1 0.92 0.92 orTRBV2*02 orTRBV2*03 TRBV2*01, TRBJ2-3*01 TRBD2*01 tgtgccagcagccgacggactagcggggggacggatacgcagtatttt 2 1.83 5.50 orTRBV2*02 orTRBV2*03 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagccggcggactagcgggggcacagatacgcagtatttt CASSRRTSGGTDTQYF* 2 1.83 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagtagaaggactagcggtggcacagatacgcagtatttt 1 0.92 TRBV2*01, TRBJ2-3*01 TRBD2*01 tgtgccagcagtagacggactagcggggggacagatacgcagtatttt 1 0.92 orTRBV2*02 TRBV2*01, TRBJ2-1*01 TRBD2*01 tgtgccagcagcagacgaactagcgggggatacgatgagcagttcttc CASSRRTSGGYDEQFF 2 1.83 1.83 orTRBV2*02 orTRBV2*03 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagtagccggactagcgggggatcagatacgcagtatttt CASSSRTSGGSDTQYF 5 4.59 4.59 TRBV2*01 TRBJ2-3*01 TRBD2*01 tgtgccagcagtgttcggactagcggggggtcagatacgcagtatttt CASSVRTSGGSDTQYF 1 0.92 0.92 TRBV2*01 TRBJ2-7*01 TRBD1*01 tgtgccagcagtataagtttacccgggacactttattacgagcagtacttc CASSISLPGTLYYEQYF 1 0.92 0.92 51 Total 30 109 100.0 100.00
TABLE-US-00038 TABLE10 AntigensensitivityoftheTCRstestedbytransductioninJ76cells.SEQIDNOs:1255to1274 TheEC50valueforCD69inductioninJ76transducedwith10differentTCRsisreported. EachTCRwastestedwithapanelof7LcelltransfcctantsusedasAPC.EachLcelllineexpressedasinglehumanHLA-DRallele. TheEC50correspondstotheGag293peptideconcentration(inM)atwhichhalfmaximalCD69inductionwasobserved. ResponsestoolowforEC50determinationarcindicatedbyadash. TheCDR3junctionsequenceisreportedfortheTRAandTRBchainsofeachTCRtested.Sequencesinboldcorrespondtopublicclonotvpes. TCR TCRACDR3 TRA CDR3 TRBCDR3 TRB DR3 DR11 DR15 DRB5 DR1 DR7 DR4 DR3 name Junction motif length Junction motif length EC50 EC50 EC50 EC50 EC50 EC50 EC50 F24 CAFKAAGNKLTF AV24-1 10 CASSRLAGGMDEQFF BV2-1 13 4.15E-07 2.17E-06 4.46E-06 2.53E-06 8.69E-06 F25 CAFKAAGNKLTF AV24-1 10 CATTPGASGISEQF 13 7.48E-07 8.91E-06 2.36E-05 3.48E-05 F5 CAFKAAGNKLTF AV24-1 10 CASSGLAGGMDEQFF BV2-1 13 2.12E-06 1.60E-05 S24 CASKAAGNKLTF AV24-1 10 CASSRLAGGMDEQFF BV2-1 13 6.19E-07 3.57E-06 9.23E-06 9.98E-06 S25 CASKAAGNKLTF AV24-1 10 CATTPGASGISEQF 13 3.79E-06 RR5 CSRRAAGNKLTF AV24-1 10 CASSGLAGGMDEQF BV2-1 13 1.25E-06 8.46E-06 1.10E-05 1.11E-05 F4 CAFKAAGNKLTF AV24-1 10 CASSPGTSGVGEQFF BV2-1 13 1.39E-06 6.78E-05 8.42E-06 F13 CAFKAAGNKLTF AV24-1 10 CASSRRTSGGTDTQYF BV2-2 14 7.54E-07 2.61E-06 4.10E-06 HD5 CASDYGGSQGNLI 12 CASSEFRTRGYTF 11 8.26E-06 5.86E-06 1.08E-05 F HY9 CAYGANNLFF 8 CASRPLHSVYEQYF 12 1.99E-06 3.84E-06 3.04E-06
Materials and Methods
[0479] Study Design
[0480] HIV Controllers (HIC group; n=14) were recruited through the CO21 CODEX cohort implemented by Agence Nationale de Recherche sur le SIDA et les hpatites virales (ANRS). HIV Controllers were defined as HIV-1 infected patients who had been seropositive for >5 years, had received no antiretroviral treatment, and for whom >90% of plasma viral load measurements were undetectable by standard assays. All HIV Controllers included in the study had current viral loads <50 copies/mL. The group of efficiently treated patients (HAART group; n=14) had received antiretroviral therapy for a minimum of 5 years and showed long term HIV-1 suppression with viral loads <50 copies/mL. Treated patients were recruited at the Raymond Poincar and Bictre hospitals (France). Patients were included in the TCR study if their genotype matched at least one of the following alleles: DRB1*0101 (DR1), DRB1*1101 (DR11), DRB1*1501 (DR15), or DRB5*0101 (DRB5). Healthy donors were anonymous volunteers who donated blood at Etablissement Francais du Sang.
[0481] MHC II Tetramer Labeling of Primary CD4+ T Cell Lines and Patient PBMC
[0482] The 20-mer Gag293 peptide (FRDYVDRFYKTLRAEQASQE), spanning amino acids 293-312 in HIV-1 HXB2 Gag, was used to stimulate Gag-specific CD4+ T cell lines, as previously described (27). Cell lines were tested for Gag293 specificity by IFN- ELISPOT assay and, if positive, labeled with an HLA-DR-matched Gag293-loaded tetramer and sorted. For ex vivo tetramer labeling, 10.sup.7 Controller PBMC were tetramer-labeled and sorted, with a minimum of 2,000 Tet+ events acquired for TCR diversity analysis.
[0483] Analysis of TCR Genetic Diversity by Immunoscope and Sequencing
[0484] TCR diversity was evaluated in sorted Tet+ cell RNA by the Immunoscope technique, as previously described (32). PCR products corresponding to the two amplified familes, TRAV24 and TRBV2, were cloned, sequenced, and analyzed with tools of IMGT database (34). Public motifs enriched in CDR3 sequences were detected with the MEME motif discovery software (http://meme.nbcr.net).
[0485] Analysis of TCR Affinity by Surface Plasmon Resonance
[0486] Soluble TCRs were produced in bacterial expression vectors as previously described (68). The affinity of the soluble TCRs for immobilized Gag293-loaded HLA-DR monomers (DR11, DRB5, and DR1) was measured on a BIAcore 3000 instrument.
[0487] TCR Transfer Experiments
[0488] Lentivectors expressing full-length TRAV24 and TRBV2 chains in equimolar amounts were produced by transfecting 293-T cells, concentrated by ultracentrifugation, and used to transduce the Jurkat-derived TCR-negative J76 cell line. TCR function was evaluated by measuring CD69 induction in transduced J76 cells incubated with Gag293-loaded HLA-DR-expressing L cells. Alternatively, monocyte-derived dendritic cells infected with pseudotyped pNL4-3-deltaEnv-EGFP were used as APC. For TCR transfer in primary cells, PBMC were PHA-stimulated for 48 h before transduction with highly concentrated lentivector stocks. TCR function was evaluated by intracellular cytokine staining for IFN-, IL-2, MIP-1, TNF- and CD107a. All possible combinations of these 5 markers were analyzed by boolean gating, before analysis of polyfunctionality with the SPICE software.
[0489] Antibodies
[0490] The following antibodies were used for membrane or intracellular staining: CD8-AlexaFluor488 (AF488, clone RPA-T8), CD3-eFluor 780-Allophycocyanin (eF780-APC, clone UCHT1), TCR-Allophycocyanin (APC, clone IP26) and IL-2-APC (clone MQ1-17H12) (all from eBioscience); CD4 BD Horizon R-phycoerythrin-CF594 (PE-CF594, clone RPA-T4), CD4-R-phycoerythrin-cyanine 7 (PE-Cy7, clone SK3), CD69-R-phycoerythrin (PE, clone FN50), CD107a-AlexaFluor700 (AF700, clone H4A3), Perforin-AF488 (clone G9), IFN-PE-Cy7 (clone B27), MIP1-PE (clone D21-1351) (all from BD Biosciences); CD14-Viogreen (clone TK4), and CD19-VioGreen (clone LT19) (from Miltenyi Biotec); TRBV2-PE (clone IMMU 546, Beckman Coulter); CD14-Brilliant Violet 510 (BV510, clone M5E2), and CD19-BV510 (clone HIB19), CD8-Brilliant Violet 785 (BV785, clone RPA-T8), HLA-DR-PE-Cy7 (clone LN3), CD45RA-Brilliant Violet 421 (BV421, clone HI100), CCR7-PE-Cy7 (clone G043H7), and TNF-BV421 (clone MAb11) (all from Biolegend). The fixable viability dye eFluor 506 (eF506, eBioscience) was added to restrict the analysis to live cells.
[0491] Cell Culture
[0492] Transformed cell lines: The mutant Jurkat cell line J76, which lacks endogenous TCR expression, was provided and are as disclosed in (69). J76 cells were maintained in RPMI 1640 medium supplemented with 100 ug/ml penicillin/streptomycin, 1% Hepes buffer, and 2 mM L-glutamine (complete RPMI) in the presence of 10% fetal bovine serum (FBS). Murine fibroblasts (L cells) stably transfected to express a single human HLA-DR allele (DR1, DR3, DR4, DR7, DR11, DR15, or DRB5) were used as antigen presenting cells (70). L cells were maintained in complete RMPI supplemented with 10% FBS and 1% Non-Essential Amino Acids (Life Technologies).
[0493] Primary Cells:
[0494] Peripheral blood mononuclear cells (PBMC) were isolated from heparinized blood via density gradient centrifugation on Ficoll-Paque PLUS (GE Healthcare Life Sciences) and were either cryopreserved or used freshly for the preparation of monocyte derived dendritic cells (MDDC). The latter were obtained by positive selection of CD14+ monocytes using magnetic Microbeads (Miltenyi Biotec). Monocytes were plated at 210.sup.6 cells per mL in synthetic AIM-V medium (Life Technologies) supplemented with 10 ng/mL GM-CSF and 20 ng/mL IL-4 (both from Miltenyi Biotec) and incubated for 5-7 days at 37 C. in a 5% C02 incubator. Differentiated immature MDDC were collected and cryopreserved until further use.
[0495] Primary CD4+ T Cell Lines:
[0496] The 20-mer Gag293 peptide (FRD YVD RFY KTL RAE QAS QE), spanning amino acids 293 to 312 in HIV-1 HXB2 Gag, was used in highly purified form (>99% pure; Proteogenix SAS) to stimulate Gag-specific CD4+ T cell lines. PBMCs from HIV-1 infected patients were plated at 210.sup.6 cells per well in 24-well plates in the presence of decreasing amount of Gag293 peptide (10.sup.5M to 10.sup.11M) in complete RPMI supplemented with 10% human AB serum, 0.5 M AZT, 5 nM Saquinavir and 5 ng/ml recombinant IL-7 (Cytheris). Recombinant IL-2 (Chiron, Novartis) was added to a final concentration of 100 U/ml starting from day 2, and every 2 days afterwards. When CD4+ T cell lines reached doubling time (observed number of cells =2 number of input cells), they were tested for Gag293 specificity by IFN- ELISPOT assay, as described previously (71).
[0497] MHC Class II Tetramer Labeling
[0498] Patients were genotyped for the HLA-DRB1 gene at a 4 digit resolution using the INNO-LiPA HLA-DRB1 Plus kit (Fujirebio). Patients were included in the study if their genotype matched at least one of the following alleles: DR1, DR11, DR15, or DRB5. APC-labeled MHC II tetramers for the DR1, DRB15, DRB5, DRB1*0301 (DR3), and DRB1*0701 (DR7) alleles were obtained through the NIH Tetramer Core Facility at Emory University, USA. HLA-DRB1*0401 (DR4) biotinylated monomers were supplied internally (Institut Pasteur, Paris). DR11 biotinylated monomers were obtained through the tetramer Core laboratory of the Benaroya Research Institute (Seattle, USA). Monomers were loaded with 0.2 mg/ml peptide by incubation at 37 C. for 72 h in the presence of 2.5 mg/ml n-octyl--D-glucopyranoside and protease inhibitors. Peptide-loaded monomers were tetramerized using APC-conjugated streptavidin (eBioscience). For each tetramer loaded with the Gag293 peptide, a corresponding control tetramer was loaded with an irrelevant peptide (either the CLIP peptide PVSKMRMATPLLMQA for the DR1, DR15, DR11 tetramers; or an Annexin II peptide DVPKWISIMTERSVPH for the DRB5 tetramer).
[0499] The MHC II tetramer labeling protocol was adapted from (72). Primary CD4+ T cells lines were incubated with 1 g MHC II tetramer/10.sup.6 cells at a concentration 1 g/mL in complete RPMI supplemented with 15% human AB serum for 90 min at 4 C. Antibodies for surface markers were added for the last 30 min of labeling, using the following combination: CD3-eF780-APC, CD4-PE-CF594, CD8-BV785, CD45RA-BV421, CCR7-PE-Cy7, CD14-VioGreen, and CD19-VioGreen. Gag293-specific tetramer-labeled (Tet+) cells were visualized in the CD3+, CD4+, CD14-, CD19-, CD8-lymphocyte gate, and were sorted using a FACSAria II cell sorter (BD Biosciences) installed in a microbiological safety cabinet. Each Gag293-tetramer labeled sample was matched with a control-tetramer labeled sample processed in identical conditions. Sorted Tet+ cells were resuspended in RLT buffer (Qiagen) and kept frozen at 80 C. until RNA extraction. Sorted samples that yielded a minimum of 20,000 Tet+ events were selected for clonotypic analysis. Patient PBMC were labeled with MHC II tetramer and sorted as described above, with a minimum of 10.sup.7 cells labeled per sample. Sorted PBMC samples that yielded a minimum of 2,000 Tet+ events were used for clonotypic analysis.
[0500] J76 cells expressing recombinant TCRs were labeled as above, except that incubation with the MHC II tetramer was performed in complete RPMI supplemented with 15% FBS for 1 h at 37 C., followed by incubation for 30 min at 4 C. with the following antibody combination: CD3-eF780-APC, CD4-PE-Cy7, TCR-APC and eF506-viability dye. The percentage of Tet+ cells was measured in the live CD3+, CD4+ gate after acquisition on an LSR Fortessa cytometer (BD Biosciences).
[0501] CDR3 Length Polymorphism Analysis and CDR3 Sequencing
[0502] The expression and diversity of 35 TCR variable gene (TRAV) families and of 24 TCR variable gene (TRBV) families were evaluated in Tet+ cells by the Immunoscope technique, as described previously (73, 74). TRAV and TRBV gene expression was measured by quantitative RT-PCR, followed by an analysis of the length distribution of the amplified CDR3 products on a capillary sequencer. Briefly, total RNA was extracted from Tet+ cells using the RNeasy mini or micro kits (Qiagen), depending on available cell number. Next, cDNA was obtained by reverse transcription with 500 g/mL oligo (dT)17 and 200 U of Superscript II reverse transcriptase (Life technologies). A cDNA aliquot was amplified with each of 35 TRAV and 24 TRBV family-specific primers, in combination with a constant region TRAC or a TRBC primer, respectively (73, 74). Amplification was performed in the presence of a family-specific TaqMan probe on an ABI 7300 real time PCR device (Applied Biosystems). An aliquot of each PCR reaction was used as template in a run-off reaction with a nested fluorescent TRAC- or TRBC-specific primer, to generate TRAV- or TRBV-specific single stranded DNA products. These fluorescent DNA samples were separated on an ABI-PRISM 3730 DNA analyzer (Applied Biosystems) and quantified for size and intensity with the Immunoscope software. Fluorescence intensity (in arbitrary units) was plotted in function of the CDR3 length in amino acids.
[0503] PCR products corresponding to the TRAV24 and TRBV2 families were cloned and sequenced. The primers used to amplify the full-length chains were: TRAV24 forward primer: 5-CCG AGG CCT TGT TTG TAA TG-3; TRAC reverse primer: 5GTG AAT AGG CAG ACA GAC TTG T-3; TRBV2 forward primer: 5-GGT CCG GAA TGG ATA CCT GGC TCG TAT GCT GGG C-3; TRBC reverse primer: 5-CCG GTC GAC CTA GCC TCT GGA ATC CTT TCT CTT GAC C-3. PCR products were cloned into the pCR-Blunt-II-TOPO vector (Life technologies), transformed in E. coli, and analyzed by DNA sequencing (Eurofins Genomics).
[0504] Analysis of the TCR Clonotypic Repertoire
[0505] TRA and TRB sequences were analyzed with the software suite from the International ImMunoGeneTics (IMGT) Information System (75). The V(D)J gene nomenclature used is that of the IMGT database (www.imgt.org). Clonotypic diversity of the TRAV24 and TRBV2 repertoires was evaluated (i) by counting the number of unique amino acid clonotypes (clonotypes AA) per 100 CDR3 nucleotide sequences (ii) by computing Simpson's diversity index, using the EstimateS software version 9.1.0 (76). Simpson's diversity index takes into account both the number of clonotypes and the frequency of each clonotype in the dataset, and is maximal when all clonotypes have an equal representation. The number of N and P mutations introduced during the V(D)J recombination process was determined by comparing the observed CDR3 sequences to their germline counterparts, using the Junction analysis module of the IMGT/HighV-QUEST software (75). The distribution of TRAV, TRAJ, TRBV, TRBJ, and TRBD genes in the sequence set was computed with the statistics module of IMGT/HighV-QUEST. The CDR3 lengths corresponded to the number of a.a. comprised between, but not including, the two conserved residues C104 and F/W118, as defined by the IMGT-ONTOLOGY unique numbering system. In contrast, the CDR3 junctions included the conserved C104 and F/W118 residues. Kurtosis, which measures the peakedness of a distribution, was used to evaluate biases in CDR3 lengths. Kurtosis was measured in the Prism v6.0 software (GraphPad). A Gaussian distribution has a kurtosis of zero, while a flatter distribution has negative kurtosis, and a more peaked distribution has positive kurtosis.
[0506] Motifs enriched in the TRAV24 and TRBV2 CDR3 sequence sets were first identified with the MEME motif discovery software version 4.10.0 (77) available at http://meme-suite.org. The MEME software chooses the width and number of occurrence of each motif automatically in order to minimize the E-value of the motif, i.e. the probability of finding an equally well conserved pattern in random sequences. Motifs were searched in discriminative mode, to identify public motifs enriched in the HIC compared to the HAART dataset. Motifs were represented as sequence logos, where the relative sizes of the letters indicate their frequencies in the sequence set, and the total height of the letters represents the information content of the position, in bits. Based on the initial motif analysis, simpler public motifs included within the MEME motifs were identified and counted using the Protein Pattern Find module of the Sequence Manipulation Suite (78).
[0507] Analysis of Soluble Recombinant TCRs by Surface Plasmon Resonance
[0508] Soluble TCRs were engineered by inserting disulfide linkage between the TRAC and TRBC constant domains and truncating the transmembrane and cytoplasmic regions, as previously described (79). The soluble TCR and TCR chains were expressed separately as inclusion bodies, refolded together, and purified before surface plasmon resonance (SPR) analysis. All SPR experiments were conducted at 25 C. on a BIAcore 3000 instrument in the presence of TBS buffer (10 mM Tris-HCl, pH 8, 150 mM NaCl and 0.005% surfactant P20). The TBS buffer was supplemented with 1% BSA to prevent non-specific binding. The pHLA-II complexes were immobilized onto a Streptadivin-coated sensor chip with 1,000-1,200 Response Unit (RU) per flow cell. A flow cell containing a pHLA-I complex was used as negative control. Experiments were conducted as previously described (79), with a concentration range of 0.78-100 M of pHLA-II complexes. The BIAevaluationVersion 3.1 software was used for data analysis with the 1:1 Langmuir binding model.
[0509] TCR Lentivector Construction
[0510] Full-length TCR and TCR chains amplified from Gag293-specific Tet+ cells were cloned into lentiviral expression vectors. Full-length TRAV24+ chains were amplified with a forward primer containing the TRAV24 leader sequence with an NheI restriction site and a Kosak sequence added in 5 (5-CGG CTA GCC GCC ACC ATG GAG AAG AAT CCT TTG GCA GCC-3) and a reverse primer containing the 3 of TRAC and a NotI site (5-TTA GCG GCC GCG CTG GAC CAC AGC CGC AGC G-3). Full-length TRBV2+ chains were amplified with a forward primer containing the TRBV2 leader sequence and a BspEI site in 5 (5-GGT CCG GAA TGG ATA CCT GGC TCG TAT GCT GGG C-3) and a reverse primer containing the 3 of TRBC and a SalI site (5-CCG GTC GAC CTA GCC TCT GGA ATC CTT TCT CTT GAC C-3). The TCR and TCR chains were first cloned separately in the pCR-Blunt-II-TOPO vector, and then combined into the pCDH-EF1-MCS-T2A vector (SBI System Bioscience), with a self-cleaving T2A sequence inserted in between, ensuring an equimolar expression of the two chains from the same transcript. All constructs were verified by DNA sequencing.
[0511] The sequence of the plasmid termed pCDH-F24-TCR herein, encoding the alpha and beta chains of the F24 TCR reported in Table S8 is provided under SEQ ID NO: 57 (8241 nucleotides)
[0512] TCR Lentivector and HIV-1 Pseudotype Preparation
[0513] TCR lentivectors were transfected in 293T cells with Lipofectamine 3000 (Life technologies) in the presence of the pPACKH1 Packaging Plasmid Mix (SBI System Bioscience). 48 h after transfection, supernatants were collected, filtered using a 0.45 m filter, and concentrated by ultracentrifugation at 23,000 g for 90 min at 4 C. on a 20% sucrose cushion. Viral particles were resuspended in PBS and frozen in aliquots at 80 C. until use. Gag p24 concentration was measured with the Alliance HIV-1 p24 Antigen ELISA kit (Perkin Elmer).
[0514] Single cycle pseudotyped HIV-1 particles (HIV-1) were produced by calcium phosphate transfection of 25 g of pNL4-3-deltaEnv-EGFP (from the NIH AIDS Reagent Program) and 10 g of pVSV-G plasmids in 293T cells. Virus-like particles (VLP) expressing Vpx were obtained similarly by co-transfection of the pSIV3+ vector (80) with pVSV-G. Viruses were harvested at 48 h later and concentrated as described above.
[0515] TCR Transduction
[0516] For TCR transfer, 0.510.sup.6 J76 cells were resuspended in 0.5 mL complete RPMI medium supplemented with 10% FBS in a 24-well plate. TCR lentiviral particles (200 ng of p24) were added to each well and thoroughly resuspended by pipetting. After 3 h, 0.5 mL fresh medium was added to each well. Transduced J76 cells were analyzed at day 3 by staining with CD4-PE-Cy7, TCR-APC, CD3-eF780-APC antibodies and the eF510-viability dye. Samples were acquired on an LSR Fortessa flow cytometer (BD Biosciences) to determine TCR expression and relocalization of the CD3 complex to the cell surface as a measure of transduction efficiency.
[0517] To transfer TCRs in primary T cells, healthy donor PBMCs were pre-activated with 5 g/mL PHA and 50 UI/mL IL-2 for 48 h. PHA blasts were collected and plated at 10.sup.5 cells/well in a 24-well plate. TCR lentiviral particles (400 ng of p24) were mixed with 5 L Lentiblast solution A +5 L Lentiblast solution B (OZ Biosciences), and added to each well. Complete RPMI medium supplemented with 10% FBS and 50 UI/mL IL-2 was added up to a volume of 0.5 mL and plates were centrifuged at 1,000 g for 1 h at 32 C., before incubation o/n at 37 C. The following day, fresh medium and 50 UI/mL IL-2 were added up to a volume of 1 mL. 48 to 72 h later, transduced PBMC were labeled with TRBV2-PE, CD4-PE-CF594, CD8-BV785, CD3-eF780-APC antibodies, and the eF506-viability dye. Samples analyzed by flow cytometry as above, and quantified for an increase in TRBV2 expression level in the live CD3+CD4+CD8-lymphocyte gate to measure transduction efficiency.
[0518] Analyses of TCR Functions
[0519] J76 Cell Activation Assay:
[0520] L cells expressing a single HLA-DR allele were pulsed with serial dilutions (from 210.sup.5 to 10.sup.11 M) of Gag293 peptide. 510.sup.4 TCR-transduced J76 cells and 510.sup.4 peptide-pulsed L cells were co-cultured in a 96-well plate o/n at 37 C. On the next day, cells were labeled with CD69-PE, CD4-PE-Cy7, TCR-APC, CD3-eF780-APC antibodies and eF506-viability dye. Samples were acquired in a 96-well plate using a FACSCanto II flow cytometer and analyzed to estimate the induction of CD69 expression as a measure of J76 cell activation upon Gag293-HLA-DR recognition.
[0521] To measure J76 cell activation upon stimulation with HIV-1-derived, endogenously processed Gag proteins, MDDC were incubated for 3 h with 50 ng p24 of HIV-1 per 0.1510.sup.6 cells in presence of Vpx VLP. Cells were then extensively washed to remove unbound viral particles and co-cultured o/n at 37 C. with TCR-transduced J76 cells at a 1:1 ratio. After co-culture, cells were harvested, washed, treated with FcR Blocker (Miltenyi Biotec), stained with CD69-PE, HLA-DR-PE-Cy7, TCR-APC, CD3-eF780-APC antibodies and eF506-viability dye, and analyzed by flow cytometry as above.
[0522] Intracellular Cytokine Staining (ICS) in Primary T Cells:
[0523] PBMC from healthy donors expressing at least one of 4 HLA-DR alleles (DR11, DR1, DR15, or DRB5) were transduced with TCR lentivectors and tested 7 to 9 days after transduction. Autologous MDDC (2.510.sup.4) were pulsed with serial dilutions of from 10.sup.5 to 10.sup.11 M of Gag293 peptide and co-cultured at a 1:1 ratio with transduced PBMC. Cells were co-cultured for 1 h at 37 C. before addition of 1 g/ml Brefeldin A (eBioscience), and further incubated o/n. Negative controls consisted in TCR-transduced PBMC incubated with unpulsed MDDC and in mock-transduced PBMC incubated with peptide-pulsed MDDC. Positive controls were obtained by pulsing MMDC with 1 g/ml Staphylococcal Enterotoxin A (Toxin Technology, Sarasota, Fla.), or by using TCR-transduced PBMC stimulated with 50 ng/mL phorbol 12-myristate 13-acetate (PMA) and 0.25 g/ml ionomycin in the absence of MDDC.
[0524] For ICS, cells were washed, treated with FcR Blocker, and stained for surface antigens with CD4-PE-CF594, CD8-BV785, CD14-BV510, CD3-eF780-APC antibodies, and eF506-viability dye. Cells were fixed and permeabilized using the CytoFix/Cytoperm kit (BD Biosciences) before staining for intracellular cytokines with IL-2-APC, MIP1-PE, IFN-PE-Cy7, TNF-BV421, and CD107a antibodies. Fluorescence was acquired on an LSR Fortessa flow cytometer. Intracellular cytokine production was evaluated in the live CD14-CD3+CD4+CD8- or CD14-CD3+CD4-CD8+ lymphocyte gates. The percentage of cytokine-producing T cells was determined after subtracting the percentage of cytokine-positive events in unstimulated controls. All flow cytometry experiments were analyzed with the Flowjo v8.8 software (Tree Star). Polyfunctionality was assessed for a panel of 5 functions that included the production of IFN-, IL-2, MIP-1, TNF- and CD107a. All possible combinations of the 5 markers were analyzed by boolean gating in Flowjo. The resulting data table was converted to the matrix symmetric positive definite (SPD) format, and then analyzed using the SPICE software version 5.3 (81), with a cytokine positivity threshold of 0.1%.
[0525] HLA-Blocking Experiments in Primary Cells:
[0526] MDDC were brought to a concentration of 510.sup.6/mL in complete RPMI medium supplemented with 10% FBS. MDDC were pretreated with 10 g/mL of an HLA-DR blocking antibody (Biolegend, clone: L243) or a pan-MHC I blocking antibody (Biolegend, clone: W6/32) for 1 h at 37 C. prior to Gag293 peptide stimulation. Incubation with 10 g/mL of an isotypic IgG2a control antibody (Biolegend, clone: MOPC-173) was used as a negative control for HLA blocking. MDDC were then pulsed with 10.sup.5M Gag293 peptide and cocultured at a 1:1 ratio with TCR-transduced PBMC, as described above. Cytokine production was evaluated by ICS in the CD8+ T cell gate.
[0527] Statistical Analyses
[0528] P values <0.05 were considered statistically significant. Statistics were computed with the Prism v6.0 software (GraphPad) and the R version 3.2.3 software (https://www.r-project.org/). Differences between groups were analyzed with the non parametric Mann-Whitney U test, with the exception of total clonotypic repertoires, for which means where compared with unpaired t tests. Differences in cell line response frequencies and HLA-DR allele frequencies were analyzed in contingency tables with Fisher's exact test. Differences in proportions of CDR3 lengths were computed with a 2-sample test for equality of proportions with continuity correction R. Correlations were analyzed with the non-parametric Spearman's coefficient. Half maximal effective concentrations (EC50) were obtained after non-linear curve fit using a sigmoidal dose response model in Prism. All significant differences between groups (P<0.05) were reported on data plots.
BIBLIOGRAPHY
[0529] 1. Deeks S G, et al. Systemic effects of inflammation on health during chronic HIV infection. Immunity. 2013; 39(4):633-45. [0530] 2. Connors M, et al. HIV infection induces changes in CD4+ T-cell phenotype and depletions within the CD4+ T-cell repertoire that are not immediately restored by antiviral or immune-based therapies. Nat Med. 1997; 3(5):533-40. [0531] 3. Gorochov G, et al. Perturbation of CD4+ and CD8+ T-cell repertoires during progression to AIDS and regulation of the CD4+ repertoire during antiviral therapy. Nat Med. 1998; 4(2):215-21. [0532] 4. Rosenberg E S, et al. Vigorous HIV-1-specific CD4+ T cell responses associated with control of viremia. Science. 1997; 278(5342):1447-50. [0533] 5. Douek D C, et al. HIV preferentially infects HIV-specific CD4+ T cells. Nature. 2002; 417(6884):95-8. [0534] 6. Lubong Sabado R, et al. In vitro priming recapitulates in vivo HIV-1 specific T cell responses, revealing rapid loss of virus reactive CD4 T cells in acute HIV-1 infection. PLoS One. 2009; 4(1):e4256. [0535] 7. Lambotte O, et al. HIV controllers: a homogeneous group of HIV-1-infected patients with spontaneous control of viral replication. Clin Infect Dis. 2005; 41(7):1053-6. [0536] 8. Chakrabarti L A, and Simon V. Immune mechanisms of HIV control. Curr Opin Immunol. 2010; 22(4):488-96. [0537] 9. Saez-Cirion A, et al. HIV controllers exhibit potent CD8 T cell capacity to suppress HIV infection ex vivo and peculiar CTL activation phenotype. Proc Natl Acad Sci USA. 2007; 104(16):6776-81. [0538] 10. Almeida J R, et al. Antigen sensitivity is a major determinant of CD8+ T-cell polyfunctionality and HIV-suppressive activity. Blood. 2009; 113(25):6351-60. [0539] 11. Ladell K, et al. A molecular basis for the control of preimmune escape variants by HIV-specific CD8+ T cells. Immunity. 2013; 38(3):425-36. [0540] 12. Chen H, et al. TCR clonotypes modulate the protective effect of HLA class I molecules in HIV-1 infection. Nat Immunol. 2012; 13(7):691-700. [0541] 13. Migueles S A, et al. Lytic granule loading of CD8+ T cells is required for HIV-infected cell elimination associated with immune control. Immunity. 2008; 29(6):1009-21. [0542] 14. Almeida J R, et al. Superior control of HIV-1 replication by CD8+ T cells is reflected by their avidity, polyfunctionality, and clonal turnover. J Exp Med. 2007; 204(10):2473-85. [0543] 15. Iglesias M C, et al. Escape from highly effective public CD8+ T-cell clonotypes by HIV. Blood. 2011; 118(8):2138-49. [0544] 16. Younes S A, et al. HIV-1 viremia prevents the establishment of interleukin 2-producing HIV-specific memory CD4+ T cells endowed with proliferative capacity. J Exp Med. 2003; 198(12): 1909-22. [0545] 17. Harari A, et al. Functional heterogeneity of memory CD4 T cell responses in different conditions of antigen exposure and persistence. J Immunol. 2005; 174(2): 1037-45. [0546] 18. van Grevenynghe J, et al. Transcription factor FOXO3a controls the persistence of memory CD4(+) T cells during HIV infection. Nat Med. 2008; 14(3):266-74. [0547] 19. Potter S J, et al. Preserved central memory and activated effector memory CD4+ T-cell subsets in human immunodeficiency virus controllers: an ANRS EP36 study. J Virol. 2007; 81(24):13904-15. [0548] 20. Kaufmann D E, et al. Limited durability of viral control following treated acute HIV infection. PLoS Med. 2004; 1(2):e36. [0549] 21. Saez-Cirion A, et al. Restriction of HIV-1 replication in macrophages and CD4+ T cells from HIV controllers. Blood. 2011; 118(4):955-64. [0550] 22. Ranasinghe S, et al. HIV-Specific CD4 T Cell Responses to Different Viral Proteins Have Discordant Associations with Viral Load and Clinical Outcome. J Virol. 2012; 86(1):277-83. [0551] 23. Ferre A L, et al. HIV controllers with HLA-DRB1*13 and HLA-DQB1*06 alleles have strong, polyfunctional mucosal CD4+ T-cell responses. J Virol. 2010; 84(21):11020-9. [0552] 24. Vingert B, et al. HIV controllers maintain a population of highly efficient Th1 effector cells in contrast to patients treated in the long term. J Virol. 2012; 86(19): 10661-74. [0553] 25. Kaufmann D E, et al. Upregulation of CTLA-4 by HIV-specific CD4+ T cells correlates with disease progression and defines a reversible immune dysfunction. Nat Immunol. 2007; 8(11):1246-54. [0554] 26. Porichis F, et al. Responsiveness of HIV-specific CD4 T cells to PD-1 blockade. Blood. 2011. [0555] 27. Vingert B, et al. HIV controller CD4+ T cells respond to minimal amounts of Gag antigen due to high TCR avidity. PLoS Pathog. 2010; 6(2):e1000780. [0556] 28. Alexander-Miller M A. High-avidity CD8+ T cells: optimal soldiers in the war against viruses and tumors. Immunol Res. 2005; 31(1): 13-24. [0557] 29. Berger C T, et al. High functional avidity CTL responses to HLA-B-restricted Gag-derived epitopes associate with relative HIV control. J Virol. 2011. [0558] 30. Kaufmann D E, et al. Comprehensive analysis of human immunodeficiency virus type 1-specific CD4 responses reveals marked immunodominance of gag and nef and the presence of broadly recognized peptides. J Virol. 2004; 78(9):4463-77. [0559] 31. Wooldridge L, et al. Tricks with tetramers: how to get the most from multimeric peptide-MHC. Immunology. 2009; 126(2):147-64. [0560] 32. Lim A, et al. Frequent contribution of T cell clonotypes with public TCR features to the chronic response against a dominant EBV-derived epitope: application to direct detection of their molecular imprint on the human peripheral T cell repertoire. J Immunol. 2000; 165(4):2001-11. [0561] 33. Hacein-Bey-Abina S, et al. Efficacy of gene therapy for X-linked severe combined immunodeficiency. N Engl J Med. 2010; 363(4):355-64. [0562] 34. Alamyar E, et al. IMGT((R)) tools for the nucleotide analysis of immunoglobulin (IG) and T cell receptor (TR) V-(D)-J repertoires, polymorphisms, and IG mutations: IMGT/V-QUEST and IMGT/HighV-QUEST for NGS. Methods Mol Biol. 2012; 882:569-604. [0563] 35. Turner S J, et al. Structural determinants of T-cell receptor bias in immunity. Nat Rev Immunol. 2006; 6(12):883-94. [0564] 36. Venturi V, et al. A mechanism for TCR sharing between T cell subsets and individuals revealed by pyrosequencing. J Immunol. 2011; 186(7):4285-94. [0565] 37. Gras S, et al. T-cell receptor bias and immunity. Curr Opin Immunol. 2008; 20(1):119-25. [0566] 38. Rossjohn J, et al. T cell antigen receptor recognition of antigen-presenting molecules. Annu Rev Immunol. 2015; 33:169-200. [0567] 39. Betts M R, et al. HIV nonprogressors preferentially maintain highly functional HIV-specific CD8+ T cells. Blood. 2006; 107(12):4781-9. [0568] 40. Liu P, et al. Characterization of human alphabetaTCR repertoire and discovery of D-D fusion in TCRbeta chains. Protein Cell. 2014; 5(8):603-15. [0569] 41. Gillespie G M, et al. Strong TCR conservation and altered T cell cross-reactivity characterize a B*57-restricted immune response in HIV-1 infection. J Immunol. 2006; 177(6):3893-902. [0570] 42. Kloverpris H N, et al. CD8+ TCR Bias and Immunodominance in HIV-1 Infection. J Immunol. 2015. [0571] 43. Miles J J, et al. Bias in the alphabeta T-cell repertoire: implications for disease pathogenesis and vaccination. Immunol Cell Biol. 2011; 89(3):375-87. [0572] 44. Mendoza D, et al. HLA B*5701-positive long-term nonprogressors/elite controllers are not distinguished from progressors by the clonal composition of HIV-specific CD8+ T cells. J Virol. 2012; 86(7):4014-8. [0573] 45. Simons B C, et al. Despite biased TRBV gene usage against a dominant HLA B57-restricted epitope, TCR diversity can provide recognition of circulating epitope variants. J Immunol. 2008; 181(7):5137-46. [0574] 46. Price D A, et al. Public clonotype usage identifies protective Gag-specific CD8+ T cell responses in SIV infection. J Exp Med. 2009; 206(4):923-36. [0575] 47. Warren R L, et al. Exhaustive T-cell repertoire sequencing of human peripheral blood samples reveals signatures of antigen selection and a directly measured repertoire size of at least 1 million clonotypes. Genome Res. 2011; 21(5):790-7. [0576] 48. Mattapallil J J, et al. Massive infection and loss of memory CD4+ T cells in multiple tissues during acute SIV infection. Nature. 2005; 434(7037):1093-7. [0577] 49. Godfrey D I, et al. The burgeoning family of unconventional T cells. Nat Immunol. 2015; 16(11):1114-23. [0578] 50. Campion S L, et al. Proteome-wide analysis of HIV-specific naive and memory CD4(+) T cells in unexposed blood donors. J Exp Med. 2014; 211(7): 1273-80. [0579] 51. Jones R B, et al. Human immunodeficiency virus type 1 escapes from interleukin-2-producing CD4+ T-cell responses without high-frequency fixation of mutations. J Virol. 2009; 83(17):8722-32. [0580] 52. Ranasinghe S, et al. Association of HLA-DRB1-restricted CD4 T cell responses with HIV immune control. Nature Medicine. 2013; 19(7):930-3. [0581] 53. Yousef S, et al. TCR bias and HLA cross-restriction are strategies of human brain-infiltrating J C virus-specific CD4+ T cells during viral infection. J Immunol. 2012; 189(7):3618-30. [0582] 54. Malhotra U, et al. Role for HLA class II molecules in HIV-1 suppression and cellular immunity following antiretroviral treatment. J Clin Invest. 2001; 107(4):505-17. [0583] 55. Williams M A, et al. Rapid culling of the CD4+ T cell repertoire in the transition from effector to memory. Immunity. 2008; 28(4):533-45. [0584] 56. Belyakov I M, et al. Impact of vaccine-induced mucosal high-avidity CD8+ CTLs in delay of AIDS viral dissemination from mucosa. Blood. 2006; 107(8):3258-64. [0585] 57. Corse E, et al. Attenuated T cell responses to a high-potency ligand in vivo. PLoS Biol. 2010; 8(9). [0586] 58. Valitutti S. The Serial Engagement Model 17 Years After: From TCR Triggering to Immunotherapy. Front Immunol. 2012; 3:272. [0587] 59. Thorborn G, et al. Clonotypic composition of the CD4+ T cell response to a vectored retroviral antigen is determined by its speed. J Immunol. 2014; 193(4):1567-77. [0588] 60. Swain S L, et al. Expanding roles for CD4(+) T cells in immunity to viruses. Nat Rev Immunol. 2012; 12(2): 136-48. [0589] 61. Blanco-Melo D, et al. Intrinsic cellular defenses against human immunodeficiency viruses. Immunity. 2012; 37(3):399-411. [0590] 62. Vetter M L, et al. Differences in APOBEC3G expression in CD4+ T helper lymphocyte subtypes modulate HIV-1 infectivity. PLoS Pathog. 2009; 5(2):e1000292. [0591] 63. Oswald-Richter K, et al. Identification of a CCR5-expressing T cell subset that is resistant to R5-tropic HIV infection. PLoS Pathog. 2007; 3(4):e58. [0592] 64. Reinherz E L, and Wang J H. Codification of bidentate pMHC interaction with TCR and its co-receptor. Trends Immunol. 2015. [0593] 65. Rihn S J, et al. Extreme genetic fragility of the HIV-1 capsid. PLoS Pathog. 2013; 9(6):e1003461. [0594] 66. Hansen S G, et al. Cytomegalovirus vectors violate CD8+ T cell epitope recognition paradigms. Science. 2013; 340(6135): 1237874. [0595] 67. Ghorashian S, et al. CD8 T cell tolerance to a tumor-associated self-antigen is reversed by CD4 T cells engineered to express the same T cell receptor. J Immunol. 2015; 194(3):1080-9. [0596] 68. Gras S, et al. The shaping of T cell receptor recognition by self-tolerance. Immunity. 2009; 30(2):193-203. [0597] 69. Heemskerk M H, et al. Redirection of antileukemic reactivity of peripheral T lymphocytes using gene transfer of minor histocompatibility antigen HA-2-specific T-cell receptor complexes expressing a conserved alpha joining region. Blood. 2003; 102(10):3530-40. [0598] 70. Klohe E P, et al. Analysis of the molecular specificities of anti-class II monoclonal antibodies by using L cell transfectants expressing HLA class II molecules. J Immunol. 1988; 141(6):2158-64. [0599] 71. Vingert B, et al. HIV controller CD4+ T cells respond to minimal amounts of Gag antigen due to high TCR avidity. PLoS Pathog. 2010; 6(2):e1000780. [0600] 72. Seth N, et al. Expansion and contraction of HIV-specific CD4 T cells with short bursts of viremia, but physical loss of the majority of these cells with sustained viral replication. J Immunol. 2005; 175(10):6948-58. [0601] 73. Lim A, et al. Frequent contribution of T cell clonotypes with public TCR features to the chronic response against a dominant EBV-derived epitope: application to direct detection of their molecular imprint on the human peripheral T cell repertoire. J Immunol. 2000; 165(4):2001-11. [0602] 74. Hacein-Bey-Abina S, et al. Efficacy of gene therapy for X-linked severe combined immunodeficiency. N Engl J Med. 2010; 363(4):355-64. [0603] 75. Alamyar E, et al. IMGT((R)) tools for the nucleotide analysis of immunoglobulin (IG) and T cell receptor (TR) V-(D)-J repertoires, polymorphisms, and IG mutations: IMGT/V-QUEST and IMGT/HighV-QUEST for NGS. Methods Mol Biol. 2012; 882(569-604. [0604] 76. Colwell R K. EstimateS: Statistical estimation of species richness and shared species from samples. Version 9. http://purloclcorg/estimates. 2013. [0605] 77. Bailey T L, et al. The MEME Suite. Nucleic Acids Res. 2015. [0606] 78. Stothard P. The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. Biotechniques. 2000; 28(6):1102, 4. [0607] 79. Gras S, et al. The shaping of T cell receptor recognition by self-tolerance. Immunity. 2009; 30(2):193-203. [0608] 80. Negre D, et al. Characterization of novel safe lentiviral vectors derived from simian immunodeficiency virus (SIVmac251) that efficiently transduce mature human dendritic cells. Gene Ther. 2000; 7(19):1613-23. [0609] 81. Roederer M, et al. SPICE: exploration and analysis of post-cytometric complex multivariate datasets. Cytometry A. 2011; 79(2): 167-74. [0610] 82. Chakrabarti L A, and Simon V. Immune mechanisms of HIV control. Curr Opin Immunol. 2010; 22(4):488-96. [0611] 83. Walker B D, and Yu X G. Unravelling the mechanisms of durable control of HIV-1. Nat Rev Immunol. 2013; 13(7):487-98. [0612] 84. Guaraldi G, Zona S, Menozzi M, Carli F, Bagni P, Berti A, Rossi E, Orlando G, Zoboli G, and Palella F. Cost of noninfectious comorbidities in patients with HIV. Clinicoecon Outcomes Res. 2013; 5(481-8. [0613] 85. Gebo K A, Fleishman J A, Conviser R, Hellinger J, Hellinger F J, Josephs J S, Keiser P, Gaist P, Moore R D, and Network HIVR. Contemporary costs of HIV healthcare in the HAART era. AIDS. 2010; 24(17):2705-15. [0614] 86. Deeks S G, Lewin S R, and Havlir D V. The end of AIDS: HIV infection as a chronic disease. Lancet. 2013; 382(9903):1525-33. [0615] 87. Gaardbo J C, Hartling H J, Gerstoft J, and Nielsen S D. Incomplete immune recovery in HIV infection: mechanisms, relevance for clinical care, and possible solutions. Clin Dev Immunol. 2012; 2012(670957. [0616] 88. Kelley C F, Kitchen C M, Hunt P W, Rodriguez B, Hecht F M, Kitahata M, Crane H M, Willig J, Mugavero M, Saag M, et al. Incomplete peripheral CD4+ cell count restoration in HIV-infected patients receiving long-term antiretroviral treatment. Clin Infect Dis. 2009; 48(6):787-94. [0617] 89. Appay V, Fastenackels S, Katlama C, Ait-Mohand H, Schneider L, Guihot A, Keller M, Grubeck-Loebenstein B, Simon A, Lambotte O, et al. Old age and anti-cytomegalovirus immunity are associated with altered T-cell reconstitution in HIV-1-infected patients. AIDS. 2011; 25(15):1813-22. [0618] 90. Zoufaly A, Cozzi-Lepri A, Reekie J, Kirk O, Lundgren J, Reiss P, Jevtovic D, Machala L, Zangerle R, Mocroft A, et al. Immuno-virological discordance and the risk of non-AIDS and AIDS events in a large observational cohort of HIV-patients in Europe. PLoS One. 2014; 9(1):e87160. [0619] 91. Engsig F N, Zangerle R, Katsarou O, Dabis F, Reiss P, Gill J, Porter K, Sabin C, Riordan A, Fatkenheuer G, et al. Long-term mortality in HIV-positive individuals virally suppressed for >3 years with incomplete CD4 recovery. Clin Infect Dis. 2014; 58(9):1312-21. [0620] 92. Linette G P, Stadtmauer E A, Maus M V, Rapoport A P, Levine B L, Emery L, Litzky L, Bagg A, Carreno B M, Cimino P J, et al. Cardiovascular toxicity and titin cross-reactivity of affinity-enhanced T cells in myeloma and melanoma. Blood. 2013; 122(6):863-71. [0621] 93. Rossjohn J, Gras S, Miles J J, Turner S J, Godfrey D I, and McCluskey J. T cell antigen receptor recognition of antigen-presenting molecules. Annu Rev Immunol. 2015; 33(169-200.